Am J Physiol Cell Physiol Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 288: C304-C313, 2005. First published September 29, 2004; doi:10.1152/ajpcell.00293.2004
0363-6143/05 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
288/2/C304    most recent
00293.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (12)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sergeant, G. P.
Right arrow Articles by Koh, S. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sergeant, G. P.
Right arrow Articles by Koh, S. D.

MEMBRANE TRANSPORTERS, ION CHANNELS, AND PUMPS

Regulation of Kv4.3 currents by Ca2+/calmodulin-dependent protein kinase II

Gerard P. Sergeant,1 Susumu Ohya,2 James A. Reihill,1 Brian A. Perrino,1 Gregory C. Amberg,1 Yuji Imaizumi,2 Burton Horowitz,1 Kenton M. Sanders,1 and Sang Don Koh1

1Department of Physiology and Cell Biology, University of Nevada School of Medicine, Reno, Nevada; and 2Department of Molecular and Cellular Pharmacology, Graduate School of Pharmaceutical Sciences, Nagoya City University, Nagoya, Japan

Submitted 22 June 2004 ; accepted in final form 23 September 2004


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The voltage-dependent K+ channel 4.3 (Kv4.3) is one of the major molecular correlates encoding a class of rapidly inactivating K+ currents, including the transient outward current in the heart (Ito) and A currents (IA) in neuronal and smooth muscle preparations. Recent studies have shown that Ito in human atrial myocytes and IA in murine colonic myocytes are modulated by Ca2+/calmodulin-dependent protein kinase II (CaMKII); however, the molecular target of CaMKII in these studies has not been elucidated. We performed experiments to investigate whether CaMKII could regulate Kv4.3 currents directly. Inclusion of the autothiophosphorylated form of CaMKII in the patch pipette (10 nM) prolonged Kv4.3 currents such that the time required to reach 50% inactivation from peak more than doubled, with positive shifts in voltage dependence of both activation and inactivation. In contrast, the rate of recovery from inactivation was accelerated under these conditions. CaMKII-inhibitory peptide or KN-93 produced effects opposite to that above; thus the rate of inactivation was increased, and recovery from inactivation decreased. A number of mutagenesis experiments were conducted on the three candidate CaMKII consensus sequence sites on the channel. Mutations at S550A, located at the COOH-terminal region of the channel, resulted in currents that inactivated more rapidly but recovered from inactivation at a slower rate than that of wild-type controls. In addition, these currents were unaffected by dialysis with either autothiophosphorylated CaMKII or the specific inhibitory peptide of CaMKII, suggesting that CaMKII slows the inactivation and accelerates the rate of recovery from inactivation of Kv4.3 currents by a direct effect at S550A, located at the COOH-terminal region of the channel.

transient outward current; potassium channel; inactivation; phosphorylation


THE VOLTAGE-DEPENDENT K+ CHANNEL 4.3 (Kv4.3) is one of the major molecular correlates encoding a class of rapidly inactivating K+ currents, often referred to as A currents (IA). These currents have been recorded in a number of excitable tissues, including cardiac, neuronal, and smooth muscle preparations (1, 2, 9, 28, 33, 34). The fast-inactivation kinetics displayed by Kv4.3 are an intrinsic feature that facilitates their key role of regulating membrane excitability. For example, in cardiac myocytes, Kv4.3 channels are known to mediate the early repolarization phase of the action potential (9, 16), and in neuronal cells, activation of Kv4.3 channels helps to establish the prolonged interval between action potentials (21, 35). Recent studies have also demonstrated that Kv4.3 is likely to be the major molecular determinant of IA in gastrointestinal smooth muscle cells (1, 2) and that this conductance appears to participate in the maintenance of the resting potential. Kv4.3 channels are known to be influenced by {alpha}-adrenergic nerves acting via PKC (30) and also by a number of other factors, including pH, external cations, and a number of pharmacological agents (10, 11, 36, 39); however, relatively little is known about the regulation of these channels. Recent studies have shown that inhibition of Ca2+/calmodulin-dependent protein kinase II (CaMKII), a multifunctional kinase with widespread expression, including the heart, brain, and smooth muscles, accelerates the inactivation kinetics of transient outward current in the heart (Ito) in human atrial myocytes (38) and murine colonic myocytes (17). The target of CaMKII in these studies was likely to be Kv4.3, because Ito in cardiac myocytes and IA in smooth muscles are mediated, at least in part, by these channels. CaMKII is also known to regulate a number of ion channels, including Ca2+-activated Cl channels in smooth muscle cells (13, 40) and a range of K+ channels such as Drosophila ether-à-go-go (eag) K+ channels (14, 41), small- and large-conductance Ca2+-activated K+ channels (see Refs. 18, 32), and Kv1.4 channels (31). The purpose of the present study was to test whether CaMKII directly modulates Kv4.3 currents. Voltage-clamp experiments were performed to determine whether autothiophosphorylated CaMKII or inhibition of native CaMKII with KN-93 or a CaMKII-inhibitory peptide would affect Kv4.3 currents. In addition, site-directed mutagenesis at CaMKII consensus sequence sites on the Kv4.3 channel was performed to ascertain potential target sites of action for CaMKII.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Expression of Kv4.3 in HEK-293 cells. The full length of rat Kv4.3 was ligated into the mammalian expression vectors, pcDNA3.1 using T4 DNA ligase (New England BioLabs, Beverly, MA). Successful cloning into this vector was confirmed by DNA sequencing. Human embryonic kidney (HEK)-293 cells were transfected with the vector using the calcium phosphate method (4), and cells lines that stably expressed Kv4.3 were obtained by G418 selection (Invitrogen, San Diego, CA). PCR analysis and whole cell patch-clamp recordings confirmed stable expression.

Construction of Kv4.3 mutants (Kv4.3T53A, S516A, and S550A), cell culture, and transfection. The mutants T53A, S516A (C1), and S550A (C2) and the double-mutant S516A and S550A (C1 and C2) of rat Kv4.3 were prepared by performing PCR-based site-directed mutagenesis using the Quick-Change Multi site-directed mutagenesis kit (Stratagene) according to the manufacturer's instructions. The following primers were used for PCR: rKv4.3T53A: 5'-GTGAGTGGCCGTCGGTTCCAGGCCTGGAGGACCACTCTGGAGCG-3' (nt 156–199; GenBank accession no. U75448); rKv4.3S516A: 5'CAGAACTACCCATCCACCAGAAGCCCTGCTCTGTCCAGCCACTCGG-GCC-3' (nt 1,539–1,587); rKv4.3S550A: 5'CTCCAACCTGCCGGCCACCCGCCTGCGCGCCATGCAAGAGCTCAGCACC-3' (nt 1,640–1,688). Underlined characters show the mutation sites. PCR was performed in a 25-µl PCR mixture containing 2.5 µl of 10x reaction buffer, 1 µl of dNTP mixture, 10 ng of rKv4.3 DNA in pcDNA3.1(+) (Invitrogen) (4, 28) as a template, 125 ng of each primer, 3 µl of QuickSolution, and 1 µl of QuickChange Multi enzyme blend. The cycling parameters were as follows: 1 cycle of 1 min at 95°C, followed by 30 cycles of 1 min at 95°C, 1 min at 55°C, and 14 min at 65°C. After completion of the PCR reaction, 10 units of DpnI were added directly to the reaction. The reaction mixture was mixed and incubated at 37°C for 60 min to digest the parental supercoiled, double-stranded DNA. After digestion using DpnI, the reaction mixture was transformed into Escherichia coli XL10-Gold ultracompetent cells (Stratagene), and the cells were grown overnight on a Luria Broth (LB; Research Products International, Mt. Prospect, IL) plate containing ampicillin (60 µM). Each sequence of rKv4.3 mutants [rKv4.3T53A, rKv4.3S516A (C1), rKv4.3S550A (C2), and rKv4.3 S516A and S550A (C1 and C2)] was confirmed by DNA sequencing. HEK-293 cell lines were used for stable transfection with the calcium phosphate coprecipitation technique, and then G418 (GIBCO-BRL) resistance cells were selected as previously reported (27).

Voltage-clamp experiments. The whole cell configuration of the patch-clamp technique was used in these experiments. Patch pipettes were made from borosilicate glass capillaries pulled with a micropipette puller (P-80/PC; Sutter Instrument, Novato, CA) and polished with a microforge (MF-83; Narishige, Tokyo, Japan). The pipette resistances were 1–3 M{Omega}. After gigaseals were obtained, currents in response to depolarizing steps were amplified with an Axopatch 1A and/or Axopatch 200B amplifier and digitized with either a 12- or 16-bit analog-to-digital converter (Digidata 1322A and Digidata 1320A, respectively; Axon Instruments, Foster City, CA). Data were stored directly and digitized online using pClamp software (version 8.0; Axon Instruments). Data were sampled at 4 kHz, filtered at 1 kHz using an eight-pole Bessel filter, and analyzed using pClamp (version 8.0; Axon Instruments), GraphPad Prism (version 3.0; San Diego, CA), and Origin software (version 5.0; Microcal Software, Northampton, MA). The mean cell capacitance of HEK-293 cells was 16 ± 1 pF. The majority of cells studied were series resistance compensated, although in some cases this was difficult to achieve because of "ringing" of the amplifier. Therefore, cells chosen for this study were carefully selected, and many had to be discarded because the currents were too large.

Synthesis of autothiophosphorylated CaMKII. A COOH-terminal truncation mutant of murine {alpha}CaMKII ({Delta}316CaM kinase II) was expressed using recombinant {Delta}316CaM kinase II baculovirus in Sf-21 insect cells as described (22). Purified {Delta}316CaM kinase II (10 µM) was autothiophosphorylated with ATP-{gamma}-S as described previously (24).

Solutions and drugs. The bath solution contained (in mM) 5 KCl, 135 NaCl, 2 CaCl2, 10 glucose, 1.2 MgCl2, and 10 HEPES, pH 7.4 with Tris. The pipette solution contained (in mM) 130 KCl, 5 MgCl2, 2.7 K2ATP, 0.1 Na2GTP, 2.5 creatine phosphate disodium salt, and 5 HEPES, set to pH 7.2 with Tris. In addition, Ca2+ was buffered to varying levels using 0.1 mM EGTA or 10 mM BAPTA. Free Ca2+ levels in these solutions were 81 nM in 0.1 mM EGTA and 13 nM in 10 mM BAPTA as determined using a Ca2+ minielectrode (6). Stock solutions of flecainide (acetate salt; Sigma) and KN-92 and KN-93 (Calbiochem) were prepared by dissolving in either deionized water or DMSO, respectively. 4-Aminopyridine (4-AP; Sigma) and the CaMKII inhibitor peptide sequence 281–301 (Calbiochem) were added directly to the bath or pipette solutions to obtain the desired concentrations. Recombinant baculovirus containing {Delta}316CaM kinase II was a gift of Dr. Debra Brickey and Dr. Thomas Soderling (Vollum Institute, Portland, OR).

Statistical analysis. Data are expressed as means ± SE. The n values indicate the number of cells used. Statistical significance was determined using either paired or unpaired Student's t-tests where appropriate. P < 0.05 was considered a statistically significant difference.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Depolarizing voltage steps applied to HEK-293 cells stably expressing Kv4.3 yielded large outward currents that activated rapidly and subsequently inactivated. The inactivation phase of Kv4.3 currents was best fit by the sum of two exponential functions. Values for both time constant components of inactivation ({tau}f and {tau}s) were comparable to those in previous reports of currents attributed to Kv4.3 (11, 36). At +40 mV, the mean {tau}f and {tau}s were 18 ± 2 ms and 95 ± 6 ms, respectively (n = 6), representing 73 ± 2% and 27 ± 2% (n = 6) of total inactivation (Fig. 1C). Both inactivation time constants decreased as a function of depolarization. Application of the known Kv4.3 blockers 4-AP and flecainide (15, 34, 42, 43) reduced the amplitude of currents evoked from these cells in a concentration-dependent fashion, with IC50 values of 1.1 ± 0.2 mM (n = 5) and 11.4 ± 2.9 µM (n = 6), respectively (data not shown).



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 1. Autothiophosphorylated Ca2+/calmodulin-dependent protein kinase II (CaMKII) decreases the rate of inactivation of voltage-dependent K+ channel 4.3 (Kv4.3) currents. The cells were held at –80 mV and stepped to test potentials ranging from –80 to +40 mV in 10-mV intervals (A, inset). A and B are families of currents evoked in the absence and presence of autothiophosphorylated CaMKII (10 nM) in the patch pipette. In A, the inactivation of Kv4.3 currents was fit by two exponentials (inset, thick line denotes actual fitting line at +40 mV). After dialysis with autothiophosphorylated CaMKII, the inactivation of Kv4.3 currents was fit by a single exponential. C and D: effects of voltage on the inactivation time constants in the absence and presence of autothiophosphorylated CaMKII (10 nM) in the patch pipette, respectively. {tau}fast, fast inactivation time constant; {tau}slow, slow inactivation time constant.

 
Effect of autothiophosphorylated CaMKII on Kv4.3 currents. The effects of dialysis of HEK-293 cells with autothiophosphorylated CaMKII (10 nM concentration in the patch pipette) were tested on the inactivation properties of Kv4.3 currents. Representative current traces recorded from a cell dialyzed with autothiophosphorylated CaMKII are shown in Fig. 1. A pipette solution containing 10 mM BAPTA was used for these experiments to minimize endogenous activity of CaMKII. Autothiophosphorylated CaMKII dramatically slowed the rate of Kv4.3 current inactivation at all test potentials compared with controls and changed the profile of inactivation from a double to a single exponential function. For example, the mean time constant of inactivation in these cells with autothiophosphorylated CaMKII was 102 ± 11 ms at +40 mV (n = 5) fit with a single exponential function, compared with control cells with inactivation time constants of 95 ± 6 ms and 18 ± 2 ms at +40 mV fit with a double exponential function. This data suggests that autothiophosphorylated CaMKII removed the fast inactivation component. Summary plots of these experiments are shown in Fig. 1, C and D. Dialysis with autothiophosphorylated CaMKII also resulted in less complete inactivation of Kv4.3 currents. For example, at the end of the 500-ms test pulse to 0 mV, 30 ± 8% of peak current remained in CaMKII-dialyzed cells, compared with 13 ± 2% in control cells (P < 0.05). At +40-mV steps, 26 ± 5% of peak current remained, compared with 13 ± 0.4% in controls (P < 0.05).

The voltage dependence of the activation and inactivation was investigated in cells dialyzed with 10 mM BAPTA to reduce intracellular Ca2+ to ~10 nM (17). At this concentration of Ca2+, endogenous CaMKII would be expected to have minimal activity. The voltage dependence of inactivation of the Kv4.3 current was characterized using the protocol shown in Fig. 2A, inset. Membrane potential was held for 1 s at conditioning potentials ranging from –80 to 0 mV. The conditioning potential was followed by steps to 0 mV. Normalized peak currents elicited by the test steps are plotted in Fig. 2B. The half-inactivation potential, determined from a Boltzmann function fitted to the data, was –58 ± 1 mV (n = 5). The voltage dependence of activation of Kv4.3 currents was obtained by performing step depolarizations from –80 to +40 mV. Peak currents elicited were converted into permeabilities using the Goldman-Hodgkin-Katz current equation. The resulting permeabilities were normalized and plotted as a function of test potential. The half-activation from a Boltzmann function fitted to the data was –22 ± 2 mV. The effects of autothiophosphorylated CaMKII on the voltage dependence of inactivation and activation of Kv4.3 current were also investigated in cells dialyzed with 10 mM BAPTA using a double-pulse protocol (see Fig. 2A, inset). The half-inactivation and half-activation voltages after autothiophosphorylated CaMKII were –37 ± 2 mV and –8 ± 1 mV, respectively (Fig. 2, C and D; n = 5; P < 0.01 for both values). Thus autothiophosphorylated CaMKII affected the voltage dependence of inactivation and activation and decreased the degree of inactivation during the conditioning steps.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2. Autothiophosphorylated CaMKII produced a positive shift in voltage-dependent activation and inactivation. A: membrane potential was stepped to conditioning potentials between –80 and 0 mV for 1 s and then stepped to a test potential of 0 mV. Cells were dialyzed with 10 mM BAPTA (see MATERIALS AND METHODS). B: voltage dependence of inactivation of Kv4.3 current is shown as a plot of normalized peak outward current during the test step as a function of the conditioning potential ({bullet}). Voltage-dependent activation is shown in B as a plot of normalized permeability as a function of test potential ({circ}). C: representative traces after dialyzed with autothiophosphorylated CaMKII. D: summarized data of activation and inactivation protocol from five cells after dialyzed with autothiophosphorylated CaMKII.

 
Previously, our laboratory (17) showed that autothiophosphorylated CaMKII not only decreased the rate of inactivation of IA in murine colonic myocytes but also accelerated the rate of recovery from inactivation. Thus we examined the effects of autothiophosphorylated CaMKII on the time required for Kv4.3 channels to recover from inactivation. Double-pulse protocols were designed to characterize recovery from inactivation at –80 mV (see Fig. 3A, inset). After a conditioning pulse to 0 mV, the cells were returned to –80 mV for recovery periods of 0–2 s before a second step to 0 mV. The time course of recovery from inactivation was determined by plotting the normalized peak test current as a function of the recovery interval. Examples of typical responses evoked by this protocol in the absence and presence of autothiophosphorylated CaMKII are shown in Fig. 3, A and C, respectively. The time course of recovery from inactivation was well fit with a single exponential function. Summary plots of recovery from inactivation in control cells and cells dialyzed with autothiophosphorylated CaMKII are shown in Fig. 3, B and D. Under control conditions, the mean time constant for recovery from inactivation was 325 ± 39 ms (n = 11), compared with 146 ± 19 ms (n = 6) in cells dialyzed with autothiophosphorylated CaMKII (10 nM). These data demonstrate that CaMKII significantly increased the rate of recovery of Kv4.3 channels from inactivation (P < 0.05).



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 3. Autothiophosphorylated CaMKII accelerates the recovery from inactivation of Kv4.3 currents. A double pulse protocol (A, inset) was used to characterize recovery from inactivation in cells with and without dialysis of autothiophosphorylated CaMKII (A and C, respectively). The time courses of recovery from inactivation under these conditions are plotted in B and D, respectively. Recovery from inactivation under both conditions was well fit with single exponentials and was significantly increased by autothiophosphorylated CaMKII.

 
Effect of inhibition of CaMKII on Kv4.3 inactivation kinetics. Because dialysis with autothiophosphorylated CaMKII slowed the rate of inactivation, we tested whether inhibition of endogenous CaMKII with a CaMKII-inhibitory peptide could produce opposite effects. Cells were dialyzed with pipette solution containing 0.1 mM EGTA and the CaMKII inhibitory peptide (nt 281–301; 100 µM). Repetitive pulses to +40 mV throughout the dialysis period elicited large, inactivating outward currents as described earlier. Figure 4A shows representative current traces immediately after rupture of the patch and after dialysis of the CaMKII inhibitor for ~3 min. Inclusion of the inhibitory peptide in the pipette solution significantly increased the rate of inactivation of Kv4.3 currents. For example, {tau}s decreased from 136 ± 19 to 101 ± 9 ms (n = 9, P < 0.05). {tau}f was similarly decreased, from 30 ± 3 to 23 ± 3 ms (n = 9, P < 0.05). Figure 4B summarizes data from nine experiments.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 4. Effect of inhibition of CaMKII on Kv4.3 currents. A: superimposed current traces from the same cell immediately after rupture of the patch and ~3 min after subsequent dialysis of the specific CaMKII inhibitor peptide (281–301). B: effects of CaMKII inhibitor peptide on the time constants of inactivation ({tau}f and {tau}s). {tau}f and {tau}s denote {tau}fast and {tau}slow, respectively. Open bars represent {tau} values in the absence of drugs, and black bars represent {tau} values in the presence of drug. C shows current traces from the same cell before and during application of the specific CaMKII inhibitor KN-93 (0.3 µM). D summarizes the effects of KN-93 on the time constants of inactivation ({tau}f and {tau}s). Open bars represent {tau} values in the absence of drugs, and black bars represent {tau} values in the presence of KN-93. A double pulse protocol (E, inset) was used to characterize recovery from inactivation in cells before and during exposure to KN-93 (0.3 µM; E and F, respectively). The time-courses of recovery from inactivation in the absence ({circ}) and presence ({blacksquare}) of KN-93 are plotted in G.

 
KN-93, a membrane-permeable methoxybenzenesulfonamide inhibitor of CaMKII with little or no effect on other protein kinases such as PKA and PKC (37), has been used to determine the role of CaMKII in a number of cell types (12, 13, 23). Therefore, we tested whether application of KN-93 could produce effects similar to those observed after dialysis with the CaMKII inhibitory peptide. Cells were dialyzed with pipette solution containing 10 mM BAPTA for this series of experiments. Figure 4C shows currents evoked from a cell expressing Kv4.3 upon a voltage step to +40 mV before and after 3-min exposure to 0.3 µM KN-93. The effect of KN-93 was maximal within this time period. The mean time for KN-93 to exert a maximal effect in nine cells was 152 ± 14 s. The CaMKII inhibitor significantly decreased the {tau}s and {tau}f from 92 ± 9 and 20 ± 1 ms to 55 ± 8 and 11 ± 2 ms, respectively (n = 10; P < 0.05). These effects were analogous to the effects of the CaMKII-inhibitory peptide and are plotted in Fig. 4D. Current amplitude was little affected by KN-93 (i.e., 5.7 ± 0.7 nA before and 5.2 ± 0.5 nA after KN-93; n = 9; P > 0.05). KN-92 (up to 1 µM) had no effect on inactivation time constants (data not shown).

Because dialysis with autothiophosphorylated CaMKII also accelerated the rate of recovery from inactivation, the effects of KN-93 on the rate of recovery from inactivation were also investigated. Cells were dialyzed with pipette solution containing 0.1 mM EGTA and subjected to the two-pulse protocol used in the experiment shown Fig. 3. Currents obtained from the same cell before and after exposure to KN-93 are displayed in Fig. 4, E and F. Addition of KN-93 increased the rate of inactivation and slowed the recovery from inactivation. Summary plots of the recovery from inactivation in the absence and presence of KN-93 are shown in Fig. 4G. Under control conditions, the {tau} for recovery from inactivation averaged 294 ± 39 ms (n = 6). After KN-93, {tau} increased significantly to 387 ± 56 ms (n = 6; P < 0.05). To confirm that the effects of KN-93 were specific, we also tested the effects of KN-92, an analog of KN-93 without inhibitory effects on CaMKII. KN-92 had no significant effect on Kv4.3 current amplitude (i.e., 3.4 ± 0.3 nA under control conditions and 3.3 ± 0.3 nA in the presence of KN-92). The mean time to reach 50% of peak amplitude was also not significantly affected by KN-92: 16.9 ± 2.8 ms under control conditions and 18.7 ± 3.4 ms in the presence of KN-92 (n = 7; P = 0.4).

Effect of mutations on CaMKII binding sites on the kinetics of Kv4.3 currents. There are three consensus sequences for phosphorylation by CaMKII in the sequence of Kv4.3 channels. We performed site-directed mutagenesis [i.e., T53A on the NH2 terminus, S516A (C1) and S550A (C2) on the COOH terminus] to test whether the effects shown in Figs. 14 attributed to CaMKII were due to direct effects of CaMKII on the pore-forming {alpha}-subunit of Kv4.3 channels. Cells stably expressing either wild-type Kv4.3 channels or Kv4.3 with T53A, S516A (C1), or S550A (C2) mutations were stepped from –80 mV to test potentials ranging from –80 to +40 mV (500-ms steps; Fig. 5). Cells were dialyzed with pipette solution containing 0.1 mM EGTA. Figure 5F shows summary data of the mean "half-decay time" of currents (e.g., measured as the time to 50% inactivation of the maximal current amplitude at 0 mV). This measurement was chosen instead of comparisons of rate constants because of the variability in the inactivation kinetics of wild-type Kv4.3 currents in pipette solutions containing 0.1 mM EGTA. The mean half-decay time decreased significantly in all mutants except C1 alone (P < 0.05). For example, the mean time taken to reach half decay was 68 ± 5 ms (n = 24) in control cells, compared with 50 ± 6 ms (n = 21) in T53A mutants, 32 ± 8 ms (n = 29) in cells with double mutations at C1 and C2, 62 ± 8 ms (n = 22) in C1 mutants, and 34 ± 2 ms (n = 19) in C2 mutants. These data show that although the rate of inactivation increased in the T53A mutants, the most dramatic effects on Kv4.3 inactivation occurred in C2 mutations or in double mutations at C1 and C2. Both groups of cells with these mutations expressed currents with similar changes in the rate of inactivation. Mutations at C1 alone, however, resulted in currents that were not quantitatively different from controls. These data suggest that the primary site on the Kv4.3 channel for phosphorylation by CaMKII is C2. Therefore, we tested whether the rate of recovery from inactivation and the responses to the application of autothiophosphorylated CaMKII or inhibition of CaMKII were affected by mutations at this site.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 5. Effect of mutagenesis on specific CaMKII consensus sequences on Kv4.3 currents. AE: representative current traces evoked by stepping from a holding potential of –80 mV to test potentials from –80 to +40 mV for durations of 500 ms from cells stably expressing either wild-type Kv4.3 (A) or with mutations at T53A on the NH2 terminus (T-53; B) or at sites S516A (C1), and S550A (C2) on the COOH terminus (CE). Cells were dialyzed with pipette solution containing 0.1 mM EGTA. F: summary data depicting the mean "half-decay time" (t) measured as the time to reach decay of 50% of maximal current amplitude from peak amplitude after a step to 0 mV.

 
Effect of C2 mutations on rate of recovery from inactivation. We further tested whether mutations of CaMKII consensus sites on the COOH-terminal region of Kv4.3 channels would affect the rate of recovery from inactivation using the same double-pulse protocol illustrated in Fig. 3. Current responses from control cells and cells with mutations at C2 and at C1 and C2 are shown in Fig. 6, AC, respectively. Figure 6D shows normalized {tau} values for the rate of recovery from inactivation between the different cell types. The rate of recovery from inactivation was significantly slowed in cells with the COOH-terminal mutations. {tau} values decreased by 41 ± 9.5% (n = 15) in C2 mutants and by 46 ± 8.1% (n = 14) in cells with C1 and C2 mutations.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 6. Effect of C2 mutagenesis on the rate of recovery from inactivation. The same double-pulse protocol illustrated in Fig. 3 was used to investigate effects of mutations of CaMKII consensus sites on the COOH-terminal region of the Kv4.3 channel on the rate of recovery from inactivation. Typical current responses to this protocol from controls and cells with double mutations at C1 and C2 and C2 only are shown in AC, respectively. D: normalized {tau} values for the rate of recovery from inactivation between the different cell types.

 
Effects of autothiophosphorylated CaMKII on inactivation kinetics of Kv4.3 channels with COOH-terminal mutations. Dialysis of autothiophosphorylated CaMKII prolonged the inactivation of wild-type Kv4.3 channels (Fig. 1). We tested the effects of autothiophosphorylated CaMKII on channels with C2 mutations and those with C1 and C2 mutations. As demonstrated previously, the mean half-decay time for wild-type Kv4.3 channels was significantly slower in cells dialyzed with autothiophosphorylated CaMKII (P < 0.05). Inactivation of currents in cells expressing either C2 or C1 and C2 mutations was not significantly affected by autothiophosphorylated CaMKII (P > 0.05 for each; Fig. 7).



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 7. Effect of C2 mutagenesis on Kv4.3 channel inactivation kinetics in response to application of autothiophosphorylated CaMKII. A and B: representative current responses from cells transfected with Kv4.3 to depolarizing pulses to 0 mV in the absence and presence of autothiophosphorylated CaMKII, respectively. The mean half decay time was significantly slower in cells dialyzed with autothiophosphorylated CaMKII (C; P < 0.05). Results from similar experiments on the C1 and C2 mutants are shown in DF. Dialysis of autothiophosphorylated CaMKII did not significantly affect the rate of inactivation in these mutants (P > 0.05). Likewise in the C2 mutants, autothiophosphorylated was without significant effect (P > 0.05, GI, respectively).

 
Effects of CaMKII inhibitors on channels with COOH-terminal mutations. As shown in Fig. 4A, inhibition of CaMKII with the specific CaMKII-inhibitory peptide (nt 281–301) increased the rate of inactivation of Kv4.3 currents. In control cells for this series of experiments, the mean half-decay time of Kv4.3 currents was significantly decreased (by 59 ± 9%) by the CaMKII-inhibitory peptide nt sequence 281–301 (P < 0.05). The mean time to reach this level of inhibition was 7.4 ± 1.7 min of dialysis (Fig. 8A). Dialysis with the CaMKII inhibitory peptide had no effect on currents in cells expressing Kv4.3 channels with C2 (n = 6) or C2 and C1 (n = 4) mutations after 17.3 ± 2.5 and 14.4 ± 3.5 min, respectively (Figs. 8, B and C). Figure 8D shows plots of the half-decay time (as described above) as a function of time from rupture of patches.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 8. Effect of C2 mutagenesis on Kv4.3 channel inactivation kinetics in response to inhibition of CaMKII. A: dialysis with the CaMKII inhibitory peptide 281–301 accelerates the rate of inactivation of Kv4.3 currents evoked by depolarizing steps to 0 mV (arrow indicates the traces every 30 s after rupture of membrane). Typical current responses to dialysis with CaMKII inhibitory peptide 281–301 in cells transfected with Kv4.3 containing double mutations at C1 and C2 or at C2 alone are shown in B and C, respectively. D: plots of half-decay time ({tau}50%), measured as the time taken to reach decay of 50% of maximal current amplitude from peak amplitude after a step to 0 mV.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
In the present study, we have shown that CaMKII modulates the gating properties and kinetics of Kv4.3 channels. This conclusion is supported by the following three observations. 1) Dialysis of cells with autothiophosphorylated CaMKII decreased the rate of inactivation and increased the rate of recovery from inactivation. 2) Dialysis of cells with the CaMKII inhibitory peptide (nt 281–301) increased the rate of inactivation of Kv4.3 currents. 3) Treatment of cells with the membrane permeable CaMKII inhibitor KN-93 increased the rate of inactivation of Kv4.3 currents and slowed the recovery from inactivation. Similar effects of KN-93 have also been observed on native Ito and A-type currents (17, 38) and are distinctly opposite the effects of dialysis of cells with autothiophosphorylated CaMKII.

Regulation of Kv4.3 currents by CaMKII appears to be mediated by direct phosphorylation of the pore-forming {alpha}-subunit of the channels. This conclusion is based on the observations that site-directed mutation at Ser550 (i.e., S550A), a CaMKII consensus site near the COOH terminus, blocked effects due to dialysis with autothiophosphorylated CaMKII and rendered the channels unresponsive to inhibition of CaMKII. Mutations at this site (C2) hastened inactivation kinetics of mutated channels, suggesting that basal phosphorylation by CaMKII regulates the kinetics of wild-type Kv4.3 channels.

Kv4.3 channels contribute significantly to Ito in rat, canine, and human cardiac myocytes (9). The principal function of Ito is to set the level of the plateau phase of the cardiac action potential (AP) by initiating the early repolarization (phase 1 or the "notch" of the AP). Activation of cardiac Ito is crucial because it affects the activity of other voltage-dependent currents. The rapid inactivation kinetics displayed by Ito tend to limit the influence of this current to the early repolarization phase of the cardiac AP. Our finding that CaMKII decreased the rate of inactivation of Kv4.3 and increased current availability after steady-state inactivation suggests that this mechanism might tend to shorten the cardiac AP and could be important in regulating excitation-contraction coupling. Consistent with this hypothesis is the finding that inhibition of Ito resulted in prolongation of cardiac AP (19) and prolonged QT intervals (5). Kv4.3 channels are also molecular components of IA expressed in neurons and smooth muscle cells (2, 28, 33, 34). The outward currents generated by activation of these channels oppose membrane depolarization and tend to stabilize membrane potential or reduce excitability. The physiological effects of Kv4.3 are therefore likely to depend on the kinetics and/or voltage dependence of activation and inactivation. Our data suggest that a rise in cytosolic Ca2+ would activate CaMKII, causing slowing of inactivation of Kv4.3 current and a shift of the window current range to more positive potentials. The shift in window current range may matter very little in cells with very negative resting potentials that depolarize through the entire range of voltage-dependent activation and inactivation during AP (i.e., cardiac muscle and neurons); however, smooth muscle cells that appear to use Kv4.3 currents to regulate membrane potential would be expected to have altered contributions to resting potential from A-type currents as a function of CaMKII activity.

We used KN-93 and CaMKII autoinhibitory peptide to inhibit the activity of endogenous CaMKII in HEK-293 cells. Because endogenous CaMKII activity depends on intracellular Ca2+ concentration, we tested the effects of CaMKII on the inactivation time constant in two different Ca2+ concentrations. CaMKII autoinhibitory peptide mainly inhibits Ca2+-dependent CaMKII (7). Therefore, we used 0.1 mM EGTA internally to keep relatively high concentration of intracellular Ca2+ for CaMKII autoinhibitory peptide experiments. Cells dialyzed with 0.1 mM EGTA (~100 nM intracellular Ca2+ concentration) had 136 ms ({tau}s) and 30 ms ({tau}f) of inactivation time constants at +40 mV. The treatment with the CaMKII autoinhibitory peptide decreased the inactivation time constants. The inactivation time constants after CaMKII autoinhibitory peptide treatments were similar in cells dialyzed with 10 mM BAPTA (~10 nM intracellular Ca2+ concentration) which also decreased the time inactivation constants to 92 ms ({tau}s) and 20 ms ({tau}f). These data suggest that intracellular Ca2+ concentration can affect the time constants of Kv4.3 currents through CaMKII. Furthermore, even though cells were dialyzed with 10 mM BAPTA, Ca2+-independent CaMKII is present in the cells (B. Perrino, unpublished observation). Therefore, we tested KN-93 effects on BAPTA-dialyzed cells to examine the effect of KN-93 on Ca2+-independent CaMKII. The CaMKII autoinhibitory peptide inhibited Ca2+/CaM-dependent activity because it mimicked the autoinhibitory domain of CaMKII. Autophosphorylation of CaMKII at Thr286 blocked the autoinhibitory domain, as well as the autoinhibitory peptide containing the autoinhibitory domain amino acid sequence, from interacting with the catalytic domain (7). KN-93 can inhibit the Ca2+-independent (Thr286 autophosphorylated) form of CaMKII in vivo because its inhibition is competitive with respect to CaM, causing Ca2+-independent CaMKII activity to decrease as endogenous phosphatases dephosphorylate Thr286 (37). Even though intracellular Ca2+ levels in BAPTA would be ~10 nM, the preexisting Ca2+-independent CaMKII would be active and also would be inhibited by KN-93. Indeed, KN-93 significantly decreased {tau}s and {tau}f in cells dialyzed with 10 mM BAPTA. However, the specificity of KN-93 and KN-62 recently was questioned with regard to whether blockers of CaMKII produce nonspecific inhibitory effects on Kv currents in portal vein myocytes (20). This nonspecificity, however, does not affect our interpretation of the effects of KN-93 in the present study, because the HEK-293 cells (used to express Kv4.3) lack contaminating Kv currents. In addition, unlike a previous study (20), KN-93 (0.3 µM) had no discernible effects on current amplitude in our experiments. However, we should also note that higher concentrations of KN-93 (>3 µM) than we typically use in our experiments reduced Kv4.3 current amplitude (data not shown). Furthermore, KN-92, an inactive form of KN-93, was without effect on Kv4.3 currents in this study. Taken together, our data suggest that KN-93 had a specific inhibitory effect on CaMKII in our experiments.

Kv4 channels are modulated by a family of Ca2+ sensor proteins termed Kv channel-interacting proteins (KChIP) (3). When Kv4 channels were coexpressed with KChIP in a mammalian cell line, the amplitude of IA was enhanced more than eightfold. KChIP increased trafficking of channels from the endoplasmic reticulum to the membrane (3). KChIP are known to be encoded by at least four genes, KChIP1–4 (3, 25), and are members of the recoverin/NCS family of Ca2+-binding proteins, providing a potential pathway for regulation of Kv4 channels by Ca2+. KChIP interact with Kv4 channels via the NH2 terminus, resulting in increased current density, decreased rates of inactivation, and accelerated recovery from inactivation. Recent studies have shown that the effects of KChIP on current density and inactivation kinetics occur independently of Ca2+, whereas the effects of KChIP on the rate of recovery from inactivation are Ca2+ dependent (29). The effects of KChIP on Kv4 inactivation are similar to those produced by CaMKII in the present study. This suggests the possibility that CaMKII regulation may be mediated by mechanisms affecting KChIP expression or interactions with Kv4.3 channels. Our studies do not support this hypothesis, however, because we observed effects of CaMKII in the absence of KChIP. We also found that direct mutation of Kv4.3 (at Ser550) eliminated the effects of CaMKII, suggesting that the channel subunit is the direct target for CaMKII. Our data suggest that direct regulation of native Ito by CaMKII should occur in cardiac myocytes, but further experiments are required to test this hypothesis on native currents.

In summary, the data presented in this study suggest that CaMKII regulates Kv4.3 currents kinetics by direct phosphorylation of {alpha}-subunits at Ser550. These data may provide novel insights into the cellular regulation of membrane excitability in cardiac, neuronal, and many smooth muscle cells.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This project was supported by National Institute of Diabetes and Digestive and Kidney Diseases Program Project Grant DK-41315.


    ACKNOWLEDGMENTS
 
Excellent technical assistance was provided by Heather Beck.


    FOOTNOTES
 

Address for reprint requests and other correspondence: S. D. Koh, Dept. of Physiology and Cell Biology, Univ. of Nevada School of Medicine, 352 Anderson Medical Bldg., Reno, NV 89557 (E-mail: sdk{at}physiology.unr.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Amberg GC, Baker SA, Koh SD, Hatton WJ, Murray KJ, Horowitz B, and Sanders KM. Characterization of the A-type potassium current in murine gastric antrum. J Physiol 544: 417–428, 2002.[Abstract/Free Full Text]

2. Amberg GC, Koh SD, Hatton WJ, Murray KJ, Monaghan K, Horowitz B, and Sanders KM. Contribution of Kv4 channels toward the A-type potassium current in murine colonic myocytes. J Physiol 544: 403–415, 2002.[Abstract/Free Full Text]

3. An WF, Bowlby MR, Betty M, Cao J, Ling HP, Mendoza G, Hinson JW, Mattsson KI, Strassle BW, Trimmer JS, and Rhodes KJ. Modulation of A-type potassium channels by a family of calcium sensors. Nature 403: 553–556, 2000.[CrossRef][Medline]

4. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, and Struhl K (eds.). Introduction of DNA into mammalian cells. 9.1. Calcium phosphate transfection. In: Current Protocols in Molecular Biology. New York: Wiley, 2001, chapt. 9, suppl. 63.

5. Barry DM, Xu H, Schuessler RB, and Nerbonne JM. Functional knockout of the transient outward current, long-QT syndrome, and cardiac remodeling in mice expressing a dominant-negative Kv4{alpha} subunit. Circ Res 83: 560–567, 1998.[Abstract/Free Full Text]

6. Baudet S, Hove-Madsen L, and Bers DM. How to make and use calcium-specific mini- and microelectrodes. Methods Cell Biol 40: 93–113, 1994.[ISI][Medline]

7. Colbran RJ, Smith MK, Schworer CM, Fong YL, and Soldering TR. Regulatory domain of calcium/calmodulin-dependent protein kinase II. Mechanism of inhibition and regulation by phosphorylation. J Biol Chem 264: 4800–4804, 1989.[Abstract/Free Full Text]

8. Deschênes I, DiSilvestre D, Juang GJ, Wu RC, An WF, and Tomaselli GF. Regulation of Kv4.3 current by KChIP2 splice variants: a component of native cardiac Ito? Circulation 106: 423–429, 2002.[Abstract/Free Full Text]

9. Dixon JE, Shi W, Wang HS, McDonald C, Yu H, Wymore RS, Cohen IS, and McKinnon D. Role of the Kv4.3 K+ channel in ventricular muscle A molecular correlate for the transient outward current. Circ Res 79: 659–668, 1996.[Abstract/Free Full Text]

10. Faivre JF, Calmels TPG, Rouanet S, Javré JL, Cheval B, and Bril A. Characterisation of Kv4.3 in HEK293 cells: comparison with the rat ventricular transient outward potassium current. Cardiovasc Res 41: 188–199, 1999.[Abstract/Free Full Text]

11. Franqueza L, Valenzuela C, Eck J, Tamkun MM, Tamargo J, and Snyders DJ. Functional expression of an inactivating potassium channel (Kv4.3) in a mammalian cell line. Cardiovasc Res 41: 212–219, 1999.[Abstract/Free Full Text]

12. Ginnan R and Singer HA. CaM kinase II-dependent activation of tyrosine kinases and ERK1/2 in vascular smooth muscle. Am J Physiol Cell Physiol 282: C754–C761, 2002.[Abstract/Free Full Text]

13. Greenwood IA, Ledoux J, and Leblanc N. Differential regulation of Ca2+-activated Cl currents in rabbit arterial and portal vein smooth muscle cells by Ca2+-calmodulin-dependent kinase. J Physiol 534: 395–408, 2001.[Abstract/Free Full Text]

14. Griffith LC, Wang J, Zhong Y, Wu CF, and Greenspan RJ. Calcium/calmodulin-dependent protein kinase II and potassium channel subunit eag similarly affect plasticity in Drosophila. Proc Natl Acad Sci USA 91: 10044–10048, 1994.[Abstract/Free Full Text]

15. Grissmer S, Nguyen AN, Aiyar J, Hanson DC, Mather RJ, Gutman GA, Karmilowicz MJ, Auperin DD, and Chandy KG. Pharmacological characterization of five cloned voltage-gated K+ channels, types Kv1.1, 12, 13, 15, and 31, stably expressed in mammalian cell lines. Mol Pharmacol 45: 1227–1234, 1994.[Abstract]

16. Kääb S, Dixon J, Duc J, Ashen D, Näbauer M, Beuckelmann DJ, Steinbeck G, McKinnon D, and Tomaselli GF. Molecular basis of transient outward potassium current downregulation in human heart failure: a decrease in Kv4.3 mRNA correlates with a reduction in current density. Circulation 98: 1383–1393, 1998.[Abstract/Free Full Text]

17. Koh SD, Perrino BA, Hatton WJ, Kenyon JL, and Sanders KM. Novel regulation of the A-type K+ current in murine proximal colon by calcium-calmodulin-dependent protein kinase II. J Physiol 517: 75–84, 1999.[Abstract/Free Full Text]

18. Kong ID, Koh SD, Bayguinov O, and Sanders KM. Small conductance Ca2+-activated K+ channels are regulated by Ca2+-calmodulin-dependent protein kinase II in murine colonic myocytes. J Physiol 524: 331–337, 2000.[Abstract/Free Full Text]

19. Kuo HC, Cheng CF, Clark RB, Lin JJ, Lin JL, Hoshijima M, Nguyen-Tran VT, Gu Y, Ikeda Y, Chu PH, Ross J, Giles WR, and Chien KR. A defect in the Kv channel-interacting protein 2 (KChIP2) gene leads to a complete loss of Ito and confers susceptibility to ventricular tachycardia. Cell 107: 801–813, 2001.[CrossRef][ISI][Medline]

20. Ledoux J, Chartier D, and Leblanc N. Inhibitors of calmodulin-dependent protein kinase are nonspecific blockers of voltage-dependent K+ channels in vascular myocytes. J Pharmacol Exp Ther 290: 1165–1174, 1999.[Abstract/Free Full Text]

21. Liss B, Franz O, Sewing S, Bruns R, Neuhoff H, and Roeper J. Tuning pacemaker frequency of individual dopaminergic neurons by Kv4.3L and KChip31 transcription. EMBO J 20: 5715–5724, 2001.[CrossRef][ISI][Medline]

22. Lledo PM, Hjelmstad GO, Mukherji S, Soderling TR, Malenka RC, and Nicoll RA. Calcium/calmodulin-dependent kinase II and long-term potentiation enhance synaptic transmission by the same mechanism. Proc Natl Acad Sci USA 92: 11175–11179, 1995.[Abstract/Free Full Text]

23. Lorenz JM, Riddervold MH, Beckett EA, Baker SA, and Perrino BA. Differential autophosphorylation of CaM kinase II from phasic and tonic smooth muscle tissues. Am J Physiol Cell Physiol 283: C1399–C1413, 2002.[Abstract/Free Full Text]

24. McGlade-McCulloh E, Yamamoto H, Tan SE, Brickey DA, and Soderling TR. Phosphorylation and regulation of glutamate receptors by calcium/calmodulin-dependent protein kinase II. Nature 362: 640–642, 1993.[CrossRef][Medline]

25. Morohashi Y, Hatano N, Ohya S, Takikawa R, Watabiki T, Takasugi N, Imaizumi Y, Tomita T, and Iwatsubo T. Molecular cloning and characterization of CALP/KChIP4, a novel EF-hand protein interacting with presenilin 2 and voltage-gated potassium channel subunit Kv4. J Biol Chem 277: 14965–14975. 2002.[Abstract/Free Full Text]

26. Ohya S, Morohashi Y, Muraki K, Tomita T, Watanabe M, Iwatsubo T, and Imaizumi Y. Molecular cloning and expression of the novel splice variants of K+ channel-interacting protein 2. Biochem Biophys Res Commun 282: 96–102, 2001.[CrossRef][ISI][Medline]

27. Ohya S, Takii T, Yamazaki HF, Matsumori M, Onozaki K, Watanabe M, and Imaizumi Y. Molecular cloning of a novel gene involved in serotonin receptor-mediated signal transduction in rat stomach. FEBS Lett 401: 252–258, 1997.[CrossRef][ISI][Medline]

28. Ohya S, Tanaka M, Oku T, Asai Y, Watanabe M, Giles WR, and Imaizumi Y. Molecular cloning and tissue distribution of an alternatively spliced variant of an A-type K+ channel {alpha}-subunit, Kv4.3 in the rat. FEBS Lett 420: 47–53, 1997.[CrossRef][ISI][Medline]

29. Patel SP, Campbell DL, and Strauss HC. Elucidating KChIP effects on Kv4.3 inactivation and recovery kinetics with a minimal KChIP2 isoform. J Physiol 545: 5–11, 2002.[Abstract/Free Full Text]

30. Po SS, Wu RC, Juang GJ, Kong W, and Tomaselli GF. Mechanism of {alpha}-adrenergic regulation of expressed hKv4.3 currents. Am J Physiol Heart Circ Physiol 281: H2518–H2527, 2001.[Abstract/Free Full Text]

31. Roeper J, Lorra C, and Pongs O. Frequency-dependent inactivation of mammalian A-type K+ channel KV1.4 regulated by Ca2+/calmodulin-dependent protein kinase. J Neurosci 17: 3379–3391, 1997.[Abstract/Free Full Text]

32. Sansom SC, Ma R, Carmines PK, and Hall DA. Regulation of Ca2+-activated K+ channels by multifunctional Ca2+/calmodulin-dependent protein kinase. Am J Physiol Renal Physiol 279: F283–F288, 2000.[Abstract/Free Full Text]

33. Serodio P, Kentros C, and Rudy B. Identification of molecular components of A-type channels activating at subthreshold potentials. J Neurophysiol 72: 1516–1529, 1994.[Abstract/Free Full Text]

34. Serodio P, Vega-Saenz de Miera E, and Rudy B. Cloning of a novel component of A-type K+ channels operating at subthreshold potentials with unique expression in heart and brain. J Neurophysiol 75: 2174–2179, 1996.[Abstract/Free Full Text]

35. Shibata R, Nakahira K, Shibasaki K, Wakazono Y, Imoto K, and Ikenaka K. A-type K+ current mediated by the Kv4 channel regulates the generation of action potential in developing cerebellar granule cells. J Neurosci 20: 4145–4155, 2000.[Abstract/Free Full Text]

36. Singarayar S, Singleton C, Tie H, Wyse K, Bursill J, Bauskin A, Wu W, Valenzuela S, Breit S, and Campbell T. Effects of components of ischemia on the Kv4.3 current stably expressed in Chinese hamster ovary cells. J Mol Cell Cardiol 34: 197–207, 2002.[CrossRef][ISI][Medline]

37. Sumi M, Kiuchi K, Ishikawa T, Ishii A, Hagiwara M, Nagatsu T, and Hidaka H. The newly synthesized selective Ca2+/calmodulin dependent protein kinase II inhibitor KN-93 reduces dopamine contents in PC12h cells. Biochem Biophys Res Commun 181: 968–975, 1991.[CrossRef][ISI][Medline]

38. Tessier S, Karczewski P, Krause EG, Pansard Y, Acar C, Lang-Lazdunski M, Mercadier JJ, and Hatem SN. Regulation of the transient outward K+ current by Ca2+/calmodulin-dependent protein kinases II in human atrial myocytes. Circ Res 85: 810–819, 1999.[Abstract/Free Full Text]

39. Wang H, Shi H, Zhang L, Pourrier M, Yang B, Nattel S, and Wang Z. Nicotine is a potent blocker of the cardiac A-type K+ channels: effects on cloned Kv43 channels and native transient outward current. Circulation 102: 1165–1171, 2000.[Abstract/Free Full Text]

40. Wang YX and Kotlikoff MI. Inactivation of calcium-activated chloride channels in smooth muscle by calcium/calmodulin-dependent protein kinase. Proc Natl Acad Sci USA 94: 14918–14923, 1997.[Abstract/Free Full Text]

41. Wang Z, Wilson GF, and Griffith LC. Calcium/calmodulin-dependent protein kinase II phosphorylates and regulates the Drosophila eag potassium channel. J Biol Chem 277: 24022–24029, 2002.[Abstract/Free Full Text]

42. Yamagishi T, Ishii K, and Taira N. Antiarrhythmic and bradycardic drugs inhibit currents of cloned K+ channels, KV1.2 and KV1.4. Eur J Pharmacol 281: 151–159, 1995.[CrossRef][ISI][Medline]

43. Yeola SW and Snyders DJ. Electrophysiological and pharmacological correspondence between Kv4.2 current and rat cardiac transient outward current. Cardiovasc Res 33: 540–547, 1997.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Circ. Res.Home page
Z. Lu, J.-i. Abe, J. Taunton, Y. Lu, T. Shishido, C. McClain, C. Yan, S. P. Xu, T. M. Spangenberg, and H. Xu
Reactive Oxygen Species-Induced Activation of p90 Ribosomal S6 Kinase Prolongs Cardiac Repolarization Through Inhibiting Outward K+ Channel Activity
Circ. Res., August 1, 2008; 103(3): 269 - 278.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
L.-Y. Chien, J.-K. Cheng, D. Chu, C.-F. Cheng, and M.-L. Tsaur
Reduced Expression of A-Type Potassium Channels in Primary Sensory Neurons Induces Mechanical Hypersensitivity
J. Neurosci., September 12, 2007; 27(37): 9855 - 9865.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
A. H. Gittis and S. du Lac
Firing Properties of GABAergic Versus Non-GABAergic Vestibular Nucleus Neurons Conferred by a Differential Balance of Potassium Currents
J Neurophysiol, June 1, 2007; 97(6): 3986 - 3996.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
Y.-J. Qu, V. E. Bondarenko, C. Xie, S. Wang, M. S. Awayda, H. C. Strauss, and M. J. Morales
W-7 modulates Kv4.3: pore block and Ca2+-calmodulin inhibition
Am J Physiol Heart Circ Physiol, May 1, 2007; 292(5): H2364 - H2377.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
L. S. Maier and D. M. Bers
Role of Ca2+/calmodulin-dependent protein kinase (CaMK) in excitation-contraction coupling in the heart
Cardiovasc Res, March 1, 2007; 73(4): 631 - 640.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
O. Colinas, M. Gallego, R. Setien, J. R. Lopez-Lopez, M. T. Perez-Garcia, and O. Casis
Differential modulation of Kv4.2 and Kv4.3 channels by calmodulin-dependent protein kinase II in rat cardiac myocytes
Am J Physiol Heart Circ Physiol, October 1, 2006; 291(4): H1978 - H1987.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
S. Koyama and S. B. Appel
A-type K+ Current of Dopamine and GABA Neurons in the Ventral Tegmental Area
J Neurophysiol, August 1, 2006; 96(2): 544 - 554.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
M. A.G. van der Heyden, T. J.M. Wijnhoven, and T. Opthof
Molecular aspects of adrenergic modulation of the transient outward current
Cardiovasc Res, August 1, 2006; 71(3): 430 - 442.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
A. Maguy, T. E. Hebert, and S. Nattel
Involvement of lipid rafts and caveolae in cardiac ion channel function
Cardiovasc Res, March 1, 2006; 69(4): 798 - 807.
[Abstract] [Full Text]