Am J Physiol Cell Physiol Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 288: C148-C155, 2005. First published September 1, 2004; doi:10.1152/ajpcell.00284.2004
0363-6143/05 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
288/1/C148    most recent
00284.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Menniti, M.
Right arrow Articles by Perrotti, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Menniti, M.
Right arrow Articles by Perrotti, N.

MEMBRANE TRANSPORTERS, ION CHANNELS, AND PUMPS

Serum and glucocorticoid-regulated kinase Sgk1 inhibits insulin-dependent activation of phosphomannomutase 2 in transfected COS-7 cells

Miranda Menniti, Rodolfo Iuliano, Rosario Amato, Rosalia Boito, Monica Corea, Ilaria Le Pera, Elio Gulletta, Giorgio Fuiano, and Nicola Perrotti

Dipartimento di Medicina Sperimentale e Clinica "G. Salvatore," Università Magna Graecia, Catanzaro, Italy

Submitted 30 June 2004 ; accepted in final form 23 August 2004


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Serum- and glucocorticoid-regulated kinase (Sgk1) is considered to be an essential convergence point for peptide and steroid regulation of ENaC-mediated sodium transport. We tried to identify molecular partners of Sgk1 by yeast two-hybrid screening. Yeast two-hybrid screening showed a specific interaction between Sgk1 and phosphomannomutase (PMM)2, the latter of which is an enzyme involved in the regulation of glycoprotein biosynthesis. The interaction was confirmed in intact cells by coimmunoprecipitation and colocalization detected using confocal microscopy. We were then able to demonstrate that Sgk1 phosphorylated PMM2 in an in vitro assay. In addition, we found that the enzymatic activity of PMM2 is upregulated by insulin treatment and that Sgk1 completely inhibits PMM2 activity both in the absence and in the presence of insulin stimulation. These data provide evidence suggesting that Sgk1 may modulate insulin action on the cotranslational glycosylation of glycoproteins.

Sgk; protein glycosylation; CDGIa


SGK1 IS A SERINE THREONINE KINASE (22) that regulates sodium absorption by the amiloride-sensitive sodium channel in kidney principal cells (1, 11). The kinase is activated by serum, steroids, insulin, and cAMP (6, 14). Recent evidence suggests that serum- and glucocorticoid-regulated kinase (Sgk1) is an important molecular target that integrates the multiple endocrine inputs regulating sodium transport (2, 3). Studies with stably transfected A6 cell lines, a well-characterized model of the principal cells of the distal nephron, have demonstrated that the activation of the kinase is required for basal as well as hormone-stimulated sodium transport. The results are compatible with a model in which Sgk1, once activated by hormonal stimulation, interacts with molecules that mediate Sgk1 action on the epithelial sodium channel (ENaC). One of the classic tools with which to search for an interaction between molecules is based on the possibility of studying the expression of reporter genes in yeast two-hybrid systems (4). This method was recently used by Maiyar et al. (8) and allowed the identification of importin-{alpha} as an Sgk1-interacting protein, leading nuclear localization of Sgk1.

Because our main interest was focused on Sgk1 regulation of sodium absorption in kidney cells, we decided to perform yeast two-hybrid screening using a kidney library as a source of prey cDNA.

We found several clones coding for putative Sgk1-interactive molecules. One of them contained the full sequence of phosphomannomutase (PMM)2, a key enzyme regulating the early steps of protein glycosylation and responsible for autosomal recessive congenital disorders of glycosylation type Ia (CDGIa) (19).

We present evidence based on colocalization and coimmunoprecipitation experiments that the interaction is specific and occurs in yeast as well as in eukaryotic cells. Moreover, we demonstrate that insulin enhances PMM2 activity in intact cells and that Sgk1 phosphorylates enzyme-inhibiting basal and insulin-stimulated PMM2 activity.

The present study represents the first demonstration of the hormonal regulation of PMM2 and opens new perspectives on the pathophysiology of glycoprotein metabolism.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Constructs pBridge-Sgk1. Polymerase chain reaction (PCR) (Klen Taq; BD Biosciences/Clontech, Palo Alto, CA) was used to amplify wild-type Sgk1 from pCINeo-Sgk1 (14). Primers introducing the EcoRI restriction site (ATGCGGAATTCATGACGGTGAAAACTGAGGCTGCTAAGGGC) and the BamH I restriction site (GTATGGGATCCTCAGAGGAAAGAGTCCGTGG) were used.

The amplified fragment, flanked by an EcoRI site upstream and a BamH I site downstream, was ligated into the TA cloning PCR 2.1 plasmid (Invitrogen, Carlsbad, CA) and subcloned into the multiple cloning sites of pBridge (BD Biosciences/Clontech, Palo Alto, CA).

pcDNA4TO Myc-Sgk1. The coding sequence of Sgk1, including the Myc epitope within pCINeo (14), was subcloned into the EcoRI and NotI sites of expression vector pcDNA4TO (Invitrogen), which demonstrated much more efficient expression in COS-7 cells (data not shown).

pCELFHA-PMM2. The full-length human PMM2 cDNA was subcloned into pCELFHa. The coding sequence of PMM2 was amplified by Klen Taq polymerase using pACT2-PMM2, from the screening, as a template. Primers introducing EcoRV (ACG ATA TCC CAT GGC CCC ACC ACC TGC T) and XbaI (ACT CTA GAT TAG GAG AAC AGC AGT TCA CA) restriction sites (underlined) were used.

pGEX4T3-PMM2. The full-length human PMM2 cDNA was subcloned into pGEX4T3 (Amersham Biosciences, Freiburg, Germany) in BamH I/XhoI sites within the glutathione-S-transferase (GST).

The coding sequence of PMM2 was amplified by Klen Taq polymerase using pACT2-PMM2 from the screening as a template. Primers introducing the BamH I (GAC GGA TCC ATG CAG CGC TGG) and XhoI (CGA CTC GAG CCC ACG TTA GGA GAA CAG) restriction sites (underlined) were used.

pACT2-({Delta}1–125)PMM2. Human cDNA PMM2 coding for the COOH-terminal 101 amino acids (from M126 to the stop codon) was subcloned into pACT2 by means of a PCR-based method (Klen Taq polymerase) using pACT2-PMM2 from the screening as a template. Primers introducing EcoRI (CGGAATTCGAATGTTAAACGTGTCCCCT) and XhoI (CGACTCGAGCCCACGTTAGGAGAACAG) restriction sites (underlined) were used.

PDK1-activated ({Delta}1–59)S422D Sgk1 mutant (active Sgk1) was purchased from Upstate Biotechnology (catalog no. 14-331; Charlottesville, VA).

Yeast Two-Hybrid Screening To identify Sgk1 binding proteins, a yeast two-hybrid system was used (MATCHMAKER Gal4 Two-Hybrid; BD Biosciences/Clontech, Palo Alto, CA). The bait plasmid pBridge-Sgk1, with full-length human Sgk1 expressed as a fusion protein with the DNA binding domain (BD) of the yeast transcription factor GAL4, was used to transform a suitable yeast strain (Saccharomyces cerevisiae AH109). The yeasts transformed by pBridge-Sgk1 were used for mating for 20 h with a Saccharomyces cerevisiae host strain Y187 (BD Biosciences/Clontech Laboratories) pretransformed using a MATCHMAKER human kidney cDNA pACT2-derived library cloned into a yeast GAL4 activation domain (AD) expressing proteins containing a hemagglutinin (HA) tag at the NH2 terminus. After 20 h, we spread the yeast-Y187 mating mixture on SD/-Ade/-His/-Leu/-Trp plates.

Yeast colonies that demonstrated activation of both reporters, galactose-dependent blue staining in the presence of X-Gal (5-bromo-4-chloro-3-indolyl-{beta}-D-galactopyranoside), and adenine- and histidine-independent growth were selected and considered for further evaluation to screen for putative Sgk1-interacting proteins.

Library plasmid DNA was isolated from this selection of clones with lyticase solution and rescued into HB101 Escherichia coli strain using the CaCl2 method (Invitrogen). The transformants were recovered on minimal M9 selective medium lacking leucine for nutrional selection.

The specificity of the interaction was tested for several clones by retransforming the interactor plasmid into yeast expressing pBridge-Sgk1 bait, as well as yeast strain containing the empty vector pBridge and two unrelated bait plasmids: pBridge-HMG(Y) and pBridge-PTP{eta}. The growth was then assayed on plates SD/-Ade/-His/-Leu/-Trp.

The cDNA encoding specific Sgk1-interacting proteins were sequenced and studied with BLAST analysis.

To verify whether the interaction between PMM2 and Sgk1 required the full-length PMM2 molecules, yeasts expressing pBridge-Sgk as a bait were retransformed with a pACT2 plasmid expressing a deletion mutant of PMM2 [pACT2-({Delta}1–126)PMM2].

Preparation of GST-PMM2 The GST-PMM2 fusion protein was isolated from the bacterial strain BL21. Cells were transformed with pGEX4T3-PMM2 construct. Bacteria were exponentially grown at 37°C for 2 h and subsequently induced with 0.5 mM isopropyl-1-thio-{beta}-D-galactopyranoside for 3 h at 30°C. Cells were centrifuged and then lysed with lysis buffer: PBS, pH 7.4, with 1% Triton X-100, 0.1% glycerol, and 1 mM dithiothreitol (DTT) in the presence of protease inhibitors (10 ml lysis buffer; Complete Roche Molecular Biochemicals, Mannheim, Germany). The GST-PMM2 fusion protein was purified on glutathione Sepharose beads (Pharmacia/Pfizer) and then dialyzed overnight at 4°C against a buffer containing (in mM) 50 Tris, pH 7.5, 1 EDTA; and 50 NaCl. The concentration of GST-PMM2 was calculated using the Bradford method and by performing in SDS-PAGE with Coomassie blue stain.

In Vitro Phosphorylation of PMM2 Thrombin cleavage (25 µU/ml, 16 h, 30°C) of GST-PMM2 released a 28-kDa band corresponding to PMM2 and a 24-kDa band corresponding to the GST molecule lacking the 16-amino acid NH2 terminal to the thrombin site. For the in vitro phosphorylation assay, equimolar amounts of GST-PMM2 and GST were bound to 30 µl of glutathione sephadex. Thrombin was added in all the reactions to cleave PMM2 from GST using the thrombin site within the fusion protein. The resin was separated with the use of supernatants by performing centrifugation and the pellets (~30 µl) in which the thrombin-cleaved PMM2 was recovered were used in a phosphorylation reaction.

PDK1-activated ({Delta}1–59)S422D Sgk1 (active Sgk1) was then used to phosphorylate thrombin-cleaved GST-PMM2 in kinase buffer (in mM: 20 Tris, pH 7.4, and 10 MgCl2) in the presence of 5 µM ATP, 1 mM DTT, and {gamma}-32P-ATP (0.02 mCi/sample). The reaction was allowed to occur for 30 min at room temperature and was stopped by boiling in Laemmli sample buffer. Phosphoproteins were separated using 12% SDS-PAGE and detected by performing autoradiography.

Expression in COS-7 Cells COS-7 cells were plated at a density of 3.5 x 105 cells/ml in six-well 35-mm plates. For the immunofluorescence studies, cells were plated at a density of 2.0 x 105 cells/ml on glass coverslips in individual 35-mm plates. Cells were cultured overnight in DMEM (Invitrogen) containing 10% fetal bovine serum (Invitrogen). The next day, the cells were transfected with expression plasmids using Lipofectamine Plus reagent (Invitrogen) according to the manufacturer's instructions. We used pCINeoMyc-Sgk1 (600 ng/well) (14) for the confocal microscopy experiments and pCDNA4TO Myc-Sgk1 (600 ng/well) to express Sgk1 for the coimmunoprecipitation experiments and for the evaluation of the Sgk1 effect on PMM2 activity in intact cells. pCELFHA-PMM2 (600 ng/ml) was used in the studies of coimmunoprecipitation and regulation of PMM2 activity in intact cells. Empty vectors were transfected in the sham-transfected cells.

Five hours after transfecting the cells, the transfection medium was exchanged with DMEM containing 10% fetal bovine serum and antibiotics (100 U/ml penicillin and 100 µg/ml streptomycin). Twenty-four hours after transfection, the medium was replaced with serum-free medium (DMEM containing 0.1% insulin-free bovine serum albumin plus antibiotics); the next day, the cells were used to study the regulation of PMM2 activity as well as coimmunoprecipitation and in the colocalization experiments. Confocal microscopy experiments showed that the efficiency of transfection reached ~30%.

Immunofluorescence Thirty-six hours after transfection, cells were washed twice with phosphate-buffered saline (PBS) and fixed for 15 min in 4% paraformaldehyde in PBS. Fixed cells were washed twice with PBS and then permeabilized for 5 min with 0.5% Triton X-100 in PBS. To visualize Sgk1, the permeabilized monolayers were incubated for 1 h with a rabbit anti-Myc (Santa Cruz Biotechnology, Santa Cruz, CA) diluted 1:200 in PBS. To visualize PMM2, the permeabilized monolayers were incubated for 1 h with a mouse anti-HA antibody (Roche Diagnostics, Indianapolis, IN) diluted 1:200 in PBS. To detect the staining for Sgk1, the coverslips were washed twice with PBS and incubated for 45 min at room temperature with a 1:800 dilution of Alexa Fluor 488 goat anti-rabbit IgG (Molecular Probes, Eugene, OR) in a humidified chamber. To detect staining for PMM2, the coverslips were washed twice with PBS and incubated for 45 min at room temperature with a 1:800 dilution of Alexa Fluor 568 donkey anti-mouse IgG (Molecular Probes, Eugene, OR) in a humidified chamber. After being washed with PBS, cells were mounted in Prolong antifade reagent (Molecular Probes) and visualized using a confocal microscope (Leica Microsystems, Wetzlar, Germany).

Coimmunoprecipitation Experiments The transfected cells were solubilized for 20 min at 4°C in a solubilization buffer (250 µl/well) containing 50 mM Tris, pH 7.8, 300 mM NaCl, and 0.5% Triton X-100, with the protease inhibitor complete TM, phosphatase inhibitors (in mM: 100 NaF, 5 sodium pyrophosphate, and 2 sodium orthovanadate and 5 EDTA). Protein extracts were quantified by means of a Bradford-based assay (Bio-Rad, Hercules, CA), and an aliquot (20 µg) of protein extracts was analyzed by performing immunoblotting with rabbit anti-HA (Roche Diagnostics) and rabbit anti-Myc (Santa Cruz Biotechnology) to assess the expression of HA-PMM2 and Myc-Sgk1. Proteins (400 µg) were immunoprecipitated with mouse anti-HA antibodies (8 µl; Roche Diagnostics) at 4°C overnight. The antibody was bound to protein G-Ultralink (15 µl; Pierce, Rockford, IL) at 4°C for 60 min. The immune complexes were sedimented and then washed three times with a washing buffer containing 25 mM HEPES, 100 mM KCl, 12.5 mM MgCl2, 0.1 mM EDTA, 10% glycerol, and 0.1% Nonidet P-40, pH 7.9 (3). The pellets were then resuspended in Laemmli sample buffer containing DTT (1 mM), boiled for 5 min, and separated by performing SDS-PAGE using a 12% gel. The proteins were transferred to nitrocellulose, blocked in 5% nonfat dry milk in Tris-buffered saline plus Tween 20 (TTBS), and incubated with mouse anti-HA antibody at a dilution of 1:1,000 in 5% nonfat dry milk in TTBS to detect immunoprecipitated PMM2, rabbit anti-peptide 267 Sgk1 antibody (2) (Zymed Laboratories, South San Francisco, CA), or preimmune rabbit serum at a dilution of 1:1,000 in 5% nonfat dry milk in TTBS for the detection of Sgk1.

PMM2 Activity in HA Immunoprecipitates After 16 h of serum starvation (see Expression in COS-7 Cells), the cells were incubated in the presence or in the absence of human recombinant insulin (1 µM for 45 min; Sigma-Aldrich). The medium was aspirated, and the cells were solubilized. The extracts were treated as described above for the immunoprecipitation experiments; however, after the pellets were washed, instead of resuspending in Laemmli sample buffer, the proteins immunoprecipitated by the anti-HA antibody were washed once and resuspended in the mannomutase buffer containing 50 mM HEPES, pH 7.1, 5 mM MgCl2, 5 µg/ml glucose-6-phosphate dehydrogenase, 10 µg/ml phosphoglucose isomerase, 3.5 µg/ml phosphomannose isomerase, and 0.2 µM glucose 1,6-biphosphate (Sigma-Aldrich, Milan, Italy), according to the method described by Van Schaftingen and Jaeken (10). The reaction was started by the addition of 0.25 mM NADP and 0.1 mM mannose-1-phosphate. The reaction was allowed to occur for 30 min at 30°C on a rotating wheel and was stopped by heating at 80°C for 5 min. The immunoglobulins bound to protein G-Sepharose were sedimented by centrifugation (microfuged at 14,000 rpm for 2 min). The absorbance at 340 nm was read in supernatants to measure the amount of NADPH produced in the reaction.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Yeast Two-Hybrid Screening Reveals Specific Sgk1/PMM2 Interaction Two-hybrid screening allowed us to identify different independent clones interacting specifically with Sgk1. Approximately 15 million yeast transformants were screened. Among several putative interacting clones, four isolated clones contained cDNA inserts of similar size. BLAST analysis revealed that all four library clones contained the coding sequence for full-length PMM2 (gi:14249867). The interaction was specific because the growth on plates SD/-Ade/-His/-Leu/-Trp was observed only when the interactor plasmid pACT2-PMM2 was retransformed into yeast expressing pBridge-Sgk1 bait. No growth was observed when the interactor plasmid pACT2-PMM2 was retransformed into yeast containing the empty vector pBridge or two unrelated bait plasmids: pBridge-HMG(Y) and pBridge-PTP{eta} (Fig. 1A). The interaction between PMM2 and Sgk1 required the integrity of the PMM2 molecule. In fact, no growth was observed when a pACT2 plasmid expressing a PMM2 deletion mutant [pACT2-({Delta}1–125)PMM2] was retransformed into yeast containing either pBridge-Sgk1 or the empty vector pBridge (Fig. 1B). We found other clones containing genes coding for putative Sgk1-interactive proteins. One of them, transportin-{beta}, is related to importin-{alpha}, previously described as an Sgk1-interacting protein (8). Other clones are currently under investigation.



View larger version (68K):
[in this window]
[in a new window]
 
Fig. 1. Identification of phosphomannomutase (PMM)2 as an serum- and glucocorticoid-regulated kinase (Sgk1)-interacting protein using yeast two-hybrid assay. AH109 yeast strain cells cotransformed with pBridge-Sgk1 and pACT2-PMM2 were able to grow in selective medium lacking histidine, tryptophan, leucine, and adenine. The interaction was specific because yeasts cotransformed by vectors expressing different molecules, pACT2-PMM2 with pBridge HMG(Y), pBridge rPTP{eta}, and pBridge empty vector, were unable to grow in selective medium (A). AH109 yeast strain cells transformed with pBridge-Sgk1 or with pBridge empty vector were unable to grow in selective medium lacking histidine, tryptophan, leucine, and adenine when retransformed with pACT2-({Delta}1–125)PMM2 (B).

 
PMM is the enzyme that catalyzes the interconversion between mannose 6-phosphate and mannose 1-phosphate. Mannose 1-phosphate is required for the synthesis of GDP-mannose, the activated intermediate essential for the synthesis of the dolichol-linked oligosaccharide early in the N-glycosylation process.

In Vitro Phosphorylation of PMM2 To verify whether Sgk and PMM2 were related in an enzyme/substrate molecular interaction, we used PDK1-activated Sgk to phosphorylate PMM2 in vitro.

Active Sgk1 appeared to be heavily phosphorylated in the conditions used for the assay (Fig. 2B, top, lanes 2 and 4). Because GST-PMM2 had electrophoretic mobility similar to that of phosphorylated Sgk1 in SDS-PAGE, it was impossible to detect Sgk1-dependent phosphorylation of GST-PMM2 in the presence of phosphorylated Sgk1. We used a thrombin-cleaved GST-PMM2 as a substrate for a kinase reaction in the presence of active Sgk1. The thrombin-digested proteins were loaded onto an SDS-PAGE gel and detected using Coomassie blue staining. A 48-kDa band corresponding to undigested GST-PMM2 (Fig. 2A, top, lanes 1 and 2), comigrating with active Sgk1, was detected (Fig. 2, A and B, top, lanes 2 and 4). A 28-kDa band just above the 25-kDa marker corresponded to PMM2, and a 24-kDa band just underneath the 25-kDa marker corresponded to the GST molecule lacking the 16-amino acid NH2 terminal to the thrombin site (Fig. 2A, bottom, lanes 1 and 2). In the lanes in which GST alone was loaded, Coomassie blue staining allowed the detection of a 25-kDa band corresponding to undigested GST and the 24-kDa band corresponding to the GST molecule lacking 16-amino acid NH2 terminal to the thrombin site (Fig. 2A, bottom, lanes 3 and 4). Thrombin-cleaved GST-PMM2 and GST were used as substrates for a phosphorylation reaction in the absence (Fig. 2, A and B, lanes 1 and 3) and in the presence (Fig. 2, A and B, lanes 2 and 4) of active Sgk1. In the presence of active Sgk1, thrombin-digested PMM2 was phosphorylated (Fig. 2B, bottom, lane 2), whereas no phosphorylation was observed when thrombin-digested GST was used as a substrate for active Sgk1 (Fig. 2B, bottom, lane 4).



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2. In vitro phosphorylation of PMM2 by active Sgk1. Active Sgk1 was used to phosphorylate thrombin-cleaved glutathione-S-transferase (GST)-PMM2 and GST as indicated in MATERIALS AND METHODS. The kinase reaction was stopped by boiling in Laemmli sample buffer. The proteins were separated by performing SDS-PAGE, stained with Coomassie blue (A), and detected by performing autoradiography (B). Thrombin-cleaved PMM2 (A and B, lanes 1 and 2, bottom) and thrombin-cleaved GST (A and B, lanes 3 and 4, bottom) were used as substrates of a kinase reaction in the presence (A and B, lanes 2 and 4) and in the absence (A and B, lanes 1 and 3) of active Sgk1.

 
Coimmunoprecipitation To verify whether the interaction between Sgk1 and PMM2 also occurred in eukaryotic cells, we performed coimmunoprecipitation experiments in transfected COS-7 cells.

Rabbit anti-Myc and anti-HA immunoglobulins allowed the detection of Myc-Sgk1 (Fig. 3A, lanes 2 and 4) and HA-PMM2 (Fig. 3A, lanes 3 and 4) in cell extracts. Mouse anti-HA was used to immunoprecipitate HA-PMM2, which was detected by performing blotting with rabbit anti-HA antibodies as expected (Fig. 3B, lanes 3 and 4). Weak and nonspecific bands were detected in extracts from cells that had not been transfected with HA-PMM2 (Fig. 3B, lanes 1 and 2). These weak bands are likely to correspond to the light chains of the mouse immunoglobulins used to immunoprecipitate HA-PMM2, cross-reacting with the HRP anti-rabbit immunoglobulins used to detect the immunoprecipitated proteins in the blot. Sgk1 was specifically detected by blotting with a rabbit anti-Sgk1 antibody (peptide 267) (6) (Fig. 3C, lane 4) but not by blotting with the preimmune serum from the same rabbit (Fig. 3D, lane 4). Nonspecific bands were detected with both the preimmune and the immune anti-Sgk antibodies. These bands have an apparent molecular weight corresponding to the heavy chains of the mouse immunoglobulins used for the HA immunoprecipitation. Because Sgk was detected only in HA immunoprecipitates from cells transfected with vectors coding for PMM2 and Sgk1, we conclude that the interaction between Sgk1 and PMM2 occurred in eukaryotic cells.



View larger version (75K):
[in this window]
[in a new window]
 
Fig. 3. Coimmunoprecipitation of Sgk1 and PMM2. COS-7 cells were transfected with empty vector (A, B, C, and D, lane 1), pcDNA4TO-Myc Sgk1 (A, B, C, and D, lane 2), pCELF-HA PMM2 (A, B, C, and D, lane 3), and both pcDNA4TO-Myc Sgk1 and pCELF-HA PMM2 (A, B, C, and D, lane 4). A: solubilized extracts were diluted with Laemmli sample buffer and analyzed by performing SDS-PAGE followed by immunoblotting with rabbit anti-Myc and mouse anti-hemagglutinin (anti-HA) immunoglobulins. HA-PMM2 was detected in lanes 3 and 4, and Myc-Sgk1 was detected in lanes 2 and 4. B: solubilized extracts were immunoprecipitated using mouse anti-HA immunoglobulins and blotted with rabbit anti-HA antibodies. HA-PMM2 was detected in lanes 3 and 4. In lanes 1 and 2, weak, nonspecific bands were detected, with an apparent molecular weight corresponding to the light chains of mouse immunoglobulins used in the immunoprecipitation. C: solubilized extracts immunoprecipitated with mouse anti-HA immunoglobulins were blotted with rabbit anti-Sgk1 antiserum. Sgk was detected only in lane 4, just above nonspecific bands also detected using the rabbit preimmune serum (D).

 
Colocalization The localization of Sgk1 and PMM2 was studied in COS-7 cells using confocal microscopy (Fig. 4) to verify whether the interaction of the two molecules was possible in eukaryotic cells.



View larger version (43K):
[in this window]
[in a new window]
 
Fig. 4. Colocalization of Sgk1 and PMM2. Monolayers of COS-7 cells grown on glass coverslips at ~50% confluence were transfected with expression vectors encoding the full-length Myc-tagged Sgk1 (pCINeo-Myc Sgk) and the full-length HA-tagged PMM2 (pCELF-HA PMM2). Serum-starved cells were fixed as indicated in MATERIALS AND METHODS and stained with rabbit anti-Myc immunoglobulins diluted 1:200 in PBS to visualize Sgk1 (A) and mouse anti-HA immunoglobulins diluted 1:200 in PBS to visualize PMM2 (B). The staining for Sgk1 was detected with Alexa Fluor 488 goat anti-rabbit IgG. The staining for PMM2 was detected with Alexa Fluor 568 donkey anti-mouse IgG (Molecular Probes). Image shown in C is an overlay of A and B.

 
COS-7 cells were transiently transfected with pCINeo Myc-Sgk1 and pCELFHA-PMM2. The Myc epitope of Sgk1, recognized by rabbit anti-Myc antibodies, was detected by means of a secondary fluorescein-conjugated anti-rabbit antibody (Fig. 4A). The HA epitope of PMM2, recognized by mouse anti-HA antibodies, was detected using a secondary rhodamine-conjugated anti-mouse antibody (Fig. 4B).

Under the conditions studied, both the proteins localized in the cytoplasm. The localization of Sgk was very similar to that reported in a recent study (12). Colocalization of Sgk1 and PMM2 was strongly suggested by the appearance of the yellow color in the Sgk1-PMM2 overlay in the vast majority of cells in which both the vectors were expressed (Fig. 4C).

Sgk1 Inhibits Basal and Insulin-Stimulated PMM2 Activity in Intact Cells PMM2 is a key enzyme in the posttranslational glycosylation of proteins. Given the interaction between Sgk and PMM2, we hypothesized that Sgk could regulate the activity of PMM2 in basal conditions or after insulin stimulation.

HA immunoprecipitates from Sgk1- and PMM2-transfected COS-7 cells were assayed in a PMM2 reaction as described in MATERIALS AND METHODS. PMM2 activity was calculated by subtracting the background in HA immunoprecipitates from untransfected cells in the absence and in the presence of insulin. The raw data are reported in Table 1. To average data from multiple experiments, the data were expressed as fractions of the mean PMM2 activity immunoprecipitated from cells incubated in the presence of insulin. Data are means ± SE from three independent experiments. The PMM2 activity recovered from cells transfected with Sgk1 alone was similar to the background and was not significantly modified by insulin (Fig. 5A, columns 1 and 2).


View this table:
[in this window]
[in a new window]
 
Table 1. Optical density of transiently transfected COS-7 cells

 


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 5. PMM2 activity in HA immunoprecipitates from Sgk1 and PMM2 transfected COS-7 cells. PMM2 activity was measured in HA immunoprecipitates from cells transfected with empty vectors (pCELF-HA and pcDNATO), Myc-tagged Sgk1 (pcDNA4TO-Myc Sgk1), empty vector pCeLF-HA (columns 1 and 2), HA-tagged PMM2 (pCELF-HA PMM2), empty vector pcDNA4TO (columns 3 and 4), Myc-tagged Sgk1 (pcDNA4TO-Myc Sgk1), and HA-tagged PMM2 (pCELF-HA PMM2) (columns 5 and 6). Serum-starved cells were stimulated with insulin as indicated. PMM2 activity was calculated by subtracting the background immunoprecipitated from cells transfected with empty vectors and was expressed as a fraction of the mean activity immunoprecipitated from insulin-stimulated cells (A). The protein G pellets used in the enzymatic assay for PMM2 activity were boiled in Laemmli sample buffer. The proteins were separated by performing SDS-PAGE, followed by immunoblotting with rabbit anti-HA immunoglobulins (B).

 
On the other hand, clearly measurable PMM2 activity was associated with the HA immunoprecipitates of cells transfected with HA-PMM2. Interestingly, incubation with insulin for 45 min led to a more than twofold activation of the enzyme (Fig. 5A, columns 3 and 4).

In cells cotransfected with both wild-type Sgk1 and PMM2, the PMM2 activity associated with the HA immunoprecipitates was again similar to the background, both in the absence and in the presence of insulin (Fig. 5A, columns 5 and 6).

Because neither insulin nor Sgk1 affected the quantity of HA-PMM2 contained in the immunoprecipitates (Fig. 5B, lanes 3, 4, 7, and 8), we conclude that insulin increased the enzymatic activity of PMM and that Sgk1 decreased the enzymatic activity of PMM in the basal state and upon insulin stimulation in intact COS-7 cells.


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Previous data in A6 cells, a well-characterized model of the principal cells of the distal nephron, suggested that PDK1/2-dependent phosphorylation of Sgk1 is essential for the activation of the enzyme and that it is indeed the active enzyme responsible for insulin-, vasopressin-, and aldosterone-dependent sodium transport through the amiloride-sensitive ENaC (2). We then decided to perform yeast two-hybrid screening to identify molecular partners involved in the transduction of signals through Sgk1. We used a kidney library as a source of prey cDNA because the hormonal regulation of sodium transport takes place in the principal cells of the distal nephron.

In Vitro Interaction between Sgk1 and PMM2 Two-hybrid screening. Using two-hybrid screening, we identified several independent clones coding for putative Sgk1 interacting proteins. One of them, transportin-{beta}, is related to importin-{alpha}, previously shown by others (8) to interact with the nuclear localization sequence of Sgk1 and to cause phosphatidylinositol 3-kinase-dependent nuclear import of Sgk1. Three more clones are under evaluation.

Four of the clones coding for putative Sgk1 interacting proteins contained cDNA inserts of similar size, with the full sequence of PMM2, an enzyme that catalyzes the interconversion between mannose-6-phosphate and mannose-1-phosphate (20).

PMM2 phosphorylation. PMM2 sequence contains several serine and threonine residues close enough to arginine residues to identify potential targets of phosphorylation by different serine/threonine kinases, such as protein kinase A (PKA residues 115–118), casein kinase II (residues 47–50, 118–121, 137–140, and 232–235), and protein kinase C (PKC 237–239) (ExPASy; Swiss protein no. 015305). Residues 134–137 are also part of a consensus sequence for Sgk and PKB (3). We were able to show that PMM2 can be an in vitro substrate for Sgk1 kinase activity, although with low efficiency. This phosphorylation experiment adds more evidence to the hypothesis that Sgk1 and PMM2 may indeed have molecular interaction, although it is not intended to prove that PMM2 activity is regulated by phosphorylation.

Interaction between Sgk1 and PMM2 in intact cells. The interaction between Sgk1 and PMM2 occurs also in eukaryotic cells. In fact, we were able to detect Sgk1 in HA immunoprecipitates from cells cotransfected with vectors coding for HA-PMM2 and Myc-Sgk1. When a Myc antibody was used to detect Sgk in the HA immunoprecipitates, a barely detectable band was observed (data not shown). A much more convincing result was obtained when our rabbit anti-Sgk antibody raised against peptide 267 was used. This was not surprising, because this rabbit antibody proved to be more sensitive than Myc antibodies in detecting Sgk in immunoprecipitates in several unrelated experiments.

Moreover, in COS-7 cells transfected with vectors coding for both PMM2 and Sgk1, the enzymes clearly colocalized in the cytoplasm after 16 h of serum starvation as expected (8).

PMM2 is an enzyme required for the synthesis of GDP-mannose, which is essential for the production of dolichol-pyrophosphate-oligosaccharides involved in the early steps of protein glycosylation and in the synthesis of membrane anchors glycosyl phosphatidylinositol and O-mannosylated brain proteoglycans (20).

Regulation of PMM2 activity. PMM2 activity can be modulated by exogenous factors. Acetaldehyde has been shown to be able to suppress the activity of the enzyme without affecting gene expression in HepG2 cells (18). We have demonstrated for the first time that the activity of PMM2 immunoprecipitated from cells treated with insulin is increased more than twofold, suggesting that the activity of the enzyme can be regulated in vivo by hormones. Interestingly, we also have demonstrated that Sgk1 completely inhibits PMM2 activity in both the basal and insulin-stimulated states.

Implication of the Interaction of Sgk1 and PMM2 in Human Diseases Congenital disorders of glycosylation type Ia. PMM deficiency due to mutations in the gene coding for PMM2 is responsible for autosomal recessive CDGIa, previously known as carbohydrate-deficient glycoprotein syndrome. CDGIa is a multisystem disorder with impressive involvement of the central nervous system and is characterized by the presence of insufficiently sialylated proteins, including transferrin and several secretory glycoproteins (7, 10).

The observation that the activity of PMM2 can be regulated by insulin opens new perspectives on the understanding of the physiopathology of CDG.

Both Sgk1 and PMM2 are stimulated by insulin. It is possible that tissue-specific expression of Sgk1 can divert insulin action from the stimulation of PMM2 activity in tissues in which insulin-dependent enhancement of protein glycosylation is not required. A similar mechanism has been proposed for other molecules regulating other pathways in insulin action, such as CEACAM1-mediated downregulation of insulin's mitogenic effect. CEACAM1, a liver-specific tumor suppressor previously known as pp-120 (13), is phosphorylated on Tyr488 by the insulin receptor kinase. Tyr488-phosphorylated CEACAM1 binds to the SH2 domain of Shc, thus decreasing the efficiency of Grb2 coupling to the insulin receptor and downregulating the insulin-dependent Ras/MAP kinase mitogenic pathway in the liver (16). In a similar manner, tissue-specific Sgk expression can downregulate insulin-dependent stimulation of PMM2-mediated cotranslational protein glycosylation.

Cystic Fibrosis Sodium transport through the ENaC is related to chloride transport through the cystic fibrosis transmembrane regulator. In particular, the activation of chloride transport has been described as inhibiting sodium transport in epithelial cells (19). The lack of inhibition in sodium absorption and the consequent hyperviscosity of secretions are thought to have a role in the pathogenesis of cystic fibrosis (9). Increased expression of Sgk1 has been described in the bronchial epithelial cells of patients with cystic fibrosis (21), and this increased expression may also have a pathogenetic role, although the relationship between cystic fibrosis transmembrane regulator and Sgk1 has only recently become partially understood (5, 17). Interestingly, decreased glycosylation has been described in the bronchial epithelia of patients with cystic fibrosis, and this has been associated with increased susceptibility to bacterial infection (15). It is possible that the increased expression of Sgk1 is indeed the mechanism by which decreased glycosylation occurs through inhibition of PMM activity.

Finally, the regulation of PMM2 activity and protein glycosylation by a kinase involved in transducing serum- and steroid-dependent survival signals may be relevant for cell adhesion and interaction as well as for the development of renal complications of diabetes and hypertension.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by the following grants issued by the Italian Department of Education: cluster work package 6A, FIRB 2001/RBNE01724C_007, and Cofin 2002/2002067759_003.


    FOOTNOTES
 

Address for reprint requests and other correspondence: N. Perrotti, Dipartimento di Medicina Sperimentale e Clinica, Università Magna Graecia di Catanzaro, Via T. Campanella 115, 88100 Catanzaro, Italy (E-mail: perrotti{at}unicz.it)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Chen SY, Bhargava A, Mastroberardino L, Meijer OC, Wang J, Buse P, Firestone GL, Verrey F, and Pearce D. Epithelial sodium channel regulated by aldosterone-induced protein sgk. Proc Natl Acad Sci USA 96: 2514–2519, 1999.[Abstract/Free Full Text]

2. Faletti CJ, Perrotti N, Taylor SI, and Blazer-Yost BL. sgk: an essential convergence point for peptide and steroid hormone regulation of ENaC-mediated Na+ transport. Am J Physiol Cell Physiol 282: C494–C500, 2002.[Abstract/Free Full Text]

3. Firestone G, Giampaolo J, and O'Keefe B. Stimulus-dependent regulation of serum and glucocorticoid inducible protein kinase (SGK) transcription, subcellular localization and enzymatic activity. Cell Physiol Biochem 13: 1–12, 2003.[Web of Science][Medline]

4. Gyuris J, Golemis E, Chertkov H, and Brent R. Cdi1, a human G1 and S phase protein phosphatase that associates with Cdk2. Cell 75: 791–803, 1993.[CrossRef][Web of Science][Medline]

5. Ji HL, Chalfant ML, Jovov B, Lockhart JP, Parker SB, Fuller CM, Stanton BA, and Benos DJ. The cytosolic termini of the {beta}- and {gamma}-ENaC subunits are involved in the functional interactions between cystic fibrosis transmembrane conductance regulator and epithelial sodium channel. J Biol Chem 275: 27947–27956, 2000.[Abstract/Free Full Text]

6. Kobayashi T and Cohen P. Activation of serum- and glucocorticoid-regulated protein kinase by agonists that activate phosphatidylinositide 3-kinase is mediated by 3-phosphoinositide-dependent protein kinase-1 (PDK1) and PDK2. Biochem J 339: 319–328, 1999.

7. Leroy JL. Oligosacchiridoses and allied disorders. In: Emery and Rimoin's Principles and Practice of Medical Genetics (4th Ed.), edited by Rimoin DL, Connor JM, Pyeritz RE, and Korf BR. New York: Churchill Livingstone, 2002, vol. 2, chapt. 99, p. 2677–2711.

8. Maiyar AC, Leong MLL, and Firestone GL. Importin-{alpha} mediates the regulated nuclear targeting of serum- and glucocorticoid-inducible protein kinase (Sgk) by recognition of a nuclear localization signal in the kinase central domain. Mol Biol Cell 14: 1221–1239, 2003.[Abstract/Free Full Text]

9. Mall M, Bleich M, Kuehr J, Brandis M, Greger R, and Kunzelmann K. CFTR-mediated inhibition of epithelial Na+ conductance in human colon is defective in cystic fibrosis. Am J Physiol Gastrointest Liver Physiol 277: G709–G716, 1999.[Abstract/Free Full Text]

10. Matthijs G, Schollen E, Pardon E, Veiga-Da-Cunha M, Jaeken J, Cassiman JJ, and Van Schaftingen E. Mutations in PMM2, a phosphomannomutase gene on chromosome 16p13, in carbohydrate-deficient glycoprotein type I syndrome (Jaeken syndrome). Nat Genet 16: 88–92, 1997.[CrossRef][Web of Science][Medline]

11. Náray-Fejes-Tóth A, Canessa C, Cleaveland ES, Aldrich G, and Fejes-Tóth G. sgk is an aldosterone-induced kinase in the renal collecting duct: effects on epithelial Na+ channels. J Biol Chem 274: 16973–16978, 1999.[Abstract/Free Full Text]

12. Náray-Fejes-Tóth A, Helms MN, Stokes JB, Fejes-Tóth G. Regulation of sodium transport in mammalian collecting duct cells by aldosterone-induced kinase, SGK1: structure/function studies. Mol Cell Endocrinol 217: 197–202, 2004.[CrossRef][Web of Science][Medline]

13. Perrotti N, Accili D, Marcus-Samuels B, Rees-Jones RW, and Taylor SI. Insulin stimulates phosphorylation of a 120-kDa glycoprotein substrate (pp120) for the receptor-associated protein kinase in intact H-35 hepatoma cells. Proc Natl Acad Sci USA 84: 3137–3140, 1987.[Abstract/Free Full Text]

14. Perrotti N, He RA, Phillips SA, Haft CR, and Taylor SI. Activation of serum- and glucocorticoid-induced protein kinase (Sgk) by cyclic AMP and insulin. J Biol Chem 276: 9406–9412, 2001.[Abstract/Free Full Text]

15. Poschet JF, Boucher JC, Tatterson L, Skidmore J, Van Dyke RW, and Deretic V. Molecular basis for defective glycosylation and Pseudomonas pathogenesis in cystic fibrosis lung. Proc Natl Acad Sci USA 98: 13972–13977, 2001.[Abstract/Free Full Text]

16. Poy MN, Ruch RJ, Fernström MA, Okabayashi Y, and Najjar SM. Shc and CEACAM1 interact to regulate the mitogenic action of insulin. J Biol Chem 277: 1076–1084, 2002.[Abstract/Free Full Text]

17. Schreiber R, Hopf A, Mall M, Greger R, and Kunzelmann K. The first-nucleotide binding domain of the cystic-fibrosis transmembrane conductance regulator is important for inhibition of the epithelial Na+ channel: (Xenopus oocytes/MDR1/YCF1/SUR1). Proc Natl Acad Sci USA 96: 5310–5315, 1999.[Abstract/Free Full Text]

18. Searashi Y, Yamauchi M, Sakamoto K, Ohata M, Asakura T, and Ohkawa K. Acetaldehyde-induced growth retardation and micro-heterogeneity of the sugar chain in transferrin synthesized by HepG2 cells. Alcohol Clin Exp Res 26, Suppl 8: 32S–37S, 2002.[CrossRef]

19. Stutts MJ, Rossier BC, and Boucher RC. Cystic fibrosis transmembrane conductance regulator inverts protein kinase A-mediated regulation of epithelial sodium channel single channel kinetics. J Biol Chem 272: 14037–14040, 1997.[Abstract/Free Full Text]

20. Van Schaftingen E and Jaeken J. Phosphomannomutase deficiency is a cause of carbohydrate-deficient glycoprotein syndrome type I. FEBS Lett 377: 318–320, 1995.[CrossRef][Web of Science][Medline]

21. Wagner CA, Ott M, Klingel K, Beck S, Melzig J, Friedrich B, Wild KN, Bröer S, Moschen I, Albers A, Waldegger S, Tümmler B, Egan ME, Geibel JP, Kandolf R, and Lang F. Effects of the serine/threonine kinase SGK1 on the epithelial Na+ channel (ENaC) and CFTR: implications for cystic fibrosis. Cell Physiol Biochem 11: 209–218, 2001.[CrossRef][Web of Science][Medline]

22. Webster MK, Goya L, Ge Y, Maiyar AC, and Firestone GL. Characterization of sgk, a novel member of the serine/threonine protein kinase gene family which is transcriptionally induced by glucocorticoids and serum. Mol Cell Biol 13: 2031–2040, 1993.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
D. Y. Huang, K. M. Boini, H. Osswald, B. Friedrich, F. Artunc, S. Ullrich, J. Rajamanickam, M. Palmada, P. Wulff, D. Kuhl, et al.
Resistance of mice lacking the serum- and glucocorticoid-inducible kinase SGK1 against salt-sensitive hypertension induced by a high-fat diet
Am J Physiol Renal Physiol, December 1, 2006; 291(6): F1264 - F1273.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
F. Lang, C. Bohmer, M. Palmada, G. Seebohm, N. Strutz-Seebohm, and V. Vallon
(Patho)physiological Significance of the Serum- and Glucocorticoid-Inducible Kinase Isoforms.
Physiol Rev, October 1, 2006; 86(4): 1151 - 1178.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
K. M. Boini, A. M. Hennige, D. Y. Huang, B. Friedrich, M. Palmada, C. Boehmer, F. Grahammer, F. Artunc, S. Ullrich, D. Avram, et al.
Serum- and glucocorticoid-inducible kinase 1 mediates salt sensitivity of glucose tolerance.
Diabetes, July 1, 2006; 55(7): 2059 - 2066.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
288/1/C148    most recent
00284.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Menniti, M.
Right arrow Articles by Perrotti, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Menniti, M.
Right arrow Articles by Perrotti, N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2005 by the American Physiological Society.