|
|
||||||||
MEMBRANE TRANSPORTERS, ION CHANNELS, AND PUMPS
1Department of Physiology and Cell Biology, University of Nevada School of Medicine, Reno, Nevada; and 2Department of Molecular and Cellular Pharmacology, Graduate School of Pharmaceutical Sciences, Nagoya City University, Nagoya, Japan
Submitted 22 June 2004 ; accepted in final form 23 September 2004
| ABSTRACT |
|---|
|
|
|---|
transient outward current; potassium channel; inactivation; phosphorylation
-adrenergic nerves acting via PKC (30) and also by a number of other factors, including pH, external cations, and a number of pharmacological agents (10, 11, 36, 39); however, relatively little is known about the regulation of these channels. Recent studies have shown that inhibition of Ca2+/calmodulin-dependent protein kinase II (CaMKII), a multifunctional kinase with widespread expression, including the heart, brain, and smooth muscles, accelerates the inactivation kinetics of transient outward current in the heart (Ito) in human atrial myocytes (38) and murine colonic myocytes (17). The target of CaMKII in these studies was likely to be Kv4.3, because Ito in cardiac myocytes and IA in smooth muscles are mediated, at least in part, by these channels. CaMKII is also known to regulate a number of ion channels, including Ca2+-activated Cl channels in smooth muscle cells (13, 40) and a range of K+ channels such as Drosophila ether-à-go-go (eag) K+ channels (14, 41), small- and large-conductance Ca2+-activated K+ channels (see Refs. 18, 32), and Kv1.4 channels (31). The purpose of the present study was to test whether CaMKII directly modulates Kv4.3 currents. Voltage-clamp experiments were performed to determine whether autothiophosphorylated CaMKII or inhibition of native CaMKII with KN-93 or a CaMKII-inhibitory peptide would affect Kv4.3 currents. In addition, site-directed mutagenesis at CaMKII consensus sequence sites on the Kv4.3 channel was performed to ascertain potential target sites of action for CaMKII. | MATERIALS AND METHODS |
|---|
|
|
|---|
Construction of Kv4.3 mutants (Kv4.3T53A, S516A, and S550A), cell culture, and transfection. The mutants T53A, S516A (C1), and S550A (C2) and the double-mutant S516A and S550A (C1 and C2) of rat Kv4.3 were prepared by performing PCR-based site-directed mutagenesis using the Quick-Change Multi site-directed mutagenesis kit (Stratagene) according to the manufacturer's instructions. The following primers were used for PCR: rKv4.3T53A: 5'-GTGAGTGGCCGTCGGTTCCAGGCCTGGAGGACCACTCTGGAGCG-3' (nt 156199; GenBank accession no. U75448); rKv4.3S516A: 5'CAGAACTACCCATCCACCAGAAGCCCTGCTCTGTCCAGCCACTCGG-GCC-3' (nt 1,5391,587); rKv4.3S550A: 5'CTCCAACCTGCCGGCCACCCGCCTGCGCGCCATGCAAGAGCTCAGCACC-3' (nt 1,6401,688). Underlined characters show the mutation sites. PCR was performed in a 25-µl PCR mixture containing 2.5 µl of 10x reaction buffer, 1 µl of dNTP mixture, 10 ng of rKv4.3 DNA in pcDNA3.1(+) (Invitrogen) (4, 28) as a template, 125 ng of each primer, 3 µl of QuickSolution, and 1 µl of QuickChange Multi enzyme blend. The cycling parameters were as follows: 1 cycle of 1 min at 95°C, followed by 30 cycles of 1 min at 95°C, 1 min at 55°C, and 14 min at 65°C. After completion of the PCR reaction, 10 units of DpnI were added directly to the reaction. The reaction mixture was mixed and incubated at 37°C for 60 min to digest the parental supercoiled, double-stranded DNA. After digestion using DpnI, the reaction mixture was transformed into Escherichia coli XL10-Gold ultracompetent cells (Stratagene), and the cells were grown overnight on a Luria Broth (LB; Research Products International, Mt. Prospect, IL) plate containing ampicillin (60 µM). Each sequence of rKv4.3 mutants [rKv4.3T53A, rKv4.3S516A (C1), rKv4.3S550A (C2), and rKv4.3 S516A and S550A (C1 and C2)] was confirmed by DNA sequencing. HEK-293 cell lines were used for stable transfection with the calcium phosphate coprecipitation technique, and then G418 (GIBCO-BRL) resistance cells were selected as previously reported (27).
Voltage-clamp experiments.
The whole cell configuration of the patch-clamp technique was used in these experiments. Patch pipettes were made from borosilicate glass capillaries pulled with a micropipette puller (P-80/PC; Sutter Instrument, Novato, CA) and polished with a microforge (MF-83; Narishige, Tokyo, Japan). The pipette resistances were 13 M
. After gigaseals were obtained, currents in response to depolarizing steps were amplified with an Axopatch 1A and/or Axopatch 200B amplifier and digitized with either a 12- or 16-bit analog-to-digital converter (Digidata 1322A and Digidata 1320A, respectively; Axon Instruments, Foster City, CA). Data were stored directly and digitized online using pClamp software (version 8.0; Axon Instruments). Data were sampled at 4 kHz, filtered at 1 kHz using an eight-pole Bessel filter, and analyzed using pClamp (version 8.0; Axon Instruments), GraphPad Prism (version 3.0; San Diego, CA), and Origin software (version 5.0; Microcal Software, Northampton, MA). The mean cell capacitance of HEK-293 cells was 16 ± 1 pF. The majority of cells studied were series resistance compensated, although in some cases this was difficult to achieve because of "ringing" of the amplifier. Therefore, cells chosen for this study were carefully selected, and many had to be discarded because the currents were too large.
Synthesis of autothiophosphorylated CaMKII.
A COOH-terminal truncation mutant of murine
CaMKII (
316CaM kinase II) was expressed using recombinant
316CaM kinase II baculovirus in Sf-21 insect cells as described (22). Purified
316CaM kinase II (10 µM) was autothiophosphorylated with ATP-
-S as described previously (24).
Solutions and drugs.
The bath solution contained (in mM) 5 KCl, 135 NaCl, 2 CaCl2, 10 glucose, 1.2 MgCl2, and 10 HEPES, pH 7.4 with Tris. The pipette solution contained (in mM) 130 KCl, 5 MgCl2, 2.7 K2ATP, 0.1 Na2GTP, 2.5 creatine phosphate disodium salt, and 5 HEPES, set to pH 7.2 with Tris. In addition, Ca2+ was buffered to varying levels using 0.1 mM EGTA or 10 mM BAPTA. Free Ca2+ levels in these solutions were 81 nM in 0.1 mM EGTA and 13 nM in 10 mM BAPTA as determined using a Ca2+ minielectrode (6). Stock solutions of flecainide (acetate salt; Sigma) and KN-92 and KN-93 (Calbiochem) were prepared by dissolving in either deionized water or DMSO, respectively. 4-Aminopyridine (4-AP; Sigma) and the CaMKII inhibitor peptide sequence 281301 (Calbiochem) were added directly to the bath or pipette solutions to obtain the desired concentrations. Recombinant baculovirus containing
316CaM kinase II was a gift of Dr. Debra Brickey and Dr. Thomas Soderling (Vollum Institute, Portland, OR).
Statistical analysis. Data are expressed as means ± SE. The n values indicate the number of cells used. Statistical significance was determined using either paired or unpaired Student's t-tests where appropriate. P < 0.05 was considered a statistically significant difference.
| RESULTS |
|---|
|
|
|---|
f and
s) were comparable to those in previous reports of currents attributed to Kv4.3 (11, 36). At +40 mV, the mean
f and
s were 18 ± 2 ms and 95 ± 6 ms, respectively (n = 6), representing 73 ± 2% and 27 ± 2% (n = 6) of total inactivation (Fig. 1C). Both inactivation time constants decreased as a function of depolarization. Application of the known Kv4.3 blockers 4-AP and flecainide (15, 34, 42, 43) reduced the amplitude of currents evoked from these cells in a concentration-dependent fashion, with IC50 values of 1.1 ± 0.2 mM (n = 5) and 11.4 ± 2.9 µM (n = 6), respectively (data not shown).
|
The voltage dependence of the activation and inactivation was investigated in cells dialyzed with 10 mM BAPTA to reduce intracellular Ca2+ to
10 nM (17). At this concentration of Ca2+, endogenous CaMKII would be expected to have minimal activity. The voltage dependence of inactivation of the Kv4.3 current was characterized using the protocol shown in Fig. 2A, inset. Membrane potential was held for 1 s at conditioning potentials ranging from 80 to 0 mV. The conditioning potential was followed by steps to 0 mV. Normalized peak currents elicited by the test steps are plotted in Fig. 2B. The half-inactivation potential, determined from a Boltzmann function fitted to the data, was 58 ± 1 mV (n = 5). The voltage dependence of activation of Kv4.3 currents was obtained by performing step depolarizations from 80 to +40 mV. Peak currents elicited were converted into permeabilities using the Goldman-Hodgkin-Katz current equation. The resulting permeabilities were normalized and plotted as a function of test potential. The half-activation from a Boltzmann function fitted to the data was 22 ± 2 mV. The effects of autothiophosphorylated CaMKII on the voltage dependence of inactivation and activation of Kv4.3 current were also investigated in cells dialyzed with 10 mM BAPTA using a double-pulse protocol (see Fig. 2A, inset). The half-inactivation and half-activation voltages after autothiophosphorylated CaMKII were 37 ± 2 mV and 8 ± 1 mV, respectively (Fig. 2, C and D; n = 5; P < 0.01 for both values). Thus autothiophosphorylated CaMKII affected the voltage dependence of inactivation and activation and decreased the degree of inactivation during the conditioning steps.
|
|
3 min. Inclusion of the inhibitory peptide in the pipette solution significantly increased the rate of inactivation of Kv4.3 currents. For example,
s decreased from 136 ± 19 to 101 ± 9 ms (n = 9, P < 0.05).
f was similarly decreased, from 30 ± 3 to 23 ± 3 ms (n = 9, P < 0.05). Figure 4B summarizes data from nine experiments.
|
s and
f from 92 ± 9 and 20 ± 1 ms to 55 ± 8 and 11 ± 2 ms, respectively (n = 10; P < 0.05). These effects were analogous to the effects of the CaMKII-inhibitory peptide and are plotted in Fig. 4D. Current amplitude was little affected by KN-93 (i.e., 5.7 ± 0.7 nA before and 5.2 ± 0.5 nA after KN-93; n = 9; P > 0.05). KN-92 (up to 1 µM) had no effect on inactivation time constants (data not shown).
Because dialysis with autothiophosphorylated CaMKII also accelerated the rate of recovery from inactivation, the effects of KN-93 on the rate of recovery from inactivation were also investigated. Cells were dialyzed with pipette solution containing 0.1 mM EGTA and subjected to the two-pulse protocol used in the experiment shown Fig. 3. Currents obtained from the same cell before and after exposure to KN-93 are displayed in Fig. 4, E and F. Addition of KN-93 increased the rate of inactivation and slowed the recovery from inactivation. Summary plots of the recovery from inactivation in the absence and presence of KN-93 are shown in Fig. 4G. Under control conditions, the
for recovery from inactivation averaged 294 ± 39 ms (n = 6). After KN-93,
increased significantly to 387 ± 56 ms (n = 6; P < 0.05). To confirm that the effects of KN-93 were specific, we also tested the effects of KN-92, an analog of KN-93 without inhibitory effects on CaMKII. KN-92 had no significant effect on Kv4.3 current amplitude (i.e., 3.4 ± 0.3 nA under control conditions and 3.3 ± 0.3 nA in the presence of KN-92). The mean time to reach 50% of peak amplitude was also not significantly affected by KN-92: 16.9 ± 2.8 ms under control conditions and 18.7 ± 3.4 ms in the presence of KN-92 (n = 7; P = 0.4).
Effect of mutations on CaMKII binding sites on the kinetics of Kv4.3 currents.
There are three consensus sequences for phosphorylation by CaMKII in the sequence of Kv4.3 channels. We performed site-directed mutagenesis [i.e., T53A on the NH2 terminus, S516A (C1) and S550A (C2) on the COOH terminus] to test whether the effects shown in Figs. 14 attributed to CaMKII were due to direct effects of CaMKII on the pore-forming
-subunit of Kv4.3 channels. Cells stably expressing either wild-type Kv4.3 channels or Kv4.3 with T53A, S516A (C1), or S550A (C2) mutations were stepped from 80 mV to test potentials ranging from 80 to +40 mV (500-ms steps; Fig. 5). Cells were dialyzed with pipette solution containing 0.1 mM EGTA. Figure 5F shows summary data of the mean "half-decay time" of currents (e.g., measured as the time to 50% inactivation of the maximal current amplitude at 0 mV). This measurement was chosen instead of comparisons of rate constants because of the variability in the inactivation kinetics of wild-type Kv4.3 currents in pipette solutions containing 0.1 mM EGTA. The mean half-decay time decreased significantly in all mutants except C1 alone (P < 0.05). For example, the mean time taken to reach half decay was 68 ± 5 ms (n = 24) in control cells, compared with 50 ± 6 ms (n = 21) in T53A mutants, 32 ± 8 ms (n = 29) in cells with double mutations at C1 and C2, 62 ± 8 ms (n = 22) in C1 mutants, and 34 ± 2 ms (n = 19) in C2 mutants. These data show that although the rate of inactivation increased in the T53A mutants, the most dramatic effects on Kv4.3 inactivation occurred in C2 mutations or in double mutations at C1 and C2. Both groups of cells with these mutations expressed currents with similar changes in the rate of inactivation. Mutations at C1 alone, however, resulted in currents that were not quantitatively different from controls. These data suggest that the primary site on the Kv4.3 channel for phosphorylation by CaMKII is C2. Therefore, we tested whether the rate of recovery from inactivation and the responses to the application of autothiophosphorylated CaMKII or inhibition of CaMKII were affected by mutations at this site.
|
values for the rate of recovery from inactivation between the different cell types. The rate of recovery from inactivation was significantly slowed in cells with the COOH-terminal mutations.
values decreased by 41 ± 9.5% (n = 15) in C2 mutants and by 46 ± 8.1% (n = 14) in cells with C1 and C2 mutations.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
Regulation of Kv4.3 currents by CaMKII appears to be mediated by direct phosphorylation of the pore-forming
-subunit of the channels. This conclusion is based on the observations that site-directed mutation at Ser550 (i.e., S550A), a CaMKII consensus site near the COOH terminus, blocked effects due to dialysis with autothiophosphorylated CaMKII and rendered the channels unresponsive to inhibition of CaMKII. Mutations at this site (C2) hastened inactivation kinetics of mutated channels, suggesting that basal phosphorylation by CaMKII regulates the kinetics of wild-type Kv4.3 channels.
Kv4.3 channels contribute significantly to Ito in rat, canine, and human cardiac myocytes (9). The principal function of Ito is to set the level of the plateau phase of the cardiac action potential (AP) by initiating the early repolarization (phase 1 or the "notch" of the AP). Activation of cardiac Ito is crucial because it affects the activity of other voltage-dependent currents. The rapid inactivation kinetics displayed by Ito tend to limit the influence of this current to the early repolarization phase of the cardiac AP. Our finding that CaMKII decreased the rate of inactivation of Kv4.3 and increased current availability after steady-state inactivation suggests that this mechanism might tend to shorten the cardiac AP and could be important in regulating excitation-contraction coupling. Consistent with this hypothesis is the finding that inhibition of Ito resulted in prolongation of cardiac AP (19) and prolonged QT intervals (5). Kv4.3 channels are also molecular components of IA expressed in neurons and smooth muscle cells (2, 28, 33, 34). The outward currents generated by activation of these channels oppose membrane depolarization and tend to stabilize membrane potential or reduce excitability. The physiological effects of Kv4.3 are therefore likely to depend on the kinetics and/or voltage dependence of activation and inactivation. Our data suggest that a rise in cytosolic Ca2+ would activate CaMKII, causing slowing of inactivation of Kv4.3 current and a shift of the window current range to more positive potentials. The shift in window current range may matter very little in cells with very negative resting potentials that depolarize through the entire range of voltage-dependent activation and inactivation during AP (i.e., cardiac muscle and neurons); however, smooth muscle cells that appear to use Kv4.3 currents to regulate membrane potential would be expected to have altered contributions to resting potential from A-type currents as a function of CaMKII activity.
We used KN-93 and CaMKII autoinhibitory peptide to inhibit the activity of endogenous CaMKII in HEK-293 cells. Because endogenous CaMKII activity depends on intracellular Ca2+ concentration, we tested the effects of CaMKII on the inactivation time constant in two different Ca2+ concentrations. CaMKII autoinhibitory peptide mainly inhibits Ca2+-dependent CaMKII (7). Therefore, we used 0.1 mM EGTA internally to keep relatively high concentration of intracellular Ca2+ for CaMKII autoinhibitory peptide experiments. Cells dialyzed with 0.1 mM EGTA (
100 nM intracellular Ca2+ concentration) had 136 ms (
s) and 30 ms (
f) of inactivation time constants at +40 mV. The treatment with the CaMKII autoinhibitory peptide decreased the inactivation time constants. The inactivation time constants after CaMKII autoinhibitory peptide treatments were similar in cells dialyzed with 10 mM BAPTA (
10 nM intracellular Ca2+ concentration) which also decreased the time inactivation constants to 92 ms (
s) and 20 ms (
f). These data suggest that intracellular Ca2+ concentration can affect the time constants of Kv4.3 currents through CaMKII. Furthermore, even though cells were dialyzed with 10 mM BAPTA, Ca2+-independent CaMKII is present in the cells (B. Perrino, unpublished observation). Therefore, we tested KN-93 effects on BAPTA-dialyzed cells to examine the effect of KN-93 on Ca2+-independent CaMKII. The CaMKII autoinhibitory peptide inhibited Ca2+/CaM-dependent activity because it mimicked the autoinhibitory domain of CaMKII. Autophosphorylation of CaMKII at Thr286 blocked the autoinhibitory domain, as well as the autoinhibitory peptide containing the autoinhibitory domain amino acid sequence, from interacting with the catalytic domain (7). KN-93 can inhibit the Ca2+-independent (Thr286 autophosphorylated) form of CaMKII in vivo because its inhibition is competitive with respect to CaM, causing Ca2+-independent CaMKII activity to decrease as endogenous phosphatases dephosphorylate Thr286 (37). Even though intracellular Ca2+ levels in BAPTA would be
10 nM, the preexisting Ca2+-independent CaMKII would be active and also would be inhibited by KN-93. Indeed, KN-93 significantly decreased
s and
f in cells dialyzed with 10 mM BAPTA. However, the specificity of KN-93 and KN-62 recently was questioned with regard to whether blockers of CaMKII produce nonspecific inhibitory effects on Kv currents in portal vein myocytes (20). This nonspecificity, however, does not affect our interpretation of the effects of KN-93 in the present study, because the HEK-293 cells (used to express Kv4.3) lack contaminating Kv currents. In addition, unlike a previous study (20), KN-93 (0.3 µM) had no discernible effects on current amplitude in our experiments. However, we should also note that higher concentrations of KN-93 (>3 µM) than we typically use in our experiments reduced Kv4.3 current amplitude (data not shown). Furthermore, KN-92, an inactive form of KN-93, was without effect on Kv4.3 currents in this study. Taken together, our data suggest that KN-93 had a specific inhibitory effect on CaMKII in our experiments.
Kv4 channels are modulated by a family of Ca2+ sensor proteins termed Kv channel-interacting proteins (KChIP) (3). When Kv4 channels were coexpressed with KChIP in a mammalian cell line, the amplitude of IA was enhanced more than eightfold. KChIP increased trafficking of channels from the endoplasmic reticulum to the membrane (3). KChIP are known to be encoded by at least four genes, KChIP14 (3, 25), and are members of the recoverin/NCS family of Ca2+-binding proteins, providing a potential pathway for regulation of Kv4 channels by Ca2+. KChIP interact with Kv4 channels via the NH2 terminus, resulting in increased current density, decreased rates of inactivation, and accelerated recovery from inactivation. Recent studies have shown that the effects of KChIP on current density and inactivation kinetics occur independently of Ca2+, whereas the effects of KChIP on the rate of recovery from inactivation are Ca2+ dependent (29). The effects of KChIP on Kv4 inactivation are similar to those produced by CaMKII in the present study. This suggests the possibility that CaMKII regulation may be mediated by mechanisms affecting KChIP expression or interactions with Kv4.3 channels. Our studies do not support this hypothesis, however, because we observed effects of CaMKII in the absence of KChIP. We also found that direct mutation of Kv4.3 (at Ser550) eliminated the effects of CaMKII, suggesting that the channel subunit is the direct target for CaMKII. Our data suggest that direct regulation of native Ito by CaMKII should occur in cardiac myocytes, but further experiments are required to test this hypothesis on native currents.
In summary, the data presented in this study suggest that CaMKII regulates Kv4.3 currents kinetics by direct phosphorylation of
-subunits at Ser550. These data may provide novel insights into the cellular regulation of membrane excitability in cardiac, neuronal, and many smooth muscle cells.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
2. Amberg GC, Koh SD, Hatton WJ, Murray KJ, Monaghan K, Horowitz B, and Sanders KM. Contribution of Kv4 channels toward the A-type potassium current in murine colonic myocytes. J Physiol 544: 403415, 2002.
3. An WF, Bowlby MR, Betty M, Cao J, Ling HP, Mendoza G, Hinson JW, Mattsson KI, Strassle BW, Trimmer JS, and Rhodes KJ. Modulation of A-type potassium channels by a family of calcium sensors. Nature 403: 553556, 2000.[CrossRef][Medline]
4. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, and Struhl K (eds.). Introduction of DNA into mammalian cells. 9.1. Calcium phosphate transfection. In: Current Protocols in Molecular Biology. New York: Wiley, 2001, chapt. 9, suppl. 63.
5. Barry DM, Xu H, Schuessler RB, and Nerbonne JM. Functional knockout of the transient outward current, long-QT syndrome, and cardiac remodeling in mice expressing a dominant-negative Kv4
subunit. Circ Res 83: 560567, 1998.
6. Baudet S, Hove-Madsen L, and Bers DM. How to make and use calcium-specific mini- and microelectrodes. Methods Cell Biol 40: 93113, 1994.[Web of Science][Medline]
7. Colbran RJ, Smith MK, Schworer CM, Fong YL, and Soldering TR. Regulatory domain of calcium/calmodulin-dependent protein kinase II. Mechanism of inhibition and regulation by phosphorylation. J Biol Chem 264: 48004804, 1989.
8. Deschênes I, DiSilvestre D, Juang GJ, Wu RC, An WF, and Tomaselli GF. Regulation of Kv4.3 current by KChIP2 splice variants: a component of native cardiac Ito? Circulation 106: 423429, 2002.
9. Dixon JE, Shi W, Wang HS, McDonald C, Yu H, Wymore RS, Cohen IS, and McKinnon D. Role of the Kv4.3 K+ channel in ventricular muscle A molecular correlate for the transient outward current. Circ Res 79: 659668, 1996.
10. Faivre JF, Calmels TPG, Rouanet S, Javré JL, Cheval B, and Bril A. Characterisation of Kv4.3 in HEK293 cells: comparison with the rat ventricular transient outward potassium current. Cardiovasc Res 41: 188199, 1999.
11. Franqueza L, Valenzuela C, Eck J, Tamkun MM, Tamargo J, and Snyders DJ. Functional expression of an inactivating potassium channel (Kv4.3) in a mammalian cell line. Cardiovasc Res 41: 212219, 1999.
12. Ginnan R and Singer HA. CaM kinase II-dependent activation of tyrosine kinases and ERK1/2 in vascular smooth muscle. Am J Physiol Cell Physiol 282: C754C761, 2002.
13. Greenwood IA, Ledoux J, and Leblanc N. Differential regulation of Ca2+-activated Cl currents in rabbit arterial and portal vein smooth muscle cells by Ca2+-calmodulin-dependent kinase. J Physiol 534: 395408, 2001.
14. Griffith LC, Wang J, Zhong Y, Wu CF, and Greenspan RJ. Calcium/calmodulin-dependent protein kinase II and potassium channel subunit eag similarly affect plasticity in Drosophila. Proc Natl Acad Sci USA 91: 1004410048, 1994.
15. Grissmer S, Nguyen AN, Aiyar J, Hanson DC, Mather RJ, Gutman GA, Karmilowicz MJ, Auperin DD, and Chandy KG. Pharmacological characterization of five cloned voltage-gated K+ channels, types Kv1.1, 12, 13, 15, and 31, stably expressed in mammalian cell lines. Mol Pharmacol 45: 12271234, 1994.[Abstract]
16. Kääb S, Dixon J, Duc J, Ashen D, Näbauer M, Beuckelmann DJ, Steinbeck G, McKinnon D, and Tomaselli GF. Molecular basis of transient outward potassium current downregulation in human heart failure: a decrease in Kv4.3 mRNA correlates with a reduction in current density. Circulation 98: 13831393, 1998.
17. Koh SD, Perrino BA, Hatton WJ, Kenyon JL, and Sanders KM. Novel regulation of the A-type K+ current in murine proximal colon by calcium-calmodulin-dependent protein kinase II. J Physiol 517: 7584, 1999.
18. Kong ID, Koh SD, Bayguinov O, and Sanders KM. Small conductance Ca2+-activated K+ channels are regulated by Ca2+-calmodulin-dependent protein kinase II in murine colonic myocytes. J Physiol 524: 331337, 2000.
19. Kuo HC, Cheng CF, Clark RB, Lin JJ, Lin JL, Hoshijima M, Nguyen-Tran VT, Gu Y, Ikeda Y, Chu PH, Ross J, Giles WR, and Chien KR. A defect in the Kv channel-interacting protein 2 (KChIP2) gene leads to a complete loss of Ito and confers susceptibility to ventricular tachycardia. Cell 107: 801813, 2001.[CrossRef][Web of Science][Medline]
20. Ledoux J, Chartier D, and Leblanc N. Inhibitors of calmodulin-dependent protein kinase are nonspecific blockers of voltage-dependent K+ channels in vascular myocytes. J Pharmacol Exp Ther 290: 11651174, 1999.
21. Liss B, Franz O, Sewing S, Bruns R, Neuhoff H, and Roeper J. Tuning pacemaker frequency of individual dopaminergic neurons by Kv4.3L and KChip31 transcription. EMBO J 20: 57155724, 2001.[CrossRef][Web of Science][Medline]
22. Lledo PM, Hjelmstad GO, Mukherji S, Soderling TR, Malenka RC, and Nicoll RA. Calcium/calmodulin-dependent kinase II and long-term potentiation enhance synaptic transmission by the same mechanism. Proc Natl Acad Sci USA 92: 1117511179, 1995.
23. Lorenz JM, Riddervold MH, Beckett EA, Baker SA, and Perrino BA. Differential autophosphorylation of CaM kinase II from phasic and tonic smooth muscle tissues. Am J Physiol Cell Physiol 283: C1399C1413, 2002.
24. McGlade-McCulloh E, Yamamoto H, Tan SE, Brickey DA, and Soderling TR. Phosphorylation and regulation of glutamate receptors by calcium/calmodulin-dependent protein kinase II. Nature 362: 640642, 1993.[CrossRef][Medline]
25. Morohashi Y, Hatano N, Ohya S, Takikawa R, Watabiki T, Takasugi N, Imaizumi Y, Tomita T, and Iwatsubo T. Molecular cloning and characterization of CALP/KChIP4, a novel EF-hand protein interacting with presenilin 2 and voltage-gated potassium channel subunit Kv4. J Biol Chem 277: 1496514975. 2002.
26. Ohya S, Morohashi Y, Muraki K, Tomita T, Watanabe M, Iwatsubo T, and Imaizumi Y. Molecular cloning and expression of the novel splice variants of K+ channel-interacting protein 2. Biochem Biophys Res Commun 282: 96102, 2001.[CrossRef][Web of Science][Medline]
27. Ohya S, Takii T, Yamazaki HF, Matsumori M, Onozaki K, Watanabe M, and Imaizumi Y. Molecular cloning of a novel gene involved in serotonin receptor-mediated signal transduction in rat stomach. FEBS Lett 401: 252258, 1997.[CrossRef][Web of Science][Medline]
28. Ohya S, Tanaka M, Oku T, Asai Y, Watanabe M, Giles WR, and Imaizumi Y. Molecular cloning and tissue distribution of an alternatively spliced variant of an A-type K+ channel
-subunit, Kv4.3 in the rat. FEBS Lett 420: 4753, 1997.[CrossRef][Web of Science][Medline]
29. Patel SP, Campbell DL, and Strauss HC. Elucidating KChIP effects on Kv4.3 inactivation and recovery kinetics with a minimal KChIP2 isoform. J Physiol 545: 511, 2002.
30. Po SS, Wu RC, Juang GJ, Kong W, and Tomaselli GF. Mechanism of
-adrenergic regulation of expressed hKv4.3 currents. Am J Physiol Heart Circ Physiol 281: H2518H2527, 2001.
31. Roeper J, Lorra C, and Pongs O. Frequency-dependent inactivation of mammalian A-type K+ channel KV1.4 regulated by Ca2+/calmodulin-dependent protein kinase. J Neurosci 17: 33793391, 1997.
32. Sansom SC, Ma R, Carmines PK, and Hall DA. Regulation of Ca2+-activated K+ channels by multifunctional Ca2+/calmodulin-dependent protein kinase. Am J Physiol Renal Physiol 279: F283F288, 2000.
33. Serodio P, Kentros C, and Rudy B. Identification of molecular components of A-type channels activating at subthreshold potentials. J Neurophysiol 72: 15161529, 1994.
34. Serodio P, Vega-Saenz de Miera E, and Rudy B. Cloning of a novel component of A-type K+ channels operating at subthreshold potentials with unique expression in heart and brain. J Neurophysiol 75: 21742179, 1996.
35. Shibata R, Nakahira K, Shibasaki K, Wakazono Y, Imoto K, and Ikenaka K. A-type K+ current mediated by the Kv4 channel regulates the generation of action potential in developing cerebellar granule cells. J Neurosci 20: 41454155, 2000.
36. Singarayar S, Singleton C, Tie H, Wyse K, Bursill J, Bauskin A, Wu W, Valenzuela S, Breit S, and Campbell T. Effects of components of ischemia on the Kv4.3 current stably expressed in Chinese hamster ovary cells. J Mol Cell Cardiol 34: 197207, 2002.[CrossRef][Web of Science][Medline]
37. Sumi M, Kiuchi K, Ishikawa T, Ishii A, Hagiwara M, Nagatsu T, and Hidaka H. The newly synthesized selective Ca2+/calmodulin dependent protein kinase II inhibitor KN-93 reduces dopamine contents in PC12h cells. Biochem Biophys Res Commun 181: 968975, 1991.[CrossRef][Web of Science][Medline]
38. Tessier S, Karczewski P, Krause EG, Pansard Y, Acar C, Lang-Lazdunski M, Mercadier JJ, and Hatem SN. Regulation of the transient outward K+ current by Ca2+/calmodulin-dependent protein kinases II in human atrial myocytes. Circ Res 85: 810819, 1999.
39. Wang H, Shi H, Zhang L, Pourrier M, Yang B, Nattel S, and Wang Z. Nicotine is a potent blocker of the cardiac A-type K+ channels: effects on cloned Kv43 channels and native transient outward current. Circulation 102: 11651171, 2000.
40. Wang YX and Kotlikoff MI. Inactivation of calcium-activated chloride channels in smooth muscle by calcium/calmodulin-dependent protein kinase. Proc Natl Acad Sci USA 94: 1491814923, 1997.
41. Wang Z, Wilson GF, and Griffith LC. Calcium/calmodulin-dependent protein kinase II phosphorylates and regulates the Drosophila eag potassium channel. J Biol Chem 277: 2402224029, 2002.
42. Yamagishi T, Ishii K, and Taira N. Antiarrhythmic and bradycardic drugs inhibit currents of cloned K+ channels, KV1.2 and KV1.4. Eur J Pharmacol 281: 151159, 1995.[CrossRef][Web of Science][Medline]
43. Yeola SW and Snyders DJ. Electrophysiological and pharmacological correspondence between Kv4.2 current and rat cardiac transient outward current. Cardiovasc Res 33: 540547, 1997.
This article has been cited by other articles:
![]() |
C. Xie, V. E. Bondarenko, M. J. Morales, and H. C. Strauss Closed-state inactivation in Kv4.3 isoforms is differentially modulated by protein kinase C Am J Physiol Cell Physiol, November 1, 2009; 297(5): C1236 - C1248. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wagner, E. Hacker, E. Grandi, S. L. Weber, N. Dybkova, S. Sossalla, T. Sowa, L. Fabritz, P. Kirchhof, D. M. Bers, et al. Ca/Calmodulin Kinase II Differentially Modulates Potassium Currents Circ Arrhythm Electrophysiol, June 1, 2009; 2(3): 285 - 294. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. El-Haou, E. Balse, N. Neyroud, G. Dilanian, B. Gavillet, H. Abriel, A. Coulombe, A. Jeromin, and S. N. Hatem Kv4 Potassium Channels Form a Tripartite Complex With the Anchoring Protein SAP97 and CaMKII in Cardiac Myocytes Circ. Res., March 27, 2009; 104(6): 758 - 769. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Lu, J.-i. Abe, J. Taunton, Y. Lu, T. Shishido, C. McClain, C. Yan, S. P. Xu, T. M. Spangenberg, and H. Xu Reactive Oxygen Species-Induced Activation of p90 Ribosomal S6 Kinase Prolongs Cardiac Repolarization Through Inhibiting Outward K+ Channel Activity Circ. Res., August 1, 2008; 103(3): 269 - 278. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-Y. Chien, J.-K. Cheng, D. Chu, C.-F. Cheng, and M.-L. Tsaur Reduced Expression of A-Type Potassium Channels in Primary Sensory Neurons Induces Mechanical Hypersensitivity J. Neurosci., September 12, 2007; 27(37): 9855 - 9865. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. H. Gittis and S. du Lac Firing Properties of GABAergic Versus Non-GABAergic Vestibular Nucleus Neurons Conferred by a Differential Balance of Potassium Currents J Neurophysiol, June 1, 2007; 97(6): 3986 - 3996. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-J. Qu, V. E. Bondarenko, C. Xie, S. Wang, M. S. Awayda, H. C. Strauss, and M. J. Morales W-7 modulates Kv4.3: pore block and Ca2+-calmodulin inhibition Am J Physiol Heart Circ Physiol, May 1, 2007; 292(5): H2364 - H2377. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. Maier and D. M. Bers Role of Ca2+/calmodulin-dependent protein kinase (CaMK) in excitation-contraction coupling in the heart Cardiovasc Res, March 1, 2007; 73(4): 631 - 640. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Colinas, M. Gallego, R. Setien, J. R. Lopez-Lopez, M. T. Perez-Garcia, and O. Casis Differential modulation of Kv4.2 and Kv4.3 channels by calmodulin-dependent protein kinase II in rat cardiac myocytes Am J Physiol Heart Circ Physiol, October 1, 2006; 291(4): H1978 - H1987. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Koyama and S. B. Appel A-type K+ Current of Dopamine and GABA Neurons in the Ventral Tegmental Area J Neurophysiol, August 1, 2006; 96(2): 544 - 554. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A.G. van der Heyden, T. J.M. Wijnhoven, and T. Opthof Molecular aspects of adrenergic modulation of the transient outward current Cardiovasc Res, August 1, 2006; 71(3): 430 - 442. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Maguy, T. E. Hebert, and S. Nattel Involvement of lipid rafts and caveolae in cardiac ion channel function Cardiovasc Res, March 1, 2006; 69(4): 798 - 807. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |