Am J Physiol Cell Physiol Journal of Neurophysiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 287: C1560-C1568, 2004. First published August 11, 2004; doi:10.1152/ajpcell.00221.2004
0363-6143/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Movie
Right arrow All Versions of this Article:
287/6/C1560    most recent
00221.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (56)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sinha, S.
Right arrow Articles by Owens, G. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sinha, S.
Right arrow Articles by Owens, G. K.

GROWTH, DIFFERENTIATION, AND APOPTOSIS

Transforming growth factor-{beta}1 signaling contributes to development of smooth muscle cells from embryonic stem cells

Sanjay Sinha,1 Mark H. Hoofnagle,1 Paul A. Kingston,2 Mary E. McCanna,1 and Gary K. Owens1

1Department of Molecular Physiology and Biological Physics. University of Virginia, Charlottesville, Virginia 22908; and 2Department of Medicine, University of Manchester, Manchester M13 9PT, United Kingdom

Submitted 5 May 2004 ; accepted in final form 7 August 2004


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Knockout of transforming growth factor (TGF)-{beta}1 or components of its signaling pathway leads to embryonic death in mice due to impaired yolk sac vascular development before significant smooth muscle cell (SMC) maturation occurs. Thus the role of TGF-{beta}1 in SMC development remains unclear. Embryonic stem cell (ESC)-derived embryoid bodies (EBs) recapitulate many of the events of early embryonic development and represent a more physiological context in which to study SMC development than most other in vitro systems. The present studies showed induction of the SMC-selective genes smooth muscle {alpha}-actin (SM{alpha}A), SM22{alpha}, myocardin, smoothelin-B, and smooth muscle myosin heavy chain (SMMHC) within a mouse ESC-EB model system. Significantly, SM2, the SMMHC isoform associated with fully differentiated SMCs, was expressed. Importantly, the results showed that aggregates of SMMHC-expressing cells exhibited visible contractile activity, suggesting that all regulatory pathways essential for development of contractile SMCs were functional in this in vitro model system. Inhibition of endogenous TGF-{beta} with an adenovirus expressing a soluble truncated TGF-{beta} type II receptor attenuated the increase in SMC-selective gene expression in the ESC-EBs, as did an antibody specific for TGF-{beta}1. Of interest, the results of small interfering (si)RNA experiments provided evidence for differential TGF-{beta}-Smad signaling for an early vs. late SMC marker gene in that SM{alpha}A promoter activity was dependent on both Smad2 and Smad3 whereas SMMHC activity was Smad2 dependent. These results are the first to provide direct evidence that TGF-{beta}1 signaling through Smad2 and Smad3 plays an important role in the development of SMCs from totipotential ESCs.

embryoid body; Smad


ALTHOUGH SMOOTH MUSCLE (SM) cell (SMC) differentiation is an essential component of vascular development, little is known regarding the specific factors that promote specification of pluripotential mesenchymal cells into the SMC lineage or maturation of early SMCs into a mature contractile form. Transforming growth factor (TGF)-{beta}1, a potent multifunctional cytokine, is thought to play a key role in modulating vascular development, although its specific effects on SMCs and their precursors during development remain unclear.

In vivo, ~50% of TGF-{beta}1-null mice die in utero at days 10.5–11.5 with defects in the yolk sac vasculature, including decreased vessel wall integrity and reduced contact between endothelial and mesenchymal cells (10). A similar phenotype has been reported in the TGF-{beta} type II receptor-null mouse (25). Null mutations in other TGF-{beta} signaling pathway components such as Alk-1 (24, 33), endoglin (5, 20), and Smad5 (6) also lead to intrauterine death at midgestation because of fragile and dilated or hemorrhagic vessels. In these knockout models, fetal death, likely due to effects on endothelial stability and tube formation leading to an abnormal vasculature, occurs before significant recruitment or maturation of vascular SMCs. Nevertheless, some of these studies have reported loss of early SMC coating around the nascent dorsal aorta in null animals (20, 24), suggesting that the TGF-{beta} signaling pathway may be required for SMC differentiation. Alternatively, the reported reduction in SMC number may simply be due to nonspecific effects, because the null embryos show significant growth retardation, edema, and necrosis by the time SMCs are first detected. Moreover, if TGF-{beta} signaling is indeed a requirement for SMC development, it is not possible to distinguish the primary effects of the null mutation on SMCs from those secondary to the defective endothelial network or to effects mediated through other cell types.

Meanwhile, there is compelling evidence that TGF-{beta}1 coordinately upregulates a variety of SMC differentiation marker genes including smooth muscle {alpha}-actin (SM{alpha}A), smooth muscle myosin heavy chain (SMMHC), and h1-calponin in cultured SMCs derived from mature blood vessels (3, 14). Because SMC differentiation is characterized by the upregulation of these and other SM-specific genes, it has been postulated that TGF-{beta}1 may promote SMC development from pluripotential precursors. This hypothesis was initially investigated in vitro, with primary cultures of neural crest cells (32) and more recently with neural crest-derived Monc-1 cells (8). These studies provided evidence that addition of TGF-{beta}1 induced these cells to express several SMC markers, including SM{alpha}A and calponin. However, although the cells were able to respond to exogenous growth factor by expressing SMC differentiation marker genes, no loss-of-function studies were done to determine whether endogenous TGF-{beta}1 signaling was a component of the normal developmental pathway of SMCs derived from the neural crest. Additional studies on mouse embryonic 10T1/2 cells (15) provided evidence that exogenous TGF-{beta}1 induced SM{alpha}A expression whereas antibody-mediated inhibition of TGF-{beta} reduced expression of this marker when the cells were cocultured with bovine endothelial cells (ECs). However, SM{alpha}A is expressed by many cell types other than SMCs (26), and evidence that TGF-{beta}1-treated 10T1/2 cells also expressed the much more definitive SMC marker SMMHC was equivocal because the studies relied on use of an antibody that we have found shows very low sensitivity for murine SMMHC, leading to problems of cross-reactivity with nonmuscle myosin heavy chains including embryonic SM myosin heavy chain [SMemb or nonmuscle myosin heavy chain B (NMMHC-B)]. Indeed, we reported (35) that TGF-{beta} does not induce expression of either SMMHC or the potent SMC/cardiac myocyte-specific transcriptional activator myocardin in 10T1/2 cells. Thus the 10T1/2 system may be a model of myofibroblast activation rather than true SMC development.

In summary, there is a lack of direct evidence that TGF-{beta} signaling contributes to differentiation of SMCs during embryonic development. Moreover, previous studies have relied on model systems that may not recapitulate normal developmental control processes in that they used cells already predetermined to particular cell fates rather than pluripotential embryonic stem cells (ESCs). Finally, of critical importance, cells derived in most of these experiments have not been shown to possess any contractile activity—a hallmark of mature SMCs. Although a recent study examining TGF-{beta}1-stimulated Monc-1 cells did document a change in the morphology of some cells in response to carbachol (8), the extent and nature of this change have not been fully investigated. Indeed, a limitation of many in vitro models of SMC development is that contractile ability of the resultant cells has not been clearly established, and it is conceivable that in these systems only a subset of the developmental programs required for the formation of SMC lineage are activated.

The focus of the present studies was to directly investigate the role of TGF-{beta} in SMC development with an ESC-embryoid body (EB) model of early SMC lineage development previously described by Drab and colleagues (11) wherein cells develop full contractile capabilities. This system is particularly intriguing because it is derived from aggregates of differentiating ESCs, which recapitulate many of the events of early embryonic development including development of mesoderm, the visceral yolk sac, and blood islands. The ESC-EB model also recreates the multiple cell types and the heterotypic cell-cell and cell-matrix interactions that occur in the developing embryo and thus may represent a more "physiological" system in which to study SMC development. Of interest, results of the present studies show that SM-specific gene expression was downregulated by a soluble truncated TGF-{beta} type II receptor, an anti-TGF-{beta}1 antibody, or small interfering (si)RNAs directed against Smad2 or Smad3, indicating that endogenous TGF-{beta}1 signaling through Smad2 and Smad3 plays an important role in the development of SMCs from totipotential ESCs.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Formation and culture of ESC-EBs. Generation of ESC-EBs and SMC differentiation were based on the protocol described by Drab et. al. (11) with some modifications. D3 ESCs were cultured on mitotically inactivated mouse embryonic fibroblasts in Dulbecco's modified Eagle's medium (DMEM) supplemented with 15% fetal bovine serum (GIBCO, Gaithersburg, MD), L-glutamine, 110 µM {beta}-mercaptoethanol, pyruvate, nonessential amino acids, penicillin-streptomycin, and 1,000 U/ml leukemia inhibitory factor (LIF; Chemicon, Temecula, CA). To generate ESC-EBs, ESCs were trypsinized and aggregated in hanging drops (800 cells per 10-µl drop) for 72 h and then cultured in suspension for a further 3 days in ESC-EB medium (similar to ESC medium but with 20% serum, minus LIF and {beta}-mercaptoethanol). On day 6, the ESC-EBs were plated onto 0.1% porcine gelatin (Sigma, St. Louis, MO)-coated surfaces and allowed to attach for 24 h. On days 7, 8, and 9, the ESC-EB medium was supplemented with 10 nM all-trans retinoic acid (atRA; Sigma) and 0.5 mM dibutyryl adenosine 3',5'-cyclic monophosphate (DBcAMP; Roche, Indianapolis, IN). Medium was changed on a daily basis.

RNA extraction and RT-PCR. RNA was extracted from ESC-EBs at a variety of time points with TRIzol (GIBCO), and the manufacturer's instructions were followed. Reverse transcription was carried out on 1 µg of total RNA. Quantitative real-time PCR was performed with Taqman chemistry probes and an iCycler (Bio-Rad). Sequences for all primers and probes (Integrated DNA Technologies, Coralville, IA) were as follows: SM{alpha}A forward CGCTGTCAGGAACCCTGAGA, reverse CGAAGCCGGCCTTACAGA, probe CAGCACAGCCCTGGTGTGCGAC; SMMHC forward TGGACACCATGTCAGGGAAA, reverse ATGGACACAAGTGCTAAGCAGTCT, probe AGAACACTAAACGACAGCAGAGCCCAGC; 18S forward CGGCTACCACATCCAAGGAA, reverse AGCTGGAATTACCGCGGC, probe TGCTGGCACCAGACTTGCCCTC; glyceraldehyde 3-phosphate dehydrogenase (GAPDH) forward ggctcatgaccacagtccat, reverse gcctgcttcaccaccttct, probe cctggagaaacctgccaagtatgatgac; platelet endothelial cell adhesion molecule-1 [PECAM-1; amplification assessed by SYBR Green (Molecular Probes, Eugene, OR) incorporation with no probe] forward cttgagcctcaccaagctct, reverse actctcgcaatccaggaatc. Conventional PCR was carried out with the following primers for semiquantitative assessment of the SM1 and SM2 isoforms of SMMHC: SMMHC forward AGGAAACACCAAGGTCAAGCA, reverse CCCTGACATAGTGTCCAACTG (36 cycles); SM22{alpha} forward tccagtccacaaacgaccaagc, reverse gaattgagccacctgttccatctg (25 cycles); myocardin forward AAACCAGGCCCCCTCCC, reverse CGGATTCGAAGCTGTTGTCTT, 34 cycles; smoothelin-B forward tcagaggcttctccaacactaagag, reverse ttggctctcgatttggggttggttg (27 cycles); GAPDH forward TCTTCACCACCATGGAGAAGG, reverse GTTGTCATGGATGACCTTGGCC (22 cycles).

Immunocytochemistry. EBs were fixed with 4% paraformaldehyde for 10 min and then washed with phosphate-buffered saline, air dried, and stored at –80°C until required for immunocytochemistry. Specimens were then rehydrated, pretreated with 0.6% H2O2 in methanol and 0.5% Triton X-100, and blocked with 3% BSA-3% normal horse, sheep, or goat serum (Jackson, West Grove, PA). Primary antibodies were anti-chicken SMMHC (12), a rabbit anti-serum used at 1:2,000 dilution; anti-SM{alpha}A (clone 1A4; Sigma), a monoclonal antibody used at 1:5,000 dilution; and anti-PECAM-1 (Santa Cruz Biotechnology, Santa Cruz, CA), a goat polyclonal antibody used at 1:500 dilution. Negative controls were performed with appropriate nonimmune serum or pooled immunoglobulins (Igs; Jackson). Detection was performed either with a fluorescence-labeled secondary antibody (Jackson) or with the avidin-biotin complex (ABC) Elite detection kit (Vector Laboratories, Burlingame, CA) and diaminobenzidine as the substrate.

Generation of adenoviruses and inhibition of TGF-{beta} signaling. Recombinant adenoviruses Ad5-RIIs and Ad5-lacZ were generated as previously described (18). Ad5-RIIs contains a truncated human TGF-{beta} type II receptor cDNA under the transcriptional control of the major immediate-early human cytomegalovirus (CMV) enhancer/promoter (MIEhCMV –700 to +50). Ad5-lacZ contains the cDNA for Escherichia coli {beta}-galactosidase under control of MIEhCMV. Stocks were purified by cesium chloride gradient centrifugation and titered by serial dilution end point assay. Viruses were added to ESC-EB culture medium at a concentration of 3 x 106 pfu/ml on days 10, 13, 17, 21, and 25. Specific inhibition of TGF-{beta}1 was achieved by supplementing ESC-EB medium daily from day 10 to day 28 with an isoform-specific antibody (R&D, Minneapolis, MN) or a nonimmune IgG control at 0.5 µg/ml. All experiments were carried out at least three times. ESC-EBs in all experiments were harvested for RNA on day 28.

siRNA generation, transfection, and reporter expression. Plasmids expressing siRNAs to Smad2, Smad3, a scrambled control, and an empty vector control were generated as previously described (35). Plasmids encoding the siRNAs were cotransfected into differentiating ESC-EBs along with a SM{alpha}A or SMMHC promoter-luciferase reporter construct and a CMV-Renilla luciferase construct (Promega, Madison, WI) to normalize for transfection efficiency. FuGENE 6 (Roche) was used for transfection in accordance with the manufacturer's protocol. Cell lysates were harvested with Reporter lysis buffer (Promega) and a freeze-thaw step. Luciferase activity was measured with a luciferase assay system (Promega) and corrected for Renilla luciferase activity as detected with 270 nM coelenterazine (Biosynth, Naperville, IL). All experiments were carried out in triplicate and repeated at least three times.

Smad immunoblotting. COS-7 cells were cotransfected with an expression vector for Smad2 or Smad3 and a plasmid expressing siRNAs to Smad2, Smad3, a scrambled control, or an empty vector control. Cell lysate was harvested 72 h after transfection with a modified radioimmunoprecipitation buffer (150 mM NaCl, 50 mM Tris·HCl pH 8.0, 1% NP-40, 0.5% deoxycholate, and 2 mM EDTA) with complete EDTA-free protease inhibitor cocktail (Roche). Protein concentration was measured with a bicinchoninic acid (BCA) protein assay kit (Pierce, Rockford, IL), and 10 µg of protein was denatured and run on a 10% SDS polyacrylamide gel. The protein was blotted onto a polyvinylidene difluoride (PVDF) membrane and blocked with 4% nonfat milk. Primary antibodies directed against Smad2 or Smad3 (Upstate, Waltham, MA) were applied at 1:1,000 dilution, and an anti-rabbit-horseradish peroxidase secondary was used at 1:3,000. The blot was visualized with an enhanced chemiluminescence kit (Amersham Biosciences, Piscataway, NJ) according to the manufacturer's guidelines.

Statistical analysis. Quantitative data on mRNA expression levels were compared with unpaired t-tests. Luciferase activity in multiple groups was compared with ANOVA. A probability value of P < 0.05 was selected as significant for all tests.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Contractile SMCs develop from ESCs in differentiating ESC-EBs and express adult isoform of SMMHC, SM2. Drab et al. (11) previously reported the development of spontaneously contractile SMCs in ESC-EBs that predominantly expressed an isoform of SMMHC that contains a seven-amino acid insert in the myosin head and is associated with the vasculature—SMMHC-A. However, they did not report on splice variants at the 3' end of SMMHC that are important markers of the stage of SMC development because the SM1 isoform is detected throughout development whereas the SM2 isoform is predominantly found in postnatal tissues (1, 4). Moreover, the SM2 isoform is rapidly downregulated in cultured SMCs (36), highlighting its role as a marker of mature contractile SM. Thus our initial aim was to establish whether the SM2 isoform of SMMHC is expressed in association with contractile cells in differentiating ESC-EBs.

Plating of ESC-EBs on a gelatin-coated surface and treatment with atRA and DBcAMP led to an extensive outgrowth from the central cellular aggregate (Fig. 1A). The ESC-EBs were harvested and fixed at day 15 and day 28. Multiple cell types were detected throughout the outgrowth with immunocytochemistry, including SMCs (Fig. 1, B and C) and ECs (Fig. 1D). No overt vascular structures were seen, but the ECs formed a primitive, poorly organized vascular plexus at day 15. Immunocytochemical analyses showed numerous SM{alpha}A-positive cells at both time points, whereas numerous SMMHC-positive cells were detected at day 28. Negative controls carried out by substituting nonimmune serum or pooled Igs for primary antibodies did not result in a signal (data not shown). SMCs were distributed sparsely throughout much of the ESC-EB outgrowth and occasionally as dense aggregates (Fig. 2C). The SM2 isoform, found predominantly in postnatal SM-containing tissues (1, 4, 36), was detected with RT-PCR on RNA extracted from the whole ESC-EBs at day 28 (Fig. 1E). Thus the presence of this isoform of SMMHC is indicative of the development of mature contractile SMCs within the ESC-EBs. In addition, the expression of several other markers of SMC—SM22{alpha}, myocardin, and smoothelin-B—was detected by RT-PCR (Fig. 1F) and supported the conclusion that genuine SMCs developed in the ESC-EBs.



View larger version (66K):
[in this window]
[in a new window]
 
Fig. 1. Light microscopy, immunocytochemistry and RT-PCR analysis of differentiating embryonic stem cell (ESC)-derived-embryoid bodies (EBs). ESC aggregates were allowed to differentiate for 15 days (A, B, and D) or 28 days (C and E). A significant cellular outgrowth developed from the central aggregate once the ESC-EB was plated onto a gelatin-coated surface (A), and immunocytochemistry revealed staining for smooth muscle (SM) {alpha}-actin (SM{alpha}A; B), SM myosin heavy chain (SMMHC; C), and platelet-endothelial cell adhesion molecule-1 (PECAM-1; D). RT-PCR performed on total RNA extracted from ESC-EBs or mouse aorta revealed that expression of SMMHC, and in particular its SM2 isoform, was predominantly seen at late developmental stages (E). Expression of additional SMC-selective markers, SM22{alpha}, myocardin, and smoothelin B, was also detected in the ESC-EBs (F). Black bar, 500 µm; white bar, 15 µm. GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

 


View larger version (97K):
[in this window]
[in a new window]
 
Fig. 2. Still images and immunocytochemistry of day 28 ESC-EBs. Light microscopic images were captured 3 s apart from real-time video imaging. The ESC-EB was then fixed and immunostained for SMMHC. Red arrows show visible slow SM-like contraction in 1 region of the ESC-EB (A and B). The contraction is more clearly demonstrated by a real-time video of the contracting area (video may be viewed online as Supplementary Material for this article). Immunostaining of the same area for SMMHC confirmed the presence of several large SM cell (SMC) aggregates in the contractile region (C). Corresponding points in the video images (A and B) and in the SMMHC-immunostained image (C) are indicated by asterisks (*). Higher magnification of the box in C revealed multiple SMMHC-positive staining SMCs packed together in a dense structure (D). Bar in D, 100 µM.

 
The contractile ability of the ESC-derived SMCs was confirmed by the presence of focal areas of the ESC-EBs that exhibited visible slow SM-like contraction [once every 5–10 s; Fig. 2, A and B; see also supplemental video1 for this article (published online at the American Journal of Physiology-Cell Physiology web site)] that was clearly different from the rapid contraction (1–3 beats/s) displayed by areas containing developing cardiac myocytes. These focal areas of slow contraction stained positively for SMMHC (Fig. 2, C and D), confirming that the contraction was due to SMC aggregates rather than cardiac or skeletal muscle. Observations that ESC-EB-derived SMCs expressed multiple SMC markers, including substantial amounts of the SM2 isoform of SMMHC, and exhibited the ability to contract suggest that all the developmental programs and mechanisms required for the formation of mature, contractile SMCs are present and functional in the ESC-EB model.

Differential upregulation of SMCs and endothelial markers in ESC-EBs. Next, it was important to determine the time course of increase in SM-selective gene expression more accurately to carry out loss-of-function interventions at appropriate time points. Because immunocytochemistry and conventional RT-PCR are poorly quantitative, we used real-time RT-PCR to accurately quantify SM- and EC-selective gene expression over a range of time points during development of SMCs within the ESC-EB system. SMC markers were expressed at very low levels during early development in the ESC-EBs and increased significantly from day 10 onward (Fig. 3). Interestingly, the greatest increase in SM{alpha}A occurred between day 10 and day 15 (Fig. 3A), whereas SMMHC expression increased later, between day 15 and day 28 (Fig. 3B). This difference in temporal expression pattern between SM{alpha}A and SMMHC is reminiscent of the time course of expression seen in vivo in the developing embryo.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 3. Temporal analysis of gene expression in differentiating ESC-EBs by real-time RT-PCR. Total RNA was extracted from ESC-EBs at the indicated times, and SM- and endothelial cell (EC)-specific gene expression was quantified. Maximal increase in SM{alpha}A expression was seen between day 10 and day 15 (A), whereas SMMHC was maximally upregulated later, between day 15 and day 28 (B). PECAM-1 mRNA expression was used as a marker of ECs and was elevated in poorly differentiated cells at day 2, decreased by day 7 once the cells had begun to differentiate, and then increased again by day 10, indicating development of ECs at this time point (C).

 
In vivo, ECs develop before SMCs and are dependent for full function on TGF-{beta} signaling. Indeed, early blockade of TGF-{beta} in ESC-EBs leads to inhibition of EC formation (13). Furthermore, previous in vitro studies suggested that an interaction between SMC progenitors and ECs is important for SMC differentiation (16). Thus, to examine the effects of TGF-{beta} signaling specifically on SMC development, it was important to choose a time point at which ECs have already developed so that the observed effects on SMCs are primary rather than secondary to disruption of EC development. Real-time RT-PCR analysis for PECAM-1, an early EC marker (2), revealed that, as previously reported (29), it was present in poorly differentiated cells, downregulated as differentiation proceeded, but then upregulated between day 7 and day 10 as ECs developed (Fig. 3C). Because most of the increase in SMC-specific markers occurs after day 10 (when EC marker expression has already peaked), it seemed reasonable to interfere with TGF-{beta} signaling from day 10 onward in ESC-EBs to maximize the effect on SMC differentiation while minimizing effects on EC development.

Endogenous TGF-{beta}1 signaling is required for SMC-specific gene expression in ESC-EBs. To directly test the role of endogenous TGF-{beta} signaling in differentiation of SMCs within the ESC-EB system, cells were infected with Ad5-RIIs, a recombinant adenovirus that expresses a soluble TGF-{beta} type II receptor that has been shown to efficiently inhibit TGF-{beta} signaling in vivo and in vitro (18). Effects on expression of SMC marker genes were measured with real-time RT-PCR in the Ad5-RIIs treatment group vs. a control group treated with Ad5-LacZ, a control virus expressing {beta}-galactosidase, at equivalent multiplicity of infection. Inhibition of TGF-{beta} signaling downregulated SM{alpha}A and SMMHC mRNA expression in the ESC-EBs (Fig. 4). These results suggested that endogenous TGF-{beta} signaling was required for SMC-specific gene expression during the development of SMCs from ESCs. A limitation of this experiment was that the soluble TGF-{beta} type II receptor does not distinguish effectively between the TGF-{beta}1 and TGF-{beta}3 isoforms. However, because data on whole animal knockout models implicate the TGF-{beta}1 isoform as potentially required for SMC development, we used an anti-TGF-{beta}1 antibody to specifically inhibit this isoform in the ESC-EBs. Treatment of developing ESC-EBs with the anti-TGF-{beta}1 antibody also reduced SMC-specific gene expression compared with a nonimmune IgG control (Fig. 5). Thus SMC development in this system appears to be mediated, at least in part, by TGF-{beta}1 isoform signaling through the type II receptor.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 4. Effect of a soluble truncated transforming growth factor (TGF)-{beta} type II receptor on SM-specific gene expression in ESC-EBs. Endogenous TGF-{beta} signaling was downregulated in differentiating ESC-EBs from day 10 to day 28 with an adenovirus-expressed soluble TGF-{beta} type II receptor (Ad5-RIIs) and compared with a {beta}-galactosidase-expressing control virus (Ad5-LacZ). SM{alpha}A (A) or SMMHC (B) mRNA was quantified in day 28 ESC-EBs by real-time RT-PCR. Downregulation of endogenous TGF-{beta} signaling resulted in a decrease in the expression of SMC marker genes. Results are displayed as means ± SE. *P < 0.01; #P = not significant (NS).

 


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 5. SM-specific gene expression in ESC-EBs after TGF-{beta}1 inhibition. Endogenous TGF-{beta}1 was inhibited in differentiating ESC-EBs with a neutralizing antibody from day 10 to day 28. SM-specific gene expression was measured by real-time RT-PCR at day 28. Inhibition of TGF-{beta}1 signaling decreased SM{alpha}A (A) and SMMHC (B) expression compared with a matched nonimmune immunoglobulin (Ig)G control. Results are displayed as means ± SE. *P < 0.01; #P = NS.

 
Inhibition of endogenous TGF-{beta}1 signaling results in downregulation of SM{alpha}A expression in individual SMCs in ESC-EBs. Inhibition of endogenous TGF-{beta}1 signaling appeared to decrease SM-specific gene expression in the ESC-EB system. However, because the RNA for these studies was extracted from intact ESC-EBs, a heterogeneous mixture of multiple cell types, it was unclear whether the decrease in SMC marker gene expression was due to reduced gene expression in each SMC or, alternatively, to a reduction in the fraction of SMCs within the ESC-EBs. To assess the level of SMC markers in individual cells, ESC-EBs were treated with either anti-TGF-{beta}1 antibody or IgG control from day 10 onward and were fixed for immunofluorescence studies at day 28. Although sheets of SMC formed in both groups, a reduction in SMC staining intensity for SM{alpha}A was detected in the anti-TGF-{beta}1 antibody-treated group (Fig. 6A) compared with the IgG control-treated group (Fig. 6B). This reduction in SM{alpha}A immunofluorescence with antibody treatment suggested that at least some of the reduction in SMC marker gene expression found in the previous quantitative RT-PCR studies was due to a reduction in gene expression in individual SMCs.



View larger version (138K):
[in this window]
[in a new window]
 
Fig. 6. Effect of TGF-{beta}1 inhibition on SM{alpha}A immunofluorescence in ESC-EBs. Endogenous TGF-{beta}1 was inhibited in differentiating ESC-EBs with a neutralizing antibody from day 10 to day 28. SM{alpha}A expression in SMC sheets in the ESC-EB, assessed by indirect immunofluorescence, was reduced in the anti-TGF-{beta}1 antibody group (B) compared with the IgG-treated control group (A). Corresponding bright-field images (C and D) are displayed below the immunofluorescent images to highlight the continuous nature of the SMC sheets. Bar, 15 µm.

 
TGF-{beta} induces SMC-specific gene expression through a Smad2- and a Smad3-dependent mechanism. To further test the role of TGF-{beta} signaling in derivation of SMCs from ESCs, and as a first step in dissecting out the signaling pathways involved, we determined the effects of Smad2 or Smad3 knockdown on SMC differentiation in differentiating ESC-EBs. These studies focused on Smad2 and Smad3 because these are the known targets of the TGF-{beta} type I receptor (23) and have been implicated in the response to TGF-{beta}1 in SMCs (17) or in the expression of SM-specific genes in myofibroblasts (7). The studies used a novel siRNA expression plasmid system developed in our laboratory in which expression of the siRNA is driven by a minimal mouse H1 promoter (35).

The efficacy and specificity of the siRNA expression constructs were tested by coexpression of Smad2 or Smad3 with either the matching Smad siRNA expression vector or a variety of control constructs in COS-7 cells. Immunoblotting studies showed that the siRNA directed against Smad2 was highly effective and almost completely abolished Smad2 protein expression in cells cotransfected with a Smad2 expression vector (Fig. 7A). Moreover, no significant effect was seen on Smad3 expression (Fig. 7B), confirming the specific nature of the Smad2-targeted siRNA. The siRNA expression construct directed against Smad3 was also effective and significantly downregulated but did not completely abrogate expression of the target gene (Fig. 7B). Interestingly, Smad3-targeted siRNAs also appeared to have a minor effect on Smad2 expression (Fig. 7A). The gene-specific nature of suppression induced by our siRNA expression plasmids was further confirmed by comparing results with a scrambled control siRNA or an empty vector control. These control constructs had no effect on Smad expression.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 7. Small interfering (si)RNA-mediated inhibition of endogenous Smad signaling in differentiating ESC-EBs. Smad2 (A) or Smad3 (B) was coexpressed in COS-7 cells with vectors expressing siRNAs directed against Smad2 (siSmad2), Smad3 (siSmad3), scrambled control (siScrambled), or empty vector (siEmpty). Immunoblotting was performed to determine efficiency of Smad downregulation by the siRNA-expressing constructs. siSmad2 was highly effective against Smad2 and demonstrated high specificity, whereas siSmad3 was moderately effective in reducing Smad3 levels. The siRNA-expressing constructs that expressed siRNAs were then cotransfected with SM{alpha}A (C) or SMMHC (D) promoters coupled to luciferase in differentiating day 15 ESC-EBs. Scrambled siRNA or empty vector groups were used as negative controls. A cytomegalovirus (CMV)-Renilla luciferase-expressing plasmid was also cotransfected to correct for transfection efficiency. SM{alpha}A promoter expression was dependent on both Smad2 and Smad3 function, whereas SMMHC promoter activity was only dependent on Smad2. Results are representative of 4 experiments and are displayed as means ± SE. *P < 0.05, **P < 0.02 (by ANOVA).

 
Because the plasmids encoding the siRNAs can only be transfected into ESC-EBs at relatively low efficiencies, it was not possible to study the effects of each respective siRNA on endogenous SMC marker gene expression. Rather, studies involved cotransfection of various SMC-specific promoter-luciferase constructs with the various siRNA plasmids. Importantly, studies used SM{alpha}A and SMMHC promoter-enhancer-reporter constructs previously shown to recapitulate expression patterns of these genes in vivo in transgenic mice (21, 22). Results showed that siRNA-induced suppression of Smad2 dramatically reduced expression of SM{alpha}A (Fig. 7C) and SMMHC (Fig. 7D) promoter-reporter constructs in ESC-EB-derived SMCs at day 15 and similarly at day 28 (data not shown). In contrast, the Smad3 siRNA markedly suppressed SM{alpha}A promoter expression (Fig. 7C) but had no effect on expression of the SMMHC promoter (Fig. 7D). Together, these results provide further evidence of the importance of TGF-{beta} signaling pathways in differentiation of SMCs from ESCs but also provide very interesting evidence suggesting that different TGF-{beta} signaling pathways may contribute to induction of early (SM{alpha}A) vs. late (SMMHC) SMC markers.


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
A major confounding feature of in vivo knockout studies that have examined the role of TGF-{beta}1 signaling in vascular development is that embryonic death occurs at midgestation, before significant SMC development and maturation occur (6, 10, 20, 24, 25). The null embryos are severely growth retarded, edematous, and necrotic because of impaired yolk sac function. Consequently, it is unclear whether the observations in some studies that early SMC marker expression in the wall of the nascent dorsal aorta is reduced (20, 24) are due to a specific effect of loss of TGF-{beta}1 signaling or a nonspecific effect of growth retardation and necrosis. This study is the first to provide direct evidence, in a system in which contractile SMCs develop from totipotent ESCs, that decreased expression of SMC-specific markers is a specific effect of loss of TGF-{beta}1 signaling. The developmental processes in the ESC-EB system are not dependent on formation of a functional yolk sac vasculature, unlike the embryo, although SMCs still develop in an environment that approximates the developing embryo.

In this study, a surprising and significant finding was that expression of the SM{alpha}A promoter was dependent on both Smad2 and Smad3 signaling whereas expression of the more SMC-selective promoter, SMMHC, was only Smad2 dependent. This may be due to the differential signaling requirements of these two SMC markers during development. Indeed, it has been shown that Smad2 and Smad3 have widely differing roles in TGF-{beta}1 stimulation of embryonic fibroblasts (27). However, another possibility is that the SM{alpha}A expression detected in the present study was from a variety of cell types in addition to SMCs because other cells, which also develop in the ESC-EBs, are known to express this gene during development (26). Interestingly, Smad2 activation has been reported in response to TGF-{beta}1 in cultured SMCs (17). In addition, although a role for Smad2 in myofibroblast activation cannot be totally excluded (19), Smad3 has been identified by several groups as a key effector molecule in TGF-{beta}1-dependent activation of SM-specific genes in embryonic fibroblasts (7, 28). Accordingly, it is possible that the specific Smad2 dependence displayed by the SMMHC promoter, which is restricted to SMCs during development (22), is more representative of the signaling requirements in developing SMCs, whereas the dependence of the SM{alpha}A promoter on both Smad2 and Smad3 reflects signals from SMCs plus myofibroblasts or other muscle types. Further data supporting this conclusion come from knockout experiments in which mice that are null for Smad3 are born with a normal vasculature (9, 34). Together, the results suggest that Smad3 may not be required for SMC development/gene expression but rather for myofibroblast activation.

In this study, as in other studies on ESC-EBs (13), EC development was noted in a network that resembled a loose, early vascular plexus. However, no mature blood vessels were found to develop, and a consistent association between ECs and SMCs was not found. A variety of studies have suggested that proximity or contact of ECs is required for SMC precursors to develop into SMCs and that heterotypic cell-cell interactions are required to allow SMCs to mature and stabilize the endothelial network (16). In this study, although there was some overlap in the distribution of ECs and early SMCs, there was not a consistent association between these cell types, and in many cases there appeared to be significant numbers of SMCs in the absence of closely associated ECs. However, heterotypic cell-cell interactions were not examined in great detail, and it is possible that, given the nature of the ESC-EB, where multiple cell layers are stacked on top of each other, a small number of ECs may have been interspersed within the SMC clusters. Additionally, EC-SMC interactions may be transient in this system, rendering these associations difficult to document. Indeed, it is thought that hemodynamic forces are required to maintain endothelial stability in the vasculature (31), and it is possible that in their absence EC-SMC interactions are not stabilized or that ECs are lost through apoptosis. Consistent with this hypothesis, we found that PECAM-1 expression in the ESC-EB peaks at day 10 and then decreases steadily (Fig. 3C). Despite these uncertainties, the key issue is that the ESC-EBs create an environment in which mature, contractile SMCs develop, and that disruption of TGF-{beta}1 signaling within this system inhibited SMC differentiation. An additional inherent limitation of the published TGF-{beta}1 mouse knockout studies was that it was unclear whether the effects on SMCs were primary or secondary to loss of TGF-{beta}1 signaling in ECs. In the present study, we attempted to minimize perturbation of EC development and to selectively target SMC development by delaying inhibition of growth factor function until EC gene expression had peaked. However, it is not possible to be certain that EC or indeed other cell functions were not affected in any way and that the effects documented are indeed direct effects of TGF-{beta}1 on SMCs. Thus, although it is clear that endogenous TGF-{beta}1 signaling through at least Smad2 is required in the ESC-EBs for SMC development, further studies in which inhibition of TGF-{beta}1 signaling is restricted to SMCs are required to more clearly answer questions on cellular specificity. Transgenic mouse systems have been developed in which cre-recombinase is expressed solely in SMCs (30) and could be used to inactivate components of the TGF-{beta} signaling pathway in a SM-specific manner. This type of study would clarify whether activation of the TGF-{beta} signaling pathway specifically in SMCs is required for expression of SMC markers. However, because promoter-enhancers capable of directing DNA-modifying enzymes in a SMC-restricted manner are only expressed once the cell has already started differentiating, this system will only have utility for examining the late stages of differentiation-maturation and not the initial induction of SMC lineage in multipotential cells. To investigate earlier stages of the developmental process, interventions would need to be targeted to SMC progenitors. However, because these cells by definition do not express any SMC markers, it has not been possible to identify or specifically target this presumptive cell population to date.

The development of mature contractile SMCs from pluripotential precursors may be considered as a series of steps involving first a commitment to the SMC lineage, then differentiation into early immature SMCs, and finally maturation into the mature contractile phenotype (26). Which of these steps are regulated by TGF-{beta}1? In previous studies (8, 15, 32) TGF-{beta}1 promoted the development of an early SM-like cell from neural crest cells or 10T1/2 cells, suggesting a role for the growth factor in both the commitment and early differentiation steps. However, it remains unclear whether TGF-{beta}1 signaling is required for commitment and early differentiation of SMCs in vivo in the embryo. In the present study, TGF-{beta}1 signaling was disrupted from day 10 onward, a time at which SM{alpha}A expression had begun to increase but SMMHC expression remained low (Fig. 3, A and B). Thus it is likely that commitment to the SMC lineage had already occurred and the major effect of our loss-of-function interventions was on the maturation process and possibly on early differentiation.

The ESC-EB system recapitulates many of the events of early embryonic development. Multiple cell types are obtained, allowing for the heterotypic cell-cell and cell-matrix interactions that are characteristic of key developmental events in vivo. The generation of multiple cell types is a strength of this system in that it recreates some of the cell-cell interactions and environmental cues present in the developing embryo. However, there are also significant limitations of the ESC-EB system in that such multiplicity of cell types renders results derived from this system more difficult to interpret because information from the cell type of interest is measured on a background of other cell types. Nevertheless, the present studies emphasize the power of the ESC-EB model for dissecting out developmental mechanisms that will be greatly enhanced by the use of transgenic and/or null ESC lines for such experiments in the future.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by National Heart, Lung, and Blood Institute Grants HL-R01-HL-38854, R37-HL-57353, and P01-HL-19242 (to G. K. Owens) and American Heart Association Post-Doctoral Fellowship Grant 0120501U (to S. Sinha).


    ACKNOWLEDGMENTS
 
We are grateful to Rupande Tripathi for excellent technical assistance.


    FOOTNOTES
 

Address for reprint requests and other correspondence: G. K. Owens, Dept. of Molecular Physiology and Biological Physics, Univ. of Virginia, 415 Lane Rd., MR5, Rm. 1220, PO Box 801394, Charlottesville, VA 22908 (E-mail: gko{at}virginia.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supplemental material for this article is available online at http://ajpcell.physiology.org/cgi/content/full/00221.2004/DC1. Back


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Aikawa M, Sivam PN, Kuro-o M, Kimura K, Nakahara K, Takewaki S, Ueda M, Yamaguchi H, Yazaki Y, and Periasamy M. Human smooth muscle myosin heavy chain isoforms as molecular markers for vascular development and atherosclerosis. Circ Res 73: 1000–1012, 1993.[Abstract/Free Full Text]

2. Baldwin HS, Shen HM, Yan HC, DeLisser HM, Chung A, Mickanin C, Trask T, Kirschbaum NE, Newman PJ, Albelda SM, and Buck CA. Platelet endothelial cell adhesion molecule-1 (PECAM-1/CD31): alternatively spliced, functionally distinct isoforms expressed during mammalian cardiovascular development. Development 120: 2539–2553, 1994.[Abstract/Free Full Text]

3. Bjorkerud S. Effects of transforming growth factor-beta 1 on human arterial smooth muscle cells in vitro. Arterioscler Thromb 11: 892–902, 1991.[Abstract/Free Full Text]

4. Borrione AC, Zanellato AM, Scannapieco G, Pauletto P, and Sartore S. Myosin heavy-chain isoforms in adult and developing rabbit vascular smooth muscle. Eur J Biochem 183: 413–417, 1989.[Web of Science][Medline]

5. Bourdeau A, Dumont DJ, and Letarte M. A murine model of hereditary hemorrhagic telangiectasia. J Clin Invest 104: 1343–1351, 1999.[Web of Science][Medline]

6. Chang H, Huylebroeck D, Verschueren K, Guo Q, Matzuk MM, and Zwijsen A. Smad5 knockout mice die at mid-gestation due to multiple embryonic and extraembryonic defects. Development 126: 1631–1642, 1999.[Abstract]

7. Chen S, Kulik M, and Lechleider RJ. Smad proteins regulate transcriptional induction of the SM22{alpha} gene by TGF-{beta}. Nucleic Acids Res 31: 1302–1310, 2003.[Abstract/Free Full Text]

8. Chen S and Lechleider RJ. Transforming growth factor-{beta}-induced differentiation of smooth muscle from a neural crest stem cell line. Circ Res 94: 1195–1202, 2004.[Abstract/Free Full Text]

9. Datto MB, Frederick JP, Pan L, Borton AJ, Zhuang Y, and Wang XF. Targeted disruption of Smad3 reveals an essential role in transforming growth factor {beta}-mediated signal transduction. Mol Cell Biol 19: 2495–2504, 1999.[Abstract/Free Full Text]

10. Dickson MC, Martin JS, Cousins FM, Kulkarni AB, Karlsson S, and Akhurst RJ. Defective haematopoiesis and vasculogenesis in transforming growth factor-beta 1 knock out mice. Development 121: 1845–1854, 1995.[Abstract]

11. Drab M, Haller H, Bychkov R, Erdmann B, Lindschau C, Haase H, Morano I, Luft FC, and Wobus AM. From totipotent embryonic stem cells to spontaneously contracting smooth muscle cells: a retinoic acid and db-cAMP in vitro differentiation model. FASEB J 11: 905–915, 1997.[Abstract]

12. Groschel-Stewart U, Schreiber J, and Mahlmeister C. Production of specific antibodies to contractile proteins, and their use in immunofluorescence microscopy. I. Antibodies to smooth and striated chicken muscle myosins. Histochemistry 46: 229–236, 1976.[CrossRef][Web of Science][Medline]

13. Gualandris A, Annes JP, Arese M, Noguera I, Jurukovski V, and Rifkin DB. The latent transforming growth factor-{beta}-binding protein-1 promotes in vitro differentiation of embryonic stem cells into endothelium. Mol Biol Cell 11: 4295–4308, 2000.[Abstract/Free Full Text]

14. Hautmann MB, Madsen CS, and Owens GK. A transforming growth factor {beta} (TGF{beta}) control element drives TGF{beta}-induced stimulation of smooth muscle {alpha}-actin gene expression in concert with two CArG elements. J Biol Chem 272: 10948–10956, 1997.[Abstract/Free Full Text]

15. Hirschi KK, Rohovsky SA, and D'Amore PA. PDGF, TGF-{beta}, and heterotypic cell-cell interactions mediate endothelial cell-induced recruitment of 10T1/2 cells and their differentiation to a smooth muscle fate. J Cell Biol 141: 805–814, 1998.[Abstract/Free Full Text]

16. Jain RK. Molecular regulation of vessel maturation. Nat Med 9: 685–693, 2003.[CrossRef][Web of Science][Medline]

17. Kato S, Ueda S, Tamaki K, Fujii M, Miyazono K, ten Dijke P, Morimatsu M, and Okuda S. Ectopic expression of Smad7 inhibits transforming growth factor-beta responses in vascular smooth muscle cells. Life Sci 69: 2641–2652, 2001.[CrossRef][Web of Science][Medline]

18. Kingston PA, Sinha S, David A, Castro MG, Lowenstein PR, and Heagerty AM. Adenovirus-mediated gene transfer of a secreted transforming growth factor-{beta} type II receptor inhibits luminal loss and constrictive remodeling after coronary angioplasty and enhances adventitial collagen deposition. Circulation 104: 2595–2601, 2001.[Abstract/Free Full Text]

19. Lan HY, Mu W, Tomita N, Huang XR, Li JH, Zhu HJ, Morishita R, and Johnson RJ. Inhibition of renal fibrosis by gene transfer of inducible Smad7 using ultrasound-microbubble system in rat UUO model. J Am Soc Nephrol 14: 1535–1548, 2003.[Abstract/Free Full Text]

20. Li DY, Sorensen LK, Brooke BS, Urness LD, Davis EC, Taylor DG, Boak BB, and Wendel DP. Defective angiogenesis in mice lacking endoglin. Science 284: 1534–1537, 1999.[Abstract/Free Full Text]

21. Mack CP and Owens GK. Regulation of smooth muscle {alpha}-actin expression in vivo is dependent on CArG elements within the 5' and first intron promoter regions. Circ Res 84: 852–861, 1999.[Abstract/Free Full Text]

22. Madsen CS, Regan CP, Hungerford JE, White SL, Manabe I, and Owens GK. Smooth muscle-specific expression of the smooth muscle myosin heavy chain gene in transgenic mice requires 5'-flanking and first intronic DNA sequence. Circ Res 82: 908–917, 1998.[Abstract/Free Full Text]

23. Massague J and Chen YG. Controlling TGF-{beta} signaling. Genes Dev 14: 627–644, 2000.[Free Full Text]

24. Oh SP, Seki T, Goss KA, Imamura T, Yi Y, Donahoe PK, Li L, Miyazono K, ten Dijke P, Kim S, and Li E. Activin receptor-like kinase 1 modulates transforming growth factor-{beta}1 signaling in the regulation of angiogenesis. Proc Natl Acad Sci USA 97: 2626–2631, 2000.[Abstract/Free Full Text]

25. Oshima M, Oshima H, and Taketo MM. TGF-{beta} receptor type II deficiency results in defects of yolk sac hematopoiesis and vasculogenesis. Dev Biol 179: 297–302, 1996.[CrossRef][Web of Science][Medline]

26. Owens GK. Regulation of differentiation of vascular smooth muscle cells. Physiol Rev 75: 487–517, 1995.[Abstract/Free Full Text]

27. Piek E, Ju WJ, Heyer J, Escalante-Alcalde D, Stewart CL, Weinstein M, Deng C, Kucherlapati R, Bottinger EP, and Roberts AB. Functional characterization of transforming growth factor {beta} signaling in Smad2- and Smad3-deficient fibroblasts. J Biol Chem 276: 19945–19953, 2001.[Abstract/Free Full Text]

28. Qiu P, Feng XH, and Li L. Interaction of Smad3 and SRF-associated complex mediates TGF-{beta}1 signals to regulate SM22 transcription during myofibroblast differentiation. J Mol Cell Cardiol 35: 1407–1420, 2003.[CrossRef][Web of Science][Medline]

29. Redick SD and Bautch VL. Developmental platelet endothelial cell adhesion molecule expression suggests multiple roles for a vascular adhesion molecule. Am J Pathol 154: 1137–1147, 1999.[Abstract/Free Full Text]

30. Regan CP, Manabe I, and Owens GK. Development of a smooth muscle-targeted cre recombinase mouse reveals novel insights regarding smooth muscle myosin heavy chain promoter regulation. Circ Res 87: 363–369, 2000.[Abstract/Free Full Text]

31. Resnick N, Yahav H, Shay-Salit A, Shushy M, Schubert S, Zilberman LC, and Wofovitz E. Fluid shear stress and the vascular endothelium: for better and for worse. Prog Biophys Mol Biol 81: 177–199, 2003.[CrossRef][Web of Science][Medline]

32. Shah NM, Groves AK, and Anderson DJ. Alternative neural crest cell fates are instructively promoted by TGFbeta superfamily members. Cell 85: 331–343, 1996.[CrossRef][Web of Science][Medline]

33. Urness LD, Sorensen LK, and Li DY. Arteriovenous malformations in mice lacking activin receptor-like kinase-1. Nat Genet 26: 328–331, 2000.[CrossRef][Web of Science][Medline]

34. Yang X, Letterio JJ, Lechleider RJ, Chen L, Hayman R, Gu H, Roberts AB, and Deng C. Targeted disruption of SMAD3 results in impaired mucosal immunity and diminished T cell responsiveness to TGF-beta. EMBO J 18: 1280–1291, 1999.[CrossRef][Web of Science][Medline]

35. Yoshida T, Sinha S, Dandre F, Wamhoff BR, Hoofnagle MH, Kremer BE, Wang DZ, Olson EN, and Owens GK. Myocardin is a key regulator of CArG-dependent transcription of multiple smooth muscle marker genes. Circ Res 92: 856–864, 2003.[Abstract/Free Full Text]

36. Zanellato AM, Borrione AC, Giuriato L, Tonello M, Scannapieco G, Pauletto P, and Sartore S. Myosin isoforms and cell heterogeneity in vascular smooth muscle. I. Developing and adult bovine aorta. Dev Biol 141: 431–446, 1990.[CrossRef][Web of Science][Medline]




This article has been cited by other articles:


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
K. Kawai-Kowase, T. Ohshima, H. Matsui, T. Tanaka, T. Shimizu, T. Iso, M. Arai, G. K. Owens, and M. Kurabayashi
PIAS1 Mediates TGF{beta}-Induced SM {alpha}-Actin Gene Expression Through Inhibition of KLF4 Function-Expression by Protein Sumoylation
Arterioscler Thromb Vasc Biol, January 1, 2009; 29(1): 99 - 106.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
R. L. Sayers, L. J. Sundberg-Smith, M. Rojas, H. Hayasaka, J. T. Parsons, C. P. Mack, and J. M. Taylor
FRNK Expression Promotes Smooth Muscle Cell Maturation During Vascular Development and After Vascular Injury
Arterioscler Thromb Vasc Biol, December 1, 2008; 28(12): 2115 - 2122.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
Y. Shang, T. Yoshida, B. A. Amendt, J. F. Martin, and G. K. Owens
Pitx2 is functionally important in the early stages of vascular smooth muscle cell differentiation
J. Cell Biol., October 14, 2008; 181(3): 461 - 473.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
J. Y. Liu, H. F. Peng, and S. T. Andreadis
Contractile smooth muscle cells derived from hair-follicle stem cells
Cardiovasc Res, July 1, 2008; 79(1): 24 - 33.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
L. J. Sundberg-Smith, L. A. DiMichele, R. L. Sayers, C. P. Mack, and J. M. Taylor
The LIM Protein Leupaxin Is Enriched in Smooth Muscle and Functions As an Serum Response Factor Cofactor to Induce Smooth Muscle Cell Gene Transcription
Circ. Res., June 20, 2008; 102(12): 1502 - 1511.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
H. Yu, M. Konigshoff, A. Jayachandran, D. Handley, W. Seeger, N. Kaminski, and O. Eickelberg
Transgelin is a direct target of TGF-{beta}/Smad3-dependent epithelial cell migration in lung fibrosis
FASEB J, June 1, 2008; 22(6): 1778 - 1789.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
K. M. Kolodziejska, M.H. Noyan-Ashraf, A. Nagy, A. Bacon, J. Frampton, H.-B. Xin, M. I. Kotlikoff, and M. Husain
c-Myb-Dependent Smooth Muscle Cell Differentiation
Circ. Res., March 14, 2008; 102(5): 554 - 561.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
C.-Q. Xie, J. Zhang, L. Villacorta, T. Cui, H. Huang, and Y. E. Chen
A Highly Efficient Method to Differentiate Smooth Muscle Cells From Human Embryonic Stem Cells
Arterioscler Thromb Vasc Biol, December 1, 2007; 27(12): e311 - e312.
[Full Text] [PDF]


Home page
Circ. Res.Home page
B. P. Herring and J. Zhou
mCAT Got YouR TEF?
Circ. Res., October 26, 2007; 101(9): 856 - 858.
[Full Text] [PDF]


Home page
Cardiovasc ResHome page
Y. Yao, A. F. Zebboudj, A. Torres, E. Shao, and K. Bostrom
Activin-like kinase receptor 1 (ALK1) in atherosclerotic lesions and vascular mesenchymal cells
Cardiovasc Res, May 1, 2007; 74(2): 279 - 289.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
Q. Xiao, L. Zeng, Z. Zhang, Y. Hu, and Q. Xu
Stem cell-derived Sca-1+ progenitors differentiate into smooth muscle cells, which is mediated by collagen IV-integrin {alpha}1/beta1/{alpha}v and PDGF receptor pathways
Am J Physiol Cell Physiol, January 1, 2007; 292(1): C342 - C352.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
E. S. Jeon, H. J. Moon, M. J. Lee, H. Y. Song, Y. M. Kim, Y. C. Bae, J. S. Jung, and J. H. Kim
Sphingosylphosphorylcholine induces differentiation of human mesenchymal stem cells into smooth-muscle-like cells through a TGF-{beta}-dependent mechanism
J. Cell Sci., December 1, 2006; 119(23): 4994 - 5005.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
B. R. Wamhoff, D. K. Bowles, and G. K. Owens
Excitation-Transcription Coupling in Arterial Smooth Muscle
Circ. Res., April 14, 2006; 98(7): 868 - 878.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
A. M. Goldsmith, J. K. Bentley, L. Zhou, Y. Jia, K. N. Bitar, D. C. Fingar, and M. B. Hershenson
Transforming Growth Factor-beta Induces Airway Smooth Muscle Hypertrophy
Am. J. Respir. Cell Mol. Biol., February 1, 2006; 34(2): 247 - 254.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
D. Vernet, G. Nolazco, L. Cantini, T. R. Magee, A. Qian, J. Rajfer, and N. F. Gonzalez-Cadavid
Evidence That Osteogenic Progenitor Cells in the Human Tunica Albuginea May Originate from Stem Cells: Implications for Peyronie Disease
Biol Reprod, December 1, 2005; 73(6): 1199 - 1210.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
P. Qiu, R. P. Ritchie, Z. Fu, D. Cao, J. Cumming, J. M. Miano, D.-Z. Wang, H. J. Li, and L. Li
Myocardin Enhances Smad3-Mediated Transforming Growth Factor-{beta}1 Signaling in a CArG Box-Independent Manner: Smad-Binding Element Is an Important cis Element for SM22{alpha} Transcription In Vivo
Circ. Res., November 11, 2005; 97(10): 983 - 991.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
A. Armulik, A. Abramsson, and C. Betsholtz
Endothelial/Pericyte Interactions
Circ. Res., September 16, 2005; 97(6): 512 - 523.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Movie
Right arrow All Versions of this Article:
287/6/C1560    most recent
00221.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (56)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sinha, S.
Right arrow Articles by Owens, G. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sinha, S.
Right arrow Articles by Owens, G. K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.