Am J Physiol Cell Physiol Watch the video to see how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 287: C1012-C1022, 2004. First published June 16, 2004; doi:10.1152/ajpcell.00101.2004
0363-6143/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
287/4/C1012    most recent
00101.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bein, K.
Right arrow Articles by Drinane, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bein, K.
Right arrow Articles by Drinane, M.

VASCULAR BIOLOGY

Role of TGF-{beta}1 and JNK signaling in capillary tube patterning

Kiflai Bein, Elizabeth T. Odell-Fiddler, and Mary Drinane

Angiogenesis Research Center, Department of Medicine, Dartmouth-Hitchcock Medical Center, Dartmouth College, Lebanon, New Hampshire 03756

Submitted 19 February 2004 ; accepted in final form 11 June 2004


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The transforming growth factor (TGF) family of secretory polypeptides comprises signaling proteins involved in numerous physiological processes, including vascular development and vessel wall integrity. Both pro- and anti-angiogenic effects of TGF-{beta}1 have also been documented. To study the intracellular mechanisms involved in capillary tube morphogenesis, endothelial cell aggregates were cultured in a fibrin matrix. It was found that the pattern of capillary tubes formed in a fibrin matrix was altered in response to TGF-{beta}1 treatment such that the capillary-like structures displayed a bipolarized pattern. In contrast, in untreated control and fibroblast growth factor-2-treated cells, the pattern of capillary tubes formed was random. TGF-{beta}1 also downregulated urokinase-type plasminogen activator (uPA) activity while upregulating PA inhibitor (PAI)-1 and thrombospondin (TSP)1 gene expression. To investigate the signaling cascade mediating the phenotypic changes observed, pharmacological inhibitors of p38 MAPK, Sp1 transcription factor, c-Jun NH2-terminal kinase (JNK), and the cytokine TNF-{alpha} were used. The p38 MAPK inhibitor SB203580 reversed the TGF-{beta}1-dependent inhibition of uPA activity but not its morphogenetic effect. In contrast, the DNA intercalator WP631 and TNF-{alpha} counteracted the TGF-{beta}1-induced morphogenetic effect while the JNK inhibitor SP600125 effectively inhibited capillary tube formation. These results indicate that the TGF-{beta}1-induced capillary tube pattern is independent of the p38 MAPK-activated PAI-1 and TSP1 expression, but the mechanism involves Sp1-dependent transcriptional regulation. The results also raise the possibility that the JNK pathway, which controls convergent extension in Xenopus, may be involved in vessel wall patterning in mammalian systems.

metalloproteinase; plasminogen activator; p38 MAPK; thrombospondin 1; Sp1


THE DEVELOPMENTAL PROCESSES of blood vessel formation and organogenesis are intimately coordinated. Endothelial cells that arise from angioblast clumps, in conjunction with associated cells and the extracellular matrix, organize into a complex network of blood vessels and form a hierarchical tubular system commonly known as the vascular tree. As exemplified by the vasculature in the lungs and the heart, the vascular system develops a pattern that matches the anatomical architecture and physiological requirements of different parts of the body. The microenvironment in different vascular beds provides guidance signals that direct a given vascular pattern. Although many secreted and cell-associated molecules critical for vasculogenesis and angiogenesis are known, the cellular and molecular mechanisms underlying vascular patterning and, in particular, the cues for cellular assembly into vessels are not well understood.

The matrix proteins in the microenvironment are known to modulate cellular activities. On the basis of studies performed using fibronectin, collagen, matrigel, and fibrin matrices, it has been proposed that traction forces exerted by cells on viscoelastic substrata induce reorganization of the vicinal matrix into cords that provide positional information for the development of capillary-like structures (13, 26, 57, 58). However, endothelial cell morphogenesis into tubelike structures depends on random motility (50) and exposure to extracellular matrix proteins, as well as synthesis of endogenous proteins by the endothelial cells in response to extracellular stimuli (27, 39, 49).

Transforming growth factor (TGF)-{beta}1 is one of the numerous proteins that are critical to the assembly of endothelial and supportive cells into efficient blood vessels. After the binding of active TGF-{beta}1 with its receptors, the vertebrate gene products related to mothers against decapentaplegia in Drosophila (SMAD) signaling proteins are activated and modulate the production of many extracellular matrix proteins involved in the regulation of angiogenesis, including plasminogen activator inhibitor (PAI)-1 and thrombospondin (TSP)1 proteins via p38 MAPK activation (52). TSP1 protein, in addition to activating the latent forms of TGF-{beta}1 (47, 48), has been shown to inhibit lumen formation by microvascular endothelial cells (53). In support of the role of TSP1 in regulating TGF-{beta}1 activity, studies of the phenotypes of TGF-{beta}1 and TSP1 null mice reveal similar histopathological effects in multiple organ systems, particularly the lung and pancreas (12).

In vivo studies highlight the importance of TGF-{beta}1 signaling pathways in vasculogenesis and vessel wall integrity (42). Differentiation of extraembryonic endothelial cells into capillary-like tubules is defective in knockout mice that lack TGF-{beta}1; the TGF-{beta} receptors endoglin, T{beta}R-II, activin receptor-like kinase (ALK)1, and ALK5; and the signaling intermediate protein SMAD5 (9). The vessel wall fragility observed in homozygous TGF-{beta}1 and TGF-{beta} receptor null mice is reminiscent of the vascular lesions in patients diagnosed with hereditary hemorrhagic telangiectasia (HHT). Mutations in endoglin or Alk-1 cause angiodysplastic lesions in distinct subsets of families diagnosed with HHT (2).

In addition to the significant knowledge gained from gene knockout and other studies, many details of the signal transduction pathways elicited by growth factors acting on endothelial cells are known. However, it is not clear how the various signaling pathways are integrated during the different phases of the angiogenic processes: endothelial cell shape changes, cellular alignment into a network of cords, lumen formation, and maturation into functional blood-transporting and nutrient- and gas-exchanging vessels. A better understanding of the molecular mechanisms underlying vascular patterning would greatly advance the effectiveness of strategies aimed at promoting or inhibiting new blood vessel formation. One potential application that could develop from an improved understanding of the signaling cues that determine the path of vessel growth would be directing new vessel growth to a particular tissue region of interest (e.g., an ischemic area or a wound) or interference with gene products that are critical in vascular patterning (e.g., cancer). This study describes capillary tube patterning in a fibrin matrix. The results suggest that TGF-{beta}1 treatment of endothelial cells causes a change in capillary tube patterning through a signaling cascade that is independent of p38 MAPK activation. The findings also suggest that the c-Jun NH2-terminal kinase (JNK) signaling pathway plays an important role in capillary tube formation in a fibrin matrix.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Cell cultures. Bovine aortic endothelial cells (BAEC) isolated from aorta obtained from a local slaughterhouse (4) were maintained in DMEM supplemented with 10% heat-inactivated fetal bovine serum, nonessential amino acids, 2 mM glutamine, 100 µg/ml penicillin, and 100 µg/ml streptomycin (Invitrogen) at 37°C in 5% CO2. Human recombinant TGF-{beta}1 was purchased from Sigma Chemical (St. Louis, MO) or R&D Systems (Minneapolis, MN). TNF-{alpha} and thrombin were purchased from Sigma Chemical. SB203580, WP631, JNK inhibitor II (SP600125), and plasminogen-depleted fibrinogen were purchased from Calbiochem (San Diego, CA).

Preparation of BAEC aggregates. BAEC aggregates were prepared by a modification of a previously described method (44). BAEC monolayers were rinsed twice with PBS, detached using enzyme-free dissociation solution, centrifuged, and resuspended in serum-free DMEM. Cell suspensions were added to 96-well plates precoated with 1.5% agarose (50,000–75,000 cells/well). The cells were incubated overnight at 37°C to allow formation of cell aggregates.

In vitro angiogenesis assay in fibrin gels. Fibrin gels were prepared by addition of thrombin (1 U/ml) to a solution of plasminogen-depleted fibrinogen (3 mg/ml) in serum-free DMEM supplemented with 0.1% {epsilon}-aminocaproic acid and 2 µg/ml aprotinin. To make the underlying fibrin gel, 0.25 ml of fibrin solution was placed into each well of a 48-well culture plate and incubated at 37°C for 30 min. After the gels were polymerized, the endothelial cell aggregates were seeded onto the gel layer (up to 8 major aggregates/well) and allowed to attach by incubating at 37°C for 4–6 h. To assess the effect of inhibitors, cell aggregates were preincubated in SB203580, WP631, and SP600125 during the attachment period. The supernatant culture medium was removed, and 0.3 ml of fibrin solution containing the experimental reagent(s) was added on top of the aggregates to form the overlying fibrin gel. The culture was incubated at 37°C for 30 min to ensure polymerization. Serum-free medium supplemented with {epsilon}-aminocaproic acid and aprotinin, as indicated above, plus the reagent(s) under study were added to each well (0.3 ml/well). For concentrations of reagents used, see RESULTS.

The culture medium was replaced with supplemented fresh medium every 24 h. In each experiment, multiple wells (2–6 wells) were used for each experimental condition. The data presented in this report were obtained using BAEC derived from a local slaughterhouse, and the cells were between passages 6 and 8. Similar results were obtained using two different batches of BAEC purchased from Clonetics (San Diego, CA), between passages 3 and 5. In addition, multiple batches of recombinant TGF-{beta}1 purchased from Sigma and R&D Systems exhibited similar effects. The culture medium from multiple wells was pooled for analysis of enzyme activity. Images of tubular structures were taken using a SPOT INSIGHT QE camera attached to a Nikon microscope at a magnification of x100.

Image analysis. Regions of the images of the tubular structures (400 x 400 pixels) were selected for analysis of directionality. A MatLAB script designed for this study was used to process the images. The script makes use of the Canny method for edge diction to separate cells from the background (7) and the MatLAB function bwlabed to identify objects in an image on the basis of connectivity of the pixels. The function bwlabed, when used in conjunction with the function regionprops, is able to calculate values for eccentricity and orientation of each object identified in an image. The values of eccentricity, which are a measure of linearity with a value of 0 being a circle and a value of 1 being a line segment, were averaged for all objects within the image. The orientation of the objects (i.e., the angle) relative to the x-axis was measured in degrees, and the standard deviation of all the angles determined for the objects in a given image was used as a measure of orientation of the structures. The logic behind this index is that if all objects are oriented in the same direction, the standard deviation will be low, and if the objects are not oriented in one direction, the standard deviation will be increased. In addition, the fractal dimension of each image was calculated using the box counting method (3, 30). Fractal dimension is a measure of the space-filling ability of a pattern. All P values were calculated using a two-tailed Student’s t-test.

Zymographic analysis of conditioned medium. Casein zymography was performed on 10% or 12% SDS-polyacrylamide gels containing 2 mg/ml {alpha}-casein (Sigma Chemical) and 34 µg/ml plasminogen (American Diagnostica, Stamford, CT). After electrophoresis, the gel was washed twice (30 min each) in 2.5% Triton X-100 and incubated in zymography buffer (50 mM Tris·HCl, pH 8.0, and 10 mM CaCl2) for 24–48 h. Caseinolytic activity was visualized as a clear zone with Coomassie Brilliant Blue R-250 staining.

Gelatin zymography was performed on 10% SDS-polyacrylamide gels containing 0.1% gelatin (Sigma Chemical). To perform reverse gelatin zymography, 30 ng/ml pro-matrix metalloproteinase (MMP)9 (Calbiochem) were added to the gel. After a washing in 2.5% Triton X-100, the gels were incubated overnight in zymography buffer (50 mM Tris·HCl, pH 7.5, 150 mM NaCl, 10 mM CaCl2, and 0.2% NaN3). Gelatinolytic and inhibitory activity was visualized as a clear or dark zone, respectively, with Coomassie Brilliant Blue R-250 staining.

Northern blotting. Total RNA from BAEC was prepared using TriReagent solution (Sigma Chemical). For Northern blot analysis, RNA samples (10 µg/lane) were fractionated by electrophoresis on a 1.3% agarose formaldehyde gel and transferred to GeneScreen Plus membrane (NEN Life Science Products, Boston, MA). Hybridization with 32P-labeled probes was performed at 68°C for 1.5–3 h in Quickhyb solution (Stratagene, La Jolla, CA). After hybridization, filters were washed twice at room temperature in 2x SSC, 0.1% SDS for 5–10 min each at 55–68°C, and in 0.1x SSC, 0.1% SDS for 15–30 min at room temperature, and subjected to autoradiography. All cDNA probes were prepared by random primer labeling followed by purification using a Sephadex G-50 spin column (Roche Molecular Products, Alameda, CA).

The probe used to detect TSP1 was a 675-bp XmnI enzyme fragment of murine TSP1 cDNA. To detect PAI-1 and urokinase-type (u) plasminogen activator (PA) mRNAs, cDNA probes were generated by RT-PCR with the use of total RNA isolated from BAEC as a template. The primers used for RT-PCR amplification were as follows: 1) for PAI-1, the 5'-primer TCATTCCCAAATTCTCCAGC and the 3'-primer CAACGTGGTTTTCTCACCCT; 2) for uPA, the 5'-primer ACAATCCCAGTCAGGGTCAG and the 3'-primer AGGTCACCAACACCGAGAAC. RNA loading was verified using cDNA probes specific for the glyceraldehyde phosphate dehydrogenase (GAPDH) and the acidic ribosomal phosphoprotein PO (36B4) mRNAs.

Western blotting. Protein extracts were fractionated on 10% SDS-PAGE. After transfer to polyvinylidene difluoride (PVDF) membrane (PerkinElmer Life Sciences, Wellesley, MA) overnight at 24 V, the membrane was rinsed twice (5 min each) in Tris-buffered saline (TBS; 20 mM Tris, 500 mM NaCl, pH 7.5) and blocked for 1 h with 0.2% nonfat milk in TBS containing protease and phosphatase inhibitor cocktails. The membrane was then incubated with rabbit anti-full-length JNK (Santa Cruz Biotechnology, Santa Cruz, CA) and anti-phospho-JNK (Promega, Fitchburg, WI) in 0.2% nonfat milk in TBS containing 0.1% Tween 20 and protease and phosphatase inhibitor cocktails. The membrane was washed and then incubated with Alexa Fluor 488-conjugated goat anti-rabbit IgG (Molecular Probes, Eugene, OR). The signal was detected by use of a typhoon scanner.

In vitro kinase assays. BAEC cultured in 100-mm-diameter dishes were treated with serum-free medium containing the JNK inhibitor SP600125 (10 µM) up to 40 min. JNK activity assays were performed as described previously (24). At the indicated times, the culture plates were placed on ice. Cell monolayers were washed with cold PBS, and extracts were prepared in lysis buffer (20 mM Tris, pH 7.5, 1% Triton X-100, 10% glycerol, 137 mM NaCl, 2 mM EDTA, 25 mM {beta}-glycerophosphate, 1 mM Na3VO4, and EDTA-free protease inhibitor cocktail from Roche). The cell lysate was centrifuged for 15 min at 14,000 g, and the supernatant was retained for kinase assays. Because JNK has been identified as the only known kinase capable of phosphorylating c-Jun, total cell extracts were used for JNK activity assays. Aliquots containing 150 µg of total cellular protein were incubated with an equal volume of kinase buffer (25 mM Tris, pH 7.5, 5 mM {beta}-glycerophosphate, 2 mM DTT, 0.1 mM Na3VO4, 10 mM MgCl2, 5 µM ATP, and 10 µCi [{gamma}-32P]ATP) and 2 µg of glutathione S-transferase (GST)-c-Jun(1–89) (Cell Signaling, Beverly, MA) at 37°C for 30 min. Glutathione-Sepharose 4B (40 µl) was added to the reaction mix, and samples were rotated for 30 min at 4°C. Pellets were washed three times with PBS containing 1% Triton X-100 and resuspended in Laemmli sample buffer. The samples were heated at 95° for 4 min and fractionated on 10% SDS-PAGE gels and transferred to PVDF membrane (Millipore, Billerica, MA). To detect phosphorylated c-Jun(1–89), the blot was exposed to Kodak X-AR film. Total GST-c-Jun protein on the membrane was visualized by staining with Ponceau S dye (Sigma).

Assessment of cell cytotoxicity and migration. The effect of SB203580, WP631, and SP600125 treatment on BAEC cytotoxicity and migration was examined using a cytotoxicity detection kit (Promega) and an in vitro wounding assay, respectively. To assess cell cytotoxicity, BAEC harvested from a confluent culture were seeded in a 96-well plate precoated with fibrinogen (20,000 cells/well). The cells were incubated for 24 h to allow attachment. The medium was replaced with serum-free medium containing various concentrations of the inhibitors. After 24-h incubation, cell cytotoxicity assays were performed according to the manufacturer’s protocols. Fluorescent detection of resorufin produced by a coupled enzymatic reaction involving lactate dehydrogenase released by lysed cells was used to assess cytotoxicity.

Cell migration was investigated using the in vitro wounding assay. BAEC were seeded in a six-well dish (4 x 105 cells/well) and incubated overnight to allow attachment. Before scraping, the cell monolayers were preincubated for 1 h in serum-free medium containing the inhibitors and manually scraped with a pipette tip. The cultures were further incubated for 24 h. Digital images of the wounded areas were captured using an inverted microscope (x4 objective) immediately after wounding and 24 h later. The area of the wound within a defined image frame (450 x 800 pixels) was determined using the Spot software and used to calculate percent wound area closure as follows:


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
TGF-{beta}1 treatment of BAEC aggregates cultured in a fibrin matrix altered the pattern of capillary tubes formed. To study the molecular basis of endothelial cell morphogenesis during capillary tube formation, BAEC were cultured in a serum-free fibrin gel sandwich. Similar to endothelial cell suspensions plated on tissue culture dishes, BAEC aggregates plated on dishes coated with gelatin formed a monolayer. In addition, when BAEC aggregates were cultured on top of a fibrin gel, the cells at the perimeter of the aggregate migrated out radially and formed a monolayer. Only a subset of the cells in this monolayer invaded the underlying matrix and developed tubelike structures (unpublished observation), whereas all the cells migrating out from the perimeter of the BAEC aggregates embedded in a fibrin sandwich aligned into tubelike structures (Fig. 1). Although monolayer formation began within hours of cell plating, there was a delay in the formation of tubelike structures. One day after the culture was started, capillary tube formation was minimal under all the conditions tested, although cells treated with TGF-{beta}1 appeared more inhibited than cells treated with fibroblast growth factor (FGF)2 (Fig. 1). The initial delay in growth was followed by a rapid expansion of outgrowths after 2–5 days in culture. Cleavage of fibrinogen by thrombin leads to release of fibrinopeptides A and B from the NH2-terminal end of the A{alpha} and B{beta} chains of the three subunits of fibrinogen, followed by cross-linking and the formation of the fibrin matrix. The various cleavage products of fibrinogen and fibrin induce capillary tube formation. Both thrombin and fibrin have been shown to promote angiogenesis (8, 55).



View larger version (92K):
[in this window]
[in a new window]
 
Fig. 1. Transforming growth factor (TGF)-{beta}1 treatment of bovine aortic endothelial cells (BAEC) cultured in a fibrin gel sandwich altered the pattern of capillary tubes formed. The cultures were examined by phase-contrast microscopy. A: BAEC aggregates were cultured in a fibrin gel sandwich and examined after 1 day (left) or 5 days (right). The cells were cultured in serum-free medium in the absence (top) or presence of 5 ng/ml TGF-{beta}1 (middle) and 10 ng/ml fibroblast growth factor (FGF)2 (bottom). B: image processing. Regions (400 x 400 pixels) of control and TGF-{beta}1-treated images (left) were processed (right) using MatLAB script. CE: MatLAB analysis for linearity of pattern (C), orientation of pattern (D), and fractal dimension (Df) (E). The values shown are means ± SE (n = 4 or 5, see RESULTS) and are representative of 4 experiments. Bar = 100 µm.

 
Control cells and cells treated with FGF2 formed a randomly organized network of tubelike structures. The pattern remained random in the presence of higher concentrations of FGF2 (20 and 40 ng/ml) (unpublished observation). On the other hand, in the presence of TGF-{beta}1, the tubelike structures were more organized and arrayed forming planar, sheetlike extensions (Fig. 1A).

MatLAB programming was used to process the images of the tubular structures (Fig. 1B). Analysis of the images (Fig. 1C) showed that the eccentricity (linearity) value (mean ± SE) determined for TGF-{beta}1-treated cells was higher than for control cells [TGF-{beta}1: 0.9211 ± 0.0071, no. of images (n) = 5; control: 0.87102 ± 0.006417, n = 5; P = 0.00079]. On the other hand, the standard deviation of orientation (angle variation) (Fig. 1D) of TGF-{beta}1-treated cells was significantly lower than for control cells (TGF-{beta}1: 25.61 ± 1.04, n = 4; control: 48.95 ± 1.99, n = 5; P = 0.00003), showing that TGF-{beta}1 treatment induced formation of more linear structures oriented in a similar direction. Analysis of fractal dimension (space filling) (Fig. 1E) also showed that the TGF-{beta}1-treated cells had a more space-filling pattern than the control cells (TGF-{beta}1: 1.638 ± 0.0118, n = 5; control: 1.590 ± 0.0074, n = 4; P = 0.0153). These results are in agreement with the conclusion that TGF-{beta}1 treatment induced a bipolarized capillary tubelike pattern.

The TGF-{beta}1-induced pattern was more obvious in areas of high density of outgrowths and where outgrowths from neighboring cell aggregates anastomosed. These observations and the known stimulatory effect of TGF-{beta}1 on extracellular matrix protein production suggest that localized secretion of proteins from opposite ends of the tubular structures generates a chemoattractant concentration gradient for other cells. Alternatively, it is also possible that the altered pattern of tubular structures suggests that a change in the cellular microenvironment due to a localized increase in matrix protein expression contributes to the vessel directionality observed.

Inhibition of uPA activity in the presence of TGF-{beta}1. TGF-{beta}1-induced alteration of uPA/PAI-1 mRNA expression has been implicated in inhibition of lumen formation in vitro (43). To study whether regulation of the PA and MMP systems was associated with the change in capillary tube patterning, conditioned medium was analyzed for select enzymes and their respective inhibitors.

To determine whether the TGF-{beta}1-induced change in capillary tube patterning was dependent on membrane type (MT)1-MMP-mediated pericellular fibrinolysis, conditioned medium collected from cells cultured in the absence or presence of TGF-{beta}1 was analyzed for the presence of MMP2 by gelatin zymography. An increase in the amount of active MMP2 would have been indicative of an increase in MT1-MMP activity (32). As shown in Fig. 2, the latent form of MMP2 (proMMP2) was expressed at a high level. However, the level of active MMP2 (bottom band) detected in TGF-{beta}1-treated samples was indistinguishable from that detected in control and FGF2-treated samples. It is also unlikely that the higher level of MMP9 detected in the presence of TGF-{beta}1 (Fig. 2A) mediated the morphogenetic change. Although the level of MMP9 was higher in FGF2-treated samples than in control samples, the capillary tube pattern remained random. Similarly, no significant alterations in tissue inhibitor of metalloproteinases (TIMP)2 and TIMP3 expression levels were detected when conditioned medium from control and TGF-{beta}1-treated BAEC was analyzed either by reverse gelatin zymography (Fig. 2B) or by Western and Northern blotting analysis (unpublished observation). These results suggested that the MMPs analyzed did not play a required role in TGF-{beta}1-induced capillary tube patterning.



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 2. The pattern of matrix metalloproteinase (MMP) and tissue inhibitor of MMPs (TIMP) protein expression was similar. A: the conditioned medium of BAEC aggregates cultured in a fibrin gel sandwich was collected every 24 h and replaced with fresh serum-free medium containing 5 ng/ml TGF-{beta}1, 10 ng/ml FGF2, and a combination of both factors. An aliquot (10 µl) of the conditioned medium collected on days 1, 4, 7, and 10 was analyzed for the level of MMP2 and MMP9 expression by gelatin zymography. B: BAEC (4 x 106 cells/10-cm dish) were plated in complete medium and cultured overnight. The cell monolayer was rinsed and incubated in serum-free medium. After 6 h of incubation, the medium was replaced with fresh medium and collected immediately (day 0) or after 24 h (days 1 and 2) of incubation in the absence and presence of TGF-{beta}1 (5 ng/ml). An aliquot (30 µl) of the conditioned medium was analyzed for the level of TIMP2 and TIMP3 expression by reverse gelatin zymography.

 
To examine the possible role of the PA system in TGF-{beta}1-dependent capillary tube patterning, conditioned medium collected from angiogenic BAEC was analyzed by casein zymography. The pattern of plasmin and tissue-type PA (tPA) activity was similar in control cells and cells treated with FGF2 and TGF-{beta}1. In contrast, uPA activity was inhibited in a time-dependent manner in cells treated with TGF-{beta}1 (Fig. 3). Casein zymography offered a sensitive method for analysis of uPA activity and served as a biochemical indicator for the effect of TGF-{beta}1 on BAEC cultured in the fibrin gel system. The inhibition of uPA activity was due to a combination of decreased uPA and increased PAI-1 expression levels (see below).



View larger version (68K):
[in this window]
[in a new window]
 
Fig. 3. Urokinase-type (u) plasminogen activator (PA) activity was inhibited in the conditioned medium of BAEC treated with TGF-{beta}1. The conditioned medium of BAEC aggregates cultured in a fibrin gel sandwich was collected every 24 h and replaced with fresh serum-free medium containing TGF-{beta}1 (5 ng/ml), FGF2 (10 ng/ml), and a combination of FGF2 and TGF-{beta}1. An aliquot (25 µl) of the conditioned medium collected on days 1, 4, 7, and 10 was analyzed by casein zymography. tPA, tissue-type PA.

 
TGF-{beta}1 treatment of BAEC upregulated PAI-1 and TSP1 expression levels. RNA isolated from BAEC cultured on gelatin-coated dishes in the presence and absence of TGF-{beta}1 was analyzed for uPA, PAI-1, and TSP1 mRNA expression levels. The level of uPA mRNA expression was slightly decreased in cells treated with TGF-{beta}1 for 48 h (Fig. 4). In contrast, TGF-{beta}1 induced PAI-1 and TSP1 mRNA expression, and the induction was sustained for at least 48 h. Although induction of PAI-1 expression was detectable 24 h after the initiation of TGF-{beta}1 treatment of BAEC monolayers, there was a measurable level of uPA activity in the day 4 conditioned medium of BAEC aggregates cultured in the fibrin sandwich matrix (Fig. 4).



View larger version (69K):
[in this window]
[in a new window]
 
Fig. 4. TGF-{beta}1 treatment of BAEC induced prolonged upregulation of PA inhibitor (PAI)-1 and thrombospondin (TSP)1 mRNA expression levels. BAEC (2 x 106) were seeded on 10-cm dishes coated with gelatin and grown overnight. The monolayer was rinsed twice with PBS, and serum-free medium with (+) or without (–) TGF-{beta}1 (5 ng/ml) was added. After incubation for 24 or 48 h, total RNA was isolated and analyzed by Northern blotting using random-primed cDNA probes for GAPDH, uPA, PAI-1, and TSP1.

 
Inhibition of p38 MAPK activity counteracted TGF-{beta}1-dependent inhibition of uPA activity but not TGF-{beta}1-dependent phenotypic alteration. The p38 MAPK inhibitor SB203580 was used to evaluate the effect of TSP1 and PAI-1 expression on BAEC capillary tube patterning. When a monolayer of BAEC was treated with 5, 10, and 40 µM SB203580, both basal and TGF-{beta}1-induced PAI-1 and TSP1 mRNA expression levels decreased in a concentration-dependent manner, whereas 36B4 expression did not (Fig. 5). On the basis of these results, SB203580 treatment of BAEC cultured in a fibrin sandwich matrix was expected to inhibit p38 MAPK-dependent upregulation of PAI-1 expression, resulting in a net increase in uPA activity. As shown (Fig. 6A), when SB203580 and TGF-{beta}1 were added in combination, the presence of SB203580 reversed the inhibition of uPA activity in a dose-dependent manner.



View larger version (56K):
[in this window]
[in a new window]
 
Fig. 5. The p38 MAPK inhibitor SB203580 downregulated basal and TGF-{beta}1-induced TSP1 and PAI-1 mRNA levels. BAEC (4 x 106) were seeded on 10-cm dishes coated with gelatin and cultured overnight. The monolayer was rinsed twice with PBS, and serum-free medium containing 5 ng/ml TGF-{beta}1 plus 5, 10, and 40 µM SB203580 was added for 24 h. Total RNA was isolated and analyzed by Northern blotting using random-primed cDNA probes for 36B4, PAI-1, and TSP1.

 


View larger version (50K):
[in this window]
[in a new window]
 
Fig. 6. The p38 MAPK inhibitor SB203580, but not the Sp1 transcription factor inhibitor WP631, counteracted the TGF-{beta}1-dependent inhibition of uPA activity. BAEC aggregates were cultured in a fibrin gel sandwich in the presence of 5 ng/ml TGF-{beta}1 containing 5, 10, and 20 µM (nos. at top) SB203580 (A) or 10 nM WP631 (B). The supernatant medium was replaced with fresh medium every 24 h. An aliquot (25 µl) of the conditioned medium collected on day 4 was analyzed for uPA activity by casein zymography.

 
Capillary tube formation was reduced in the presence of SB203580 (Fig. 7), demonstrating the importance of p38 MAPK in angiogenesis. However, adding SB203580 to the culture did not counteract the TGF-{beta}-induced capillary tube pattern. These results suggest that either the molecular determinants of the TGF-{beta}-induced capillary tube pattern are activated upstream of the TGF-{beta}-mediated activation of p38 MAPK or that the pattern is generated by a distinct signaling cascade. A hallmark for the potency of TGF-{beta} to induce diverse cellular functions is the ability of the TGF-{beta}-activated signaling intermediates, the SMADs, to cooperate with each other and with other members of DNA binding proteins from many different families to elicit specific transcriptional responses in a given cellular context (29). The transcription factor Sp1 has been shown to mediate the transcriptional activation of collagen expression by TGF-{beta} (22, 62). To determine whether transcriptional regulation was involved in the bipolarized capillary tube patterning observed, the DNA intercalator WP631, which has been shown to inhibit collagen expression (19), was used. In contrast to addition of SB203580, WP631 did not counteract the TGF-{beta}-dependent inhibition of uPA activity (Fig. 6B). However, WP631 partially counteracted the TGF-{beta}-induced capillary tube pattern (Fig. 7). These results suggest that the mechanism involves Sp1-dependent transcriptional regulation, but it is distinct from the p38 MAPK-dependent regulation of uPA activity.



View larger version (175K):
[in this window]
[in a new window]
 
Fig. 7. The Sp1 transcription factor inhibitor WP631, but not the p38 MAPK inhibitor SB203580, partially counteracted the TGF-{beta}1-induced change in capillary tube patterning. BAEC aggregates were cultured in a fibrin gel sandwich and, after 4 days, examined by phase-contrast microscopy. The cells were cultured in the absence (left) or presence of 5 ng/ml TGF-{beta}1 (right) containing 20 µM SB203580 (middle) or 10 nM WP631 (bottom). The shaded structures observed in the presence of WP631 (arrows, bottom left) represent the images of shadows of capillary tubes oriented at an angle to the focal plane. Bar = 100 µm.

 
TNF-{alpha} counteracted the TGF-{beta}1-induced capillary tube pattern: the role of the JNK signaling pathway. Because TNF-{alpha} has been shown to be a potent antagonist of TGF-{beta}/SMAD signaling (5, 10), the effect of TNF-{alpha} on TGF-{beta}1-induced capillary tube pattern was examined. As shown in Fig. 8, the pattern of capillary tubes formed in the presence of both TGF-{beta}1 and TNF-{alpha} was similar to the pattern observed in the presence of TNF-{alpha} alone and not to the pattern observed in the presence of TGF-{beta}1 alone. These results have shown that TNF-{alpha} counteracted the TGF-{beta}1-induced capillary tube pattern. One of the above-mentioned studies (5) demonstrated that the ability of TNF-{alpha} to antagonize the effect of TGF-{beta}1 treatment was mediated through upregulation of SMAD 7 synthesis. The second group (59, 60) instead demonstrated that JNK, c-Jun, and JunB played a critical role in mediating the antagonistic activity of TNF-{alpha}.



View larger version (139K):
[in this window]
[in a new window]
 
Fig. 8. TNF-{alpha} counteracted the TGF-{beta}1-induced capillary tube pattern. BAEC aggregates were cultured in a fibrin gel sandwich and, after 4 days, examined by phase-contrast microscopy. The cells were cultured in the absence (left) or presence of 5 ng/ml TGF-{beta}1 (right) containing 5 ng/ml TNF-{alpha} (bottom). Bar = 100 µm.

 
Because the level of SMAD 7 mRNA has been demonstrated to be unaltered after exposure of endothelial cells to TNF-{alpha} or TGF-{beta} (54), the role of JNK in capillary tube patterning was studied. BAEC aggregate cultures in fibrin matrix were treated with the specific JNK inhibitor SP600125. Capillary formation was almost completely inhibited by SP600125 (Fig. 9). However, at low concentrations of SP600125, i.e., 5 µM, the presence of TGF-{beta}1 suppressed the inhibition of capillary tube formation by SP600125, and the TGF-{beta}1-induced capillary tube pattern was displayed. Previous studies have shown that TGF-{beta} blocked apoptosis of serum-deprived A549 human lung carcinoma cells through inhibition of JNK activation (25). On the other hand, other studies reported that TGF-{beta} induced fibronectin synthesis in a human fibrosarcoma cell line through activation of JNK (24).



View larger version (117K):
[in this window]
[in a new window]
 
Fig. 9. c-Jun NH2-terminal kinase (JNK) activity was required for capillary tube formation. BAEC aggregates were cultured in a fibrin gel sandwich and, after 4 days, examined by phase-contrast microscopy. The cells were cultured in the absence (left) or presence of 5 ng/ml TGF-{beta}1 (right) containing 5, 10, and 20 µM of the JNK inhibitor SP600125, as indicated. Bar = 100 µm.

 
To examine the JNK phosphorylation state, confluent BAEC cultures were treated with TNF-{alpha}. Total cell extracts were analyzed by Western blotting using anti-full-length- and anti-phospho-JNK antibodies. The anti-full-length-JNK antibody reacts with JNK1, JNK2, and JNK3, which are 46 kDa, 54 kDa, and 55 kDa, respectively. As shown in Fig. 10A, TNF-{alpha} induced phosphorylation of the top band (indicated by an arrow), suggesting activation of JNK2 or JNK3. Further studies are needed to determine whether TNF-{alpha} selectively induces the phosphorylation of one of the JNK isoforms. To determine the effect of the JNK inhibitor SP600125 on JNK activity, BAEC were treated with 10 µM SP600125 for 0, 10, 20, and 40 min. Western blot analysis using anti-phospho-JNK antibodies showed that the level of phospho-JNK was similar in cell lysates prepared from BAEC treated with SP600125 and control cells (unpublished observation). However, SP600125 inhibited JNK activity as demonstrated by its ability to inhibit phosphorylation of GST-c-Jun substrate. As shown in the autoradiogram (Fig. 10B), SP600125 inhibited JNK activity within 10 min of treatment, resulting in lower levels of phosphorylated GST-c-Jun. Thus the experiments with SP600125 and TNF-{alpha} suggest a central role for JNK activity in endothelial cell morphogenesis. Together, these studies identify JNK as an important component of capillary tube formation in a fibrin matrix.



View larger version (63K):
[in this window]
[in a new window]
 
Fig. 10. TNF-{alpha} induced phosphorylation of JNK, and SP600125 inhibited JNK activity in BAEC. A: JNK phosphorylation. BAEC (1–4 x 106) were seeded in fibrinogen-coated 10-cm dishes and cultured overnight. The monolayer was rinsed twice with PBS, and fresh serum-free medium was added. After 24 h, the cells were treated with TNF-{alpha} (5 ng/ml) for the indicated incubation period. Protein extract was analyzed by Western blotting for phospho-JNK and total JNK. B: JNK activity. The serum-containing medium was replaced with serum-free medium containing 10 µM SP600125 for the periods indicated. Lysates were prepared and kinase assays performed utilizing 150 µg of cell extracts and 2 µg of glutathione S-transferase (GST)-c-Jun(1–89) as a substrate. Reaction products were fractionated on 10% SDS-PAGE gels and transferred to polyvinylidene difluoride (PVDF) membrane. Phosphorylated (P) GST-c-Jun was detected by autoradiography (top), whereas total GST-c-Jun was detected by Ponceau S staining (bottom). Control reaction samples contained GST-c-Jun without the addition of cell extract (lane 1) or cell extract without the addition of GST-c-Jun substrate (lane 2).

 
Effects of SB203580, WP631, and SP600125 on BAEC cytotoxicity and migration. The effect of the pharmacological inhibitors SB203580, WP631, and SP600125 on BAEC cytotoxicity was determined by resazurin-based assays from Promega. As shown in Fig. 11A, the level of cytotoxicity (<5%) of treated cells was similar to that of control cells. Because the capacity of endothelial cells to migrate in two-dimensional assays has been demonstrated to correlate with their invasive behavior in three-dimensional collagen gels (20, 45), the effect of the inhibitors SB203580, WP631, and SP600125 on BAEC migration was investigated using the in vitro wounding assay. As shown in Fig. 11B, WP631 did not inhibit the process of wound closure, whereas SP600125 strongly inhibited wound closure and the effect of SB203580 was intermediate. These results indicate that the JNK pathway plays a critical role in BAEC migration and capillary tube formation.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 11. Effects of the pharmacological inhibitors SB203580, WP631, and SP600125 on BAEC cytotoxicity and migration. BAEC cultured in a 96-well plate (A) or a 6-well dish (B) were treated for 24 h with SB203580, WP631, and SP600125 in serum-free medium. A: cell cytotoxicity detection reagent was added for 10 min. After the addition of stop solution, fluorescence (excitation 560 nm/emission 590 nm) was recorded. As a positive control for 100% cell lysis and for calculating percent lysis, cells were treated for 10 min with 1% Triton X-100 before addition of the cytotoxicity detection reagent. B: confluent BAEC cultures were preincubated for 1 h in the absence or presence of the reagents indicated before wounding and further incubated for 24 h. Images of wounded areas captured at 0 and 24 h after wounding were used for determining wound area closure as described in MATERIALS AND METHODS. The values shown are means ± SD (n = 4) and are representative of 3 experiments each.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The process of blood vessel formation is orchestrated by a complex series of cellular activities elicited in response to signaling cues from the surrounding environment. The initial phase involves assembly of endothelial cells into a network of cordlike structures in a given physiological or pathological setting. At sites of tissue insult such as wounding, chronic inflammation, and tumor stroma, spillage of plasma proteins (i.e., fibrinogen) into the perivascular environment and proteolytic action of thrombin lead to formation of a fibrin matrix. The fibrin matrix induces and serves as a provisional substratum for supporting the ingrowth of new blood vessels and other mesenchymal cells that generate mature, vascularized stroma (16). In addition, expression of all three isoforms of TGF-{beta} is induced in full-thickness cutaneous wounds in mice (18). Thus, as presented in this work, use of a fibrin-based in vitro angiogenesis assay might offer insights into the molecular basis of capillary tube patterning during the early phases of blood vessel formation in vivo.

Fibrin matrix, like other macromolecular matrices, has been used to study in vitro the morphogenesis of endothelial cells into capillary-like tubes. Endothelial cell monolayers sandwiched between two fibrin gels (8), endothelial cells incorporated in or seeded on top of a fibrin matrix (15, 56), and cell-coated microcarrier beads incorporated in a fibrin matrix (37) have been shown to give rise to capillary-like structures. On the basis of studies using fibronectin, collagen, matrigel, and fibrin matrices, it has been proposed that traction forces exerted by cells on viscoelastic substrata induce reorganization of the vicinal matrix into cords that provide positional information for the development of capillary-like structures (13, 26, 37, 57, 58). In the present study, capillary tube patterning by endothelial cell aggregates sandwiched between two layers of fibrin matrix was studied. Although this method is complex and difficult to visualize and quantify, because capillary-like tubes are formed in multiple directions and at different surface layers, it offers unique advantages: 1) Endothelial cell aggregates have been shown to remodel over time to establish a differentiated surface layer of endothelial cells and a center of unorganized endothelial cells that, if not rescued by survival factors, subsequently undergoes apoptosis. The cells on the surface become quiescent and establish firm cell-to-cell contacts and can be induced to express differentiation antigens such as CD34 in response to vascular endothelial growth factor (VEGF) (31). 2) Essentially all the endothelial cells growing into the surrounding fibrin matrix participate in capillary-like tube formation. Analysis of the changes in the levels of proteins secreted into the supernatant medium (e.g., PA activity) reflects changes in gene regulation during the angiogenic process.

The capillary tubes developed radially along the interface between the two layers of fibrin matrix. The presence of TGF-{beta}1 induced a more planar pattern of endothelial cell morphogenesis compared with control or FGF2-treated cells. Because TGF-{beta}1 has been shown to induce FGF2 expression in mouse embryo fibroblasts (46), other investigators suggested that the guided migration of endothelial cells along a preestablished capillary-like structure is regulated by FGF2 (38). It is possible that in the current study FGF2 did contribute to the TGF-{beta}1-induced capillary tube pattern. However, if FGF2 was the major factor mediating the phenotypic change, exogenous FGF2 should have reversed the TGF-{beta}1-induced capillary tube pattern. When FGF2 and TGF-{beta}1 were added simultaneously, the resulting capillary-like pattern was similar to the structured pattern observed in the presence of TGF-{beta}1 alone and not the random pattern observed in the presence of FGF2 alone. These observations suggested that the observed TGF-{beta}1-induced capillary tube pattern was not mediated by FGF2.

TGF-{beta}1 is a widely expressed pleiotropic cytokine controlling cellular functions that are critical to animal embryo development and tissue homeostasis. Despite the diversity and physiological importance of the TGF-{beta}-elicited cellular responses, the basic signaling cascade consists of two receptor serine-threonine protein kinases (receptor types I and II) and a family of receptor substrates (the SMAD proteins) that translocate into the nucleus and induce or suppress target gene expression (33). In this report, TGF-{beta}1 activated the basic TGF-{beta}/SMAD signaling pathway in BAEC sandwiched in fibrin matrix as evidenced by 1) the inhibition of uPA activity by upregulation of PAI-1 expression and 2) the reversal of the inhibition of uPA activity by the p38 MAPK inhibitor SB203580. Moreover, the DNA intercalator WP631 and the cytokine TNF-{alpha} have been shown to inhibit SMAD 3/4-induced collagen synthesis (19). Because of the ability of WP631 and TNF-{alpha} to antagonize TGF-{beta}1-induced capillary tube pattern, it is likely that SMAD signaling is involved in capillary tube patterning. Furthermore, in support of the role of the SMADs in morphogenesis, transfection with Smad 2 and Smad 4 has been shown to induce fibroblast-myofibroblast terminal differentiation (17).

Although the majority of in vitro studies have found TGF-{beta}1 to inhibit endothelial cell functions, including tube formation, it has also been shown to regulate capillary tube formation in a biphasic manner. In an in vitro model of angiogenesis in which bovine microvascular endothelial cells from adrenal cortex were seeded on the surface of a matrix, VEGF- or basic FGF-induced invasion of collagen or fibrin gels was further induced when TGF-{beta}1 was co-added to the system at 0.2–3 ng/ml and inhibited when TGF-{beta}1 was added at 10 ng/ml. In addition to the effect of TGF-{beta}1 on invasion, lumen size in the resulting structures was progressively reduced with increasing concentrations of TGF-{beta}1 (42). In the present study, the lowest concentration of TGF-{beta}1 that reproducibly altered the random pattern of capillary tubes formed was 5 ng/ml. Further studies are needed to determine the specific role of the different TGF-{beta} receptors in our system. Although conflicting, more recent studies (21, 40) suggested that the TGF-{beta} type I receptors ALK1 and ALK5 transduce TGF-{beta}-dependent signals that regulate the activation and resolution phases of the vessel formation process and that differential regulation of TGF-{beta} type I receptors might explain the biphasic effect of TGF-{beta}1.

Alternatively, a change in the net balance of extracellular matrix proteolysis has been proposed as the mechanism of TGF-{beta}1-dependent inhibition of endothelial cell invasion of amniotic basement membrane and three-dimensional collagen or fibrin gels (35, 36, 41, 43, 44, 51). MMPs, in particular MT1-MMP, have been shown to be critical for invasion of fibrin gels and formation of capillary-like structures by tissue explants and micro- and macrovascular endothelial cells (11, 23, 32). The results reported in this study do not indicate that the MMPs analyzed play a direct role in capillary tube patterning. To investigate the possible role of uPA enzyme activity and TSP1 expression in capillary tube patterning, the p38 MAPK inhibitor SB203580 was used. SB203580 inhibited TGF-{beta}1-induced upregulation of PAI-1 and TSP1 expression but not TGF-{beta}1-induced capillary tube patterning. Thus differential expression of TSP1, uPA, MMP2, MMP9, and possibly MT1-MMP as inferred from the pattern of active MMP2 enzyme levels or their respective inhibitory regulators, PAI-1 and TIMP, could not account for the TGF-{beta}1-induced capillary tube pattern. These results suggested that TGF-{beta}1-elicited signals regulate capillary tube patterning through downstream signaling events that are distinct from the cascades that control the PA system.

Another interesting and important observation is the role of the JNK pathway in cell survival and capillary tube patterning. Although more studies remain to be done, this study shows that intracellular signals, and in particular the JNK pathway, play a key role in BAEC morphogenesis in fibrin matrix. Inhibition of JNK activity by SP600125 prevented capillary tube formation and wound closure. In the presence of TGF-{beta}1, SP600125 was less inhibitory because the JNK pathway functions within the overall context of the state of activation of other signaling pathways (14). Although it is established that JNK contributes to some apoptotic responses, JNK may also contribute to survival signaling (1) under the defined serum-free culture conditions in this study. Additionally, in support of our results using endothelial cells, the JNK pathway has been shown to regulate fibroblast motility (28). The above-mentioned functions of the JNK pathway are consistent with genetic and overexpression studies in Drosophila and Xenopus that have shown that JNK signaling coordinates dorsal closure (34), planar cell polarity (6), and convergent extension (61). The JNK pathway is thought to affect both the cytoskeleton and gene expression. Interestingly, the TGF-{beta} family member decapentaplegic is one target gene of the JNK pathway that functions as a chemoattractant to more lateral cells and thereby induces coordinated cell elongation and movement during dorsal closure (34). In conclusion, the observations of this report and cited studies indicate that the TGF-{beta} and JNK signaling pathways play important roles in capillary tube patterning and morphogenesis. TGF-{beta}1 modulates PAI-1 and TSP1 expression, both of which are important regulators of angiogenesis. TGF-B1-induced alteration of capillary tube patterning is mediated through a signaling pathway that is independent of its effect on PAI-1 and TSP1 expression.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
We gratefully acknowledge funding support from the National Heart, Lung, and Blood Institute of the National Institutes of Health (to K. Bein).


    ACKNOWLEDGMENTS
 
We thank Dr. Louise Rosenbaum for reading the manuscript and for helpful suggestions.


    FOOTNOTES
 

Address for reprint requests and other correspondence: K. Bein, Dartmouth-Hitchcock Medical Center, 1 Medical Center Drive, Borwell Research Bldg., 550W, Lebanon, NH 03756 (E-mail: Kiflai.Bein{at}Dartmouth.Edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Almeida EA, Ilic D, Han Q, Hauck CR, Jin F, Kawakatsu H, Schlaepfer DD, and Damsky CH. Matrix survival signaling: from fibronectin via focal adhesion kinase to c-Jun NH2-terminal kinase. J Cell Biol 149: 741–754, 2000.[Abstract/Free Full Text]

2. Avorn J. Depression in the elderly—falls and pitfalls. N Engl J Med 339: 918–920, 1998.[Free Full Text]

3. Baish JW, Gazit Y, Berk DA, Nozue M, Baxter LT, and Jain RK. Role of tumor vascular architecture in nutrient and drug delivery: an invasion percolation-based network model. Microvasc Res 51: 327–346, 1996.[CrossRef][Web of Science][Medline]

4. Bein K and Simons M. Thrombospondin type 1 repeats interact with matrix metalloproteinase 2. Regulation of metalloproteinase activity. J Biol Chem 275: 32167–32173, 2000.[Abstract/Free Full Text]

5. Bitzer M, von Gersdorff G, Liang D, Dominguez-Rosales A, Beg AA, Rojkind M, and Bottinger EP. A mechanism of suppression of TGF-beta/SMAD signaling by NF-kappa B/RelA. Genes Dev 14: 187–197, 2000.[Abstract/Free Full Text]

6. Boutros M, Paricio N, Strutt DI, and Mlodzik M. Dishevelled activates JNK and discriminates between JNK pathways in planar polarity and wingless signaling. Cell 94: 109–118, 1998.[CrossRef][Web of Science][Medline]

7. Castleman KR. Digital Image Processing. Englewood Cliffs, NJ: Prentice-Hall, 1979.

8. Chalupowicz DG, Chowdhury ZA, Bach TL, Barsigian C, and Martinez J. Fibrin II induces endothelial cell capillary tube formation. J Cell Biol 130: 207–215, 1995.[Abstract/Free Full Text]

9. Chang H, Brown CW, and Matzuk MM. Genetic analysis of the mammalian transforming growth factor-{beta} superfamily. Endocr Rev 23: 787–823, 2002.[Abstract/Free Full Text]

10. Chung KY, Agarwal A, Uitto J, and Mauviel A. An AP-1 binding sequence is essential for regulation of the human {alpha}2(I) collagen (COL1A2) promoter activity by transforming growth factor-{beta}. J Biol Chem 271: 3272–3278, 1996.[Abstract/Free Full Text]

11. Collen A, Hanemaaijer R, Lupu F, Quax PH, van Lent N, Grimbergen J, Peters E, Koolwijk P, and van Hinsbergh VW. Membrane-type matrix metalloproteinase-mediated angiogenesis in a fibrin-collagen matrix. Blood 101: 1810–1817, 2003.[Abstract/Free Full Text]

12. Crawford SE, Stellmach V, Murphy-Ullrich JE, Ribeiro SM, Lawler J, Hynes RO, Boivin GP, and Bouck N. Thrombospondin-1 is a major activator of TGF-{beta}1 in vivo. Cell 93: 1159–1170, 1998.[CrossRef][Web of Science][Medline]

13. Davis GE and Camarillo CW. Regulation of endothelial cell morphogenesis by integrins, mechanical forces, and matrix guidance pathways. Exp Cell Res 216: 113–123, 1995.[CrossRef][Web of Science][Medline]

14. Davis RJ. Signal transduction by the JNK group of MAP kinases. Cell 103: 239–252, 2000.[CrossRef][Web of Science][Medline]

15. Dubois-Stringfellow N, Jonczyk A, and Bautch VL. Perturbations in the fibrinolytic pathway abolish cyst formation but not capillary-like organization of cultured murine endothelial cells. Blood 83: 3206–3217, 1994.[Abstract/Free Full Text]

16. Dvorak HF, Brown LF, Detmar M, and Dvorak AM. Vascular permeability factor/vascular endothelial growth factor, microvascular hyperpermeability, and angiogenesis. Am J Pathol 146: 1029–1039, 1995.[Abstract]

17. Evans RA, Tian YC, Steadman R, and Phillips AO. TGF-{beta}1-mediated fibroblast-myofibroblast terminal differentiation—the role of Smad proteins. Exp Cell Res 282: 90–100, 2003.[CrossRef][Web of Science][Medline]

18. Frank S, Madlener M, and Werner S. Transforming growth factors {beta}1, {beta}2, and {beta}3 and their receptors are differentially regulated during normal and impaired wound healing. J Biol Chem 271: 10188–10193, 1996.[Abstract/Free Full Text]

19. Gaidarova S and Jimenez SA. Inhibition of basal and transforming growth factor-{beta}-induced stimulation of COL1A1 transcription by the DNA intercalators, mitoxantrone and WP631, in cultured human dermal fibroblasts. J Biol Chem 277: 38737–38745, 2002.[Abstract/Free Full Text]

20. Gajdusek CM, Luo Z, and Mayberg MR. Basic fibroblast growth factor and transforming growth factor {beta}-1: synergistic mediators of angiogenesis in vitro. J Cell Physiol 157: 133–144, 1993.[CrossRef][Web of Science][Medline]

21. Goumans MJ, Valdimarsdottir G, Itoh S, Rosendahl A, Sideras P, and ten Dijke P. Balancing the activation state of the endothelium via two distinct TGF-{beta} type I receptors. EMBO J 21: 1743–1753, 2002.[CrossRef][Web of Science][Medline]

22. Greenwel P, Inagaki Y, Hu W, Walsh M, and Ramirez F. Sp1 is required for the early response of {alpha}2(I) collagen to transforming growth factor-{beta}1. J Biol Chem 272: 19738–19745, 1997.[Abstract/Free Full Text]

23. Hiraoka N, Allen E, Apel IJ, Gyetko MR, and Weiss SJ. Matrix metalloproteinases regulate neovascularization by acting as pericellular fibrinolysins. Cell 95: 365–377, 1998.[CrossRef][Web of Science][Medline]

24. Hocevar BA, Brown TL, and Howe PH. TGF-{beta} induces fibronectin synthesis through a c-Jun N-terminal kinase-dependent, Smad4-independent pathway. EMBO J 18: 1345–1356, 1999.[CrossRef][Web of Science][Medline]

25. Huang Y, Hutter D, Liu Y, Wang X, Sheikh MS, Chan AM, and Holbrook NJ. Transforming growth factor-{beta}1 suppresses serum deprivation-induced death of A549 cells through differential effects on c-Jun and JNK activities. J Biol Chem 275: 18234–18242, 2000.[Abstract/Free Full Text]

26. Ingber DE and Folkman J. Mechanochemical switching between growth and differentiation during fibroblast growth factor-stimulated angiogenesis in vitro: role of extracellular matrix. J Cell Biol 109: 317–330, 1989.[Abstract/Free Full Text]

27. Iruela-Arispe ML, Hasselaar P, and Sage H. Differential expression of extracellular proteins is correlated with angiogenesis in vitro. Lab Invest 64: 174–186, 1991.[Web of Science][Medline]

28. Javelaud D, Laboureau J, Gabison E, Verrecchia F, and Mauviel A. Disruption of basal JNK activity differentially affects key fibroblast functions important for wound healing. J Biol Chem 278: 24624–24628, 2003.[Abstract/Free Full Text]

29. Kang Y, Chen CR, and Massague J. A self-enabling TGF{beta} response coupled to stress signaling: Smad engages stress response factor ATF3 for Id1 repression in epithelial cells. Mol Cell 11: 915–926, 2003.[CrossRef][Web of Science][Medline]

30. Kirchner LM, Schmidt SP, and Gruber BS. Quantitation of angiogenesis in the chick chorioallantoic membrane model using fractal analysis. Microvasc Res 51: 2–14, 1996.[CrossRef][Web of Science][Medline]

31. Korff T and Augustin HG. Integration of endothelial cells in multicellular spheroids prevents apoptosis and induces differentiation. J Cell Biol 143: 1341–1352, 1998.[Abstract/Free Full Text]

32. Lafleur MA, Handsley MM, Knauper V, Murphy G, and Edwards DR. Endothelial tubulogenesis within fibrin gels specifically requires the activity of membrane-type-matrix metalloproteinases (MT-MMPs). J Cell Sci 115: 3427–3438, 2002.[Abstract/Free Full Text]

33. Massague J and Chen YG. Controlling TGF-{beta} signaling. Genes Dev 14: 627–644, 2000.[Free Full Text]

34. McEwen DG, Cox RT, and Peifer M. The canonical Wg and JNK signaling cascades collaborate to promote both dorsal closure and ventral patterning. Development 127: 3607–3617, 2000.[Abstract]

35. Mignatti P, Tsuboi R, Robbins E, and Rifkin DB. In vitro angiogenesis on the human amniotic membrane: requirement for basic fibroblast growth factor-induced proteinases. J Cell Biol 108: 671–682, 1989.[Abstract/Free Full Text]

36. Muller G, Behrens J, Nussbaumer U, Bohlen P, and Birchmeier W. Inhibitory action of transforming growth factor beta on endothelial cells. Proc Natl Acad Sci USA 84: 5600–5604, 1987.[Abstract/Free Full Text]

37. Nehls V and Drenckhahn D. A novel, microcarrier-based in vitro assay for rapid and reliable quantification of three-dimensional cell migration and angiogenesis. Microvasc Res 50: 311–322, 1995.[CrossRef][Web of Science][Medline]

38. Nehls V, Herrmann R, and Huhnken M. Guided migration as a novel mechanism of capillary network remodeling is regulated by basic fibroblast growth factor. Histochem Cell Biol 109: 319–329, 1998.[CrossRef][Web of Science][Medline]

39. Nicosia RF and Madri JA. The microvascular extracellular matrix. Developmental changes during angiogenesis in the aortic ring-plasma clot model. Am J Pathol 128: 78–90, 1987.[Abstract]

40. Oh SP, Seki T, Goss KA, Imamura T, Yi Y, Donahoe PK, Li L, Miyazono K, ten Dijke P, Kim S, and Li E. Activin receptor-like kinase 1 modulates transforming growth factor-beta 1 signaling in the regulation of angiogenesis. Proc Natl Acad Sci USA 97: 2626–2631, 2000.[Abstract/Free Full Text]

41. Okamura K, Morimoto A, Hamanaka R, Ono M, Kohno K, Uchida Y, and Kuwano M. A model system for tumor angiogenesis: involvement of transforming growth factor-{alpha} in tube formation of human microvascular endothelial cells induced by esophageal cancer cells. Biochem Biophys Res Commun 186: 1471–1479, 1992.[CrossRef][Web of Science][Medline]

42. Pepper MS. Transforming growth factor-{beta}: vasculogenesis, angiogenesis, and vessel wall integrity. Cytokine Growth Factor Rev 8: 21–43, 1997.[CrossRef][Medline]

43. Pepper MS, Belin D, Montesano R, Orci L, and Vassalli JD. Transforming growth factor-beta 1 modulates basic fibroblast growth factor-induced proteolytic and angiogenic properties of endothelial cells in vitro. J Cell Biol 111: 743–755, 1990.[Abstract/Free Full Text]

44. Pepper MS, Montesano R, Vassalli JD, and Orci L. Chondrocytes inhibit endothelial sprout formation in vitro: evidence for involvement of a transforming growth factor-beta. J Cell Physiol 146: 170–179, 1991.[CrossRef][Web of Science][Medline]

45. Pepper MS, Vassalli JD, Wilks JW, Schweigerer L, Orci L, and Montesano R. Modulation of bovine microvascular endothelial cell proteolytic properties by inhibitors of angiogenesis. J Cell Biochem 55: 419–434, 1994.[CrossRef][Web of Science][Medline]

46. Pertovaara L, Saksela O, and Alitalo K. Enhanced bFGF gene expression in response to transforming growth factor-{beta} stimulation of AKR-2B cells. Growth Factors 9: 81–86, 1993.[Web of Science][Medline]

47. Ribeiro SM, Poczatek M, Schultz-Cherry S, Villain M, and Murphy-Ullrich JE. The activation sequence of thrombospondin-1 interacts with the latency-associated peptide to regulate activation of latent transforming growth factor-{beta}. J Biol Chem 274: 13586–13593, 1999.[Abstract/Free Full Text]

48. Schultz-Cherry S, Lawler J, and Murphy-Ullrich JE. The type 1 repeats of thrombospondin 1 activate latent transforming growth factor-{beta}. J Biol Chem 269: 26783–26788, 1994.[Abstract/Free Full Text]

49. Sephel GC, Kennedy R, and Kudravi S. Expression of capillary basement membrane components during sequential phases of wound angiogenesis. Matrix Biol 15: 263–279, 1996.[CrossRef][Web of Science][Medline]

50. Stokes CL and Lauffenburger DA. Analysis of the roles of microvessel endothelial cell random motility and chemotaxis in angiogenesis. J Theor Biol 152: 377–403, 1991.[CrossRef][Medline]

51. Tada K, Fukunaga T, Wakabayashi Y, Masumi S, Sato Y, Izumi H, Kohno K, and Kuwano M. Inhibition of tubular morphogenesis in human microvascular endothelial cells by co-culture with chondrocytes and involvement of transforming growth factor beta: a model for avascularity in human cartilage. Biochim Biophys Acta 1201: 135–142, 1994.[Medline]

52. Takekawa M, Tatebayashi K, Itoh F, Adachi M, Imai K, and Saito H. Smad-dependent GADD45{beta} expression mediates delayed activation of p38 MAP kinase by TGF-{beta}. EMBO J 21: 6473–6482, 2002.[CrossRef][Web of Science][Medline]

53. Tolsma SS, Stack MS, and Bouck N. Lumen formation and other angiogenic activities of cultured capillary endothelial cells are inhibited by thrombospondin-1. Microvasc Res 54: 13–26, 1997.[CrossRef][Web of Science][Medline]

54. Topper JN, Cai J, Qiu Y, Anderson KR, Xu YY, Deeds JD, Feeley R, Gimeno CJ, Woolf EA, Tayber O, Mays GG, Sampson BA, Schoen FJ, Gimbrone MA Jr, and Falb D. Vascular MADs: two novel MAD-related genes selectively inducible by flow in human vascular endothelium. Proc Natl Acad Sci USA 94: 9314–9319, 1997.[Abstract/Free Full Text]

55. Tsopanoglou NE, Pipili-Synetos E, and Maragoudakis ME. Thrombin promotes angiogenesis by a mechanism independent of fibrin formation. Am J Physiol Cell Physiol 264: C1302–C1307, 1993.[Abstract/Free Full Text]

56. Vailhe B, Ronot X, Tracqui P, Usson Y, and Tranqui L. In vitro angiogenesis is modulated by the mechanical properties of fibrin gels and is related to alpha(v)beta3 integrin localization. In Vitro Cell Dev Biol Anim 33: 763–773, 1997.

57. Vernon RB, Lara SL, Drake CJ, Iruela-Arispe ML, Angello JC, Little CD, Wight TN, and Sage EH. Organized type I collagen influences endothelial patterns during "spontaneous angiogenesis in vitro": planar cultures as models of vascular development. In Vitro Cell Dev Biol Anim 31: 120–131, 1995.

58. Vernon RB and Sage EH. Between molecules and morphology. Extracellular matrix and creation of vascular form. Am J Pathol 147: 873–883, 1995.[Abstract]

59. Verrecchia F, Pessah M, Atfi A, and Mauviel A. Tumor necrosis factor-{alpha} inhibits transforming growth factor-{beta}/Smad signaling in human dermal fibroblasts via AP-1 activation. J Biol Chem 275: 30226–30231, 2000.[Abstract/Free Full Text]

60. Verrecchia F, Tacheau C, Wagner EF, and Mauviel A. A central role for the JNK pathway in mediating the antagonistic activity of pro-inflammatory cytokines against transforming growth factor-{beta}-driven SMAD3/4-specific gene expression. J Biol Chem 278: 1585–1593, 2003.[Abstract/Free Full Text]

61. Wallingford JB, Rowning BA, Vogeli KM, Rothbacher U, Fraser SE, and Harland RM. Dishevelled controls cell polarity during Xenopus gastrulation. Nature 405: 81–85, 2000.[CrossRef][Medline]

62. Zhang W, Ou J, Inagaki Y, Greenwel P, and Ramirez F. Synergistic cooperation between Sp1 and Smad3/Smad4 mediates transforming growth factor {beta}1 stimulation of {alpha} 2(I)-collagen (COL1A2) transcription. J Biol Chem 275: 39237–39245, 2000.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. Medhora, A. Dhanasekaran, P. F. Pratt Jr., C. R. Cook, L. K. Dunn, S. K. Gruenloh, and E. R. Jacobs
Role of JNK in network formation of human lung microvascular endothelial cells
Am J Physiol Lung Cell Mol Physiol, April 1, 2008; 294(4): L676 - L685.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. Yang, J. Wu, C. M. Martin, P. R. Kvietys, and T. Rui
Important role of p38 MAP kinase/NF-{kappa}B signaling pathway in the sepsis-induced conversion of cardiac myocytes to a proinflammatory phenotype
Am J Physiol Heart Circ Physiol, February 1, 2008; 294(2): H994 - H1001.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. A. Glesne, W. Zhang, S. Mandava, L. Ursos, M. E. Buell, L. Makowski, and D. J. Rodi
Subtractive Transcriptomics: Establishing Polarity Drives In vitro Human Endothelial Morphogenesis.
Cancer Res., April 15, 2006; 66(8): 4030 - 4040.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
287/4/C1012    most recent
00101.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bein, K.
Right arrow Articles by Drinane, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bein, K.
Right arrow Articles by Drinane, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.