Am J Physiol Cell Physiol Journal of Applied Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 287: C64-C72, 2004. First published February 18, 2004; doi:10.1152/ajpcell.00061.2003
0363-6143/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
287/1/C64    most recent
00061.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via ISI Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Aruga, S.
Right arrow Articles by Alpern, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Aruga, S.
Right arrow Articles by Alpern, R. J.

MEMBRANE TRANSPORTERS, ION CHANNELS, AND PUMPS

OKP cells express the Na-dicarboxylate cotransporter NaDC-1

Seiji Aruga,1 Ana M. Pajor,3 Kiyoshi Nakamura,1 Liping Liu,1 Orson W. Moe,1,2 Patricia A. Preisig,1 and Robert J. Alpern1

1Department of Internal Medicine, University of Texas Southwestern Medical Center, Dallas 75390; 2Veterans Administration Medical Center, Dallas 75216; and 3Department of Physiology, University of Texas Medical Branch, Galveston, Texas 77555

Submitted 12 February 2003 ; accepted in final form 11 February 2004


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Urinary citrate concentration, a major factor in the formation of kidney stones, is primarily determined by its rate of reabsorption in the proximal tubule. Citrate reabsorption is mediated by the Na-dicarboxylate cotransporter-1 (NaDC-1). The opossum kidney (OKP) cell line possesses many characteristics of the renal proximal tubule. The OKP NaDC-1 (oNaDC-1) cDNA was cloned and encodes a 2.4-kb mRNA. When injected into Xenopus oocytes, the cotransporter is expressed and demonstrates Na-coupled citrate transport with a stoichiometry of ≥3 Na:1 citrate, specificity for di- and tricarboxylates, pH-dependent citrate transport, and pH-independent succinate transport, all characteristics of the other NaDC-1 orthologs. Chronic metabolic acidosis increases proximal tubule citrate reabsorption, leading to profound hypocitraturia and an increased risk for stone formation. Under the conditions studied, endogenous OKP NaDC-1 mRNA abundance is not regulated by changes in media pH. In OKP cells transfected with a green fluorescent protein-oNaDC-1 construct, however, media acidification increases Na-dependent citrate uptake, demonstrating posttranscriptional acid regulation of NaDC-1 activity.

citrate; acid base; nephrocalcinosis; nephrolithiasis; opossum kidney cells


INGESTED CITRATE IS ABSORBED in the intestine. When citrate is metabolized to neutral end products, base equivalents are produced. Citrate is present in the circulation at low concentrations and is freely filtered by the renal glomerulus. Its concentration in urine is important because it plays a key role in preventing nephrocalcinosis and nephrolithiasis. Citrate's urinary excretion rate is regulated primarily by its rate of reabsorption in the proximal tubule, a process mediated by an apical membrane electrogenic 3Na+-citrate2– cotransporter (16).

Substantial evidence supports the idea that this apical membrane 3Na+-citrate2– cotransporter is encoded by the Na-dicarboxylate cotransporter-1 (NaDC-1) (14). NaDC-1 expressed in Xenopus oocytes exhibits many characteristics of the apical membrane 3Na+-citrate2– transporter, including Na-coupled electrogenic transport, specificity for di- and tricarboxylates, pH-dependent citrate transport, and pH-independent succinate transport (14). NaDC-1 protein has been localized to the apical membrane of the proximal tubule (2). Chronic metabolic acidosis, which is known to increase proximal tubule citrate absorption as well as the activity of the apical membrane 3Na+-citrate2– cotransporter, also increases renal cortical NaDC-1 mRNA and apical membrane protein abundance (2, 5, 7).

OKP cells are an opossum kidney cell line that possesses many characteristics of the renal proximal tubule. These cells have proved extremely useful in studying the mechanisms of regulation of proximal tubule H+, Na+, and phosphate transport. Recently, OK cells, another opossum kidney cell line, were demonstrated to exhibit Na-dependent citrate transport with many of the characteristics of NaDC-1 (6). The purpose of our study was to clone the OKP NaDC-1 (oNaDC-1) cDNA and examine its characteristics. Results demonstrate that OKP cells express a 2.4-kb NaDC-1 mRNA. Injection of oNaDC-1 cRNA into Xenopus oocytes leads to expression of a Na-dicarboxylate cotransporter with functional characteristics similar to those of NaDC-1. When OKP cells are exposed to acidic media, there is no change in oNaDC-1 mRNA abundance at 12 and 24 h. When the cells are transfected with a green fluorescent protein (GFP)-oNaDC-1 construct, media acidification increases oNaDC-1 activity, demonstrating a nontranscriptionally regulated, chronic adaptation in the cotransporter.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
RNA Extraction and Northern Blot Analysis

OKP cells were passaged in high-glucose DMEM with 10% fetal bovine serum (FBS). For experimentation, wild-type (untransfected) cells were grown to confluence, rendered quiescent by serum removal for 48 h, and harvested in guanidinium thiocyanate, and then total cellular RNA was extracted with phenol-chloroform-ethanol precipitate as previously described (2). Poly(A)+ RNA was isolated by oligo(dT) cellulose chromatography. Poly(A)+ RNA (5 µg) was size-fractionated by agarose formaldehyde gel electrophoresis and transferred to nylon membranes. Radiolabeled probes were synthesized from the appropriate cDNA using the random hexamer method. Filters were prehybridized in 5x SSC (0.75 M NaCl and 0.075 M Na-citrate, pH 7.0), 5x Denhardt's solution, 0.1 mg/ml salmon sperm DNA, and 50% formamide for 2 h at 42°C; hybridized in the same solution containing radiolabeled probe at 42°C overnight; and washed three times in 2x SSC containing 0.1% sodium dodecyl sulfate (SDS) at room temperature for 20 min at 55°C. Filters were then exposed to film overnight at –70°C, and labeling was quantitated by densitometry.

Reverse Transcription and Degenerate Polymerase Chain Reaction

First-strand cDNA was synthesized from 5 µg of poly(A)+ RNA using Moloney murine leukemia virus reverse transcriptase (SuperScript II; GIBCO BRL, Grand Island, NY) with oligo(dT) primers. DNA was then amplified by PCR using 0.2 mM dNTP, 2 mM Mg, and 2 mM each of degenerate primers: forward primer, GGCATTGCCACGCTGACTGGNACN(A/G)CNCCNAA; reverse primer, GGNTA(A/G/A)(G/A)ANCCNAGGTACCGGGTCCGGTAGAC.

Primers were designed on the basis of the conserved amino acid sequences in NaDC-1 using the consensus-degenerate hybrid oligonucleotide primers (CODEHOP) method (19). PCR was initiated by incubation at 94°C for 2 min, followed by 28 cycles of 94°C for 1 min, 62°C for 1 min, and 72°C for 1 min, with annealing temperature decreasing by 1°C every four cycles. Because no band was seen after agarose gel electrophoresis, a secondary PCR was performed as described above using the product of the first PCR as the template. In this PCR, the annealing temperature was 57°C, which again was lowered by 1°C every four cycles. Agarose gel electrophoresis of this second PCR product showed a band of the expected size. This PCR product was subcloned into a TA cloning vector (Invitrogen, Carlsbad, CA) and sequenced.

5' Rapid Amplification of cDNA Ends

First-strand cDNA was synthesized from 1 µg of poly(A)+ RNA using SuperScript II with a gene-specific primer, GSP5-1 (AGGATCTGGAGCCATATCCA), designed from the sequence obtained by degenerate PCR. Template RNA was digested with 1 µl of RNase Mix (GIBCO BRL); cDNA was purified using a GlassMax DNA isolation spin cartridge (GIBCO BRL); and poly(dC) was added to the 5' end of the cDNA using dCTP and terminal deoxynucleotidyl transferase (TdT). dC-tailed cDNA was PCR-amplified using an abridged anchor primer (GIBCO BRL), 5'-GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG-3, and a nested gene-specific primer, GSP5-2 (CCAAACCAGGAAGCAAAGTT), designed from the previous PCR product, with 30 cycles of 94°C for 1 min, 54°C for 1 min, and 72°C for 1 min. Because no bands were seen on agarose gel electrophoresis, a second PCR was performed with the PCR product using the same primers, resulting in five bands. To determine which was the band of interest, Southern blot analysis was performed using a full-length rabbit NaDC-1 cDNA as the probe. One band was positive, which was gel-extracted, cloned into a TA cloning vector, and sequenced.

3' Rapid Amplification of cDNA Ends

First-strand cDNA was synthesized from 1 µg of poly(A)+ RNA using SuperScript II with an adapter primer, 5'-GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTT-3'. RNA was digested with RNase Mix, and PCR was performed using Taq polymerase with an abridged universal amplification primer (AUAP), 5'-GGCCACGCGTCGACTAGTAC-3', and a gene-specific primer, GSP3-3 (CAGCCTACCAGGTTATCCAGACTG), designed from the sequence of the initial PCR product. Nested PCR was performed with AUAP and GSP3-4 (CTTTTCTAATGAGGATGGGGAAA). The PCR product was size-fractionated by gel electrophoresis and transferred to a nylon membrane. Southern blot analysis was performed using full-length rabbit NaDC-1 cDNA as the probe. The positive band was gel-extracted, cloned into a TA cloning vector, and sequenced.

Full-Length cDNA

The products from degenerate PCR, 5' rapid amplification of cDNA ends (RACE), and 3' RACE were assembled to yield the 2.4-kb product of oNaDC-1.

Xenopus Oocytes

Stages V and VI oocytes from Xenopus laevis were dissected, treated with collagenase, and cultured as described previously (13). The oNaDC-1 cDNA in pSP64LA plasmid, containing the Xenopus {beta}-globin untranslated regions, was used as a template for cRNA synthesis (13). Plasmids were linearized with XbaI, and in vitro cRNA transcription was performed using the SP6 mMessage mMachine kit (Ambion, Austin, TX). cRNA was resuspended in water to a final concentration of 20–40 ng/µl, and each oocyte was injected with 50 nl (total injection of 1–2 ng/oocyte).

Transport Experiments

Oocytes. Transport of [3H]succinate (DuPont NEN, Boston, MA) and [14C]citrate (Moravek Biochemicals, Brea, CA) was measured 2–3 days after oocyte injection as described (13). Na and choline buffers were as follows (in mM): 100 NaCl or choline-Cl, 2 KCl, 1 MgCl2, 1 CaCl2, and 10 HEPES-Tris, pH 7.5. The oocytes were rinsed briefly with choline buffer to remove Na and serum. Transport was initiated by replacement of the choline rinse with 0.4 ml of the appropriate transport buffer, as described in the figure legends. Transport was stopped by addition of 4 ml of ice-cold choline buffer, followed by removal of extracellular radioactivity with three additional washes in cold choline buffer. Individual oocytes were transferred to scintillation vials and dissolved in 0.5 ml of 10% SDS. Scintillation cocktail was added, and radioactivity was counted. Counts in uninjected control oocytes were subtracted from counts in cRNA-injected oocytes. Data are presented as means ± SE, except for kinetic data, in which the error represents the standard error of the curve fit. Statistical analysis was performed with the SigmaStat software program (Jandel Scientific, Chicago, IL).

Control studies were performed to compare Na-dependent uptake in uninjected vs. cRNA-injected oocytes. Uptake in uninjected oocytes ranged from 10 to 16 pmol·oocyte–1·h–1, and in cRNA-injected oocytes, it ranged from 437 to 1,084 pmol·oocyte–1·h–1. There were no differences between water and uninjected oocytes.

OKP cells. OKP cells were passaged in high-glucose DMEM with 10% FBS. For experimentation, cells were plated on six-well culture plates, grown to 50–70% confluence, and then transfected for 5 h with 1 µg of DNA [pEGFP-C3 vector (Clontech Laboratories, Palo Alto, CA) with or without full-length oNaDC-1 inserted into the multiple cloning site at the EcoR I restriction site] using the Lipofectamine Plus kit (Invitrogen). Serum (10% FBS) was then added to the wells for 19 h, after which the cells were 95–100% confluent. The cells were rendered quiescent within 24 h by the removal of serum and then were exposed to control (pH 7.4) or acidic (pH 6.8) media for 6 h. [14C]citrate (DuPont NEN) uptake was measured at pH 7.4 for 5 min in the presence (136 mM) or absence of NaCl (NaCl replaced with 136 mM choline-Cl) using a solution containing, in addition to either NaCl or choline-Cl, 1.2 mM CaCl2, 1 mM MgSO4, 3 mM KCl, 25 mM HEPES, 1.39 mM citric acid, and 0.5 µCi/ml [14C]citrate. The uptake reaction was stopped, and the remaining extracellular [14C]citrate was removed by washing the cells three times with an ice-cold 0.1 M MgCl2 solution. After the last wash, the cells were lysed in 300 µl of 0.1 N NaOH and scraped with a rubber policeman. A 10-µl aliquot was used to measure protein content by Bradford assay (Bio-Rad Laboratories, Hercules, CA), the remaining 290 µl were put into 5 ml of scintillation fluid, and [14C]citrate was counted with a Beckman scintillation counter (model LS 3801; Fullerton, CA). Uptake is reported as picomoles of citrate per 5 min per milligram of protein.

Statistics

Statistical significance was determined by performing the appropriate t-test. Differences between means were considered significant at P ≤ 0.05.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Cloning of OKP NaDC-1 cDNA

To determine whether OKP cells express NaDC-1 mRNA, Northern blot analysis using OKP poly(A)+ RNA was performed using rabbit NaDC-1 cDNA as the probe. A 2.4-kb band the size of NaDC-1 mRNA in other species was visualized (data not shown).

We next attempted to clone the oNaDC-1 using degenerate PCR. Degenerate PCR primers were designed on the basis of amino acid sequences conserved across rat, rabbit, and human NaDC-1 proteins. A specific PCR product was not obtained, probably because of marked codon degeneracy and low mRNA abundance. We next tried the CODEHOP method, which uses hybrid primers consisting of a relatively short 3' degenerate core and a 5' nondegenerate consensus sequence. Reducing the length of the 3' core to a minimum decreases the total number of individual primers in the degenerate primer pool. Hybridization of the 3' degenerate core with the target template is stabilized by the 5' nondegenerate consensus sequence, allowing higher annealing temperatures without increasing the degeneracy of the pool. By this method, PCR primers were designed on the basis of amino acid sequences conserved in rat, rabbit, and human NaDC-1, corresponding to amino acids 233–246 (GIATLTGTAPN) and 485–495 (PILASMAQAIC) of the human sequence. The PCR product obtained using 5 µg of OKP poly(A)+ RNA was 784 bp, consistent with the predicted size. Sequencing of the 784-bp product revealed 80% sequence identity to human NaDC-1. The PCR clone hybridized to a 2.4-kb transcript in OKP poly(A)+ RNA and was able to detect a 2.8-kb transcript in rat kidney cortex total RNA at high stringency.

5' and 3' sequences were then determined by 5' and 3' RACE, respectively, with gene-specific primers designed from the above PCR product. The sequences obtained by 5' RACE and 3' RACE also revealed 80% homology to human NaDC-1. oNaDC-1 mRNA obtained by combining the sequences of the three PCR yielded an oNaDC-1 cDNA of 2,404 bp in length with an open reading frame of 1,818 bp that encoded a protein of 605 amino acid residues (Fig. 1A). oNaDC-1 shows 71, 67, 68, and 72% amino acid identity to human, rabbit, rat, and mouse NaDC-1, respectively (Fig. 1B). The hydropathy plot predicts that oNaDC-1 has 13 transmembrane domains (TMDs; Fig. 1C).



View larger version (51K):
[in this window]
[in a new window]
 
Fig. 1. A: nucleotide and predicted amino acid sequence of opossum kidney cell (OKP) Na-dicarboxylate cotransporter-1 (NaDC-1). B: amino acid sequence comparison between human, rabbit, rat, mouse, and OKP NaDC-1. C: schematic diagram of predicted membrane topology. Sequence analysis was performed with the Clustalw software program (European Bioinformatics Institute/European Molecular Biology Laboratory, Heidelberg, Germany). The predicted hydropathy and membrane topology were obtained from the TopPred2 structure and sequence tools database (Institut Pasteur, Paris, France) [OKP NaDC-1 (oNaDC-1), GenBank accession no. AY-186579]. Asterisks indicate residues conserved in all sequences in the alignment, colons indicate conserved substitutions, and dots indicate semiconserved substitutions.

 


View larger version (67K):
[in this window]
[in a new window]
 
Fig. 1—Continued.

 
Expression of oNaDC-1 in Xenopus Oocytes

Anion specificity. The OKP cell Na+-dicarboxylate cotransporter oNaDC-1 transports both succinate and citrate with kinetic values that are similar to those of the rabbit NaDC-1 (16). In a typical experiment (averaging 5 oocytes from a single frog for each data point) (Fig. 2A), the Km for succinate was 150 µM. In three separate experiments, the mean Km was 180 ± 28 µM. The Km for citrate in the single experiment shown in Fig. 2B was 1.7 mM, and the mean Km for three experiments was 1.5 ± 0.3 mM.



View larger version (12K):
[in this window]
[in a new window]
 
Fig. 2. Kinetics of succinate (A) and citrate (B) transport in Xenopus oocytes injected with cRNA for oNaDC-1. Five-minute uptakes (5 min) were measured in 5 oocytes from a single frog, and the mean was calculated to obtain a single data point for that experiment. The Na buffer (see METHODS) uptake solution contained 0–5 mM succinate or 0–7 mM citrate. The data were fit to the Michaelis-Menten (Km) equation using nonlinear regression. The Michaelis-Menten kinetics for succinate transport in this single experiment were Km 150 ± 30 µM (SE of regression), Vmax = 2,550 ± 100 pmol·oocyte1·h–1. The Michaelis-Menten kinetics for citrate transport in this single experiment were Km = 1.70 ± 0.35 mM, Vmax = 4,100 ± 360 pmol·oocyte1·h–1.

 
The transport of succinate by oNaDC-1 was inhibited >50% by {alpha}-ketoglutarate, methylsuccinate, fumarate, 2,2-dimethylsuccinate, and succinate (Fig. 3). 2,2-Dimethylsuccinate does not inhibit the rabbit and human NaDC-1 (13, 14), but it induces inward currents in rat and mouse NaDC-1 and in rat SDCT2 (NaDC-3) (3). Both L-aspartate and L-glutamate inhibited succinate transport by oNaDC-1 (Fig. 3). L-Aspartate and L-glutamate also induced inward currents, verifying that they are transported substrates (results not shown). Other members of the family also interact with L-aspartate and L-glutamate, but with low affinity (3, 4, 23). Citrate had a small inhibitory effect on succinate transport, reflecting the differences in affinity between the two substrates. The monocarboxylate pyruvate did not inhibit succinate transport. Sulfate inhibited transport by ~20%, but it did not induce inward currents, suggesting that sulfate is a nontransported inhibitor. Although the sulfate transporter NaSi-1 (9) is related to the Na-dicarboxylate cotransporters (12), this is the first example of a dicarboxylate cotransporter that interacts with sulfate.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 3. Anion specificity of oNaDC-1. Fifteen-minute uptakes were measured in Na buffer containing 10 µM succinate in the absence or presence of 1 mM concentrations of test inhibitors. Uptake is expressed as a percentage of control uptake (absence of inhibitor). Data represent the means of n = 2 for methylsuccinate (Me-succinate), {alpha}-ketoglutarate ({alpha}-KG), citrate, and pyruvate; n = 3 for succinate, dimethylsuccinate (DMS), fumarate, L-aspartate, and sulfate; and n = 5 for L-glutamate. The errors represent the SE or, when n = 2, the range of the 2 samples.

 
Cation specificity. The preferred cation for oNaDC-1 is Na. Transport of succinate was reduced to background levels when Na was replaced with choline or cesium (Fig. 4A). Although Li could partially substitute for Na, the transport rate with Li was 11% of that with Na (Fig. 4A). In the presence of Na, succinate transport was also inhibited by the presence of Li (Fig. 4B), which binds to one of the NaDC-1 Na binding sites with high affinity (18). Succinate transport was not inhibited by choline (Fig. 4B).



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 4. Cation specificity of oNaDC-1. A: cation replacement. Transport of 10 µM succinate was measured in solutions containing 100 mM concentrations of each cation as Cl salts. Fifteen-minute time points were measured. B: Li inhibition. In a separate experiment, transport of succinate was measured in 100 mM Na, 95 mM Na + 5 mM choline (Na:choline), or 95 mM Na + 5 mM Li (Na:Li). In both graphs, transport rates are expressed as percent succinate uptake measured in the presence of 100 mM Na (control). Data represent means ± SE (n = 5 oocytes).

 
There was a sigmoid relationship between succinate uptake by oNaDC-1 and the concentration of Na. In a typical experiment (Fig. 5), the half-saturation constant for Na, KNa, was 19 mM, and the apparent Hill coefficient, nH, was 2.2. In three experiments, the mean KNa was 22 ± 6 mM, and the mean nH was 2.5 ± 0.4. A Hill coefficient >2 indicates that ≥3 Na+ are involved in transport. Consistent with this, the coupled transport of Na and succinate by oNaDC-1 is electrogenic; Na- and succinate-induced inward currents were seen in two-electrode voltage clamp experiments (results not shown).



View larger version (12K):
[in this window]
[in a new window]
 
Fig. 5. Kinetics of Na dependence of succinate transport in Xenopus oocytes expressing oNaDC-1. Five-minute uptake of 25 µM succinate was measured in transport buffer containing Na concentrations ranging from 0 to 100 mM (NaCl replaced by choline-Cl). In this typical experiment, each data point represents the mean of 5 oocytes from 1 frog. Data were fit to the Hill equation by nonlinear regression. For this single experiment, KNa was 19 ± 4 mM (SE of regression), Vmax was 299 ± 26 pmol·oocyte1·h–1, and Hill coefficient nH was 2.2 ± 0.7.

 
pH sensitivity. As seen previously in other NaDC-1 orthologs, there was an effect of pH on citrate transport by oNaDC-1 but relatively little effect of pH on succinate transport (Fig. 6). Citrate transport is stimulated at acidic pH and inhibited at alkaline pH.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 6. pH dependence of succinate and citrate transport in Xenopus oocytes expressing OKP NaDC-1. The uptake of 100 µM succinate (A) and citrate (B) was measured for 15 min in Na-containing buffer adjusted to pH values ranging from 5.5 to 8.0. Data represent means ± SE (n = 5).

 
Acid Regulation of NaDC-1 in OKP Cells

In untransfected cells, we were unable to reliably demonstrate Na-dependent citrate uptake at pH 7.4 or 6.8, probably because of the low level of native NaDC-1 expression (data not shown). Thus, to determine whether media acidification regulates oNaDC-1 activity, cells were transfected with oNaDC-1 as a GFP-NaDC-1 construct, grown to confluence, and rendered quiescent as described in METHODS. Cells were then exposed to either control (pH 7.4) or to acidic (pH 6.8) media for 6 h, and Na-dependent [14C]citrate uptake was measured as described in METHODS. As shown in Fig. 7, media acidification led to a 30% increase in NaDC-1 activity.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 7. Acid regulation of NaDC-1 activity. OKP cells were transiently transfected with green fluorescent protein (GFP) alone or with the GFP-oNaDC-1 construct and exposed to media of pH 7.4 [control (Con)] or pH 6.8 (acid) for 6 h, and then Na-independent and -dependent NaDC-1 activity was assayed as [14C]citrate uptake at pH 7.4 as described in METHODS. Data are plotted as [14C]citrate uptake (pmol·mg protein–1·5 min–1); n = 3 for GFP; n = 12 for all GFP-oNaDC-1 groups. *P < 0.001 vs. without Na; #P < 0.05 vs. control (pH 7.4).

 
To determine whether media acidification regulates oNaDC-1 mRNA abundance, cells were grown to confluence, rendered quiescent as described in METHODS, and then exposed to either control (pH 7.4) or acidic (pH 6.8) media for 12 or 24 h. Figure 8A displays a Northern blot probed with the oNaDC-1 cDNA showing that oNaDC-1 mRNA abundance is not regulated by media acidification. In four experiments, there was no trend toward an acid-induced increase in NaDC-1 mRNA abundance (Fig. 8B).



View larger version (51K):
[in this window]
[in a new window]
 
Fig. 8. Effect of media pH on oNaDC-1 mRNA abundance. Cells were exposed to control (pH 7.4) or acidic (pH 6.8) media for 12 or 24 h. NaDC-1 mRNA [5 µg poly(A)+/lane] was probed using a full-length OKP NaDC-1 cDNA. Results were normalized for GAPDH. A: typical blot; B: data summary; n = 4 for both 12- and 24-h experiments. For NaDC-1 expression, the film was exposed overnight; for GAPDH expression, exposure was for 1 h.

 

    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Because citrate complexes ionized Ca, citrate is an important inhibitor of nephrolithiasis and nephrocalcinosis. Urinary citrate excretion is determined by the rate of proximal tubule citrate reabsorption. In the proximal tubule, citrate is reabsorbed across the apical membrane by a Na-coupled electrogenic transporter that transports citrate and succinate and is encoded by NaDC-1 (13, 14, 16, 18, 20, 21). After transport into the cell, citrate is metabolized in the tricarboxylic acid cycle and by cytoplasmic ATP citrate lyase (10, 11, 22).

Chronic metabolic acidosis is associated with nephrolithiasis and nephrocalcinosis, in part because of hypocitraturia (2, 11, 22). In rats, metabolic acidosis has been shown to increase proximal tubule citrate absorption, apical membrane Na+-citrate2– cotransporter activity, and cortical NaDC-1 mRNA and proximal tubule apical membrane protein abundances (2, 5, 7).

To further study the mechanisms responsible for NaDC-1 regulation, it would be extremely useful to possess a tissue culture model. OKP is an opossum kidney cell line that has proved extremely valuable in examining the regulation of proximal tubular hydrogen and phosphate transport. Hering-Smith et al. (6) recently demonstrated that incubation in acidic media causes an increase in Na-coupled citrate uptake in OK cells. To determine whether OKP cells express a Na-dicarboxylate transporter, we performed Northern blot analysis using the rabbit NaDC-1 as a probe. Although a band was visualized, it required 5 µg of poly(A)+ mRNA.

We therefore decided to clone the OKP NaDC-1 cDNA by performing PCR. The OKP NaDC-1 cDNA is a 2,404-bp sequence, has 80% sequence identity to the human NaDC-1 cDNA, and labels a 2.4-kb transcript in OKP mRNA. The open reading frame is 1,818 bp and encodes a protein of 605 amino acids that has 71, 67, 68, and 72% amino acid identity to human, rabbit, rat, and mouse NaDC-1, respectively. The major difference between oNaDC-1 and NaDC-1 of the other four species is that oNaDC-1 has nine additional amino acids (residues 204–212), which are predicted to be in the fourth hydrophilic loop (see below).

Depending on the program used, the predicted hydropathy plot for oNaDC-1 contains 13 (3 programs), 14 (1 program), or 15 (1 program) TMDs. All five programs predicted the first TMD and nine COOH-terminal TMDs. The variation in the predicted topologies was in the size and/or number of domains between amino acids 40 and 156. Figure 1C is based on the programs that predicted 13 TMDs.

For comparison, human, rabbit, and mouse NaDC-1 are all predicted to have at least 11 TMDs (13, 14, 18). All four species vary in the sizes of the individual hydrophilic domains. The major difference between the oNaDC-1 and human, rabbit, or mouse predicted hydropathy plots is that there is essentially no hydrophilic loop between TMD 10 and 11 and TMD 11 and 12 in oNaDC-1, whereas the hydrophilic domains in the other three species are larger.

Hydropathy plots are only predictions. Pajor and colleagues (15, 24, 25) used cysteine mutagenesis, chemical modifications, antibodies, and epitope tagging to verify the locations of specific amino acids. They confirmed that the NH2 terminus is intracellular, which is predicted by all hydropathy plots, and that amino acids 164–233 of rabbit NaDC-1 are part of hydrophilic loop 4 (cytoplasmic). These amino acids correspond to amino acids 164–243 in oNaDC-1, with amino acids 164–233 predicted to be part of hydrophilic loop 4 (cytoplasmic) and amino acids 234–243 on the cytoplasmic side of TMD 5. This is in the region of the additional amino acids in oNaDC-1 (see above; Ref. 3). Amino acids R349 and D373 of rabbit NaDC-1, both involved in substrate affinity and cation binding, are near the extracellular side of TMD 7 and 8, respectively. These amino acids correspond to R360 and D384 in oNaDC-1, which are also predicted to be near the extracellular side of TMD 7 and 8, respectively. These arginine and aspartic acid residues are conserved in all five species. Amino acid S372 of rabbit NaDC-1, also conserved in all five species, is near the extracellular side of TMD 8. It corresponds to amino acid 383 in oNaDC-1, also predicted to be near the extracellular edge of TMD 8. Rabbit NaDC-1 amino acids F473, T474, E475, S478, N479, A480, A481, and T482 are predicted to be on the extracellular side of TMD 9. All except A481 are conserved in all five species. Rabbit A481 is a valine residue in the other four species. These eight amino acids correspond to amino acids F483, T484, E485, S488, N489, V490, A491, and T492 in oNaDC-1. In oNaDC-1, however, these amino acids are predicted to be on the cytoplasmic side of TMD 10 (F483, T484, and E485) and 11 (S488, N489, V490, A491, and T492). As noted above, the predicted hydropathy plot for oNaDC-1 in this region (Fig. 1C) does not predict an intracellular loop between TMD 10 and 11 or an extracellular loop between TMD 11 and 12. Because this whole region of the protein is highly conserved among the five species, it is possible that the oNaDC-1 predicted hydropathy plot is in error.

To confirm that this transcript encodes an NaDC-1 analog, protein was expressed and studied functionally in Xenopus oocytes. The transporter has a high affinity for succinate and a lower affinity for citrate and is Na selective. A number of dicarboxylic acids inhibited succinate transport, and Li could substitute for Na, but poorly. Na affinity is 22 mM with a stoichiometry of ≥3 Na:1 citrate. Most important, transport of citrate is pH dependent, whereas succinate is not. This pH dependence is characteristic of NaDC-1 and the proximal tubule apical membrane Na-dicarboxylate transporter and likely is due to the fact that the transporter carries only dicarboxylates. All of the above functional characteristics confirm that this transcript encodes oNaDC-1.

The oNaDC-1 Km for citrate is similar to that of other NaDC-1 orthologs, which provides additional support for its being the oNaDC-1 ortholog. This Km is higher than the luminal citrate concentration. However, Km is calculated on the basis of rates analyzed as a function of total luminal citrate concentration, whereas the transported substrate is citrate2–. Along the proximal tubule, pH drops from 7.4 to 6.5, with most of the decrease occurring in the early proximal tubule. This pH drop would raise the concentration of citrate2– and thus lower the apparent Km ~10-fold, bringing it into the range of plasma citrate concentration (0.1–0.2 mM).

Ingestion of acid in vivo leads to enhanced NaDC-1 activity, mRNA abundance, and protein abundance (2, 7). OKP cells provide a model for studying the mechanisms that mediate acid-induced NaDC-1 regulation. We (1) previously showed that exposing OKP cells to acidic media for 24 h increased NHE-3 mRNA abundance. However, incubation at pH 6.8 for 12 or 24 h had no effect on endogenously expressed oNaDC-1 mRNA. There are a number of possible explanations for the apparent discrepancy between this observation and our results in vivo. First, regulation of NaDC-1 mRNA abundance in OKP cells may require more than 24 h, although in rats, NaDC-1 mRNA was upregulated 16 h after gavage and 24 h after NH4Cl was added to the drinking water. Second, it is possible that regulation requires participation of a second cell type present in vivo that secretes a hormone or a paracrine factor. Third, this form of regulation may be species specific. Given the similarities between rat, rabbit, mouse, and opossum cells in other forms of pH regulation, however, the latter explanation seems unlikely.

We also examined the effect of pH on Na-coupled citrate transport in OKP cells. In the past, we have been unable to demonstrate Na-dependent citrate uptake in wild-type cells in a manner that we thought was convincing; this remained so in the present study. One possible reason for this is the low level of NaDC-1 expression in our cells. Even in the kidney proximal tubule, rates of citrate transport are significantly lower than those of other Na-dependent processes, such as H+, glucose, or phosphate transport. In addition, cultured cells tend to have poorly developed brush border membranes and thus would be expected to have even lower expression levels of brush border membrane proteins. We therefore decided to overexpress oNaDC-1 in OKP cells and measure transport. In cells transiently transfected with a GFP-oNaDC-1 construct, Na-dependent citrate uptake was clearly evident and upregulated by acid incubation. These results demonstrate that acid stimulates oNaDC-1 by a posttranscriptional regulatory mechanism, but an additional transcriptional regulatory component cannot be ruled out. Possible mechanisms of posttranscriptional regulation include regulation of mRNA stability, protein synthesis or degradation, trafficking to the apical membrane, and posttranslational modification. The OKP cell is a good cell line in which to study such regulation because it has the same signaling mechanisms as the intact proximal tubule. It is unfortunate that NaDC-1 expression is low, making it necessary to transfect the cells with NaDC-1 to study regulation.

Our finding of acid regulation is slightly different from what Hamm and colleagues (6, 8) found. In their studies using OK cells, acute decreases in pH had no effect on citrate transport, whereas acute increases raised transporter activity. As these authors (8) noted, this response to changes in pH is not typical of the proximal tubule apical membrane citrate transporter. In further studies (6), they did find that both acute and chronic (48 h) decreases in media pH increased transporter activity. However, these studies were conducted with total extracellular calcium concentrations of <200 µM. At higher extracellular calcium concentrations, Hamm and colleagues found that transporter activity was significantly lower and did not demonstrate competition between citrate and succinate, another characteristic of the apical membrane transporter. Our functional as well as acid regulation studies, showing competition between citrate and succinate and chronic regulation by pH, were performed in the presence of 1.0 or 1.2 mM Ca, respectively. The reason for this difference in the effect of Ca on transporter function and regulation is not apparent. Our results suggest that the transporter cloned represents the opossum NaDC-1. The transporter studied by Hamm and coworkers may represent a different NaDC isoform.


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This study was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-20543, DK-39298, DK-54396, DK-48482, and DK-46269 and by the Veterans Affairs Research Service.


    ACKNOWLEDGMENTS
 
Technical assistance was provided by Kavita Mahti and Ebtesam Abdul Salam.


    FOOTNOTES
 

Address for reprint requests and other correspondence: P. A. Preisig, Dept. of Internal Medicine, Univ. of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Rm. H5.112, Dallas, TX 75390-8856 (E-mail: patricia.preisig{at}utsouthwestern.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Amemiya M, Yamaji Y, Cano A, Moe OW, and Alpern RJ. Acid incubation increases NHE-3 mRNA abundance in OKP cells. Am J Physiol Cell Physiol 269: C126–C133, 1995.[Abstract/Free Full Text]

2. Aruga S, Wehrli S, Kaissling B, Moe OW, Preisig P, Pajor A, and Alpern RJ. Chronic metabolic acidosis increases NaDC-1 mRNA and protein abundance in rat kidney. Kidney Int 58: 206–215, 2000.[CrossRef][Web of Science][Medline]

3. Chen X, Tsukaguchi H, Chen XZ, Berger UV, and Hediger MA. Molecular and functional analysis of SDCT2, a novel rat sodium-dependent dicarboxylate transporter. J Clin Invest 103: 1159–1168, 1999.[Web of Science][Medline]

4. Chen XZ, Shayakul C, Berger UV, Tian W, and Hediger MA. Characterization of a rat Na+-dicarboxylate cotransporter. J Biol Chem 273: 20972–20981, 1998.[Abstract/Free Full Text]

5. Hamm LL. Renal handling of citrate. Kidney Int 38: 728–735, 1990.[Web of Science][Medline]

6. Hering-Smith KS, Gambala CT, and Hamm LL. Citrate and succinate transport in proximal tubule cells. Am J Physiol Renal Physiol 278: F492–F498, 2000.[Abstract/Free Full Text]

7. Jenkins AD, Dousa TP, and Smith LH. Transport of citrate across renal brush border membrane: effects of dietary acid and alkali loading. Am J Physiol Renal Fluid Electrolyte Physiol 249: F590–F595, 1985.[Abstract/Free Full Text]

8. Law D, Hering-Smith KS, and Hamm LL. Citrate transport in proximal cell line. Am J Physiol Cell Physiol 263: C220–C225, 1992.[Abstract/Free Full Text]

9. Markovich D, Forgo J, Stange G, Biber J, and Murer H. Expression cloning of rat renal Na+/SO42–2– cotransport. Proc Natl Acad Sci USA 90: 8073–8077, 1993.[Abstract/Free Full Text]

10. Melnick JZ, Preisig PA, Moe OW, Srere PA, and Alpern RJ. Renal cortical mitochondrial aconitase is regulated in hypo- and hypercitraturia. Kidney Int 54: 160–165, 1998.[CrossRef][Web of Science][Medline]

11. Melnick JZ, Srere PA, Elshourbagy NA, Moe OW, Preisig PA, and Alpern RJ. Adenosine triphosphate citrate lyase mediates hypocitraturia in rats. J Clin Invest 98: 2381–2387, 1996.[Web of Science][Medline]

12. Pajor A. Sodium-coupled transporters for Krebs cycle intermediates. Annu Rev Physiol 61: 663–682, 1999.[CrossRef][Web of Science][Medline]

13. Pajor AM. Sequence and functional characterization of a renal sodium/dicarboxylate cotransporter. J Biol Chem 270: 5779–5785, 1995.[Abstract/Free Full Text]

14. Pajor AM. Molecular cloning and functional expression of a sodium-dicarboxylate cotransporter from human kidney. Am J Physiol Renal Fluid Electrolyte Physiol 270: F642–F648, 1996.[Abstract/Free Full Text]

15. Pajor AM. Conformationally sensitive residues in transmembrane domain 9 of the Na+/dicarboxylate co-transporter. J Biol Chem 276: 29961–29968, 2001.[Abstract/Free Full Text]

16. Pajor AM. Sodium-coupled transporters for Krebs cycle intermediates. Annu Rev Physiol 61: 663–682, 2002.

17. Pajor AM, Hirayama BA, and Loo DDF. Sodium and lithium interactions with the Na+/dicarboxylate cotransporter. J Biol Chem 273: 18923–18929, 1998.[Abstract/Free Full Text]

18. Pajor AM and Sun NN. Molecular cloning, chromosomal organization, and functional characterization of a sodium-dicarboxylate cotransporter from mouse kidney. Am J Physiol Renal Physiol 279: F482–F490, 2000.[Abstract/Free Full Text]

19. Rose TM, Schultz ER, Henikoff JG, Pietrokovski S, McCallum CM, and Henikoff S. Consensus-degenerate hybrid oligonucleotide primers for amplification of distinctly related sequences. Nucleic Acids Res 26: 1628–1635, 1998.[Abstract/Free Full Text]

20. Sekine T, Cha SH, Hosoyamada M, Kanai Y, Watanabe N, Furuta Y, Fukuda K, Igarashi T, and Endou H. Cloning, functional characterization, and localization of a rat renal Na+-dicarboxylate transporter. Am J Physiol Renal Physiol 275: F298–F305, 1998.[Abstract/Free Full Text]

21. Sekine T, Watanabe N, Hosoyamada M, Kanai Y, and Endou H. Expression cloning and characterization of a novel multispecific organic anion transporter. Biol Chem 272: 18526–18529, 1997.[Abstract/Free Full Text]

22. Simpson DP. Citrate excretion: a window on renal metabolism. Am J Physiol Renal Fluid Electrolyte Physiol 244: F223–F234, 1983.[Abstract/Free Full Text]

23. Steffgen J, Burckhardt BC, Langenberg C, Kühne L, Muller GA, Burckhardt G, and Wolff NA. Expression cloning and characterization of a novel sodium-dicarboxylate cotransporter from winter flounder kidney. J Biol Chem 274: 20191–20196, 1999.[Abstract/Free Full Text]

24. Yao X and Pajor AM. Arginine-349 and aspartate-373 of the Na+/dicarboxylate cotransporter are conformationally sensitive residues. Biochemistry 41: 1083–1090, 2002.[CrossRef][Medline]

25. Zhang FF and Pajor AM. Topology of the Na+/dicarboxylate cotransporter: the N-terminus and hydrophilic loop 4 are located intracellularly. Biochim Biophys Acta 1511: 80–89, 2001.[Medline]





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
287/1/C64    most recent
00061.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via ISI Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Aruga, S.
Right arrow Articles by Alpern, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Aruga, S.
Right arrow Articles by Alpern, R. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.