Am J Physiol Cell Physiol Journal of Applied Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 287: C357-C364, 2004. First published March 24, 2004; doi:10.1152/ajpcell.00068.2004
0363-6143/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
287/2/C357    most recent
00068.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (28)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, X.
Right arrow Articles by Sansom, S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, X.
Right arrow Articles by Sansom, S. C.

MEMBRANE TRANSPORTERS, ION CHANNELS, AND PUMPS

TRPC4 forms store-operated Ca2+ channels in mouse mesangial cells

Xiaoxia Wang, Jennifer L. Pluznick, Peilin Wei, Babu J. Padanilam, and Steven C. Sansom

Department of Physiology and Biophysics, University of Nebraska Medical Center, Omaha, Nebraska 68198-5850

Submitted 4 February 2004 ; accepted in final form 18 March 2004


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Studies were performed to identify the molecular component responsible for store-operated Ca2+ entry in murine mesangial cells (MMC). Because the canonical transient receptor potential (TRPC) family of proteins was previously shown to comprise Ca2+-selective and -nonselective cation channels in a variety of cells, we screened TRPC1–TRPC7 with the use of molecular methods and the fura 2 method to determine their participation as components of the mesangial store-operated Ca2+ (SOC) channel. Using TRPC-specific primers and RT-PCR, we found that cultured MMC contained mRNA for TRPC1 and TRPC4 but not for TRPC2, TRPC3, TRPC5, TRPC6, and TRPC7. Immunocytochemical staining of MMC revealed predominantly cytoplasmic expression of TRPC1 and plasmalemmal expression of TRPC4. The role of TRPC4 in SOC was determined with TRPC4 antisense and fura 2 ratiometric measurements of intracellular Ca2+ concentration ([Ca2+]i). SOC was measured as the increase in [Ca2+]i after extracellular Ca2+ was increased from <10 nM to 1 mM in the continued presence of thapsigargin. We found that TRPC4 antisense, which reduced plasmalemmal expression of TRPC4, inhibited SOC by 83%. Incubation with scrambled TRPC4 oligonucleotides did not affect SOC. Immunohistochemical staining identified expressed TRPC4 in the glomeruli of mouse renal sections. The results of RT-PCR performed to distinguish between TRPC4-{alpha} and TRPC4-{beta} were consistent with expression of both isoforms in brain but with only TRPC4-{alpha} expression in MMC. These studies show that TRPC4-{alpha} may form the homotetrameric SOC in mouse mesangial cells.

canonical transient receptor potential; TRPC4-{alpha}; TRPC4-{beta}; TRPC1; fura 2; glomerulus


IN BOTH EXCITABLE AND NONEXCITABLE CELLS, depletion of intracellular stores of Ca2+ causes a flux of Ca2+ into the cell until the sarcoendoplasmic reticulum refills to its original Ca2+ concentration. This process of refilling Ca2+ stores has been studied extensively in nonexcitable cells, in which it is often the predominant mode of Ca2+ cell entry. The inward Ca2+ flux resulting from inositol 1,4,5-trisphosphate (IP3)-mediated depletion of Ca2+ stores is designated Ca2+ release-activated Ca2+ current (ICRAC) or store-operated Ca2+ (SOC) channel (8, 25).

Glomerular mesangial cells, which are smooth muscle-like cells involved in regulating the filtration surface area, contract in response to vasoactive agonists such as angiotensin II, which induces a G protein-coupled and IP3-mediated release of stored Ca2+ (26). The first evidence for SOC in (rat) mesangial cells was provided by Menè et al. (18), who used fura 2 fluorescence techniques. More recently, with the use of patch-clamp techniques and fura 2 ratiometry, investigators at our laboratory (14, 15) confirmed those initial studies and showed that cultured human mesangial cells possess SOC with high Ca2+/Na+ selectivity and single-channel conductance of 2 pS with Ba2+ as the charge carrier.

Several studies support the notion that the canonical subfamily of the transient receptor potential (TRPC) family of proteins contains members that form Ca2+-selective and -nonselective cation channels in a variety of mammalian cells (23, 28, 29, 31, 47, 49). The purpose of this study was to identify which among TRPC1–TRPC7 contribute to SOC in mouse mesangial cells (MMC). Whereas mRNA and protein level expression are evident for both TRPC1 and TRPC4 in cultured MMC, immunostaining experiments showed that TRPC4 is the only member localized in the plasma membrane and that it is abundantly expressed in the glomeruli of mouse renal tissue sections.

Several splice variants of TRPC4 have been revealed by RT-PCR in a variety of species (19, 33, 35). However, the most abundantly described transcripts have been designated TRPC4-{alpha} and TRPC4-{beta}, which have an 84-amino acid deletion in the cytosolic COOH terminus (19). It was previously determined that TRPC4-{alpha} transcripts are expressed in rat kidney (33) and that both TRPC4-{alpha} and TRPC4-{beta} are expressed in the human kidney (19). We therefore performed RT-PCR to distinguish transcripts of TRPC4-{alpha} and TRPC4-{beta} in MMC. Functional studies with the use of fura 2 ratiometry and antisense were used to determine the role of TRPC4-{alpha} as a SOC in MMC.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Cell culture procedures. The MMC cell line, which we purchased from American Type Culture Collection (Manassas, VA), was cultured in Dulbecco's modified Eagle's medium (DMEM; Sigma, St. Louis, MO) supplemented with 10 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES), 2.0 mM glutamine, 0.66 U/ml insulin, 1.0 mM sodium pyruvate, 0.1 mM nonessential amino acids, 100 U/ml penicillin, 100 µg/ml streptomycin, and 5% fetal bovine serum (pH 7.2–7.4) as described previously by our laboratory (36) and by others (21).

RT-PCR. Total RNA was isolated from MMC, and primers were used to determine the presence of TPRC1–TRPC7 by RT-PCR as previously described (40, 46). In brief, 1 µg of total RNA, first isolated from MMC with Trizol reagent (GIBCO-BRL, Grand Island, NY), was reverse transcribed with the use of reverse transcriptase (Promega, Madison, WI). The primer sequences for TRPC1–TRPC7 were published previously (46). The primers used for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were forward 5'-CCCTTCATTGACCTCAACTACATGG-3' and reverse 5'-GAGGGGCCATCCACAGTCTTCTG-3'. The annealing temperatures were as follows: TRPC1, TRPC4, and TRPC5, 60°C for 1 min; TRPC2 and TRPC3, 54°C for 1 min; and TRPC6 and TRPC7, 58°C for 1 min. For all experiments, the denaturing temperature was 94°C and the extension temperature was 72°C, and 35–40 PCR cycles were performed. The PCR products were visualized on 1.5% agarose gel containing ethidium bromide under UV light.

To distinguish splice variants TRPC4-{alpha} and TRPC4-{beta}, isolated mRNA was amplified by PCR with the use of a forward primer (5'-CATTTCTAGCTTCCGCTTCG-3') paired with a reverse primer (5'-TCTTCCACCACCACCTTCTC-3'). Annealing was performed at 60°C for 1 min. All other cycle conditions were as described above.

Western blotting. For the detection of proteins by Western blot analysis, MMC proteins were collected and isolated according to standard protocols by sonication and centrifugation. Protein concentration was assayed with the use of Bio-Rad protein assay dye (Bio-Rad, Hercules, CA), and proteins were loaded onto a 12.5% polyacrylamide gel after being boiled in Laemmli sample buffer. After electrophoresis, proteins were transferred to a polyvinylidene difluoride nitrocellulose membrane blocked in 5% milk in Tris-buffered saline containing Tween 20 (TBST; 0.1% Tween 20) before exposure to the primary antibody (TRPC1, 1:200, or TRPC4, 1:100; Santa Cruz Biotechnology, Santa Cruz, CA). After being washed in TBST, the membranes were exposed to a horseradish peroxidase (HRP)-conjugated secondary antibody and washed once again, and then the signal was visualized with the use of SuperSignal West Femto substrate (Pierce, Rockford, IL). Images were captured with a UVP bioimaging system (EpiChemi II Darkroom; UVP, Upland, CA) and saved as digital image files.

Immunocytochemical staining. For immunocytochemical staining, MMC were plated on glass coverslips, fixed with 4% paraformaldehyde for 10 min at 23°C, and then washed briefly in PBS followed by methanol (10 min at 23°C). Next, the cells were incubated with PBS containing 1% BSA for 1 h at 23°C, incubated with primary antibodies overnight at 4°C, and then washed with PBS three times for 5 min each. After this first incubation, the MMC were incubated for 1 h at 23°C with the secondary antibodies. For TRPC1, the primary antibody used was rabbit anti-human TRPC1 (1:50), commercially available from Santa Cruz Biotechnology. The secondary antibody was goat anti-rabbit IgG (1:400) conjugated with Alexa Fluor 594 (Molecular Probes, Eugene, OR). For TRPC4, the primary antibody used was rabbit polyclonal anti-TRPC4 (1:100; Sigma) or goat polyclonal anti-TRPC4 (1:50; Santa Cruz Biotechnology). The secondary antibody for TRPC4 was Alexa 594-conjugated donkey anti-rabbit IgG or Alexa 488-conjugated donkey anti-goat (1:400; Molecular Probes). The negative control was IgG incubated in the absence of the primary antibody but at the same concentration. Samples were viewed with an Olympus BX50 microscope. Images were captured with a digital camera (Princeton Scientific Instruments, Monmouth Junction, NJ), and the final layout of images was created with Adobe Photoshop software.

Fura 2 ratiometry. For fura 2 ratiometric measurement of Ca2+, cells were grown to confluence, passed onto 22 x 22-mm glass coverslips (Fisher Scientific, Pittsburgh, PA), and studied within 48 h at 23°C. Measurements of intracellular Ca2+ concentration ([Ca2+]i) in MMC were obtained by fura 2 and dual excitation wavelength fluorescence microscopy as previously described (4, 7). In brief, after loading with fura 2, the glass coverslips with MMC were placed into a perfusion chamber (Warner RC-20H; Warner Instruments, Hamden, CT) and then mounted on the stage of a Nikon Diaphot 300 inverted microscope. With light provided by a DeltaScan dual monochromator system (Photon Technology International, Lawrenceville, NJ), the cells were illuminated alternately at 340- and 380-nm wavelengths (3-nm bandwidths). An adjustable optical sampling window was positioned within the light path before detection with a photon-counting photomultiplier to monitor fluorescence emission (510 nm, 20-nm bandpass) from a single cell. Background-corrected data were collected at a rate of 5 points/s and then stored and processed with the use of the FeliX software package (Photon Technology International). Calibration of the fura 2 signal was performed according to established methods (4, 7). Cells were loaded with fura 2 by incubation for 60 min (23°C) in physiological salt solution (135 mM NaCl, 5 mM KCl, 2 mM MgCl2, 1 mM CaCl2 , and 10 mM HEPES) containing 7 µM fura 2-acetoxymethyl ester, 0.09 g/dl DMSO, and 0.018 g/dl Pluronic F-127 (Molecular Probes). For all experiments, the initial bathing solution contained (in mM) 135 NaCl, 5 KCl, 10 HEPES, and 1 CaCl2. Free [Ca2+] was reduced to <10 nM by the addition of EGTA.

SOC activity was measured as previously described by investigators at our laboratory (15) and by others (1). In brief, after stable baseline [Ca2+]i was obtained, 1 µM thapsigargin was applied to the bathing solution containing 1 mM Ca2+. After an initial rapid rise and a subsequent plateau phase, the bath [Ca2+] was reduced to <10 nM by the addition of EGTA. When [Ca2+]i declined to the lowest level, 1 mM Ca2+ was returned to the bath. Once added, thapsigargin was present throughout the experiment. The difference in [Ca2+]i ({Delta}[Ca2+]i) in response to the return of 1 mM Ca2+ to the external solution was used as the measurement of SOC.

TRPC4 antisense. To determine the function of TRPC4 in MMC, the cells were pretreated for 48 h with TRPC4 antisense or scrambled oligonucleotides (4 nM). The antisense and scrambled sequences were TTTGTAATAGAACTGAGCCAT and CATTAGGATGCGTAACTTATA, respectively (corresponding to GenBank accession no. NM_016984). {Delta}[Ca2+]i values were determined by following the same procedures as described above. The differences in {Delta}[Ca2+]i among the three groups (control, antisense, and scrambled) were compared by performing ANOVA plus the Student-Newman-Keuls test. Significance was established as P < 0.05.

Immunohistochemistry. For histological analyses, kidneys were removed from 8-wk-old mice (C57BL/6). Coronal cross sections containing the hilus were removed from kidneys, fixed in neutral buffered formalin, embedded in paraffin, and mounted on glass slides. For immunohistochemical analysis, 5-µm sections of paraffin-embedded tissue were deparaffinized in two changes of xylene for 10 min each. The sections were rehydrated in a series of graded alcohol solutions (100, 90, 85, 50, and 30%) for 2 min each. Antigen was retrieved by continuous boiling in 10 mM citrate buffer (pH 6.0) for 20 min. The sections were blocked with 3% H2O2 for 15 min followed by 1% BSA for 15 min at 23°C. After blocking solution was removed, the specimens were covered and incubated in a mixture of goat anti-human TRPC4 antibody (1:50, 1% BSA/PBS; Santa Cruz Biotechnology) overnight at 4°C. The slides were then washed in PBS three times for 5 min each. Each section was then covered and incubated for 1 h at 23°C with sufficient HRP-conjugated donkey anti-goat IgG (1:200; Santa Cruz Biotechnology). The slides were washed again in PBS three times for 5 min each. Each section was then covered with sufficient solution (liquid DAB substrate kit; Zymed Laboratories, South San Francisco, CA) at 23°C for 2 min in the dark and then counterstained with hematoxylin. Samples were viewed with an Olympus BX50 microscope. Images were captured with a Princeton Scientific Instruments digital camera and manipulated with the use of Adobe Photoshop software.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
RT-PCR for TRPC RNA. Figure 1 shows the results of experiments in which RT-PCR was performed and specific primers were used to probe for TRPC1–TRPC7 RNA in MMC. Figure 1A demonstrates the presence of RNA for TRPC1–TRPC7 in mouse brain (positive controls). The sizes of the bands correctly matched the expected lengths of the amplified fragments of each TRPC (365, 297, 309, 304, 365, 309, 260, and 469 bp for TRPC1, TRPC2, TRPC3, TRPC4, TRPC5, TRPC6, TRPC7, and GAPDH, respectively).



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 1. RT-PCR amplification of canonical transient receptor potential (TRPC) isozymes with the use of specific primers designed for TRPC1–TRPC7. A: bands in 1.5% agarose gel correspond to sizes for amplified products of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and TRPC1–TRPC7 in mouse brain. B: amplification of RNA corresponding to TRPC1 and TRPC4 but not TRPC2, TRPC3, TRPC5, TRPC6, and TRPC7 in mouse mesangial cells (MMC).

 
As shown in Fig. 1B, only bands corresponding to TRPC1 and TRPC4 were amplified by RT-PCR and mRNA derived from MMC. Bands representing TRPC2, TRPC3, TRPC5, TRPC6, and TRPC7 were not detected. We conclude that MMC contain mRNA for TRPC1 and TRPC4 but not for TRPC2, TRPC3, TRPC5, TRPC6, and TRPC7.

Immunocytochemical localization of TRPC1 and TRPC4. The localization of TRPC1 and TRPC4 in MMC was determined by immunocytochemistry with the use of anti-TRPC1 and anti-TRPC4, both of which were purchased from Santa Cruz Biotechnology. The specificities of TRPC1 and TRPC4 antibodies were established by Western blot analysis of MMC proteins. As shown in Fig. 2A, two distinct bands, at 90 and 50 kDa, were detected with anti-TRPC1. The molecular mass of 90 kDa is in the range (80–95 kDa) previously reported for TRPC1 protein (2, 9, 24, 32, 44, 47, 51). The 50-kDa band, demonstrated previously with the use of a variety of TRPC1 antibodies, has been identified as the heavy chain of IgG (24). Figure 2B shows a Western blot for TRPC4 using MMC proteins in which a single band of ~115 kDa was detected. This size is in agreement with previous reports regarding TRPC4 (29, 39, 43).



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2. Immunoblot analysis of TRPC1 (A) and TRPC4 (B) in MMC with rabbit anti-TRPC1 polyclonal IgG (1:200). A: 90- and 50-kDa bands were consistent with sizes for TRPC1 and heavy chain of IgG (IgGH), respectively. B: lone ~115-kDa band is consistent with previous reports in which TRPC4 was detected.

 
As shown in Fig. 3, immunofluorescence staining of single mesangial cells with anti-TRPC1 (Fig. 3B) and anti-TRPC4 (Fig. 3D) revealed a diffuse cytoplasmic pattern for TRPC1 and a distinct plasmalemmal pattern for TRPC4. Cytosolic localization of TRPC1 was confirmed with the use of two other antibodies (Alomone Laboratories, Jerusalem, Israel; a kind gift from Dr. L. Tsiokas, Department of Cell Biology, University of Oklahoma Health Sciences Center, Oklahoma City, OK). Minimal nonspecific staining was observed for TRPC1 and TRPC4 (Fig. 3, A and C).



View larger version (106K):
[in this window]
[in a new window]
 
Fig. 3. Immunocytochemical identification of TRPC1 and TRPC4 in MMC with use of immunofluorescent microscopy (magnification, x400). A and C: negative controls for TRPC1 (A) and TRPC4 (C). B: TRPC1 staining predominantly in the cytosol. D: TRPC4 staining in the plasma membrane.

 
Distinguishing TRPC4-{alpha} and TRPC4-{beta}. RT-PCR performed with primers to amplify a region encompassing the 84-amino acid deletion for TRPC4-{beta} amplified 329- and 581-bp products in the positive control (mouse brain) (Fig. 4A). These products were the expected sizes for TRPC4-{beta} and TRPC4-{alpha}, respectively. However, the 581-bp product, but not the 329-bp product, was amplified from MMC RNA (Fig. 4B). An additional product of ~620 bp was amplified (Fig. 4B). It is not known whether this 620-bp band is a new splice variant or a nonspecific product of the RT-PCR. For a future project, we are obtaining the full-length sequence of the mesangial TRPC4. In this study, we concluded that MMC contain transcripts consistent with the expression of TRPC-{alpha} but not TRPC4-{beta}.



View larger version (55K):
[in this window]
[in a new window]
 
Fig. 4. Products of RT-PCR amplification of a region encompassing the 84-amino acid deletion for TRPC4-{beta}. The expected products, shown in the positive control (brain), were 329 bp for TRPC-{beta} (brain, bottom band) and 581 bp for TRPC4-{alpha} (brain, top band). In MMC, a product of expected size was evident for TRPC4-{alpha} but not for TRPC4-{beta}. Whether the larger band is a nonspecific product is not known.

 
Antisense determination of SOC role of TRPC4. Immunocytochemical staining was used to establish the effectiveness of TRPC4 antisense. As shown in Fig. 5, antisense reduced the expression of TRPC4 in the plasma membrane. However, the intensity of cytoplasmic staining of TRPC1 was unaffected by TRPC4 antisense.



View larger version (127K):
[in this window]
[in a new window]
 
Fig. 5. Effects of TRPC4 antisense on expression levels of TRPC1 and TRPC4 in MMC. A: TRPC1 staining; B: TRPC1 treated with TRPC4 antisense; C: TRPC4 staining; D: TRPC4 with TRPC4 antisense. Magnification, x400.

 
Fura 2 ratiometric analysis and antisense experiments were conducted to determine whether TRPC4 is involved in the function of SOC in MMC. Figure 6A shows a typical experiment in which SOC was determined by fura 2 ratiometric measurement of [Ca2+]i. In control experiments, 1 µM thapsigargin caused an initial elevation of cytosolic [Ca2+] due to inhibition of Ca2+-ATPase in the sarcoplasmic reticulum. After an initial thapsigargin-induced peak elevation in [Ca2+]i, the [Ca2+]i relaxed to a lower level. After removal of external Ca2+, [Ca2+]i decreased to 50 nM. The return of 1 mM Ca2+ resulted in a 160-nM increase in [Ca2+]i. This increase in [Ca2+]i after the bath [Ca2+] was increased from <10 nM to 1 mM in the presence of thapsigargin was previously shown to be a measure of SOC (15). When cells were pretreated with TRPC4 antisense for 48 h, the first (thapsigargin-induced) peak was not affected; however, SOC (the second peak) was reduced to 30 nM (Fig. 6B). The scrambled oligonucleotides did not affect SOC (Fig. 5C).



View larger version (12K):
[in this window]
[in a new window]
 
Fig. 6. Representative measurements of Ca2+ by fura-2 ratiometry demonstrating effects of TRPC4 antisense on store-operated Ca2+ (SOC) channel. A: control tracing showing an initial increase in [Ca2+]i in response to 1 µM thapsigargin (arrow). After relaxation of [Ca2+]i toward baseline, Ca2+ was removed from the external solution. The readdition of 1 mM Ca2+ to the external solution led to a second peak elevation in [Ca2+]i (SOC). B: same experimental protocol using a cell treated with TRPC4 antisense before experiment. C: same protocol using a cell treated with scrambled oligonucleotides. [Ca2+]o, Ca2+ concentration in external solution.

 
As shown in Fig. 7, the first peak was not affected by TRPC4 antisense or by scrambled oligonucleotides. However, SOC was reduced by ~83% with TRPC4 antisense treatment. Treating MMC with TRPC4 scrambled oligonucleotides did not affect SOC. These results show that TRPC4 is a contributor to SOC in MMC.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 7. Bar graph summarizing effects of TRPC4 antisense on SOC. The first peak (thapsigargin evoked) increase in [Ca2+]i was unaffected by TRPC4 antisense or scrambled oligonucleotides. SOC was significantly attenuated by TRPC4 antisense but not by scrambled oligonucleotides. Values are means ± SE; control, n = 5; TRPC4-antisense, n = 5; TRPC4 scrambled, n = 6. *P < 0.05, ANOVA plus Student-Newman-Keuls test.

 
Immunohistochemical analysis of in vivo TRPC4 expression. Immunohistochemical techniques were used to determine whether TRPC4 was expressed in glomerular sections from C57BL/6 mice. Figure 8B shows that the glomeruli were stained with anti-TRPC4 antibody (brown areas), consistent with mesangial expression. In contrast to the negative control, the anti-TRPC4-stained sections showed that mesangial cells express an abundance of TRPC4 in vivo. Note that TRPC4 also is abundantly expressed in some extraglomerular structures. These experiments show that TRPC4 SOC is expressed both in vivo and in vitro and is due not merely to a biochemical change in the cultured environment.



View larger version (99K):
[in this window]
[in a new window]
 
Fig. 8. Immunohistochemical identification of TRPC4 in MMC. Kidney sections were stained with anti-TRPC4 antibody. In contrast to the negative control (A), the anti-TRPC4 staining (B; brown areas) showed that glomeruli contain an abundance of TRPC4. Note that TRPC4 is also abundantly expressed in some tubular structures. Magnification, x400.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
In this study, RT-PCR revealed the presence of TRPC1 and TRPC4 mRNA in MMC; however, immunocytochemistry showed that only TRPC4 resided in the plasma membrane. In functional experiments, TRPC4 antisense reduced the SOC response measured by fura 2 ratiometry. TRPC4 was identified in the glomeruli of renal sections obtained from mice with the use of immunohistochemical techniques.

Expression of TRPC isoforms in MMC. Because mesangial cells have a smooth muscle-like phenotype, it is not surprising that TRPC1, previously identified in smooth muscle (24, 37, 38, 51), was also found in MMC. However, TRPC1 was predominately expressed in the cytoplasm of MMC and therefore would not serve as a component of SOC, which occurs in membranes. Because the cytoplasmic localization of TRPC1 was a surprising result, we used three different TRPC1 antibodies (sc-20110, Santa Cruz Biotechnology; ACC-010, Alomone Laboratories; a gift from Dr. L. Tsiokas) and seven fixation methods to ensure the accuracy of this result. In each experiment, we found the localization of TRPC1 to be intracellular. The localization of TRPC1 in the cytoplasm is not understood and is somewhat contradictory to studies showing that TRPC1 is endogenously localized in the plasma membranes of some cells. For example, TRPC1 associates with caveolin-1 in the plasma membrane region of human submandibular glands (13, 41) and sperm cells (42). In the MMC used in this study, we did not find clear evidence of plasma membrane localization of TRPC1; however, we are unable to conclude that TRPC1 is not in the plasma membrane. It remains possible that TRPC1 is localized to the plasma membrane but is not resolvable by our methods. Interestingly, Philipp et al. (29) also found transcripts of both TRPC1 and TRPC4 in adrenal cells. That TRPC4 antisense reduced ICRAC in adrenal cells led to the conclusion that TRPC4 was at least one of the proteins forming SOC. However, it was not determined whether TRPC1 was also a component of ICRAC in the Philipp et al. study.

Function of TRPC4 in native cells. In the absence of pharmacological inhibitors of specific isoforms of TRPC, antisense knockdown technology has been used extensively to study the function of TRPC channels in native environments. Antisense methods provided the first compelling evidence that TRP homologs were involved in SOC activity (52). After the Zhu et al. (52) study, Wu et al. (50) used antisense to show that human TRPC1 is a functional component of SOC in human embryonic kidney (HEK)-293 cells. TRPC1 antisense oligonucleotides successfully inhibited SOC in endothelial cells (3) and in salivary glands (12). Patch-clamp experiments showed that TRPC4 antisense silenced SOC in bovine adrenal cortical cells (29). Thus antisense is a proven method of establishing the SOC function of specific isoforms of TRPC in their native environment.

By performing fura 2 ratiometry in the present study, we demonstrated that TRPC4 antisense reduced SOC by 83% (from 213 to 36 nM), a value close to the 20 µM La3+ reduction that inhibited SOC by 93% [also determined with fura 2 techniques (15)]. Thus TRPC4-antisense appears to be effective in silencing the SOC response to releasing Ca2+ stores with thapsigargin. That TRPC4 antisense did not affect expression of TRPC1, which has 35% amino acid identity with TRPC4, demonstrates the specificity of this particular knockdown strategy.

RNA transcripts of TRPC4 were previously described in a variety of tissues, including brain, kidney, lung, heart, testis, ovary, and adrenal glands (6, 20, 33). Consistent with our results, transcripts of TRPC4 have been discovered in rat (33) and human (19) kidney. However, a study of bovine adrenal cells may have been the first to describe a functional role for TRPC4 in its native environment (29). More recent studies with TRPC4 knockout mice showed that TRPC4, although not necessary for survival, has an important role in regulating blood flow and vascular permeability (5, 40). Freichel et al. (5) demonstrated that TRPC4–/– expressed with impaired agonist-dependent vasorelaxation and concluded that TRPC4 forms the SOC channels necessary for Ca2+ stimulation of nitric oxide synthase in endothelial cells. More recently, Tiruppathi et al. (40) showed that lung vascular endothelial cells of TRPC4–/– mice lack the thrombin-induced endothelial cell retraction response. These studies show that in some cells, TRPC4 is a crucial component not only of maintaining intracellular Ca2+ stores but also of Ca2+-regulated physiological responses.

Properties of mesangial TRPC4 channels. The membrane-spanning structure of TRPC channels is similar to the molecules that form tetrameric ion-selective channels in the plasma membranes of cells. Therefore, it has been concluded that TRPC isoforms can form either heterotetrameric or homotetrameric channels. Because only TRPC4 was localized in the plasma membrane of MMC, our study results imply that the mesangial SOC is a homotetramer formed by only TRPC4. However, we cannot rule out the possibility that other membrane-associated TRPCs exist that were not detected with our methods. Clearly, further studies are necessary to clarify the role of TRPC4 in store-operated Ca2+ entry. Although several studies have reported SOC currents at the whole-cell level, few studies have reported single-channel currents. Our (15) previous results showed that thapsigargin-induced SOC was expressed in cultured human mesangial cells as a small, La3+-sensitive, Ca2+-selective, 2-pS channel with Ba2+ as the current carrier. The present study shows that the same channels, when examined with fura 2 methods, are silenced by TRPC4 antisense.

In agreement with our findings, previous studies showed that bovine TRPC4 (formerly CCE1), which is closely homologous to mTRPC4-{alpha}, was Ca2+ selective and activated by store depletion when heterologously expressed in HEK-293 or Chinese hamster ovary cells (27, 48). However, our findings are in disagreement with the described properties in many studies which heterologously overexpress TRPC4 (34, 35). It was shown that TRPC4 channels, presumably expressed as homotetramers, formed receptor-operated, nonselective cation channels activated independently of IP3 or store depletion (17, 30, 34). The single-channel conductance of these nonselective TRPC4 channels was much higher (41 pS) (34) than we found in our previous study (15). It was therefore suggested that TRPC4 did not form ICRAC, which was originally described as Ca2+ selective, inwardly rectifying, and having a small single-channel conductance (8, 16). However, Philipp et al. (29) showed that the endogenous TRPC4 in adrenal cells is a Ca2+-selective SOC. These data are consistent with studies showing that TRPC4–/– mice lack a highly Ca2+-selective, store-dependent current in endothelial cells (5, 40). This large discrepancy between the overexpressed and the endogenous TRPC4 is not surprising in light of a recent study by Vazquez et al. (45), who found that TRPC3 functioned as a SOC when expressed at low levels in chicken DT40 B lymphocytes. However, when expressed at higher levels, TRPC3 no longer formed a SOC but could be activated by receptor-coupled phospholipase C. Thus the native TRPC4 may be interacting with another endogenous protein that influences its properties. It is now known that several types of channels have accessory subunits that influence the biophysical, pharmacological, and regulatory properties of the pore-forming subunit (11, 22). It will be interesting to determine whether TRPC channels are similarly influenced by accessory subunits.

Splice variants of TRPC4. Although there are multiple splice variants of TRPC4 (30), isoforms TRPC4-{alpha} and TRPC4-{beta} have been shown to be the most abundantly expressed in tissues (19, 34, 35). Northern blot analysis revealed an abundance of both TRPC4-{alpha} and TRPC4-{beta} RNA in human renal tissue (19). Satoh et al. (33) also showed that TRPC4-{alpha} transcripts were specifically expressed in rat kidney. Because Satoh et al. found both TRPC4-{alpha} and TRPC4-{beta} in rat brain, we used mouse brain as a positive control. Our results revealed amplified transcripts consistent with TRPC-{alpha} but not TRPC-{beta} expression in MMC. That TRPC4-{alpha} forms the SOC channel in MMC is consistent with a study by Mery et al. (19), who showed, using the yeast two-hybrid method, a strong interaction between human TRPC4-{alpha} (but not TRPC4-{beta}) and the intracellular Ca2+ release channel (IP3R). An association between TRP and IP3R is the sine qua non of the conformational coupling hypothesis regarding activation of SOC (10).

In summary, we have found that both TRPC1 and TRPC4 are expressed in MMC. TRPC4 was clearly localized in the plasma membrane of glomerular MMC, where it may form a homotetrameric SOC. Recent studies with TRPC4–/– mice revealed important roles for TRPC4 SOC in the normal function of cardiovascular and pulmonary systems. It therefore will be interesting to examine the renal function of TRPC4–/– mice at the cellular and integrative levels.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by an American Heart Association Affiliate Grant-in-Aid (to S. C. Sansom), National Institute of Diabetes and Digestive and Kidney Diseases Grant R01 DK-49561 (to S. C. Sansom), and National Heart, Lung, and Blood Institute Grant IT32 HL-0788 (to J. L. Pluznick).


    ACKNOWLEDGMENTS
 
We thank Drs. Leonidas Tsiokas and Rong Ma from the Department of Cell Biology, University of Oklahoma Health Sciences Center, Oklahoma City, OK, for their generous gift of mouse anti-TRPC1.


    FOOTNOTES
 

Address for reprint requests and other correspondence: S. C. Sansom, Univ. of Nebraska Medical Center, 985850 Nebraska Medical Center, Omaha, NE 68198-5850 (E-mail: ssansom{at}unmc.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Altenberg GA, Subramanyam M, and Reuss L. Muscarinic stimulation of gallbladder epithelium. II. Fluid transport, cell volume, and ion permeabilities. Am J Physiol Cell Physiol 265: C1613–C1619, 1993.[Abstract/Free Full Text]

2. Brereton HM, Harland ML, Auld AM, and Barritt GJ. Evidence that the TRP-1 protein is unlikely to account for store-operated Ca2+ inflow in Xenopus laevis oocytes. Mol Cell Biochem 214: 63–74, 2000.[CrossRef][Web of Science][Medline]

3. Brough GH, Wu S, Cioffi D, Moore TM, Li M, Dean N, and Stevens T. Contribution of endogenously expressed Trp1 to a Ca2+-selective, store-operated Ca2+ entry pathway. FASEB J 15: 1727–1738, 2001.[Abstract/Free Full Text]

4. Carmines PK, Fowler BC, and Bell PD. Segmentally distinct effects of depolarization on intracellular [Ca2+] in renal arterioles. Am J Physiol Renal Fluid Electrolyte Physiol 265: F677–F685, 1993.[Abstract/Free Full Text]

5. Freichel M, Suh SH, Pfeifer A, Schweig U, Trost C, Weissgerber P, Biel M, Philipp S, Freise D, Droogmans G, Hofmann F, Flockerzi V, and Nilius B. Lack of an endothelial store-operated Ca2+ current impairs agonist-dependent vasorelaxation in TRP4–/– mice. Nat Cell Biol 3: 121–127, 2001.[CrossRef][Web of Science][Medline]

6. Garcia RL and Schilling WP. Differential expression of mammalian TRP homologues across tissues and cell lines. Biochem Biophys Res Commun 239: 279–283, 1997.[CrossRef][Web of Science][Medline]

7. Grynkiewicz G, Poenie M, and Tsien RY. A new generation of Ca2+ indicators with greatly improved fluorescence properties. J Biol Chem 260: 3440–3450, 1985.[Abstract/Free Full Text]

8. Hoth M and Penner R. Depletion of intracellular calcium stores activates a calcium current in mast cells. Nature 355: 353–356, 1992.[CrossRef][Medline]

9. Huang L, Wolska BM, Montgomery DE, Burkart EM, Buttrick PM, and Solaro RJ. Increased contractility and altered Ca2+ transients of mouse heart myocytes conditionally expressing PKC{beta}. Am J Physiol Cell Physiol 280: C1114–C1120, 2001.[Abstract/Free Full Text]

10. Kiselyov K, Xu X, Mozhayeva G, Kuo T, Pessah I, Mignery G, Zhu X, Birnbaumer L, and Muallem S. Functional interaction between InsP3 receptors and store-operated Htrp channels. Nature 396: 478–482, 1998.[CrossRef][Medline]

11. Kudlacek PE, Pluznick JL, Ma R, Padanilam B, and Sansom SC. Role of h{beta}1 in activation of human mesangial BK channels by cGMP kinase. Am J Physiol Renal Physiol 285: F289–F294, 2003.[Abstract/Free Full Text]

12. Liu X, Wang W, Singh BB, Lockwich T, Jadlowiec J, O'Connell B, Wellner R, Zhu MX, and Ambudkar IS. Trp1, a candidate protein for the store-operated Ca2+ influx mechanism in salivary gland cells. J Biol Chem 275: 3403–3411, 2000.[Abstract/Free Full Text]

13. Lockwich TP, Liu X, Singh BB, Jadlowiec J, Weiland S, and Ambudkar IS. Assembly of Trp1 in a signaling complex associated with caveolin-scaffolding lipid raft domains. J Biol Chem 275: 11934–11942, 2000.[Abstract/Free Full Text]

14. Ma R, Kudlacek PE, and Sansom SC. Protein kinase C{alpha} participates in activation of store-operated Ca2+ channels in human glomerular mesangial cells. Am J Physiol Cell Physiol 283: C1390–C1398, 2002.[Abstract/Free Full Text]

15. Ma R, Smith S, Child A, Carmines PK, and Sansom SC. Store-operated Ca2+ channels in human glomerular mesangial cells. Am J Physiol Renal Physiol 278: F954–F961, 2000.[Abstract/Free Full Text]

16. McDonald TV, Premack BA, and Gardner P. Flash photolysis of caged inositol 1,4,5-trisphosphate activates plasma membrane calcium current in human T cells. J Biol Chem 268: 3889–3896, 1993.[Abstract/Free Full Text]

17. McKay RR, Szymeczek-Seay CL, Lievremont JP, Bird GS, Zitt C, Jungling E, Luckhoff A, and Putney JW Jr. Cloning and expression of the human transient receptor potential 4 (TRP4) gene: localization and functional expression of human TRP4 and TRP3. Biochem J 351: 735–746, 2000.[CrossRef][Web of Science][Medline]

18. Menè P, Teti A, Pugliese F, and Cinotti GA. Calcium release-activated calcium influx in cultured human mesangial cells. Kidney Int 46: 122–128, 1994.[Web of Science][Medline]

19. Mery L, Magnino F, Schmidt K, Krause KH, and Dufour JF. Alternative splice variants of hTrp4 differentially interact with the C-terminal portion of the inositol 1,4,5-trisphosphate receptors. FEBS Lett 487: 377–383, 2001.[CrossRef][Web of Science][Medline]

20. Mori Y, Takada N, Okada T, Wakamori M, Imoto K, Wanifuchi H, Oka H, Oba A, Ikenaka K, and Kurosaki T. Differential distribution of TRP Ca2+ channel isoforms in mouse brain. Neuroreport 9: 507–515, 1998.[Web of Science][Medline]

21. Nagamine K, Kudoh J, Minoshima S, Kawasaki K, Asakawa S, Ito F, and Shimizu N. Molecular cloning of a novel putative Ca2+ channel protein (TRPC7) highly expressed in brain. Genomics 54: 124–131, 1998.[CrossRef][Web of Science][Medline]

22. Nimigean CM and Magleby KL. The {beta} subunit increases the Ca2+ sensitivity of large conductance Ca2+-activated potassium channels by retaining the gating in the bursting states. J Gen Physiol 113: 425–440, 1999.[Abstract/Free Full Text]

23. Nowicki S, Kruse MS, Brismar H, and Aperia A. Dopamine-induced translocation of protein kinase C isoforms visualized in renal epithelial cells. Am J Physiol Cell Physiol 279: C1812–C1818, 2000.[Abstract/Free Full Text]

24. Ong HL, Chen J, Chataway T, Brereton H, Zhang L, Downs T, Tsiokas L, and Barritt G. Specific detection of the endogenous transient receptor potential (TRP)-1 protein in liver and airway smooth muscle cells using immunoprecipitation and Western-blot analysis. Biochem J 364: 641–648, 2002.[CrossRef][Web of Science][Medline]

25. Parekh AB and Penner R. Store depletion and calcium influx. Physiol Rev 77: 901–930, 1997.[Abstract/Free Full Text]

26. Pfeilschifter J. Protein kinase C from rat renal mesangial cells: its role in homologous desensitization of angiotensin II-induced polyphosphoinositide hydrolysis. Biochim Biophys Acta 969: 263–270, 1988.[Medline]

27. Philipp S, Cavalie A, Freichel M, Wissenbach U, Zimmer S, Trost C, Marquart A, Murakami M, and Flockerzi V. A mammalian capacitative calcium entry channel homologous to Drosophila TRP and TRPL. EMBO J 15: 6166–6171, 1996.[Web of Science][Medline]

28. Philipp S, Hambrecht J, Braslavski L, Schroth G, Freichel M, Murakami M, Cavalie A, and Flockerzi V. A novel capacitative calcium entry channel expressed in excitable cells. EMBO J 17: 4274–4282, 1998.[CrossRef][Web of Science][Medline]

29. Philipp S, Trost C, Warnat J, Rautmann J, Himmerkus N, Schroth G, Kretz O, Nastainczyk W, Cavalie A, Hoth M, and Flockerzi V. TRP4 (CCE1) protein is part of native calcium release-activated Ca2+-like channels in adrenal cells. J Biol Chem 275: 23965–23972, 2000.[Abstract/Free Full Text]

30. Plant TD and Schaefer M. TRPC4 and TRPC5: receptor-operated Ca2+-permeable nonselective cation channels. Cell Calcium 33: 441–450, 2003.[CrossRef][Web of Science][Medline]

31. Putney JW Jr. TRP, inositol 1,4,5-trisphosphate receptors, and capacitative calcium entry. Proc Natl Acad Sci USA 96: 14669–14671, 1999.[Free Full Text]

32. Rosado JA and Sage SO. Activation of store-mediated calcium entry by secretion-like coupling between the inositol 1,4,5-trisphosphate receptor type II and human transient receptor potential (hTrp1) channels in human platelets. Biochem J 356: 191–198, 2001.[CrossRef][Web of Science][Medline]

33. Satoh E, Ono K, Xu F, and Iijima T. Cloning and functional expression of a novel splice variant of rat TRPC4. Circ J 66: 954–958, 2002.[CrossRef][Web of Science][Medline]

34. Schaefer M, Plant TD, Obukhov AG, Hofmann T, Gudermann T, and Schultz G. Receptor-mediated regulation of the nonselective cation channels TRPC4 and TRPC5. J Biol Chem 275: 17517–17526, 2000.[Abstract/Free Full Text]

35. Schaefer M, Plant TD, Stresow N, Albrecht N, and Schultz G. Functional differences between TRPC4 splice variants. J Biol Chem 277: 3752–3759, 2002.[Abstract/Free Full Text]

36. Stockand JD and Sansom SC. Role of large, Ca-activated K channels in regulation by nitroprusside and ANP of mesangial contraction. Am J Physiol Cell Physiol 270: C1773–C1779, 1996.[Abstract/Free Full Text]

37. Sweeney M, McDaniel SS, Platoshyn O, Zhang S, Yu Y, Lapp BR, Zhao Y, Thistlethwaite PA, and Yuan JX. Role of capacitative Ca2+ entry in bronchial contraction and remodeling. J Appl Physiol 92: 1594–1602, 2002.[Abstract/Free Full Text]

38. Sweeney M, Yu Y, Platoshyn O, Zhang S, McDaniel SS, and Yuan JX. Inhibition of endogenous TRP1 decreases capacitative Ca2+ entry and attenuates pulmonary artery smooth muscle cell proliferation. Am J Physiol Lung Cell Mol Physiol 283: L144–L155, 2002.[Abstract/Free Full Text]

39. Tang Y, Tang J, Chen Z, Trost C, Flockerzi V, Li M, Ramesh V, and Zhu MX. Association of mammalian Trp4 and phospholipase C isozymes with a PDZ domain-containing protein, NHERF. J Biol Chem 275: 37559–37564, 2000.[Abstract/Free Full Text]

40. Tiruppathi C, Freichel M, Vogel SM, Paria BC, Mehta D, Flockerzi V, and Malik AB. Impairment of store-operated Ca2+ entry in TRPC4–/– mice interferes with increase in lung microvascular permeability. Circ Res 91: 70–76, 2002.[Abstract/Free Full Text]

41. Toews ML, Ustinova EE, and Schultz HD. Lysophosphatidic acid enhances contractility of isolated airway smooth muscle. J Appl Physiol 83: 1216–1222, 1997.[Abstract/Free Full Text]

42. Trevino CL, Serrano CJ, Beltran C, Felix R, and Darszon A. Identification of mouse trp homologs and lipid rafts from spermatogenic cells and sperm. FEBS Lett 509: 119–125, 2001.[CrossRef][Web of Science][Medline]

43. Trost C, Bergs H, Himmerkus N, and Flockerzi V. The transient receptor potential, TRP4, cation channel is a novel member of the family of calmodulin binding proteins. Biochem J 355: 663–670, 2001.[Web of Science][Medline]

44. Tsiokas L, Arnould T, Zhu C, Kim E, Walz G, and Sukhatme VP. Specific association of the gene product of PKD2 with the TRPC1 channel. Proc Natl Acad Sci USA 96: 3934–3939, 1999.[Abstract/Free Full Text]

45. Vazquez G, Wedel BJ, Trebak M, St John BG, and Putney JW Jr. Expression level of the canonical transient receptor potential 3 (TRPC3) channel determines its mechanism of activation. J Biol Chem 278: 21649–21654, 2003.[Abstract/Free Full Text]

46. Walker RL, Hume JR, and Horowitz B. Differential expression and alternative splicing of TRP channel genes in smooth muscles. Am J Physiol Cell Physiol 280: C1184–C1192, 2001.[Abstract/Free Full Text]

47. Wang W, O'Connell B, Dykeman R, Sakai T, Delporte C, Swaim W, Zhu X, Birnbaumer L, and Ambudkar IS. Cloning of Trp1{beta} isoform from rat brain: immunodetection and localization of the endogenous Trp1 protein. Am J Physiol Cell Physiol 276: C969–C979, 1999.[Abstract/Free Full Text]

48. Warnat J, Philipp S, Zimmer S, Flockerzi V, and Cavalie A. Phenotype of a recombinant store-operated channel: highly selective permeation of Ca2+. J Physiol 518: 631–638, 1999.[Abstract/Free Full Text]

49. Wes PD, Chevesich J, Jeromin A, Rosenberg C, Stetten G, and Montell C. TRPC1, a human homolog of a Drosophila store-operated channel. Proc Natl Acad Sci USA 92: 9652–9656, 1995.[Abstract/Free Full Text]

50. Wu XY, Babnigg G, and Villereal ML. Functional significance of human trp1 and trp3 in store-operated Ca2+ entry in HEK-293 cells. Am J Physiol Cell Physiol 278: C526–C536, 2000.[Abstract/Free Full Text]

51. Xu SZ and Beech DJ. TrpC1 is a membrane-spanning subunit of store-operated Ca2+ channels in native vascular smooth muscle cells. Circ Res 88: 84–87, 2001.[Abstract/Free Full Text]

52. Zhu X, Jiang M, Peyton M, Boulay G, Hurst R, Stefani E, and Birnbaumer L. trp, a novel mammalian gene family essential for agonist-activated capacitative Ca2+ entry. Cell 85: 661–671, 1996.[CrossRef][Web of Science][Medline]




This article has been cited by other articles:


Home page
Exp. Biol. Med.Home page
S. Sours-Brothers, M. Ding, S. Graham, and R. Ma
Interaction Between TRPC1/TRPC4 Assembly and STIM1 Contributes to Store-Operated Ca2+ Entry in Mesangial Cells
Experimental Biology and Medicine, June 1, 2009; 234(6): 673 - 682.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S. Brechard and E. J. Tschirhart
Regulation of superoxide production in neutrophils: role of calcium influx
J. Leukoc. Biol., November 1, 2008; 84(5): 1223 - 1237.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
R. M. Foutz, P. R. Grimm, and S. C. Sansom
Insulin increases the activity of mesangial BK channels through MAPK signaling
Am J Physiol Renal Physiol, June 1, 2008; 294(6): F1465 - F1472.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. Du, M. Ding, S. Sours-Brothers, S. Graham, and R. Ma
Mediation of angiotensin II-induced Ca2+ signaling by polycystin 2 in glomerular mesangial cells
Am J Physiol Renal Physiol, April 1, 2008; 294(4): F909 - F918.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
S. Wimmers and O. Strauss
Basal Calcium Entry in Retinal Pigment Epithelial Cells Is Mediated by TRPC Channels
Invest. Ophthalmol. Vis. Sci., December 1, 2007; 48(12): 5767 - 5772.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
X. Wang, J. L. Pluznick, D. C. Settles, and S. C. Sansom
Association of VASP with TRPC4 in PKG-mediated inhibition of the store-operated calcium response in mesangial cells
Am J Physiol Renal Physiol, December 1, 2007; 293(6): F1768 - F1776.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
R. G. O'Neil
VASP: a TRPC4-associated phosphoprotein that mediates PKG-induced inhibition of store-operated calcium influx
Am J Physiol Renal Physiol, December 1, 2007; 293(6): F1766 - F1767.
[Full Text] [PDF]


Home page
J. Physiol.Home page
A. P. Albert, S. N. Saleh, C. M. Peppiatt-Wildman, and W. A. Large
Multiple activation mechanisms of store-operated TRPC channels in smooth muscle cells
J. Physiol., August 15, 2007; 583(1): 25 - 36.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
Y.-K. Ju, Y. Chu, H. Chaulet, D. Lai, O. L. Gervasio, R. M. Graham, M. B. Cannell, and D. G. Allen
Store-Operated Ca2+ Influx and Expression of TRPC Genes in Mouse Sinoatrial Node
Circ. Res., June 8, 2007; 100(11): 1605 - 1614.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
J. Du, S. Sours-Brothers, R. Coleman, M. Ding, S. Graham, D.-H. Kong, and R. Ma
Canonical Transient Receptor Potential 1 Channel Is Involved in Contractile Function of Glomerular Mesangial Cells
J. Am. Soc. Nephrol., May 1, 2007; 18(5): 1437 - 1445.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. Sours, J. Du, S. Chu, M. Ding, X. J. Zhou, and R. Ma
Expression of canonical transient receptor potential (TRPC) proteins in human glomerular mesangial cells
Am J Physiol Renal Physiol, June 1, 2006; 290(6): F1507 - F1515.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
M. Goel, W. G. Sinkins, C.-D. Zuo, M. Estacion, and W. P. Schilling
Identification and localization of TRPC channels in the rat kidney
Am J Physiol Renal Physiol, May 1, 2006; 290(5): F1241 - F1252.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
C. Y. Ku, L. Babich, R. A. Word, M. Zhong, A. Ulloa, M. Monga, and B. M. Sanborn
Expression of Transient Receptor Channel Proteins in Human Fundal Myometrium in Pregnancy
Reproductive Sciences, April 1, 2006; 13(3): 217 - 225.
[Abstract] [PDF]


Home page
Exp. Biol. Med.Home page
R. Ma, J. Du, S. Sours, and M. Ding
Store-Operated Ca2+ Channel in Renal Microcirculation and Glomeruli
Experimental Biology and Medicine, February 1, 2006; 231(2): 145 - 153.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
M. H. Zhu, M. Chae, H. J. Kim, Y. M. Lee, M. J. Kim, N. G. Jin, D. K. Yang, I. So, and K. W. Kim
Desensitization of canonical transient receptor potential channel 5 by protein kinase C
Am J Physiol Cell Physiol, September 1, 2005; 289(3): C591 - C600.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
R. Ma, J. L. Pluznick, and S. C. Sansom
Ion Channels in Mesangial Cells: Function, Malfunction, or Fiction
Physiology, April 1, 2005; 20(2): 102 - 111.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
W. Lee-Kwon, J. B. Wade, Z. Zhang, T. L. Pallone, and E. J. Weinman
Expression of TRPC4 channel protein that interacts with NHERF-2 in rat descending vasa recta
Am J Physiol Cell Physiol, April 1, 2005; 288(4): C942 - C949.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
D. J. Beech, K. Muraki, and R. Flemming
Non-selective cationic channels of smooth muscle and the mammalian homologues of Drosophila TRP
J. Physiol., September 15, 2004; 559(3): 685 - 706.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
287/2/C357    most recent
00068.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (28)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, X.
Right arrow Articles by Sansom, S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, X.
Right arrow Articles by Sansom, S. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.