Am J Physiol Cell Physiol Add DOIs to your references at manuscript stage!
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 287: C1547-C1559, 2004. First published July 28, 2004; doi:10.1152/ajpcell.00260.2004
0363-6143/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
287/6/C1547    most recent
00260.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (9)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, J.-Y.
Right arrow Articles by Barasch, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, J.-Y.
Right arrow Articles by Barasch, J.

METHODS IN CELL PHYSIOLOGY

Detection of intracellular iron by its regulatory effect

Jau-Yi Li,1 Gita Ram,1,* Katherine Gast,1,* Xia Chen,1 Kimberly Barasch,1 Kiyoshi Mori,1 Kai Schmidt-Ott,1 Jianjun Wang,2 Hung-Chieh Kuo,3 Cathy Savage-Dunn,2 Michael D. Garrick,3 and Jonathan Barasch1

1College of Physicians and Surgeons of Columbia University, New York 10032; 2Queens College and Graduate School and University Center of City University of New York, Flushing 11367; and 3State University of New York at Buffalo, Buffalo, New York 14214

Submitted 27 May 2004 ; accepted in final form 16 July 2004


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Intracellular iron regulates gene expression by inhibiting the interaction of iron regulatory proteins (IRPs) with RNA motifs called iron-responsive elements (IREs). To assay this interaction in living cells we have developed two fluorescent IRE-based reporters that rapidly, reversibly, and specifically respond to changes in cellular iron status as well as signaling that modifies IRP activity. The reporters were also sufficiently sensitive to distinguish apo- from holotransferrin in the medium, to detect the effect of modifiers of the transferrin pathway such as HFE, and to detect the donation or chelation of iron by siderophores bound to the lipocalin neutrophil gelatinase-associated lipocalin (Ngal). In addition, alternative configurations of the IRE motif either enhanced or repressed fluorescence, permitting a ratio analysis of the iron-dependent response. These characteristics make it possible to visualize iron-IRP-IRE interactions in vivo.

iron regulatory proteins; iron-responsive element; labile iron pool; transferrin; HFE; neutrophil gelatinase-associated lipocalin; siderophore


IRON SERVES A NUMBER OF FUNCTIONS in cells. It is the catalytic site of many enzymes and the binding site for gases in transport proteins. In addition, iron regulates mammalian gene expression. Iron regulates cell cycle activities (such as p21, cdk2, cyclins), signaling [inducible nitric oxide synthase (iNOS), PKC-{beta}], and developmental genes at the transcriptional level (27, 89), but the mechanism of regulation is not yet established (for yeast see Ref. 86). Iron also regulates the posttranscriptional expression of genes that contain stem loop structures in their untranslated regions (UTRs) called iron-responsive elements (IREs; Refs. 2, 44, 67, 70). Cytosolic proteins called iron regulatory proteins (IRP; Refs. 18, 32, 35, 46, 48, 69) bind the stem loops and determine the translation of the message. If a gene contains an IRE in the 5'-untranslated region (UTR) interaction with IRP inhibits translation. Conversely, when the IRE is located in the 3'-UTR the IRE-IRP interaction stabilizes the message by inhibiting access to an endonuclease site. Iron negatively regulates the formation of the IRP-IRE complex by inhibiting the association of IRP-1 with IRE and by triggering the degradation of IRP-2 (16, 18, 34, 35, 39, 41, 82, 88). Hence, iron promotes the translation of messages containing a 5'-IRE, but it suppresses the translation of messages containing a 3'-IRE. Conversely, low iron levels have the opposite effect (diagrammed in Fig. 1). IREs provide a critical mechanism for the regulation of many proteins involved in iron metabolism, as well as other factors (13, 45).



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 1. Iron-dependent posttranscriptional regulation of gene expression. The 5' iron-responsive element (IRE) motif determines whether ferritin or a substitute such as yellow fluorescent protein (YFP) is translated (top). Conversely, the 3'-IRE motif determines the stability of mRNA for transferrin receptor 1 or a substitute such as YFP by regulating access to an endonuclease site (marked by X). The alternative organization of these motifs produces a reciprocal response to iron, which can be measured by reciprocal changes in protein translation (arrows). Whether a different threshold is present for different IREs, or whether the response to increasing iron concentration is linear, is not yet determined (right). IRP, iron regulatory protein.

 
The regulation of gene expression by iron is thought to depend on the concentration of iron in the cell cytoplasm, which is called the "labile," "exchangeable," or "transient" pool of iron (20, 71). Although the chemical nature of this pool is not yet clear and its regulation is complex (18, 33, 85), the activity of the labile pool has been estimated by a variety of methods. For example, the expression level of ferritin (which has a 5'-IRE) and transferrin receptor 1 (which has a 3'-IRE) proteins may reflect the labile iron pool, because ferritin expression is enhanced and transferrin receptor 1 expression is suppressed by iron loading of cells. This relationship, however, may not hold for all mammalian cells (62) or apply to all responses of ferritin and transferrin receptor 1. For example, ferritin (67) and transferrin receptor 1 (12, 38, 50, 63, 79, 84, 90) are not only regulated at the posttranscriptional level by iron but also by stimuli, such as cytokines, that activate iron-independent promoters. Indeed, in some lineages, such as the hematopoietic series (1, 10, 11, 23, 51, 53, 73, 80), transferrin receptor 1 is regulated predominantly by transcriptional rather than posttranscriptional mechanisms. Hence, although ferritin and the transferrin receptor proteins are useful measures of the response to iron in vitro, the endogenous expression of these genes could reflect a myriad of signals. Direct measurements of the IRP-IRE interaction could better reflect the labile pool of iron.

Direct measurement of cytoplasmic iron is possible with calcein and phen-green. These dyes are very important reagents because they detect changes in iron over seconds to minutes and their responses can be quantified (20, 21). One must assume, however, that they chelate iron from the same pool that interacts with the IRPs. Moreover, the dyes are used at concentrations that could perturb these pools. In addition, reversal of the quenched signal can require changing pH or the addition of large doses of iron chelators (21), protocols that are difficult to use in complex tissues. Measurement of iron over hours to days is also not possible with calcein or phen-green because of bleaching and leakage of the dye. Hence, although the dyes are invaluable to detect initial changes in iron that, for example, might occur with acute modulation of iron transporters, new methods are required for continuous evaluation of iron loading in growing and differentiating cells.

The best approach to studying iron metabolism in complex organs is to use methods that can assay single cells, because mechanisms of iron acquisition may vary among adjacent cells. For example, we found a gradient of transferrin uptake and transferrin receptor 1 expression that correlated with the appearance of developmental milestones in the developing kidney (Refs. 19, 24, 87; Barasch J, unpublished observations). Similarly, stage-specific expression and a functional requirement for transferrin receptor 1 were found in the hematopoietic and lymphoid lineages (Refs. 8, 40, 49, 59, 76; reviewed in Ref. 64), but other cell types were indifferent to the absence of transferrin receptor 1 and hence must have obtained iron by an alternative pathway (59). Cellular iron content might also vary by stage and by lineage because different regions of the brain have a different content of ferritin (68, 74) and the IRPs are developmentally regulated (47, 74) and differentially expressed in different cells of an organ (56). These studies indicate that examination of tissue iron requires methods to analyze the IRP-IRE interaction and the labile iron pool at the level of single cells.

A simple method to follow IRP-IRE interactions was suggested by earlier studies that demonstrated that the 5'-IRE can regulate the expression of reporters in vitro (see, e.g., Refs. 29, 37, 52) and that a number of different promoters can be used to drive reporter constructs in vivo (see, e.g., Ref. 77). Analysis of an iron reporter in tissues, however, requires the simultaneous expression of two reporters that are differentially sensitive to iron, to permit ratio imaging of the fluorescent signal. Ratio imaging allows the measurement of iron to be normalized for an iron-insensitive component of reporter expression and for iron-insensitive variations in the detection of fluorescence. To produce two iron-dependent reporters that are differentially sensitive to iron, we ligated the 5'-UTR domain of the ferritin gene and the 3'-UTR domain of the transferrin receptor protein to destabilized forms of green fluorescent protein (GFP)-type proteins. We tested these reporters in cell cultures to learn whether they respond in a manner predicted by a variety of published experiments that have manipulated iron, transferrin, and the IRP system. We found that these reporters rapidly and reversibly respond to changes in cell iron or changes in the IRP-IRE interaction (Fig. 1). When we used both the 5' and the 3' configurations of the IREs with different fluors, we found that we could measure reciprocal responses to iron in the same cell. Because these reporters capitalize on endogenous mechanisms of iron-mediated gene expression, they are likely to assay the same pool of iron that regulates gene expression. We have used these reporters to monitor iron uptake from different sources, including a novel iron transporter called siderocalin, a lipocalin containing a bacterial siderophore (28). Some of these data have been presented in brief abstract form in 2002 (4) and 2003 (5) at the annual meeting of the American Society of Nephrology and in 2003 (3) at the annual meeting of the American Society of Hematology. An abstract by Henderson et al. (36) is also relevant.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Iron reporters. We used PCR (forward: 5'-gcctcgagcagcgccttggaggtcccgt-3' and reverse: 5'-gcggatccggctgatccggagtaggagc-3') to amplify a 206-base pair fragment upstream of the ferritin ATG from a mouse embryo E15 cDNA library (Clontech). The fragment, which contained one IRE, was ligated to a yellow fluorescent protein (YFP) with a 2-h half-life (Clontech) at the BamH1 and XhoI sites in the CMV-D2EYFP-N1 vector. The final product was resequenced across the ligation site. The distance between the 5'-IRE and the start codon of ferritin and the 5'-IRE and the start codon of YFP differed by 19 base pairs, which were introduced by the multiple cloning site of the YFP vector. To create a probe with a 3'-IRE, we cloned 900 base pairs of the 3'-UTR of transferrin receptor 1 with the primers 5'gcggccgcagactcaatttgtcagactt 3' and 5'gcggccgctttataatgtttgctggtga 3' and mouse embryo E15 cDNA library (Clontech). We chose this sequence because it was conserved in human, chicken, and mouse transferrin receptor 1 and it contained multiple IREs and an endonuclease site. The fragment was ligated at the NotI site in the CMV-D2EYFP-N1 vector. A control probe was also made with the same YFP but without an upstream or downstream IRE. Reporters expressing destabilized cyan fluorescent protein (CFP) were generated by similar methods.

Expression of iron reporters in 293 cells. The IRE and control reporters were introduced into 293 cell lines with Lipofectamine 2000 (Invitrogen), and plasmid-containing lines were then selected by neomycin (400 µg/ml) in DMEM (high glucose) with 10% FCS at 37°C in 5% CO2. Eight colonies with the 5'-IRE-YFP probe, six colonies with 3'-IRE-YFP, and eight colonies with non-IRE-YFP were expanded in neomycin and analyzed by a fluorescence-activated cell sorter (FACS; Excalibur) with a 488-nm laser. Before each experiment, the cells were rinsed and recultured in serum-free DMEM (0.2 µM iron) overnight to remove most of the serum. The response to iron loading was determined by culture with holotransferrin (1–100 µg/ml; Sigma), iron-containing or iron-free siderocalin/neutrophil gelatinase-associated lipocalin (Ngal, 50 µg/ml; see below), or ferric ammonium citrate or ferric chloride (1–25 µM) in serum-free DMEM. The response to iron chelation was examined with deferoxamine (DFO) mesylate (10 or 20 µM). Single 293 cells expressing IRE-YFP were also followed by time-lapse cinematography. Cells were seeded in 25-mm dishes in DMEM with HEPES (10 mM, pH 7.4), and YFP fluorescence was detected in individual cells with a Nikon inverted microscope, a Hamamatsu digital camera and controller, a Prior Proscan positioner, and a Sage Aircurtain (Watanabe T and Costantini F, unpublished observations). Cells were observed for 3 h to establish baseline fluorescence and then were treated with ferric ammonium citrate (25 µM). Images were collected at 30-min intervals and quantified with the ImageJ program (http://rsb.info.nih.gov/ij/). A relative standard deviation was derived for analysis of ratio imaging (57). The response to iron was also detected by YFP immunoblot with rabbit anti-GFP/YFP antibodies (Clontech) and by fluorescent microscopy. Anti-GAPDH (Chemicon) and anti-transferrin receptor 1 (Zymed) antibodies were used in control experiments.

Retroviral constructs. The 5'-IRE-d2EYFP fragment was isolated by digestion with XhoI and NotI and then ligated into pMIG, a retroviral vector [based on MSCV; kindly provided by Dr. Luk van Parijs (14)], that was modified by inserting a 30-base pair linker containing NotI. The d2EYFP fragment was cloned into the modified MIG vector at the XhoI and NotI sites. For the 3'-IRE-d2EYFP fragment, the 3'-IRE sequence was transferred to the MIG-d2EYFP at the 3' NotI site. To produce viral particles, we cotransfected these constructs with retroviral packaging constructs (pCL-Eco) (58) and pSVS-G (Clontech) with Lipofectamine 2000 (Invitrogen) into 293 cells. Virus was collected from 48- to 72-h media.

Expression of iron reporters in TRvb-1 cells. TRvb-1 cells [a kind gift of T. McGraw (54)] were grown in 24-well plates to 80% confluence under continuous selection with geneticin (200 µg/ml). TRvb-1/HFE and TRvb-1/HFE/{beta}2-microglobulin cells [kind gifts of W. Sly (81)] were grown with geneticin (200 µg/ml) and puromycin (10 µg/ml). The iron reporters were introduced by viral infection with polybrene (16 µg/ml) and centrifugation (1,800 rpm, 90 min). Cells were analyzed after two passages.

Siderocalin/Ngal. Recombinant, purified Ngal from BL-21 bacteria (87) was obtained by glutathione S-transferase (GST)-reduced glutathione (GSH) chromatography (Pharmacia) followed by gel filtration to remove impurities (Superdex75, SMART System, Pharmacia). Ngal was loaded with enterochelin in either its iron-free or in its iron-saturated form (EMC Microcollection), using a 2-to-1 molar ratio of siderophore:siderocalin/Ngal, washed in a 10-kDa microcon, and added to the reporter lines. Alternatively, 293 cells or TRvb-1 cells stably expressing 5'- and 3'-IRE-YFP reporters were transfected with 24p3/Ngal containing a signal sequence (pcDNAIII vector), and the cells were analyzed after 48 h by FACS.

IRP. IRP-1 was analyzed by immunoblot (Alpha Diagnostics). IRP-1 and IRP-2 were analyzed by real-time PCR from 293 cell RNA prepared by on-column DNase digestion (Qiagen). Total RNA (1.3 µg in 50 µl) was reverse transcribed with an oligo(dT) primer (1 µM), 10 U of RNase inhibitor (Invitrogen), and 4 U of Omniscript reverse transcriptase for 60 min at 37°C. Human IRP-1 (GenBank accession no. M58510.1) was amplified with forward primer ATGCGTGATGCTGTGAAAAA (positions 81–100) and reverse primer GTTGTGAAAAGCCTGGGAAC (positions 281–262), and human IRP-2 (GenBank accession no. NM004136.1) was amplified with forward primer AGTCGGCACAGATTCACACA (positions 882–901) and reverse primer AGCCACTCCTACTTGCCTGA (positions 1101–1082), using the cDNA (1 µl) and 200 nM of each primer with dNTP (200 nM), MgCl (2 mM), rTaq DNA polymerase (1.25 U, Invitrogen) for 35 cycles at 95°C (30 s), 60°C (30 s), and 72°C (30 s). The products were analyzed by 2% agarose gel and then sequenced. Real-time PCR used 0.2 µl of cDNA and 200 nM of each primer with 1x iQ SYBR green super mix (Bio-Rad) for 40–60 cycles at 95°C (30 s) and 60°C (30 s) and the MyiQ single-color real-time PCR detection system (Bio-Rad). The product was quantified by comparison with {beta}-actin mRNA (GenBank accession no. BC014861) with forward primer CCTCGCCTTTGCCGATCC (positions 13–30) and reverse primer GGATCTTCATGAGGTAGTCAGTC (positions 651–629). Comparison of 293 cDNA and human liver cDNA (Clontech, BD Biosciences) was calculated according to the comparative threshold cycle for detection (CT) method, where the amount of target, normalized to endogenous {beta}-actin, and relative to a calibrator, is given by 2{Delta}{Delta}Ct. The specificity of the amplifications was checked by melting curve analysis. Electrophoretic mobility shift assay also evaluated IRP binding, but, as previously reported (6), IRP-1 dominates the gel shift in 293 cells.

Nematode strains and manipulations. To create iron reporters in Caenorhabditis elegans, we inserted the sma-3 promoter (83) into pPD117.01-GFP between SalI and ClaI. 5'-IRE and 3'-IRE sequences were then amplified from the mammalian IRE-YFPs with primers 5'-IRE reverse(r) 5'-CCGGTACCGTCATGGCTGATCCGGAGT-3', 5'-IRE forward (f) 5'-CCATCGATCAGCGCCTTGGAGGTCCCGT-3', 3'-IREr 5'-CCGGGCCCTCACCAGCAAACATTATAAA-3', and 3'-IREf 5'-CCACTAGTAGACTCAATTTGTCAGACTT-3' and inserted into sma-3::GFP. Worms (N2 strain) were then microinjected with these plasmids (20 ng/µl) (55) together with 100 ng/µl pRF4 (rol-6 plasmid). Lines carrying these constructs had the roller phenotype. Worms were grown at 20°C on EZ plates (550 mg Tris-Cl, 240 mg Tris-OH, 3.1 g Bactopeptone, 8 mg cholesterol, 2.0 g NaCl, 200 mg streptomycin sulfate, and 20 g agar per liter) seeded with OP50 bacteria (9) and ferric ammonium citrate (100 µM) or DFO (20 µM) to vary iron.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Single-wavelength reporters of cytoplasmic iron. We used 293 cells to analyze the response of two different iron reporters and a control construct. Real-time PCR demonstrated that 293 cells contain both IRP-1 and IRP-2, expressed 0.1- and 20.60-fold in 293 cells relative to a human liver cDNA library, respectively (normalizing these samples for {beta}-actin). The CT was 27.3 for IRP-1, 24.2 for IRP-2, and 25.4 for {beta}-actin, indicating that the IRP transcripts were expressed at high copy number. Because both IRP-1 and IRP-2 can regulate iron-dependent messages in vitro, and IRP-2 dominates iron metabolism in vivo (56), these data indicate that 293 cells are useful to examine the expression of an IRE-based reporter.

We produced an iron reporter by ligating the 5'-UTR of the mouse ferritin light chain, which contains a single IRE, with a destabilized form of YFP to produce a 5'-IRE-YFP reporter (Fig. 1). The 5'-IRE-YFP was expressed by a cytomegalovirus (CMV) promoter rather than the endogenous ferritin promoter because the ferritin promoter demonstrates both iron-dependent and iron-independent regulation.

When the 5'-IRE-YFP reporter was expressed in 293 cells, YFP was expressed in an iron-responsive fashion (Fig. 2A). As little as 1 µM ferric ammonium citrate (test doses ranged from 1 to 50 µM; Ref. 78) produced a small but often detectable increase in fluorescence, whereas 5 µM ferric ammonium citrate reproducibly increased fluorescence 2.41 ± 0.3-fold and the higher doses of iron increased the signal further. Other iron donors such as ferric and ferrous chloride and ferric sulfate had a similar effect. Clones expressing the 5'-IRE-YFP reporter (Fig. 2B) demonstrated reciprocal responses to iron (ferric ammonium citrate, 25 µM) and iron chelation by DFO (20 µM). Mean fluorescence varied sevenfold on average with these treatments [210 ± 26 vs. 33.3 ± 3.3 (mean ± SE) fluorescence units with iron and DFO, respectively; n = 8 independent clones; P < 0.001]. All cells responded to iron and DFO, suggesting that the 5'-IRE-YFP was not expressed in excess of the IRPs. In addition, the expression of ferritin and transferrin receptor 1 proteins was similar in transfected and parental 293 cells, indicating that the reporters did not squelch endogenous IRP-IRE interactions (not shown).



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 2. Response to iron, assayed by fluorescence-activated cell sorter (FACS). Populations of 293 cells expressing 5'-IRE-YFP (A), YFP without an IRE (C), or 3'-IRE-YFP (E) were treated with increasing doses of ferric ammonium citrate (Fe, 1–25 µM) for 12 h and then analyzed by FACS. Similarly, independent 293 clones expressing 5'-IRE-YFP (B), YFP without an IRE (D), or 3'-IRE-YFP (E) were treated with ferric ammonium citrate (50 µM) or deferoxamine (DFO, 20 µM) for 12 h, and their mean fluorescence intensity was recorded by FACS. 5'-IRE-YFP cells upregulated YFP expression in response to iron, whereas the 3'-IRE-YFP clones decreased fluorescence. Clones expressing non-IRE-YFP had little response to iron. Note that the addition of iron to 5'-IRE cells or DFO to 3'-IRE cells increased fluorescence almost to the level of the non-IRE 293 cells.

 
The response to iron was likely at the posttranscriptional level, because changes in 5'-IRE-YFP message were not detectable by real-time PCR (not shown) and electrophoretic mobility assays revealed that the addition of iron blocked the binding of IRP to an IRE probe (supplemental data for this article may be found at http://ajpcell.physiology.org/cgi/content/full/00260.2004/DC1). It remained possible, however, that changes in 5'-IRE-YFP fluorescence might be due to global changes in protein synthesis or degradation. To rule out this possibility, we examined cells transfected with the YFP vector lacking the IRE. Ferric ammonium citrate (1–50 µM; Fig. 2C) failed to increase the fluorescence of these cells, and none of the clones responded to iron or to DFO [331 ± 73 fluorescence units with iron (25 µM) vs. 331 ± 58 fluorescence units with DFO (20 µM); n = 8 clones, P = 0.99; Fig. 2C], suggesting that the IRE was the critical component of the iron response. It is also notable that, after the addition of iron, 5'-IRE-YFP clones and the non-IRE-YFP cells generated similar fluorescence (compare Fig. 2, A vs. C and B vs. D), suggesting that the 5'-IRE acted appropriately as a reversible suppressor of YFP fluorescence.

To demonstrate further the specificity of the response to iron, we created a reporter with 3'-IREs and an endonuclease site by using the 3'-UTR of mouse transferrin receptor 1 DNA and the destabilized YFP vector (Fig. 1). The 3'-IRE-YFP cells had the opposite set of responses to iron and DFO as the 5'-IRE-YFP clones. Iron repressed fluorescence of 3'-IRE-YFP cells (Fig. 2, E and F), whereas DFO enhanced fluorescence (93 ± 27 with 25 µM iron vs. 287 ± 66 with 20 µM DFO; n = 8 clones, P = 0.03). All cells in the 3'-YFP-IRE clones responded to iron or DFO, and DFO raised the 3'-IRE-YFP fluorescence to levels similar to those found in the non-IRE-YFP clones. These data demonstrate reversible regulation of 5'- and 3'-IRE YFP reporters by an iron-sensitive mechanism.

We used immunoblots to confirm that the IREs regulate the translation of YFP proteins and showed that, although the non-IRE-YFP protein was unresponsive to iron, the 5'- and 3'-IRE-YFP proteins varied with iron loading and iron chelation, in a manner similar to endogenous transferrin receptor 1 (Fig. 3). These reciprocal changes could also be detected by microscopy. Ligation of the 5'-IRE sequence to the YFP reporter markedly diminished the fluorescence (compare Fig. 4, A vs. C), but the addition of iron reactivated the signal (compare Fig. 4, C vs. D). Conversely, iron reduced the fluorescence of the 3'-IRE-YFP reporter (compare Fig. 4, E vs. F). These reciprocal responses cannot be explained simply by global changes in protein synthesis or degradation, but rather they depend on predicted functions of 5'- and 3'-IREs in reciprocally regulating the posttranscriptional expression of proteins.



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 3. Response to iron, assayed by immunoblot with anti-YFP. YFP is constitutively expressed in non-IRE-YFP cells, but the addition of 5'- or 3'-IRE results in iron-dependent translation. 5'-IRE suppresses translation in low iron (DFO, 20 µM), whereas the 3'-IRE cassette suppresses translation in the presence of ferric ammonium citrate (25 µM). Transferrin receptor 1 (TfR1) also responded to iron, but GAPDH was unchanged. Extract from 105 cells was loaded on each lane of the immunoblot.

 


View larger version (89K):
[in this window]
[in a new window]
 
Fig. 4. Response to iron assayed by fluorescence microscopy. The addition of the 5'-IRE sequence suppressed the expression of YFP (compare A with C), but the addition of ferric ammonium citrate (Fe; 25 µM) to the culture medium (12 h) enhanced fluorescence in the same field (compare C and D). Conversely, the addition of iron to 3'-IRE-YFP cells suppressed fluorescence (compare E and F). Non-IRE-YFP cells in contrast were not responsive to iron (compare A and B). Exposure time = 3 s for all panels.

 
We next examined whether IRE-based reporters are specific for iron. We found that the addition of gallium, copper, and zinc had only modest effects on the fluorescence of 5'-IRE-YFP and 3'-IRE-YFP and that these effects were similar to changes in the non-IRE-YFP (Fig. 5). The lack of response to gallium was particularly notable because gallium can occupy iron-binding sites, although much higher doses were used to block iron transport in prior studies (15, 60). Nonetheless, assuming that the metals entered the cells, the data indicate that the IRE reporters have a favorable specificity profile compared with calcein (which, in solution, is sensitive to 1 µM metals; Molecular Probes).



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 5. Specificity for iron. 5'-IRE-YFP (shaded bars), 3'-IRE-YFP (open bars), and non-IRE-YFP (solid bars) 293 clones were treated with different metals (25 µM) for 12 h, and then mean fluorescence was calculated by FACS. The change in cellular fluorescence after the addition of the metal is displayed. Note the specific response to iron in 5'-IRE-YFP and in 3'-IRE-YFP cells but the more limited and nonspecific responses to other metals.

 
Finally, it should be noted that the IRE reporters were effective in mammalian cells but were not responsive to iron when introduced into C. elegans (using the sma-3 promoter, which drives GFP expression in the pharynx, hypodermis, and intestine; Ref. 83). This finding is consistent with gel shift analyses that show that the C. elegans ortholog of IRP-1 (AcoI) does not bind mammalian IREs (30), and it further demonstrates the specificity of our reporters.

Rapid responses to iron. Because translation of the 5'-IRE-YFP protein and degradation of 3'-IRE-YFP RNA after the addition of iron are time-consuming events, we examined how fast the reporters could respond to iron. Using FACS, we detected a response within 60 min of the addition of iron. Similarly, time-lapse cinematography of single cells detected a response to iron by 60 min and a plateau of the signal after 5 h (Fig. 6). 3'-IRE-YFP cells exhibited the reciprocal response (not shown), and non-IRE-YFP cells were not responsive to iron at all.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 6. Time-lapse cinematography of a single 293 cell exposed to iron. Images were collected at 30-min intervals. For each photograph, the mean fluorescence (F) intensity (circles) and the maximum and minimum fluorescent pixels (vertical bars) were recorded by ImageJ software. The interval between each analysis was 30 min. Note the rapid response to ferric ammonium citrate (25 µM) in the 5'-IRE cell (left) but the lack of response in non-IRE-YFP cells (right).

 
The destabilized YFP proteins have a 2-h half-life. Consequently, changes in fluorescence should be rapidly reversible. Using FACS analysis, we found that reversion to baseline fluorescence occurred over 8–12 h (Fig. 7) after removal of iron and the rate of reversion was enhanced when DFO (20 µM, not shown) was included in the medium. The return to baseline occurred at approximately equal rates for both reporters, indicating either that the regeneration of IRP-1 binding activity or the de novo synthesis of IRP-2 was rate limiting, rather than the resynthesis of the 3'-IRE-YFP RNA. These data show that the IRE-iron reporters are useful to detect rapid changes in cellular iron, even within the lifespan of rapidly cycling cells.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 7. Reversibility of IRE-dependent fluorescence. 5'-IRE-YFP (top)- and 3'-IRE-YFP (bottom)-expressing cells were treated with ferric ammonium citrate (25 µM) for 12 h and were then washed and reexposed to basal culture medium. YFP fluorescence was detected by FACS analysis (gray curves, labeled according to 1, 4, 8, and 12 h after iron withdrawal). Control cells remained in basal medium throughout the experiment (black curves, labeled No Fe).

 
Manipulation of transferrin pathway. In the preceding studies we used "non-transferrin-bound iron" (ferric ammonium citrate) to test the reporters. Because transferrin is the major iron transporter of the adult (64), we compared transferrin to non-transferrin-bound iron. We found a dose-dependent, saturable increase in 5'-IRE-YFP fluorescence and a dose-dependent, saturable decrease in 3'-IRE-YFP fluorescence (Fig. 8) after exposure to holotransferrin. The response to transferrin differed, as one might expect, from the response to non-transferrin-bound iron, because only 20 µg/ml of transferrin (at maximum 500 nM iron) had a maximal effect on fluorescence (a 3-fold increase in 5'-IRE fluorescence and a 2-fold decrease in 3'-IRE fluorescence), suggesting saturation of high-affinity receptors, whereas much larger doses of non-transferrin-bound iron (>25 µM) still did not saturate the capacity of the reporters to increase in fluorescence (see Fig. 2). In contrast, apotransferrin (not shown) had only a slight effect on the reporters, demonstrating that apotransferrin failed to reload with iron from the culture medium (which contains at minimum 0.25 µM Fe). These data show that the behavior of the reporters can distinguish iron-loaded from unloaded carriers, as well as different mechanisms of iron acquisition.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 8. Holotransferrin enhances 5'-IRE-YFP ({blacklozenge}) but inhibits 3'-IRE-YFP ({blacktriangleup}) fluorescence in a dose-dependent manner (0–100 µg/ml, 0–1.25 µM; n = 26 independent assays) without changing the non-IRE-YFP fluorescence ({blacksquare}). Note that as little as 20 µg/ml holotransferrin yields a maximal effect and DFO produces the opposite effect to holotransferrin. Data are expressed as a ratio of treated to untreated cells.

 
Import of iron from transferrin is regulated by HFE, the protein defective in hemochromatosis. In one model using cell lines, overexpression of HFE decreased iron delivery (66, 72), as a result of an interaction with transferrin receptors (22, 31), whereas the coexpression of HFE with the interacting protein {beta}2-microglobulin stimulated transferrin delivery (81). We tested whether the reporters could distinguish the differential effect of these proteins by virally introducing IRE-YFP constructs into TRvb-1 (transferrin receptor 1-deficient CHO cells that carry human transferrin receptor 1; Ref. 54) expressing either HFE or HFE plus {beta}2-microglobulin (Ref. 81; Fig. 9). In the HFE-expressing cells, ferric ammonium citrate increased 5'-IRE-YFP fluorescence and decreased 3'-IRE-YFP fluorescence (the ratio of 5'- to 3'-YFP fluorescence = 3.1-fold compared with untreated cells in basal medium; n = 6); however, there was no change in fluorescence after culture with human holotransferrin (ratio of 5' to 3' fluorescence = 1.1 compared with untreated cells in basal medium; n = 6). In contrast, cells expressing HFE and {beta}2-microglobulin demonstrated responses to both non-transferrin-bound iron (ratio of 5' to 3' fluorescence = 3.3; n = 6) and holotransferrin (ratio of 5' to 3' fluorescence = 1.9; n = 6). The parental cell line likewise demonstrated (not shown) responses to both non-transferrin-bound iron (ratio of 5' to 3' fluorescence = 3.3; n = 6) and holotransferrin (ratio of 5' to 3' fluorescence = 2.8; n = 6). Cells infected with the non-IRE-containing reporter did not respond to non-transferrin-bound or to transferrin-bound iron (ratio of 1.09 and 1.05, respectively, compared with cells in basal medium). These findings indicate that the combination of HFE and {beta}2-microglobulin positively regulates the steady-state level of cellular iron by permitting transferrin uptake, whereas HFE alone is not effective. In contrast, the HFE-{beta}2-microglobulin complex does not regulate the acquisition of non-transferrin-bound iron. These results confirm a prior study using these cell lines (81) in showing that HFE plus {beta}2-microglobulin is the physiological regulator for iron uptake from transferrin, and they demonstrate that the IRE reporters can detect manipulations of the transferrin pathway.



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 9. FACS analysis of HFE and HFE-{beta}2-microglobulin cells that express 5'-IRE-, non-IRE-, and 3'-IRE-YFP. The 5'- and 3'-IRE cells expressing either HFE or HFE/{beta}2-microglobulin responded similarly to ferric ammonium citrate (25 µM; purple line), but the response to holotransferrin (100 µg/ml; red line) required the coexpression of HFE and {beta}2-microglobulin. Cells expressing HFE alone did not respond to holotransferrin. As expected, the non-IRE-YFP cells did not respond to ferric ammonium citrate or to transferrin. Black lines, basal medium (DMEM without fetal calf serum).

 
Ngal/siderocalin lipocalin. The lipocalins are structurally related proteins that bind and transport low-molecular-weight chemicals (25, 88). Ngal was recently renamed siderocalin because it binds bacterial siderophores with high affinity and these siderophores chelate iron (28). When Ngal/siderocalin was cloned in the XL-1B bacterial strain, it contained a siderophore called enterobactin that is stoichiometrically loaded with iron. When Ngal/siderocalin is cloned in BL-21 strains, in contrast, it is siderophore free and iron poor. We previously found (87) that Ngal induced the conversion of rat kidney mesenchymal cells into epithelial cells that form complete nephrons in vitro. The response of the mesenchyme was enhanced by utilizing Ngal obtained from XL-1B bacteria. This preparation upregulated ferritin and downregulated transferrin receptor 1 proteins in cell lines, suggesting that it was iron loaded and able to donate iron to the cytoplasm (87).

To examine these hypotheses further, we generated matched samples of iron-loaded and iron-free Ngal by combining a single lot of Ngal produced in BL-21 bacteria with either iron-loaded or iron-free enterochelin (EMC Microcollection). Iron-loaded Ngal-enterochelin was red in color, whereas the iron-free Ngal-enterochelin had no color (Fig. 10A). Iron-containing Ngal-enterochelin markedly enhanced the growth of rat kidney mesenchyme, the expression of epithelial E-cadherin, and de novo tubulogenesis, whereas the iron-poor Ngal-enterochelin had much less effect (Fig. 10B), suggesting that Fe-Ngal-enterochelin donated iron. To further test whether iron-loaded Ngal-enterochelin could donate iron, we added these preparations to the YFP reporter cells. We found that the iron-loaded Ngal-enterochelin doubled the fluorescence of the 5'-IRE-YFP cells [no addition: 43 ± 2.8 (n = 6); Fe-Ngal-enterochelin: 85 ± 9.7 (n = 6); P < 0.004] whereas the iron-poor Ngal-enterochelin reduced the fluorescence [Ngal-enterochelin: 33 ± 2.4 (n = 6); P < 0.04; Fig. 10C]. The opposite was found when the two preparations of Ngal were added to the 3'-IRE-YFP cells. Iron-loaded Ngal reduced the fluorescence [no addition: 149 ± 6.9 (n = 5), Fe-Ngal-enterochelin: 95 ± 21.8; P < 0.045] whereas iron-poor Ngal enhanced the fluorescence [Ngal-enterochelin: 191 ± 22 (n = 6); P < 0.004]. Control cells containing the YFP reporter lacking the IRE had no response to either form of Ngal [no addition: 980 ± 84 (n = 6); Fe-Ngal-enterochelin: 921 ± 178 (n = 6, P = 0.78); Ngal-enterochelin: 1,035 ± 86 (n = 6, P = 0.69)]. To determine whether Ngal might downregulate the message for IRP-1 or IRP-2, and hence mimic iron delivery, we measured IRP transcripts by real-time PCR, but we failed to find a difference when cells were treated with either iron-loaded or iron-poor Ngal-enterochelin or were left untreated. These data implicate iron-loaded Ngal-enterochelin as an iron donor and, conversely, iron-free Ngal-enterochelin as an iron chelator. The data also demonstrate that growth and epithelial conversion of the rat mesenchyme in vitro is enhanced by iron donation by this novel transporter.



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 10. Enterochelin-neutrophil gelatinase-associated lipocalin (Ngal) donates and cheats iron. Iron- and siderophore-free Ngal was generated in BL-21 bacteria and then loaded with either iron-free or iron-saturated enterochelin. A: iron-free Ngal-enterochelin (right) had no color, but the iron-saturated Ngal-enterochelin (left) was reddish purple. B: iron-loaded Ngal (+Fe) stimulated mesenchymal growth (note the increase in actin levels in the immunoblot) and epithelial conversion (note the convoluted surface of the treated mesenchyme, reflecting tubulogenesis and the appearance of E-cadherin in the immunoblot), whereas iron-free Ngal (–Fe) was much less effective. C: iron-loaded Ngal-enterochelin (red lines) stimulated expression of the 5'-IRE-YFP, suppressed the expression of 3'-IRE-YFP, and had no effect on the non-IRE-YFP, indicating that it donated iron. Conversely, iron-free Ngal-enterochelin (blue lines) decreased 5'-IRE and increased 3'-IRE expression, indicating that it chelated iron. DFO (20 µM)-treated cells (green lines) and untreated cells (black lines) are included for comparison.

 
IRP activation. Because the IRE-based reporters are regulated by the binding of IRP proteins, inhibition of IRP binding activity should mimic treatment of cells with iron. Nitric oxides (NO) have been reported to modify IRP function (17, 43, 85). NO+, which is generated by sodium nitroprusside (SNP), inhibits IRP-2 activity by nitrosylation of a cysteine (44), and this effect could not be reversed by iron chelation in some studies (7, 41, 65) but was reversed in other works (6, 42).

We found that addition of SNP (1–100 µM) to the reporter cells increased 5'-IRE fluorescence as much as 30-fold and decreased 3'-IRE fluorescence as much as 6-fold (Fig. 11). In contrast, there was no effect of SNP on the non-IRE-YFP reporters, indicating that these changes could not be attributed to global changes in protein synthesis. In addition, the effect of SNP could not be mimicked by adding the same concentration of iron (Fig. 11) or ferricyanide, a metabolite of SNP, or reversed or diminished by DFO (not shown), suggesting that the effect of SNP cannot be attributed to the delivery of iron alone. These findings are consistent with prior work (7, 41, 65) that showed that NO+ directly modifies IRP (44). The data indicate that the fluorescent IRE reporters are sensitive to modification of IRP activity.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 11. NO regulates translation of the IRE reporters. The addition of the NO+ donor sodium nitroprusside (SNP, 10 µM) induces the translation of the 5'-IRE-YFP reporter and the suppression of 3'-IRE probe. Other metabolites of SNP such as ferricyanide had no effect (not shown), and iron (10 µM) was less effective than the same dose of SNP.

 
Ratio imaging analysis. Because the 5'-IRE, 3'-IRE, and non-IRE reporters demonstrated differing responses to iron and NO, it may be possible to use more than one of these constructs in the same cell to measure a ratio of responses to factors that affect the IRP-IRE interaction. Measurement of a ratio may increase the specificity and perhaps the sensitivity of the iron-dependent signal. To create reporters suitable for ratio imaging, we ligated a 5'-IRE with a destabilized CFP and then introduced this vector into 293 cells. To determine the feasibility of two-color imaging, we analyzed the 5'-IRE-CFP, 3'-IRE-YFP, and untransfected 293 cells by confocal microscopy to measure crossover between the fluorescent channels as well as autofluorescence. Only 4.2% and 3.6% of CFP fluorescence crossed into the YFP channel in transiently (n = 556 cells) and stably (n = 635 cells) transfected 293 cells, respectively. Addition of iron and DFO did not alter this crossover. Conversely, YFP-expressing cells demonstrated little crossover into the CFP channel (n = 460 cells). Moreover, autofluorescence was <2% of the CFP or the YFP signal (n = 225). These values show the feasibility of using two-color reporters in the same cell to measure IRP-IRE interactions.

5'-IRE-CFP was transiently introduced into 3'-IRE-YFP expressing clones. The ratio of 5'-IRE-CFP to 3'-IRE-YFP fluorescence decreased from 2.7 ± 0.03 (n = 2,481 cells) to 0.66 ± 0.007 (n = 2,628 cells) in the presence of DFO and increased in a dose-responsive fashion to 12.3 ± 0.18 (n = 1,588 cells) in the presence of ferric ammonium citrate. DFO (10 µM) and iron (≥10 µM) produced significant changes in mean CFP and YFP fluorescence (P < 0.001; n = 4 independent experiments; 515–668 cells/measurement) (Fig. 12). These data show that the IRE reporters are useful to measure iron-dependent fluorescence with ratio analysis and data collection by confocal microscopy.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 12. Ratio imaging detects dose-responsive changes in cell iron. The 293 cells expressing 3'-IRE-YFP were transfected with 5'-IRE-cyan fluorescent protein (CFP) and were then treated with DFO (10 µM) or ferric ammonium citrate (0–25 µM) for 12 h in basal medium. Mean 5'-IRE-CFP ({blacklozenge}) and 3'-IRE-YFP ({blacktriangleup}) were analyzed by confocal microscopy and the ImageJ program, and the ratio of these values was derived ({lozenge}). The ratio varies nearly 20-fold with DFO and iron treatments. A representative experiment is shown.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The interaction of the cytoplasmic pool of iron with the IRP proteins regulates the expression of messages that contain IREs (Fig. 1). To assay the activity of the IRP proteins in living cells, we have developed a series of fluorescent molecular probes whose expression is dependent on the IRP-IRE interaction. These reporters are appropriate reagents for a number of reasons. First, the reporter cells were sensitive to exogenous iron in a range similar to that of cells loaded with calcein (21). Second, the fluorescence response was dependent on the IRE, because constructs lacking the IRE were not responsive to changes in iron (Fig. 2). Moreover, changes in the fluorescent response correlated well with changes in the binding of IRP to IRE (supplemental data). Third, IRE-based reporters utilize an endogenous mechanism of iron sensing and hence are expected to assay the same pool of iron that regulates the expression of endogenous messages that contain IREs. Although high levels of expression of a reporter construct can render a reporter unresponsive ("squelching"; see, e.g., Ref. 26), we did not find cells that failed to respond to DFO and we did not find changes in endogenous messages that depend on the IRPs. In fact, because only a single copy of YFP or CFP is detectable in transgenic mice (77), it will not be necessary to express high levels of the reporter constructs in vivo. Fourth, because the location of the IRE-IRP generated reciprocal responses to iron, and because these responses could be compared with one another (Fig. 12) as different fluorescent proteins can be independently monitored, IRE-based reporters provide a ratio analysis of iron-dependent gene expression. Comparison of iron-sensitive IRE reporters with iron-insensitive non-IRE reporters provides a second method of ratio analysis. Ratio analysis is very useful to validate subtle changes in IRP-IRE interaction, as well as to exclude changes in reporter expression that reflect non-iron-, non-IRP-based events. For example, treatment with apotransferrin induced a small increase in 5'-IRE, a small decrease in 3'-IRE, and no change in non-IRE fluorescence (not shown), indicating the delivery of a small quantity of iron. In contrast, treatment with copper and gallium induced small changes in the expression of 5'-IRE, 3'-IRE, and the non-IRE constructs, ruling out that these metals mimic the effect of iron (Fig. 5). The reciprocal responses of the IRE reporters compare favorably to the metal-sensing dyes, which respond only by quenching (20, 21). Fifth, the availability of fluorescent proteins with short half-lives permits reversibility of the signal (Fig. 7). This is a necessary precondition to follow IRP activity in real time. We used fluorescent proteins with a 2-h half-life, but even finer resolution may be obtainable with reporters with shorter half-lives because of reduced background and more rapid resolution of the deflections. Indeed, reversibility of our reporters differs from the LacZ or CAT reporters, which are not reversible, and from calcein, which may be difficult to reverse. Sixth, the changes in fluorescence were visible by standard microscopy (Fig. 4) and could be followed by time-lapse cinematography (Fig. 6). Hence, it should be possible to analyze individual cells in a complex tissue. These data indicate that the IRP-IRE system provides the specificity and sensitivity to follow the actions of iron without undue perturbation of the endogenous system. The reporters detect relative changes in the IRP-IRE interaction, whereas calcein is believed to detect absolute values of exchangeable iron. We used many standard models of the IRP-IRE system to test the reporter constructs. For example, the IRE reporters could distinguish the effects of different iron transporters. The effect of holotransferrin rapidly saturated (above 500 nM iron; Fig. 8), but the effect of non-transferrin-bound iron, given in even larger doses, did not saturate its signal (5–50 µM; Fig. 2). This distinction is consistent with higher affinity mechanisms of transferrin compared with non-transferrin-bound iron delivery (78). In fact, the reporters could distinguish the two pathways in cells transfected with HFE and {beta}2-microglobulin, which regulate transferrin, but not non-transferrin iron traffic (Fig. 9). Iron delivery by the iron-loaded enterochelin-Ngal complex was also detected (Fig. 10). Given the response to different iron carriers, we speculate that a good use of the IRE-based reporters may be to identify new iron delivery pathways by screening fractions of blood or other tissue extracts with transferrin receptor 1-negative cell lines carrying the IRE reporters. This technique may be superior to measuring ferritin levels, which could be misleading because the candidate factor might regulate ferritin at the transcriptional level. The converse of these experiments, the isolation of new compounds that chelate iron, could also be aided by the reporter cells. For example, we found that the iron-free enterochelin-Ngal complex reduced the 5'-IRE-YFP, increased the 3'-IRE-YFP fluorescent signals, and had no effect on non-IRE-YFP cells, indicating that it chelated iron.

The IRE reporters were also useful to evaluate factors that directly effect IRP proteins. For example, we found that SNP, a NO+ generator, mimicked the addition of iron. The effect of SNP, however, was many times greater than the effect of the same concentration of iron or ferricyanide (a metabolite), consistent with prior data suggesting that NO+ directly inhibits IRP activity (see, e.g., Ref. 44). Curiously, the NO· generator S-nitroso-N-acetyl-penicillamine (SNAP) (61, 65, 75) did not reproduce the effect of nitroprusside, suggesting that the pool of iron that can be affected by NO· was quite small. Support for this explanation comes from the finding that the addition of iron generally had a greater effect on fluorescence than did DFO. In this light, the dramatic effect of SNP is likely attributable to inhibition of IRP binding to IRE, most likely the inhibition of IRP-2. This assignment is based on the dramatic effect of NO+ on IRP-2 (6, 41, 43, 44) and not IRP-1 (43) in other cells and the abundance of IRP-2 message in 293 cells. Because 293 cells also express IRP-1, and because they derive from kidney, where, unlike other organs, IRP-1 is required for basal iron sensing (56), an unequivocal assignment of the NO+ target, however, should await the introduction of the iron reporters into knockout cells.

We foresee that the IRE reporters will be useful to examine developing organs and to determine the effects of gene deletions. Given that transferrin receptor 1 is expressed in a stage- and cell type-specific manner in kidney, hematopoietic, and lymphoid cells (8, 19, 24, 40, 76, 87) and is absolutely required only at a single stage of development (8, 59) by the latter tissues, mechanisms of iron acquisition may be quite heterogeneous in vivo. This idea is also suggested by the fact that ferritin expression (68, 74) varies among different regions and stages of the developing brain, and the IRPs are themselves developmentally regulated (47, 74), indicating that cellular iron loading may vary from one cell type to another. Because the IRE-based reporters can monitor single cells in a reversible fashion, we propose that these constructs will be useful in vivo to detect changes in iron and IRP activity during organ development.

In sum, we have developed a method of iron sensing that is complementary to the fluorescent dyes. Although calcein and phen-green may be useful to detect the initial rates of iron flux and can be calibrated to yield absolute iron concentrations, our probes can be used to provide long-term, continuous monitoring of relative changes in cellular iron that accompany cell growth and development. Our probes detect the actions of IRP signal transducers in living cells.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by a March of Dimes Research Grant and by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-55388 and DK-58872 to J. Barasch and DK-59794 to M. D. Garrick.


    ACKNOWLEDGMENTS
 
We thank Dr. William Sly and his laboratory as well as T. McGraw for supplying the TRVB-1/HFE/{beta}2-microglobulin cell lines.


    FOOTNOTES
 

Address for reprint requests and other correspondence: J. Barasch, Coll. of Physicians and Surgeons, Columbia Univ., 630 W 168th St., New York, NY 10032 (E-mail: jmb4{at}columbia.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

* G. Ram and K. Gast contributed equally to this work. Back


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Alcantara O, Denham CA, Phillips JL, and Boldt DH. Transcriptional regulation of transferrin receptor expression by cultured lymphoblastoid T cells treated with phorbol diesters. J Immunol 142: 1719–1726, 1989.[Abstract]

2. Aziz N and Munro HN. Iron regulates ferritin mRNA translation through a segment of its 5' untranslated region. Proc Natl Acad Sci USA 84: 8478–8482, 1987.[Abstract/Free Full Text]

3. Barasch J. Iron, lipocalins and induction of nephrons (Abstract). Scientific Committee of the American Society of Hematology, 2003 (http://www.abstracts2view.com/hem/sessionindex.php?p=4).

4. Barasch J and Li JY. Measurement of intracellular iron (Abstract). J Am Soc Nephrol 13: 504A, 2002.

5. Barasch J, Mori K, and Li JY. Novel reporter for the regulatory pool of iron (Abstract). J Am Soc Nephrol 14: 329A, 2003.

6. Bourdon E, Kang DK, Ghosh MC, Drake SK, Wey J, Levine RL, and Rouault TA. The role of endogenous heme synthesis and degradation domain cysteines in cellular iron-dependent degradation of IRP2. Blood Cells Mol Dis 31: 247–255, 2003.[CrossRef][Web of Science][Medline]

7. Bouton C, Oliveira L, and Drapier JC. Converse modulation of IRP1 and IRP2 by immunological stimuli in murine RAW 264.7 macrophages. J Biol Chem 273: 9403–9408, 1998.[Abstract/Free Full Text]

8. Brekelmans P, van Soest P, Voerman J, Platenburg PP, Leenen PJ, and van Ewijk W. Transferrin receptor expression as a marker of immature cycling thymocytes in the mouse. Cell Immunol 159: 331–339, 1994.[CrossRef][Web of Science][Medline]

9. Brenner S. The genetics of Caenorhabditis elegans. Genetics 77: 71–94, 1974.[Abstract/Free Full Text]

10. Busfield SJ, Tilbrook PA, Callus BA, Spadaccini A, Kuhn L, and Klinken SP. Complex regulation of transferrin receptors during erythropoietin-induced differentiation of J2E erythroid cells—elevated transcription and mRNA stabilisation produce only a modest rise in protein content. Eur J Biochem 249: 77–84, 1997.[Web of Science][Medline]

11. Chan RY, Seiser C, Schulman HM, Kuhn LC, and Ponka P. Regulation of transferrin receptor mRNA expression. Distinct regulatory features in erythroid cells. Eur J Biochem 220: 683–692, 1994.[Web of Science][Medline]

12. Chaudhary J, Cupp AS, and Skinner MK. Role of basic-helix-loop-helix transcription factors in Sertoli cell differentiation: identification of an E-box response element in the transferrin promoter. Endocrinology 138: 667–675, 1997.[Abstract/Free Full Text]

13. Chen X, Wang LQ, Huang Y, Qiu P, Murgolo NJ, Greene JR, Wu CH, and Jiang Y. IRE_FINDER-computational search of iron response element in human and mouse UTRs. Sheng Wu Hua Xue Yu Sheng Wu Wu Li Xue Bao (Shanghai) 34: 743–747, 2002.[Medline]

14. Cherry SR, Biniszkiewicz D, van Parijs L, Baltimore D, and Jaenisch R. Retroviral expression in embryonic stem cells and hematopoietic stem cells. Mol Cell Biol 20: 7419–7426, 2002.

15. Chitambar CR and Wereley JP. Resistance to the antitumor agent gallium nitrate in human leukemic cells is associated with decreased gallium/iron uptake, increased activity of iron regulatory protein-1, and decreased ferritin production. J Biol Chem 272: 12151–12157, 1997.[Abstract/Free Full Text]

16. Constable A, Quick S, Gray NK, and Hentze MW. Modulation of the RNA-binding activity of a regulatory protein by iron in vitro: switching between enzymatic and genetic function? Proc Natl Acad Sci USA 89: 4554–4558, 1992.[Abstract/Free Full Text]

17. Drapier JC, Hirling H, Wietzerbin J, Kaldy P, and Kuhn LC. Biosynthesis of nitric oxide activates iron regulatory factor in macrophages. EMBO J 12: 3643–3649, 1993.[Web of Science][Medline]

18. Eisenstein R and Blemings KP. Iron regulatory proteins, iron responsive elements and iron homeostasis. J Nutr 128: 2295–2298, 1998.[Abstract/Free Full Text]

19. Ekblom P, Thesleff I, Saxen L, Miettinen A, and Timpl R. Transferrin as a fetal growth factor: acquisition of responsiveness related to embryonic induction. Proc Natl Acad Sci USA 80: 2651–2655, 1983.[Abstract/Free Full Text]

20. Epsztejn S, Kakhlon O, Glickstein H, Breuer W, and Cabantchik ZI. Fluorescence analysis of the labile iron pool of mammalian cells. Anal Biochem 248: 31–40, 1997.[CrossRef][Web of Science][Medline]

21. Esposito BP, Epsztejn S, Breuer W, and Cabantchik ZI. A review of fluorescence methods for assessing labile iron in cells and biological fluids. Anal Biochem 304: 1–18, 2002.[CrossRef][Web of Science][Medline]

22. Feder JN, Penny DM, Irrinki A, Lee VK, Lebron JA, Watson N, Tsuchihashi Z, Sigal E, Bjorkman PJ, and Schatzman RC. The hemochromatosis gene product complexes with the transferrin receptor and lowers its affinity for ligand binding. Proc Natl Acad Sci USA 95: 1472–1477, 1998.[Abstract/Free Full Text]

23. Festa M, Ricciardelli G, Mele G, Pietropaolo C, Ruffo A, and Colonna A. Overexpression of H ferritin and up-regulation of iron regulatory protein genes during differentiation of 3T3-L1 pre-adipocytes. J Biol Chem 275: 36708–36712, 2000.[Abstract/Free Full Text]

24. Fleming S and Jones DB. Immunocytochemical evidence for transferrin-dependent proliferation during renal tubulogenesis. J Anat 153: 191–201, 1987.[Web of Science][Medline]

25. Flower DR, North AC, and Sansom CE. The lipocalin protein family: structural and sequence overview. Biochim Biophys Acta 1482: 9–24, 2000.[CrossRef][Medline]

26. Garate MA and Nunez MT. Overexpression of the ferritin iron-responsive element decreases the labile iron pool and abolishes the regulation of iron absorption by intestinal epithelial (Caco-2) cells. J Biol Chem 275: 1651–1655, 2000.[Abstract/Free Full Text]

27. Gazitt Y, Reddy SV, Alcantara O, Yang J, and Boldt DH. A new molecular role for iron in regulation of cell cycling and differentiation of HL-60 human leukemia cells: iron is required for transcription of p21(WAF1/CIP1) in cells induced by phorbol myristate acetate. J Cell Physiol 187: 124–135, 2001.[CrossRef][Web of Science][Medline]

28. Goetz DH, Holmes MA, Borregaard N, Bluhm ME, Raymond KN, and Strong RK. The neutrophil lipocalin NGAL is a bacteriostatic agent that interferes with siderophore-mediated iron acquisition. Mol Cell 10: 1033–1043, 2002.[CrossRef][Web of Science][Medline]

29. Goetze B, Grunewald B, Kiebler MA, and Macchi P. Coupling the iron-responsive element to GFP—an inducible system to study translation in a single living cell. Sci STKE 2003: PL12, 2003.[Medline]

30. Gourley BL, Parker SB, Jones BJ, Zumbrennen KB, and Leibold EA. Cytosolic aconitase and ferritin are regulated by iron in Caenorhabditis elegans. J Biol Chem 278: 3227–3234, 2003.[Abstract/Free Full Text]

31. Gross CN, Irrinki A, Feder JN, and Enns CA. Co-trafficking of HFE, a nonclassical major histocompatibility complex class I protein, with the transferrin receptor implies a role in intracellular iron regulation. J Biol Chem 273: 22068–22074, 1998.[Abstract/Free Full Text]

32. Haile DJ. Regulation of genes of iron metabolism by the iron-response proteins. Am J Med Sci 318: 230–240, 1999.[CrossRef][Web of Science][Medline]

33. Hanson ES and Leibold EA. Regulation of iron regulatory protein 1 during hypoxia and hypoxia/reoxygenation. J Biol Chem 273: 7588–7593, 1998.[Abstract/Free Full Text]

34. Hanson ES, Rawlins ML, and Leibold EA. Oxygen and iron regulation of iron regulatory protein 2. J Biol Chem 278: 40337–40342, 2003.[Abstract/Free Full Text]

35. Henderson BR and Kuhn LC. Differential modulation of the RNA-binding proteins IRP-1 and IRP-2 in response to iron. IRP-2 inactivation requires translation of another protein. J Biol Chem 270: 20509–20515, 1995.[Abstract/Free Full Text]

36. Henderson RJ, Patton SM, and Connor JR. Development of a novel method for the measurement of cellular iron levels and iron-regulated protein expression. BioIron 2003. 16th International Conference of the International BioIron Society, NIH. Bethesda, MD, May 4–9, 2003 (poster abst 195).

37. Hentze MW, Caughman SW, Rouault TA, Barriocanal G, Dancis A, Harford JB, and Klausner RD. Identification of the iron-responsive element for the translational regulation of human ferritin mRNA. Science 238: 1570–1573, 1987.[Abstract/Free Full Text]

38. Hirsch S and Miskimins W. Mitogen induction of nuclear factors that interact with a delayed responsive region of the transferrin receptor gene promoter. Cell Growth Differ 6: 719–726, 1995.[Abstract]

39. Iwai K, Klausner RD, and Rouault TA. Requirements for iron-regulated degradation of the RNA binding protein, iron regulatory protein 2. EMBO J 14: 5350–5357, 1995.[Web of Science][Medline]

40. Kanayasu-Toyoda T, Yamaguchi T, Uchida E, and Hayakawa T. Commitment of neutrophilic differentiation and proliferation of HL-60 cells coincides with expression of transferrin receptor. Effect of granulocyte colony stimulating factor on differentiation and proliferation. J Biol Chem 274: 25471–25480, 1999.[Abstract/Free Full Text]

41. Kim S and Ponka P. Control of transferrin receptor expression via nitric oxide-mediated modulation of iron-regulatory protein 2. J Biol Chem 274: 33035–33042, 1999.[Abstract/Free Full Text]

42. Kim S and Ponka P. Effects of interferon-{gamma} and lipopolysaccharide on macrophage iron metabolism are mediated by nitric oxide-induced degradation of iron regulatory protein 2. J Biol Chem 275: 6220–6226, 2000.[Abstract/Free Full Text]

43. Kim S and Ponka P. Nitrogen monoxide-mediated control of ferritin synthesis: implications for macrophage iron homeostasis. Proc Natl Acad Sci USA 99: 12214–12219, 2002.[Abstract/Free Full Text]

44. Kim S, Wing SS, and Ponka P. S-nitrosylation of IRP2 regulates its stability via the ubiquitin-proteasome pathway. Mol Cell Biol 24: 330–337, 2004.[Abstract/Free Full Text]

45. Klausner RD and Rouault TA. The molecular basis of iron metabolism. In: The Harvey Lectures. New York: Wiley-Liss, 1998, vol. 92, p. 99–112.

46. LaVaute T, Smith S, Cooperman S, Iwai K, Land W, Meyron-Holtz E, Drake SK, Miller G, Abu-Asab M, Tsokos M, Switzer R, Grinberg A, Love P, Tresser N, and Rouault TA. Targeted deletion of the gene encoding iron regulatory protein-2 causes misregulation of iron metabolism and neurodegenerative disease in mice. Nat Genet 27: 209–214, 2001.[CrossRef][Web of Science][Medline]

47. Leibold EA, Gahring LC, and Rogers SW. Immunolocalization of iron regulatory protein expression in the murine central nervous system. Histochem Cell Biol 115: 195–203, 2001.[Web of Science][Medline]

48. Leibold EA and Munro HN. Cytoplasmic protein binds in vitro to a highly conserved sequence in the 5' untranslated region of ferritin heavy- and light-subunit mRNAs. Proc Natl Acad Sci USA 85: 2171–2175, 1988.[Abstract/Free Full Text]

49. Levy JE, Jin O, Fujiwara Y, Kuo F, and Andrews NC. Transferrin receptor is necessary for development of erythrocytes and the nervous system. Nat Genet 21: 396–399, 1999.[CrossRef][Web of Science][Medline]

50. Lok CN and Ponka P. Identification of a hypoxia response element in the transferrin receptor gene. J Biol Chem 274: 24147–25152, 1999.[Abstract/Free Full Text]

51. Lok CN, Chan KF, and Loh TT. Transcriptional regulation of transferrin receptor expression during phorbol-ester-induced HL-60 cell differentiation. Evidence for a negative regulatory role of the phorbol-ester-responsive element-like sequence. Eur J Biochem 236: 614–619, 1996.[Web of Science][Medline]

52. Macchi P, Hemraj I, Goetze B, Grunewald B, Mallardo M, and Kiebler MA. A GFP-based system to uncouple mRNA transport from translation in a single living neuron. Mol Biol Cell 14: 1570–1582, 2003.[Abstract/Free Full Text]

53. Marziali G, Perrotti E, Ilari R, Lulli V, Coccia EM, Moret R, Kuhn LC, Testa U, and Battistini A. Role of Ets-1 in transcriptional regulation of transferrin receptor and erythroid differentiation. Oncogene 21: 7933–7944, 2002.[CrossRef][Web of Science][Medline]

54. McGraw TE, Greenfield L, and Maxfield FR. Functional expression of the human transferrin receptor cDNA in Chinese hamster ovary cells deficient in endogenous transferrin receptor. J Cell Biol 105: 207–214, 1987.[Abstract/Free Full Text]

55. Mello CC, Kramer JM, Stinchcomb DT, and Ambros V. Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J 10: 3959–3970, 1991.[Web of Science][Medline]

56. Meyron-Holtz EG, Ghosh MC, Iwai K, LaVaute T, Brazzolotto X, Berger UV, Land W, Ollivierre-Wilson H, Grinberg A, Love P, and Rouault TA. Genetic ablations of iron regulatory proteins 1 and 2 reveal why iron regulatory protein 2 dominates iron homeostasis. EMBO J 23: 386–395, 2004.[CrossRef][Web of Science][Medline]

57. Miller JC and Miller JN. Statistics for Analytical Chemistry. New York: Wiley, 1984, chapts. 2 and 3, p. 46–48.

58. Naviaux RK, Costanzi E, Haas M, and Verma IM. The pCL vector system: rapid production of helper-free, high-titer, recombinant retroviruses. J Virol 70: 5701–5705, 1996.[Abstract/Free Full Text]

59. Ned RM, Swat W, and Andrews NC. Transferrin receptor 1 is differentially required in lymphocyte development. Blood 102: 3711–3718, 2003.[Abstract/Free Full Text]

60. Oshiro S, Nozawa K, Hori M, Zhang C, Hashimoto Y, Kitajima S, and Kawamura K. Modulation of iron regulatory protein-1 by various metals. Biochem Biophys Res Commun 290: 213–218, 2002.[CrossRef][Web of Science][Medline]

61. Pantopoulos K, Weiss G, and Hentze MW. Nitric oxide and oxidative stress (H2O2) control mammalian iron metabolism by different pathways. Mol Cell Biol 16: 3781–3788, 1996.[Abstract]

62. Ponka P. Tissue-specific regulation of iron metabolism and heme synthesis: distinct control mechanisms in erythroid cells. Blood 89: 1–25, 1997.[Abstract/Free Full Text]

63. Ponka P and Lok C. The transferrin receptor: role in health and disease. Int J Biochem Cell Biol 31: 1111–1137, 1999.[CrossRef][Web of Science][Medline]

64. Ponka P, Schulman HM, and Woodworth RC. Iron Transport and Storage. Boston, MA: CRC, 1990, chapt. 10.

65. Richardson DR, Neumannova V, Nagy E, and Ponka P. The effect of redox-related species of nitrogen monoxide on transferrin and iron uptake and cellular proliferation of erythroleukemia (K562) cells. Blood 86: 3211–3219, 1995.[Abstract/Free Full Text]

66. Riedel HD, Muckenthaler MU, Gehrke SG, Mohr I, Brennan K, Herrmann T, Fitscher BA, Hentze MW, and Stremmel W. HFE downregulates iron uptake from transferrin and induces iron-regulatory protein activity in stably transfected cells. Blood 94: 3915–3921, 1999.[Abstract/Free Full Text]

67. Rogers JT. Ferritin translation by interleukin-1 and interleukin-6: the role of sequences upstream of the start codons of the heavy and light subunit genes. Blood 87: 2525–2537, 1996.[Abstract/Free Full Text]

68. Roskams AJ and Connor JR. Iron, transferrin, and ferritin in the rat brain during development and aging. J Neurochem 63: 709–716, 1994.[Web of Science][Medline]

69. Rouault TA, Hentze MW, Caughman SW, Harford JB, and Klausner RD. Binding of a cytosolic protein to the iron-responsive element of human ferritin messenger RNA. Science 241: 1207–1210, 1988.[Abstract/Free Full Text]

70. Rouault TA and Klausner R. Regulation of iron metabolism in eukaryotes. Curr Top Cell Regul 35: 1–19, 1997.[Web of Science][Medline]

71. Roy CN, Blemings KP, Deck KM, Davies PS, Anderson EL, Eisenstein RS, and Enns CA. Increased IRP-1 and IRP-2 RNA binding activity accompanies a reduction of the labile iron pool in HFE-expressing cells. J Cell Physiol 190: 218–226, 2002.[CrossRef][Web of Science][Medline]

72. Roy CN, Penny DM, Feder JN, and Enns CA. The hereditary hemochromatosis protein, HFE, specifically regulates transferrin-mediated iron uptake in HeLa cells. J Biol Chem 274: 9022–9028, 1999.[Abstract/Free Full Text]

73. Seiser C, Teixeira S, and Kuhn LC. Interleukin-2-dependent transcriptional and post-transcriptional regulation of transferrin receptor mRNA. J Biol Chem 268: 13074–13080, 1993.[Abstract/Free Full Text]

74. Siddappa AJ, Rao RB, Wobken JD, Leibold EA, Connor JR, and Georgieff MK. Developmental changes in the expression of iron regulatory proteins and iron transport proteins in the perinatal rat brain. J Neurosci Res 68: 761–775, 2002.[CrossRef][Web of Science][Medline]

75. Soum E and Drapier JC. Nitric oxide and peroxynitrite promote complete disruption of the [4Fe-4S] cluster of recombinant human iron regulatory protein 1. J Biol Inorg Chem 8: 226–232, 2003.[CrossRef][Web of Science][Medline]

76. Sposi N, Cianetti L, Tritarelli E, Pelosi E, Militi S, Barberi T, Gabbianelli M, Saulle E, Kuhn L, Peschle C, and Testa U. Mechanisms of differential transferrin receptor expression in normal hematopoiesis. Eur J Biochem 267: 6762–6774, 2000.[Web of Science][Medline]

77. Srinivas S, Watanabe T, Lin CS, William CM, Tanabe Y, Jessell TM, and Costantini F. Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus. BMC Dev Biol 1: 4, 2001.[CrossRef][Medline]

78. Sturrock A, Alexander J, Lamb J, Craven C, and Kaplan J. Characterization of a transferrin-independent uptake system for iron in HeLa cells. J Biol Chem 265: 3139–3145, 1990.[Abstract/Free Full Text]

79. Tacchini L, Bianchi L, Bernelli ZA, and Cairo G. Transferrin receptor induction by hypoxia. HIF-1-mediated transcriptional activation and cell-specific post-transcriptional regulation. J Biol Chem 274: 24142–24146, 1999.[Abstract/Free Full Text]

80. Testa U, Kuhn L, Petrini M, Quaranta MT, Pelosi E, and Peschle C. Differential regulation of iron regulatory element-binding protein(s) in cell extracts of activated lymphocytes versus monocytes-macrophages. J Biol Chem 266: 13925–13930, 1991.[Abstract/Free Full Text]

81. Waheed A, Grubb JH, Zhou XY, Tomatsu S, Fleming R, Costaldi M, Britton RS, Bacon BS, and Sly WS. Regulation of transferrin-mediated iron uptake by HFE, the protein defective in hereditary hemochromatosis. Proc Natl Acad Sci USA 99: 3117–3122, 2002.[Abstract/Free Full Text]

82. Wang J, Chen GH, Muckenthaler M, Galy B, Hentze MW, and Pantopoulos K. Iron-mediated degradation of IRP2, an unexpected pathway involving a 2-oxoglutarate-dependent oxygenase activity. Mol Cell Biol 24: 954–965, 2004.[Abstract/Free Full Text]

83. Wang J, Tokarz R, and Savage-Dunn C. The expression of TGF{beta} signal transducers in the hypodermis regulates body size in C. elegans. Development 129: 4989–4998, 2002.[Abstract/Free Full Text]

84. Weiss G, Bogdan G, and Hentze MW. Pathways for the regulation of macrophage iron metabolism by the anti-inflammatory cytokines IL-4 and IL-13. J Immunol 158: 420–425, 1997.[Abstract]

85. Weiss G, Goossen B, Doppler W, Fuchs D, Pantopoulos K, Werner-Felmayer G, Wachter H, and Hentze MW. Translational regulation via iron-responsive elements by the nitric oxide/NO-synthase pathway. EMBO J 12: 3651–3657, 1993.[Web of Science][Medline]

86. Yamaguchi-Iwai Y, Ueta R, Fukunaka A, and Sasaki R. Subcellular localization of Aft1 transcription factor responds to iron status in Saccharomyces cerevisiae. J Biol Chem 277: 18914–18918, 2002.[Abstract/Free Full Text]

87. Yang J, Goetz D, Li JY, Wang W, Mori K, Setlik D, Du T, Erdjument-Bromage H, Tempst P, Strong R, and Barasch J. An iron delivery pathway mediated by a lipocalin. Mol Cell 10: 1045–1056, 2002.[CrossRef][Web of Science][Medline]

88. Yang J, Mori K, Li JY, and Barasch J. Iron, lipocalin, and kidney epithelia. Am J Physiol Renal Physiol 285: F9–F18, 2003.[Abstract/Free Full Text]

89. Ye Z and Connor J. Screening of transcriptionally regulated genes following iron chelation in human astrocytoma cells. Biochem Biophys Res Commun 264: 709–713, 1999.[CrossRef][Web of Science][Medline]

90. Zakin MM, Baron B, and Guillou F. Regulation of the tissue-specific expression of transferrin gene. Dev Neurosci 24: 222–226, 2002.[CrossRef][Web of Science][Medline]




This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
P. N. Paradkar, K. B. Zumbrennen, B. H. Paw, D. M. Ward, and J. Kaplan
Regulation of Mitochondrial Iron Import through Differential Turnover of Mitoferrin 1 and Mitoferrin 2
Mol. Cell. Biol., February 15, 2009; 29(4): 1007 - 1016.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
K. M. Schmidt-Ott, K. Mori, J. Y. Li, A. Kalandadze, D. J. Cohen, P. Devarajan, and J. Barasch
Dual Action of Neutrophil Gelatinase-Associated Lipocalin
J. Am. Soc. Nephrol., February 1, 2007; 18(2): 407 - 413.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
S. Venkatesha, J.-i. Hanai, P. Seth, S. A. Karumanchi, and V. P. Sukhatme
Lipocalin 2 Antagonizes the Proangiogenic Action of Ras in Transformed Cells
Mol. Cancer Res., November 1, 2006; 4(11): 821 - 829.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-i. Hanai, T. Mammoto, P. Seth, K. Mori, S. A. Karumanchi, J. Barasch, and V. P. Sukhatme
Lipocalin 2 Diminishes Invasiveness and Metastasis of Ras-transformed Cells
J. Biol. Chem., April 8, 2005; 280(14): 13641 - 13647.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
N. C. Andrews
Probing the iron pool. Focus on "Detection of intracellular iron by its regulatory effect"
Am J Physiol Cell Physiol, December 1, 2004; 287(6): C1537 - C1538.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
287/6/C1547    most recent
00260.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (9)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, J.-Y.
Right arrow Articles by Barasch, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, J.-Y.
Right arrow Articles by Barasch, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.