Am J Physiol Cell Physiol Watch the video to see how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 286: C1453-C1463, 2004. First published February 4, 2004; doi:10.1152/ajpcell.00275.2003
0363-6143/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/6/C1453    most recent
00275.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (18)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Krumerman, A.
Right arrow Articles by McDonald, T. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Krumerman, A.
Right arrow Articles by McDonald, T. V.

CALL FOR PAPERS
Protein and Vesicle Trafficking, Cytoskeleton

An LQT mutant minK alters KvLQT1 trafficking

Andrew Krumerman, Xiaohong Gao, Jin-Song Bian, Yonathan F. Melman, Anna Kagan, and Thomas V. McDonald

Departments of Medicine and Molecular Pharmacology, Albert Einstein College of Medicine, Bronx, New York 10461

Submitted 26 January 2003 ; accepted in final form 30 January 2004


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cardiac IKs, the slowly activated delayed-rectifier K+ current, is produced by the protein complex composed of {alpha}- and {beta}-subunits: KvLQT1 and minK. Mutations of genes encoding KvLQT1 and minK are responsible for the hereditary long QT syndrome (loci LQT1 and LQT5, respectively). MinK-L51H fails to traffic to the cell surface, thereby failing to produce effective IKs. We examined the effects that minK-L51H and an endoplasmic reticulum (ER)-targeted minK (minK-ER) exerted over the electrophysiology and biosynthesis of coexpressed KvLQT1. Both minK-L51H and minK-ER were sequestered primarily in the ER as confirmed by lack of plasma membrane expression. Glycosylation and immunofluorescence patterns of minK-L51H were qualitatively different for minK-ER, suggesting differences in trafficking. Cotransfection with the minK mutants resulted in reduced surface expression of KvLQT1 as assayed by whole cell voltage clamp and immunofluorescence. MinK-L51H reduced current amplitude by 91% compared with wild-type (WT) minK/KvLQT1, and the residual current was identical to KvLQT1 without minK. The phenotype of minK-L51H on IKs was not dominant because coexpressed WT minK rescued the current and surface expression. Collectively, our data suggest that ER quality control prevents minK-L51H/KvLQT1 complexes from trafficking to the plasma membrane, resulting in decreased IKs. This is the first demonstration that a minK LQT mutation is capable of conferring trafficking defects onto its associated {alpha}-subunit.

potassium channel; hereditary arrhythmia; electrophysiology; protein interaction


LONG QT (LQT) syndrome is a disorder characterized by delayed cardiac repolarization resulting in prolongation of the QT interval on ECG. Patients affected with LQT syndrome present with syncope and with sudden death due to ventricular tachyarrhythmia (3, 9, 37). Five genes encoding ion channel protein subunits have been linked to the hereditary form of LQT syndrome: KCNQ1 (locus LQT1), KCNH2 (LQT2), SCN5A (LQT3), KCNE1 (LQT5), and KCNE2 (LQT6) (30). KCNQ1 and KCNE1 encode the {alpha}- and {beta}-subunits KvLQT1 and minK, respectively. These proteins coassemble to form the K+ channel that produces cardiac IKs, the slowly activating delayed-rectifier K+ current (5, 26). LQT syndrome-causing mutations of KCNE1 have been identified that result in the autosomal dominant Romano-Ward form (6, 31) and the rarer autosomal recessive Jervell and Lange-Nielsen (JLN) form (10).

Several types of accessory subunits exist that interact with the pore-forming subunits of K+ channels (18, 22, 23). These protein-protein interactions usually result in functional changes in channel behavior such as altered gating. Moreover, there is evidence that Kv{beta} and KChIP subunits (soluble cytoplasmic proteins) also serve a chaperone-like function by altering the abundance of channel proteins expressed at the plasma membrane (13, 16, 25, 29). The KCNE gene family encodes type 1 transmembrane proteins that are capable of associating with, and regulating, a number of voltage-gated K+ channels (1). Mutations in three of the KCNEs have been linked to human disease (2). Although regulation of channel gating by the KCNE-encoded proteins is well established, less is known about their assembly with the pore-forming subunits or their potential for chaperone-like properties.

Genetic mutations often cause disease due to misfolding and mistrafficking of the mutant proteins (34). This has been well documented for LQT2 mutations, where some HERG mutants are retained in the endoplasmic reticulum (ER) and are rapidly degraded in a process that can lead to a dominant phenotype (11, 12, 15, 44, 45). KCNE-encoded subunits play an important role in modulation of cardiac K+ channels. Therefore, studying mechanisms of channel protein coassembly and surface expression is essential to understanding the pathophysiology of LQT syndrome and other ion channel diseases. LQT mutations of KCNE1 can result in varied phenotypes: dominant suppression of IKs, altered gating of IKs, or a nondominant trafficking defect of the minK protein (6, 31). The minK-L51H mutation fails to traffic to the cell surface, thereby failing to produce effective IKs, but is functionally nondominant by electrophysiological analysis (6). The trafficking defect of minK-L51H provides a useful tool to explore KvLQT1/minK association and channel assembly. In this report we show how minK affects the KvLQT1 {alpha}-subunit through the use of two minK trafficking mutants: L51H, a mutation linked to JLN, and wild-type (WT) minK with an engineered ER retrieval/retention signal at its COOH terminus (LRRRKR). We demonstrate that LQT5 mutant minK is capable of conferring trafficking defects onto its {alpha}-subunit. Moreover, our results indicate that the site of minK/KvLQT1 association/assembly is the ER and that the mechanism for minK-L51H mistrafficking differs from that of receptor-based ER retrieval/retention.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Construction of minK-ER and minK-L51H. Primers were synthesized (GIBCO/Life Technologies) to engineer an ER retention signal (LRRRKR) onto the COOH terminus of minK (forward, 5'-AAGAATTCAATGATCCTGTCTAACACCACA; reverse, 5'-AAAAAAGGATCC TCATCTCTTTCTTCTTCTCAGCGG). Polymerase chain reaction (PCR) was performed using Pfu turbo polymerase (Stratagene) to generate blunt-ended fragments. PCR fragments were gel purified and subcloned using the pCR Blunt II TOPO kit (Invitrogen). The HindIII and EcoRI fragment containing the cDNA encoding minK-LRRRKR (minK-ER) was ligated into pFLAG-CMV-2 (Sigma) to place the FLAG epitope at the NH2 terminus. Site-directed mutagenesis of WT minK to produce FLAG-minK-L51H and HA-minK-L51H was done using the QuickChange system (Stratagene) as described previously (20). For expression of KvLQT1, we used either pCI-Neo (Promega) with cardiac KvLQT1 cDNA or pCMV-Tag (Stratagene), which encodes a fusion of the myc-epitope and KvLQT1 (19).

Cell culture and transfection. Human embryonic kidney (HEK)-293 and Chinese hamster ovary (CHO) cell lines (ATCC) were cultured in RPMI 1640 (Cellgro; HEK-293) or Ham's F-12 (Cellgro; CHO) with L-glutamine supplemented with 10% fetal calf serum (Intergen) and penicillin/streptomycin (Cellgro). Cultured cells were maintained in 5% CO2-humidified air at 37 or 30°C, as indicated. For biochemical analyses, transient transfection was performed using Lipofectamine (Life Technologies). In preliminary experiments, we found that optimal expression, determined as a percentage of cells transformed and overall level of protein expression, was achieved when a total of 2 µg of DNA were combined with 12 µl of Lipofectamine for transient transfection of a 35-mm dish (data not shown). Cells were grown in 80-cm2 tissue culture flasks (Nunc) and transferred every 2–4 days by treatment with trypsin-EDTA when they reached a confluence of 70–80%. For electrophysiology studies, CHO cells were transfected by electroporation with 2 µg of WT KvLQT cDNA, 1 µg of green fluorescent protein cDNA, and 4.5 µg of the appropriate KCNE {beta}-subunit (WT minK, minK-ER, or minK-L51H; molar ratio of {alpha}:{beta}-subunit ~1:3). Electroporation was performed on a BTX electroporation (225 V, 72 {Omega}, 1,800 µF) as previously described (15, 19). Cells were studied with voltage clamp 24–72 h after transfection.

Electrophysiology. Cells were plated and grown on sterile glass coverslips within 35-mm tissue culture dishes. The coverslips were taken directly from the cell culture incubator and placed in an acrylic/polystyrene perfusion chamber (Warner Instruments) to obtain immediate electrophysiological measurements. Extracellular solution contained 150 mM NaCl, 1.8 mM CaCl2, 4 mM KCl, 1 mM MgCl2, 5 mM glucose, and 10 mM HEPES, pH 7.4 (titrated with HCl), at room temperature. Intracellular pipette solution contained 126 mM KCl, 4 mM K-ATP, 2 mM MgSO4, 5 mM EGTA, 0.5 mM CaCl2, and 25 mM HEPES, pH 7.2 (titrated with KOH), at room temperature. The whole cell patch-clamp configuration was used to study currents from KvLQT channels coexpressed with the various minK constructs. Patch pipettes were pulled and polished to obtain a tip resistance of 2–3 M{Omega} in the above solutions. Pipette offset potential in these solutions was corrected to zero just before gigaseal formation. Junction potential for our experimental solutions was calculated between 3 and 4 mV (using pCLAMP9 analysis software) and was not corrected for analyses. Whole cell capacitance (generally 10–25 pF) was compensated electronically through the amplifier. Whole cell series resistance of 6–12 M{Omega} was compensated by 75–90% through amplifier circuitry such that the voltage errors for currents of 2 nA were always <6 mV. Only cells with seal resistances >10 M{Omega} were included in our analyses. As additional monitoring, we attempted postacquisition leak subtraction using pCLAMP9 software. If there were significant (>5 mV) changes in current-voltage responses, the cells were excluded. Cell capacitance was generally 7–20 pF and was compensated by analog circuitry. An Axopatch-1D patch-clamp amplifier was used for voltage-clamp measurements, and voltage protocols were controlled via personal computer with the use of pCLAMP9 acquisition and analysis software. Data were filtered on-line with an eight-pole Bessel filter at 2 kHz before digitization. Activation curves are derived from current values during a repolarization step to –120 mV after a series of 1.5-s depolarizations. Current densities were calculated as current (pA) divided by cell capacitance (pF). To control for transfection efficiency, current densities were normalized to the control group (KvLQT1 alone) daily on the basis of average current density of cells transfected with KvLQT and minK. Voltage activation data were plotted as peak tail current amplitudes, normalized to the maximal value, against the test potential values and were fitted to a Boltzmann function, I = 1/{1 + exp[(VhV)/k]}, where I is the measured tail current, V is the applied membrane voltage, Vh is the voltage at half-maximal activation, and k is the slope factor.

Immunoblot and immunoprecipitation. Cells were harvested for analysis 36–48 h after transient transfection by detaching cells in RPMI supplemented with 10 mM EDTA at 37°C. Resuspended cells were pelleted by centrifugation at 300 g for 5 min at 4°C and washed with ice-cold phosphate-buffered saline (PBS). All subsequent steps were performed at 4°C. For whole cell lysate analysis, cell pellets were incubated in 50 µl of lysis buffer [25 mM Tris·HCl (pH 7.4), 150 mM NaCl, 5 mM EDTA, 0.4% deoxycholic acid, 1% Nonidet P-40 (NP-40), and Complete EDTA-free protease inhibitor mixture tablets (Roche)] per 35-mm dish for 5 min. Lysates were then cleared by centrifugation at 16,000 g for 5 min at 4°C. The cleared supernatants were assayed for total protein content (Coomassie-Plus protein assay; Pierce), and equivalent amounts of protein were subjected to SDS-PAGE analysis. Protein samples were combined with 4x SDS-PAGE sample buffer [4% SDS (wt/vol), 40% glycerol, 20% {beta}-mercaptoethanol (vol/vol), 0.004% bromphenol blue (wt/vol), and 125 mM Tris·HCl, pH 6.8], incubated for 5 min at room temperature, separated on 7.5% SDS-PAGE, and electrophoretically transferred onto nitrocellulose membrane (Schleicher & Schuell). Membranes were blocked with 10% nonfat dry milk and 0.05% Tween 20 in Tris-buffered saline (TBS) for 2 h at room temperature and incubated with anti-FLAG monoclonal antibody (Sigma) diluted to 1:3,000 in 5% dry milk and 0.05% Tween 20 in TBS for 4 h at room temperature. The membranes were then washed five times for 5 min each with 0.05% Tween 20-TBS and incubated in goat anti-mouse horseradish peroxidase-conjugated antibody (Pierce) diluted 1:20,000–1:50,000 for 1 h at room temperature. After five washes as described above, horseradish peroxidase-bound protein was detected by chemiluminescence (SuperSignal West Pico chemiluminescent substrate; Pierce).

For coimmunoprecipitation studies, transiently transfected cells were harvested as described above, and cleared cell lysates were incubated with 30 µl of rabbit polyclonal anti-KvLQT antiserum or 3 µl of rabbit polyclonal anti-FLAG antibody (Sigma) for 4 h at 4°C. Protein-antibody complexes were precipitated with 30 µl of protein G-agarose (Pierce) for an additional 3 h. Precipitated proteins were washed with lysis buffer three times and eluted with SDS-PAGE sample buffer, separated on 12% SDS-PAGE, and subjected to immunoblot analysis.

PNGase F digestion. Transfected HEK-293 cells were harvested, and minK proteins were immunoprecipitated with anti-FLAG antibody as described in Immunoblot and immunoprecipitation. Protein-antibody complexes precipitated with protein G-agarose were incubated with denaturing buffer (0.5% SDS and 1% {beta}-mercaptoethanol) at 100°C for 10 min. Samples were then digested by the addition of 5 µl of the endoglycosidase PNGase F (New England Biolabs) in 50 mM sodium phosphate (pH 7.5) with 1% NP-40 for 1 h at 37°C. After digestion, proteins were separated on 12% SDS-PAGE and subjected to immunoblot analysis.

Immunoprecipitation for plasma membrane and internal proteins. Intact transiently transfected HEK-293 cells were incubated with rabbit polyclonal anti-FLAG antibody (Sigma) diluted 1:2,000 in RPMI medium for 2 h at 14°C (lower temperature was selected to prevent endocytosis/internalization of membrane-attached antibody). Cells were detached from the cell culture dish surface by RPMI supplemented with 10 mM EDTA and collected by centrifugation. Resuspended cells were subsequently pelleted by centrifugation at 300 g for 5 min at 4°C and washed with ice-cold PBS. Cells were then lysed in NP-40-based lysis buffer as described above, and protein-antibody complexes were precipitated with 30 µl of protein G-agarose (Pierce) for 3 h. After incubation, the mixture was centrifuged at 16,000 g to isolate the FLAG-minK that was accessible to extracellularly applied antibody. The postimmunoprecipitation supernatant was subjected to another anti-FLAG immunoprecipitation to recover the residual FLAG-minK protein not precipitated in the first round, which represented that pool of protein not expressed on the cell surface. This allowed for separation of membrane and intracellular proteins. Precipitated proteins were eluted with SDS-PAGE sample buffer, separated on 12% SDS-PAGE, and subjected to immunoblot analysis with monoclonal mouse anti-FLAG antibody (Sigma). To control for protein immunoprecipitated from dead cells, trypan blue (0.4%) was added to transiently transfected HEK-293 cells to estimate the percentage of dead cells (always <1%).

Immunofluorescence. HEK-293 cells were transiently transfected with WT or mutant minK cDNA. Twenty-four hours after transfection, cells were replated onto sterile glass coverslips. At 48 h after transfection, culture medium was removed and cells were fixed with 4% paraformaldehyde in PBS for 20 min. After washing with PBS, cells were permeabilized with 0.3% Triton X-100 in PBS for 10 min, washed, and blocked with 5% BSA in PBS for 30 min. Slides were incubated with primary antibodies (mouse anti-FLAG and/or rabbit anti-KvLQT) and washed with PBS and 0.1% NP-40 for 1 h. After washing with PBS, the slides were incubated in the dark with the secondary antibodies goat anti-mouse AlexaFluor 568 (Molecular Probes) and/or goat anti-rabbit AlexaFluor 488 (Molecular Probes) diluted 1:500 for 1 h. For external labeling experiments, initial fixation and permeabilization steps were omitted and coverslips were directly blocked with 5% milk for 60 min. The slides were then incubated with primary antibodies (mouse anti-FLAG) for another 60 min. After extensive washing with PBS, cells were fixed with 4% paraformaldehyde for 20 min. Samples were washed with PBS and 0.1% NP-40 in PBS as above before being mounted onto slides for fluorescence microscopy examination. Images were acquired using either confocal microscopy (Bio-Rad) or an Olympus IX70 microscope with a x60 PlanApo objective and a Photometrics Censys cooled charge-coupled device. Nonconfocal images were subject to deconvolution with Powerhazebuster (Vaytek), and all images were analyzed with Adobe Photoshop.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Expression of mutant minK and binding to KvLQT1. To confirm minK-L51H and minK-ER protein expression, HEK-293 cells coexpressing KvLQT1 and FLAG-tagged minK, minK-ER, or minK-L51H (Fig. 1A) were lysed and coimmunoprecipitated with anti-KvLQT1 antibody. Binding of KvLQT1 to minK, minK-ER, and minK-L51H was observed (Fig. 1B). Multiple bands of minK have been shown to represent variably glycosylated forms in transfection systems (32). Higher glycosylation forms of minK-ER were increased, whereas minK-L51H showed primarily the lower core form compared with WT minK. This differential glycosylation was observed despite varying cDNA transfection concentrations and suggests that these two proteins are processed differently. To confirm that the increased abundance of higher molecular weight forms of minK-ER represented increased glycosylation, immunoprecipitated proteins were treated with PNGase F, an endoglycosidase that cleaves all complex sugars from their attachment to asparagine residues. PNGase F treatment of WT minK and minK-ER eliminated the bands that migrated more slowly, thereby confirming their identity as N-link glycoproteins (Fig. 1C). The enhanced abundance of higher glycosylation forms for minK-ER is likely due to differences in compartmental location. The ER-localization signal of minK functions as a retrieval/retention signal by which the protein is repeatedly drawn back from Golgi compartments into the ER. In this case, repeated and prolonged exposure to complex carbohydrate processing occurs, compared with either those forms that rapidly traverse the Golgi (WT minK) or those that never exit the ER (minK-L51H). That all glycosylation forms of minK coprecipitate with KvLQT1 indicates that the association begins early in the biosynthetic pathway, probably in the ER (Fig. 1B). Even after treatment with PNGase F, minK-ER mutant consistently migrated more rapidly than WT minK despite its additional amino acids. The most likely cause for this anomalous gel migration is that the additional residues of minK-ER present significantly more charge, making it move faster in the electrical field. Additional posttranslational modification such as partial proteolysis cannot be ruled out, however. To control for nonspecific binding due to protein aggregation in a heterologous overexpression system, we performed coimmunoprecipitation studies on cells transfected with varying {alpha}:{beta}-subunit molar ratios (from 1:0.5 to 1:8). Comparable binding of KvLQT1 to minK was noted at all transfection ratios (data not shown). Moreover, when detergent lysates from different groups of cells expressing either minK or KvLQT1 were mixed, they were never seen to coprecipitate suggesting that KvLQT1 and minK must be synthesized and assembled within the cell for binding to occur.



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 1. MinK (17 kDa) is expressed at the cell surface. A: schematic representation of wild-type (WT) minK, minK-ER, and minK-L51H expression constructs used in this study. WT minK is a type I transmembrane protein containing 129 amino acids with 2 glycosylation sites on its NH2 terminus. All 3 proteins have FLAG epitopes engineered in the NH2 terminus. MinK-ER has 6 amino acids engineered into the COOH terminus (LRRRKR) that are predicted to confer retrieval and retention in the endoplasmic reticulum (ER). B: expression and coimmunoprecipitation of minK, minK-ER, and minK-L51H with KvLQT1. Human embryonic kidney (HEK)-293 cells coexpressing KvLQT1 with minK, minK-ER, or L51H were immunoprecipitated (IP) by anti-KvLQT1 antibody, subjected to SDS-PAGE (12%) separation, and immunoblotted with anti-FLAG antibody to assay for coprecipitated minK protein. Three minK bands were consistently observed corresponding to the nascent (17 kDa) and polyglycosylated forms (20 and 25 kDa) of minK. The minK-ER protein consistently demonstrated a greater abundance of the higher glycosylation forms compared with WT minK. The L51H protein, however, showed almost no maturation into the higher glycosylation forms (n = 10). All 3 minK proteins were comparably coprecipitated by KvLQT1. GFP lanes indicate lysates from control cells transfected with only green fluorescent protein. wt, Wild type. C: the higher molecular weight bands of minK and minK-ER represent glycosylation products. FLAG-minK or FLAG-minK-ER were immunoprecipitated and subject to digestion with the endoglycosidase PNGase F, followed by immunoblot analysis. The same gel was exposed for different durations: a longer exposure (top) showing that the 2 larger bands from minK disappear with PNGase F treatment, and a shorter exposure (bottom) showing that the larger bands of minK-ER are also PNGase F sensitive.

 
MinK-ER and minK-L51H are retained in the endoplasmic reticulum. Proteins with an RXR motif are retrieved from Golgi and returned to the ER by an unknown receptor(s) and mechanisms (42, 43). To examine the subcellular compartmentalization of minK-ER and L51H, we performed immunofluorescence labeling. MinK, a type 1 membrane protein, was tagged with an NH2-terminal FLAG epitope that is exposed on the plasma membrane external surface. To detect the surface expression, we incubated HEK-293 cells transfected with FLAG-minK, FLAG-minK-ER, or FLAG-minK-L51H with FLAG antibody and with fluorescently labeled secondary antibody before fixation or permeabilization. Confocal microscopic examination showed WT minK plasma membrane expression (Fig. 2A). In contrast, plasma membrane expression was not detected on cells expressing minK-ER or L51H. Examination of cells fixed and permeabilized before incubation with anti-FLAG antibody confirmed that minK-ER and minK-L51H proteins were expressed but were retained in a reticular intracellular pattern consistent with ER localization (Fig. 2A).



View larger version (66K):
[in this window]
[in a new window]
 
Fig. 2. MinK-ER and minK-L51H are retained in intracellular organelles. Cells were labeled with anti-FLAG antibody and FITC-conjugated secondary antibody and then visualized by confocal microscopy. A: immunofluorescence localization of minK, minK-ER, or minK-L51H. Nonpermeabilized cells showed plasma membrane expression of WT minK. No fluorescence labeling was detected in nonpermeabilized cells (left) expressing minK-ER or minK-L51H proteins. Immunofluorescence labeling of permeabilized cells (right) confirmed that minK-ER and minK-L51H protein were abundantly expressed in a reticular pattern consistent with ER location. Scale bar, 10 µm. B: external labeling of HEK-293 cells expressing minK or minK-L51H. Surface presentation of minK subunits was detected by incubating live, intact cells with anti-FLAG antibody. Cells were extensively washed before lysis to ensure removal of residual antibody and labeling of surface-expressed protein only. Precipitation of immunolabeled surface minK, followed by SDS-PAGE and anti-FLAG immunoblotting showed a single 17-kDa band (external). A second round of anti-FLAG immunoprecipitation of the cell lysate demonstrated intracellular expression (internal) of both 17- and 25-kDa forms. The minK-L51H was not detected at the cell surface despite abundant protein expression (n = 4).

 
We confirmed these results using immunoprecipitation of surface proteins. Live HEK-293 cells expressing NH2-terminal FLAG-tagged minK or minK-L51H were externally labeled with rabbit anti-FLAG antibody and thoroughly washed before detergent lysis. This technique allowed for selective immunoprecipitation of proteins expressed on the plasma membrane. Incubation with trypan blue revealed <0.5% dead cells, ensuring that precipitated protein represented that expressed on the cell surface. Western blot analysis revealed a single 17-kDa band that was detected on the plasma membrane of the cells expressing WT minK. In contrast, no minK-L51H plasma membrane expression was detected (Fig. 2B). Fractions of both WT minK and minK-L51H were detected in intracellular compartments not accessible to surface immunoprecipitation when detergent lysates previously probed for plasma membrane proteins were reprobed with FLAG antibody. Thus both the engineered ER retrieval/retention signal and the LQT mutation minK-L51H prevented the trafficking of minK to the plasma membrane despite an adequate abundance of protein.

As an additional confirmation of altered intracellular localization of minK mutants, we examined transiently transfected cells by double-labeled immunofluorescence with antibodies for either a Golgi marker protein (GM130; a gift from Dr. Denis Shields, Albert Einstein College of Medicine, Bronx, NY) or an ER marker protein (calnexin; Affinity Bioreagents) in combination with anti-FLAG antibody to detect the FLAG-tagged minK proteins. The distribution pattern of Golgi-restricted GM130 staining was clearly distinct from that of all three minK proteins (Fig. 3). Although the staining pattern of the minK mutants was largely different from that of GM130, there was some degree of coincidence, suggesting that some small portion of these transiently transfected proteins was capable of entering the Golgi. Each of the proteins showed considerable overlap with the ER marker; however, the WT minK showed the greater distribution toward the periphery, as expected for a surface-expressed protein. That both the minK-ER and minK-L51H proteins showed a larger intracellular distribution than calnexin suggests that either calnexin has a more restricted subdomain of ER localization or the mutant minK proteins are being directed to degradation pathways.



View larger version (55K):
[in this window]
[in a new window]
 
Fig. 3. MinK-ER and minK-L51H show an ER localization pattern. Cells were labeled with anti-FLAG antibody and FITC-conjugated secondary antibody (green) to visualize minK proteins and either anti-GM130 or anti-calnexin antibody and Alexa 588-conjugated secondary antibody (red) to visualize the Golgi or ER, respectively. Immunofluorescence micrograph images were subject to deconvolution for clarity. A: cells transiently transfected with WT minK. B: cells transfected with minK-ER. C: cells transfected with minK-L51H. Micrographs at right show merged images of minK with the organelle-specific antibody. Scale bar, 10 µm.

 
KvLQT1 localization is altered by association with mutant minK. We next tested whether trafficking mutants of minK alter the localization of KvLQT1. HEK-293 cells expressing myc-tagged KvLQT1 alone or in combination with minK, minK-ER, or minK-L51H were examined by immunofluorescence labeling of KvLQT1 protein with anti-myc antibody (Fig. 4). When expressed by itself or with WT minK, KvLQT1 is detected at the cell surface as well as in intracellular compartments (presumably intermediate trafficking locales). When KvLQT1 was coexpressed with minK-ER, KvLQT1 surface expression was reduced and exhibited a reticular intracellular pattern comparable to that of minK-ER (Fig. 2A). When KvLQT1 was coexpressed with minK-L51H, KvLQT1 surface expression could not be detected and the intracellular signal was similar to that of minK-L51H, consistent with an ER location. To control for a nonspecific protein trafficking defect caused by heterologous expression of minK L51H, we performed cotransfection of mutant minKs with myc-tagged Kv1.4, a voltage-gated K+ channel {alpha}-subunit that does not associate with minK (Fig. 4). Unlike KvLQT1, Kv1.4 {alpha}-subunit protein was seen at the plasma membrane when coexpressed with either minK-L51H or WT minK. These findings indicate that minK trafficking defects specifically affect KvLQT1 surface expression. Moreover, they support an ER location for coassembly of {alpha}- and {beta}-subunits of the IKs channel.



View larger version (96K):
[in this window]
[in a new window]
 
Fig. 4. KvLQT1 location is controlled by trafficking of minK. HEK-293 cells transfected with myc-KvLQT1 alone or in combination with WT minK, minK-ER, or minK-L51H were examined by immunofluorescence. HEK-293 cells were fixed, permeabilized, and incubated with anti-myc antibody. When KvLQT1 was expressed with WT minK (A) or alone (B), a prominent fluorescence signal was observed at the cell periphery, consistent with surface expression. When KvLQT1 was coexpressed with either minK-L51H (C) or minK-ER (E), fluorescence at the cell perimeter was markedly decreased and a reticular pattern was observed (similar to that seen with immunofluorescence of minK-ER and minK-L51H, as shown in Fig 2A). Control experiments with immunofluorescence of myc-Kv1.4 (a voltage-gated K+ channel that does not associate with minK) showed no alteration of the {alpha}-subunit protein when coexpressed with either L51H (D) of minK (F). Scale bar, 10 µm.

 
LQT mutant minK reduces functional coexpression of KvLQT1 channels. To determine how the differences in KvLQT1 distribution affected functional K+ currents, we employed the whole cell configuration of the patch-clamp technique to obtain voltage-clamp current measurements from KvLQT1/minK-transfected CHO cells. Current measured in cells transfected with KvLQT1 alone was characterized by rapid activation and inactivation with relatively small current density (Figs. 5A and 6A). When KvLQT1 was expressed with WT minK, current amplitude was increased (7-fold ± 1) and an alteration in channel kinetics produced the slowly activating noninactivating currents characteristic of IKs (Figs. 5B and 6A). These data are consistent with previously described results of minK and KvLQT1 coexpression (5, 19, 26).



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 5. Currents from cells expressing KvLQT1 with minK or minK mutants. Representative whole cell current tracings of Chinese hamster ovary (CHO) cells expressing KvLQT1 alone (A), KvLQT1 + minK (B), KvLQT1 + minK-L51H (C), or KvLQT1 + minK-ER (D) are shown. The molar ratio of transfections for all KvLQT1 and minK constructs was 1:3.5.

 


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 6. Functional consequences of WT and mutant {beta}-subunit expression on IKs current. Analysis of voltage-clamp recordings of CHO cells coexpressing KvLQT1 and minK, minK-ER, or minK-L51H is shown. A: maximal current density measured during repolarizing steps to –120 mV. B: histograms depict 80 and 91% reductions in maximal pA/pF in cells expressing KvLQT1 + minK-ER and KvLQT1 + minK-L51H, respectively, compared with currents measured from cells expressing WT channels. C: analysis of current density normalized to currents measured from cells expressing KvLQT1 alone demonstrated a significant reduction in pA/pF in cells expressing KvLQT1/L51H compared with cells expressing KvLQT1 alone (Student's t-test, P < 0.05). D: histograms depicting 30% reduction in current density in cells expressing KvLQT1/L51H compared with those expressing KvLQT1 alone. E: normalized voltage-dependent activation curves of KvLQT1 (n = 41), KvLQT1 = wt minK (n = 23), KvLQT1 + minK-ER (n = 17), and KvLQT1 + minK-L51H (n = 20). Voltages of half-maximal activation were –11.7, +34.4, +32.5, and –10.6 mV, respectively. F: histograms depicting whole cell peak current density in cells coexpressing Kv1.4 + WT minK (n = 11) or Kv1.4 + minK-L51H (n = 7). Current density measured from cells expressing Kv1.4 was unaltered by WT minK and minK L51H.

 
Cotransfection of KvLQT1 with saturating amounts of the mutant minK (KvLQT1:minK = 1:3.5) reduced the functional surface expression of channels assayed by whole cell voltage clamp. L51H reduced current amplitude by ~91% compared with minK/KvLQT1 (Fig. 6, A and B), and the current expressed was indistinguishable from that of homotetrameric KvLQT1 channels without minK (albeit ~30% smaller) (Fig. 5B and Fig. 6, C and D). MinK-ER reduced current ~80% compared with WT minK/KvLQT1; however, the residual current had biophysical characteristics of IKs, suggesting that a small fraction of minK-ER bound to KvLQT1 escaped the ER retrieval mechanisms and was expressed on the cell surface (Figs. 5D and 6E) but still below the detection threshold of immunodetection methods (Fig. 2). Currents in cells expressing Kv1.4 and either WT minK or minK-L51H demonstrated no significant difference in peak current density, indicating that defective minK trafficking specifically affects the KvLQT1 {alpha}-subunit (Fig. 6F). Thus minK-L51H and minK-ER are both capable of conferring trafficking defects to KvLQT1 that result in alteration of functional K+ channels.

L51H is not dominant negative. Most LQT syndrome mutations are autosomal dominant in inheritance and exhibit dominant phenotypic mechanisms at the molecular level. The minK-L51H, however, has been linked to the JLN form of LQT syndrome with a recessive inheritance (6). We coexpressed WT minK and minK-L51H with KvLQT1 to test for a dominant or recessive effect of the mutation. Whole cell voltage-clamp experiments were used to determine whether minK-L51H could significantly reduce IKs channel current in the presence of WT minK. Currents in cells transfected with L51H and minK in equal proportions showed IKs-like kinetics without a significant reduction in maximum current density (Fig. 7).



View larger version (49K):
[in this window]
[in a new window]
 
Fig. 7. Coexpression of KvLQT1 with WT and L51H {beta}-subunits. A: representative whole cell current tracing recorded from CHO cells expressing KvLQT1 and equal amounts of WT minK and minK-L51H. The molar ratio for transfection of KvLQT1:minK was 1:2:2. B: maximal current density measured during repolarizing steps to –120 mV recorded from cells expressing KvLQT1 + minK + minK-L51H (n = 10), KvLQT1 + minK (n = 14), and KvLQT1 = +L51H (n = 9). C: voltage-dependent activation curves. Recorded voltages of half-maximal activation were +35.6, +19, and –15.9 mV, respectively. D: surface labeling with anti-FLAG antibody of nonpermeabilized cells expressing FLAG-WT-minK + KvLQT1 (left) or FLAG-minK-L51H + KvLQT1 with untagged WT minK (right). Coexpression of WT minK allows minK-L51H to be expressed on plasma membrane. Arrowheads indicate fluorescence at the edge of the cell surface. Scale bar, 20 µm.

 
The stoichiometry of minK within the KvLQT1-minK channel complex is not known with certainty. Most estimates have been between 1 and 4 minK peptides per channel, with one report suggesting as many as 14 (36, 38, 39). If an LQT mutation of minK were dominant over WT protein coassembled within the same channel, then the phenotype would follow a binomial pattern to the nth (with n = no. of subunits per channel) (15, 17, 38). Thus, assuming random and equal association of minK subunits within the channel and complete dominance of the mutant, we would expect a 75% reduction in current amplitude for a 50/50 mix of WT and L51H if there were two subunits per channel. Higher order subunit stoichiometry would result in greater current reductions. That we found no reduction of current in cells coexpressing WT minK and minK-L51H argues against a dominant phenotype and suggests that the WT protein may act to rescue channels from the mutant effect. These results were consistent with clinical findings in a patient reported to be a minK-L51H carrier who had a normal QT interval on surface ECG recordings (6). Toaddress the mechanism of this nondominant mutant, we coexpressed minK-L51H and KvLQT1 with untagged minK (Fig. 7D). Immunofluorescence of nonpermeabilized, intact cells showed that coexpression of WT minK resulted in surface expression of L51H minK, which was never observed for L51H without minK (Fig. 2B).


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Defects of ion channel subunit trafficking and assembly have been implicated in numerous ion channelopathies including cystic fibrosis, persistent hyperinsulinemia of infancy, and LQT syndrome (7, 8, 14, 15, 40, 44). In this study we examined the mechanisms of protein subunit assembly and trafficking required for IKs. Our results demonstrate that minK trafficking mutants alter localization of coexpressed WT KvLQT1. The {alpha}- and {beta}-subunits of the IKs channel physically associate within the ER. Although minK-ER and minK-L51H result in similar localization patterns for KvLQT1, functional K+ channel activity differs. Therefore, the mechanisms responsible for ER retention of minK-L51H are different from ER retention/retrieval signals. Coexpression of both minK-L51H and wild-type minK together with KvLQT1 confirm, on a molecular and functional level, that minK-L51H is not a dominant-negative mutation.

Our finding that KvLQT1 and minK physically associate in the ER is analogous to the work by Nagaya et al. (21) characterizing the biogenesis of Shaker K+ channel proteins in HEK-293 cells. Biogenesis of Shaker included {alpha}-subunit tetramerization, core glycosylation, and association with Kv{beta}2 subunits in the ER (21). Collectively, these studies underscore the importance of the ER in subunit oligomerization, glycosylation, and trafficking of K+ channels.

We show that an engineered minK-ER binds to the KvLQT1 {alpha}-subunit and prevents its trafficking to the plasma membrane. The ER retention/retrieval signal attached to the minK-ER COOH terminus contains an RKR motif. This motif, noted by Zerangue et al. (43) in ATP-sensitive K+ (KATP) channel subunits, appears to function as a quality control mechanism. Partially assembled KATP channel proteins have an RKR motif that is exposed, causing ER retention (43). The cytoplasmic reticular immunofluorescence pattern of minK-L51H is similar to that of minK-ER and is consistent with ER retention. KvLQT1 binds both ER-localized minK mutants, implicating ER oligomerization of IKs channel {alpha}- and {beta}-subunits. One difference between our results and those of Bianchi et al. (6) is that coexpression of minK-L51H in that study did not reduce KvLQT1 current expression as much as we observed. A possible explanation for the difference may be in the expression systems used. We used mammalian CHO cells, whereas the other group used Xenopus oocytes, which are now known to express considerable amounts of KCNE-encoded proteins that may alter the nondominant effect of minK-L51H (4).

MinK-L51H and minK-ER appear to have distinctly different mechanisms of ER retention. Upon immunofluorescence labeling, both mutant minK proteins exhibit identical cytoplasmic reticular patterns consistent with an ER locale. A small fraction of minK-ER, however, was consistently seen on the surface, whereas no minK-L51H was detected on the cell surface. These biochemical data were consistent with the patch-clamp measurements of whole cell current. No evidence of functional minK was ever detected with minK-L51H, whereas a small fraction (~14% compared with WT minK + KvLQT1) of minK-ER with functional characteristics similar to WT minK was seen. Sequence-based receptor mechanisms for ER retrieval and retention may become saturated in an overexpression system, allowing a small amount of the minK-ER protein to escape to the cell surface where it has normal function (33, 42). Our results suggest that the minK-ER is not as avidly retained in the ER as the L51H mutant.

What is the mechanism of minK-L51H retention? On the basis of differences between minK-ER and minK-L51H function and glycosylation, it seems unlikely to be a receptor-based retention/retrieval mechanism. The substitution of a bulky, positively charged histidine for a leucine in the transmembrane segment of minK is likely to result in misfolding or altered conformation of minK-L51H. An efficient protein quality control system prevents targeting to the cell surface. Quality control mechanisms may entirely prevent the exit of misfolded proteins from the ER, rather than retrieval from the Golgi. A caveat to this interpretation is that our immunofluorescence data suggest that a small fraction of all three of the recombinant minK proteins may colocalize with the Golgi protein GM130. This may be a function of an overexpressed protein from transfected plasmids with strong viral (CMV) promoters. Our other results (differential glycosylation, absence on the cell surface, and altered current), however, point to L51H failing to transit from the ER to the Golgi.

MinK has two N-glycosylation consensus sites at N5 and N26; complex glycosylation at a single site is predicted to yielda mass of ~21 kDa and at both sites, ~25 kDa. The greater abundance of complex glycosylation forms of minK-ER is consistent with a protein that repeatedly enters the Golgi and is retrieved to the ER where there is constant exposure to ER or Golgi glycosylation enzymes. In contrast, minK L51H consistently demonstrated the lowest abundance of higher complex glycosylated forms of minK, suggesting that it fails to exit the ER because of protein quality control mechanisms. The predominance of low-molecular-weight minK either in whole cell lysates or on the surface probably represents limited kinetics of the glycosylation machinery. With forced overexpression of a small protein such as minK, it is reasonable to expect a rate of production and transit through the Golgi that exceeds the capacity of glycosylation.

Our results indicate that minK is not a chaperone for KvLQT1, in the strict sense, because there is no change in the immunofluorescence locale of the channel when expressed with or without WT minK. The augmented current density that minK confers on KvLQT1 is attributable to changes in single-channel behavior (28, 41). Our finding that minK-ER and minK-L51H each coprecipitate with KvLQT1 with comparable avidity to WT minK suggests that the physical interaction occurs early in the ER, before trafficking to the Golgi and plasma membrane. Alteration of the immunofluorescence pattern of KvLQT1 toward more abundance in the ER when coexpressed with minK-L51H supports this analysis. The con-sequence of this early association is the conferring of the minK-L51H trafficking defects on coexpressed KvLQT1 with reduced current density and absence of IKs-like current. This current suppression, however, was not dominant when both WT and minK-L51H were coexpressed with KvLQT1, consistent with the lack of clinical phenotype described in the original report by Bianchi et al. (6). Possible mechanisms for the nondominant trafficking defect of minK-L51H include a dominant rescue by coassociated WT minK or preferential association with WT minK. Because WT minK was able to bring KvLQT1 and the minK-L51H mutant to the plasma membrane, minK may act as a conditional chaperone in situations in which protein proofreading mechanisms attempt to retain the channel complex. Most minK LQT mutations analyzed thus far reside in extracellular or cytoplasmic portions of the molecule. These mutations have, for the most part, resulted in functional defects rather than protein trafficking defects and may underlie a possible difference between dominant and nondominant disease inheritance (24, 27, 35).

In summary, our data provide insight into mechanisms of ER retention and their importance in LQT syndrome. Our results show that minK-L51H is not a dominant-negative mutation, confirming findings in gene carriers (6). Furthermore, we provide evidence suggesting that the mechanism of ER retention differs from ER retention/retrieval and that the subunits of the IKs channel assemble at the level of the ER. Future studies that focus on mechanisms of ER retention and protein trafficking are necessary and are likely to reveal therapeutic targets to treat diseases caused by defects in protein trafficking and assembly.


    ACKNOWLEDGMENTS
 
Present address of J.-S. Bian: Department of Pharmacology, Faculty of Medicine, National University of Singapore, Block MD2, 18 Medical Dr., Singapore 117597.

T. McDonald is an Established Investigator of the American Heart Association.


    FOOTNOTES
 

Address for reprint requests and other correspondence: T. V. McDonald, Depts. of Medicine and Molecular Pharmacology, Albert Einstein College of Medicine, 1300 Morris Park Ave., Bronx, NY 10461 (E-mail: mcdonald{at}aecom.yu.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
1. Abbott GW and Goldstein SA. A superfamily of small potassium channel subunits: form and function of the MinK-related peptides (MiRPs). Q Rev Biophys 31: 357–398, 1998.[CrossRef][Web of Science][Medline]

2. Abbott GW and Goldstein SAN. Potassium channel subunits: the MiRP family. Mol Interv 1: 95–107, 2001.[Abstract/Free Full Text]

3. Ackerman MJ. The long QT syndrome: ion channel diseases of the heart. Mayo Clinic Proc 73: 250–269, 1998.[Abstract]

4. Anantharam A, Lewis A, Panaghie G, Gordon E, McCrossan ZA, Lerner DJ, and Abbott GW. RNA intereference reveals endogenous Xenopus MinK-related peptides govern mammalian K+ channel function in oocyte expression studies. J Biol Chem 278: 11739–11745, 2003.[Abstract/Free Full Text]

5. Barhanin J, Lesage F, Guillemare E, Fink M, Lazdunski M, and Romey G. KVLQT1 and IsK (minK) proteins associate to form IKs cardiac potassium current. Nature 384: 78–80, 1996.[CrossRef][Web of Science][Medline]

6. Bianchi L, Shen Z, Dennis AT, Priori SG, Napolitano C, Ronchetti E, Bryskin R, Schwartz PJ, and Brown AM. Cellular dysfunction of LQT5-minK mutants: abnormalities of IKs, IKr and trafficking in long QT syndrome. Hum Mol Genet 8: 1499–1507, 1999.[Abstract/Free Full Text]

7. Cartier EA, Conti LR, Vandenberg CA, and Shyng SL. Defective trafficking and function of KATP channels caused by a sulfonylurea receptor 1 mutation associated with persistent hyperinsulinemic hypoglycemia of infancy. Proc Natl Acad Sci USA 98: 2882–2887, 2001.[Abstract/Free Full Text]

8. Cheng SH, Gregory RJ, Marshall J, Paul S, Souza DW, White GA, O'Riordan CR, and Smith AE. Defective intracellular transport and processing of CFTR is the molecular basis of most cystic fibrosis. Cell 63: 827–834, 1990.[CrossRef][Web of Science][Medline]

9. Chiang CE and Roden DM. The long QT syndromes: genetic basis and clinical implications. J Am Coll Cardiol 36: 1–12, 2000.[Abstract/Free Full Text]

10. Duggal P, Vesely MR, Wattanasirichaigoon D, Villafane J, Kaushik V, and Beggs AH. Mutation of the gene for IsK associated with both Jervell and Lange-Nielsen and Romano-Ward forms of long-QT syndrome. Circulation 97: 142–146, 1998.[Abstract/Free Full Text]

11. Ficker E, Dennis AT, Obejero-Paz CA, Castaldo P, Taglialatela M, and Brown AM. Retention in the endoplasmic reticulum as a mechanism of dominant-negative current suppression in human long QT syndrome. J Mol Cell Cardiol 32: 2327–2337, 2000.[CrossRef][Web of Science][Medline]

12. Ficker E, Thomas D, Viswanathan PC, Dennis AT, Priori SG, Napolitano C, Memmi M, Wible BA, Kaufman ES, Iyengar S, Schwartz PJ, Rudy Y, and Brown AM. Novel characteristics of a misprocessed mutant HERG channel linked to hereditary long QT syndrome. Am J Physiol Heart Circ Physiol 279: H1748–H1756, 2000.[Abstract/Free Full Text]

13. Fink M, Duprat F, Lesage F, Heurteaux C, Romey G, Barhanin J, and Lazdunski M. A new K+ channel {beta} subunit to specifically enhance Kv2.2 (CDRK) expression. J Biol Chem 271: 26341–2648, 1996.[Abstract/Free Full Text]

14. Furutani M, Trudeau MC, Hagiwara N, Seki A, Gong Q, Zhou Z, Imamura S, Nagashima H, Kasanuki H, Takao A, Momma K, January CT, Robertson GA, and Matsuoka R. Novel mechanism associated with an inherited cardiac arrhythmia: defective protein trafficking by the mutant HERG (G601S) potassium channel. Circulation 99: 2290–2294, 1999.[Abstract/Free Full Text]

15. Kagan A, Yu Z, Fishman GI, and McDonald TV. The dominant negative LQT2 mutation A561V reduces wild-type HERG expression. J Biol Chem 275: 11241–11248, 2000.[Abstract/Free Full Text]

16. Kuo HC, Cheng CF, Clark RB, Lin JJ, Lin JL, Hoshijima M, Nguyen-Tran VT, Gu Y, Ikeda Y, Chu PH, Ross J, Giles WR, and Chien KR. A defect in the Kv channel-interacting protein 2 (KChIP2) gene leads to a complete loss of Ito and confers susceptibility to ventricular tachycardia. Cell 107: 801–813, 2001.[CrossRef][Web of Science][Medline]

17. MacKinnon R. Determination of the subunit stoichiometry of a voltage-activated potassium channel. Nature 350: 232–235, 1991.[CrossRef][Medline]

18. Martens JR, Kwak YG, and Tamkun MM. Modulation of Kv channel {alpha}/{beta} subunit interactions. Trends Cardiovasc Med 9: 253–258, 1999.[CrossRef][Medline]

19. Melman YF, Domenech A, de la Luna S, and McDonald TV. Structural determinants of KvLQT1 control by the KCNE family of proteins. J Biol Chem 276: 6439–6444, 2001.[Abstract/Free Full Text]

20. Melman YF, Krumerman A, and McDonald TV. A single transmembrane site in the KCNE-encoded proteins controls the specificity of KvLQT1 channel gating. J Biol Chem 277: 25187–25194, 2002.[Abstract/Free Full Text]

21. Nagaya N and Papazian DM. Potassium channel {alpha} and {beta} subunits assemble in the endoplasmic reticulum. J Biol Chem 272: 3022–3027, 1997.[Abstract/Free Full Text]

22. Nerbonne JM. Molecular basis of functional voltage-gated K+ channel diversity in the mammalian myocardium. J Physiol 525: 285–298, 2000.[Abstract/Free Full Text]

23. Nerbonne JM and Guo W. Heterogeneous expression of voltage-gated potassium channels in the heart: roles in normal excitation and arrhythmias. J Cardiovasc Electrophysiol 13: 406–409, 2002.[CrossRef][Web of Science][Medline]

24. Priori SG, Schwartz PJ, Napolitano C, Bianchi L, Dennis A, De Fusco M, Brown AM, and Casari G. A recessive variant of the Romano-Ward long-QT syndrome? Circulation 97: 2420–2425, 1998.[Abstract/Free Full Text]

25. Rosati B, Pan Z, Lypen S, Wang HS, Cohen I, Dixon JE, and McKinnon D. Regulation of KChIP2 potassium channel beta subunit gene expression underlies the gradient of transient outward current in canine and human ventricle. J Physiol 533: 119–125, 2001.[Abstract/Free Full Text]

26. Sanguinetti MC, Curran ME, Zou A, Shen J, Spector PS, Atkinson DL, and Keating MT. Coassembly of KVLQT1 and minK (IsK) proteins to form cardiac IKs potassium channel. Nature 384: 80–83, 1996.[CrossRef][Medline]

27. Schulze-Bahr E, Wang Q, Wedekind H, Haverkamp W, Chen Q, Sun Y, Rubie C, Hordt M, Towbin JA, Borggrefe M, Assmann G, Qu X, Somberg JC, Breithardt G, Oberti C, and Funke H. KCNE1 mutations cause Jervell and Lange-Nielsen syndrome. Nat Genet 17: 267–268, 1997.[CrossRef][Web of Science][Medline]

28. Sesti F and Goldstein SA. Single-channel characteristics of wild-type IKs channels and channels formed with two minK mutants that cause long QT syndrome. J Gen Physiol 112: 651–663, 1998.[Abstract/Free Full Text]

29. Shi G, Nakahira K, Hammond S, Rhodes KJ, Schechter LE, and Trimmer JS. {beta}Subunits promote K+ channel surface expression through effects early in biosynthesis. Neuron 16: 843–852, 1996.[CrossRef][Web of Science][Medline]

30. Splawski I, Shen J, Timothy KW, Lehmann MH, Priori S, Robinson JL, Moss AJ, Schwartz PJ, Towbin JA, Vincent GM, and Keating MT. Spectrum of mutations in long-QT syndrome genes KVLQT1, HERG, SCN5A, KCNE1, and KCNE2. Circulation 102: 1178–1185, 2000.[Abstract/Free Full Text]

31. Splawski I, Tristani-Firouzi M, Lehmann MH, Sanguinetti MC, and Keating MT. Mutations in the hminK gene cause long QT syndrome and suppress IKs function. Nat Genet 17: 338–340, 1997.[Web of Science][Medline]

32. Takumi T, Moriyoshi K, Aramori I, Ishii T, Oiki S, Okada Y, Ohkubo H, and Nakanishi S. Alteration of channel activities and gating by mutations of slow ISK potassium channel. J Biol Chem 2266: 22192–22198, 1991.

33. Teasdale RD and Jackson MR. Signal-mediated sorting of membrane proteins between the endoplasmic reticulum and the Golgi apparatus. Annu Rev Cell Dev Biol 12: 27–54, 1996.[CrossRef][Web of Science][Medline]

34. Thomas PJ, Qu BH, and Pedersen PL. Defective protein folding as a basis of human disease. Trends Biochem Sci 20: 456–459, 1995.[CrossRef][Web of Science][Medline]

35. Tyson J, Tranebjaerg L, Bellman S, Wren C, Taylor JF, Bathen J, Aslaksen B, Sorland SJ, Lund O, Malcolm S, Pembrey M, Bhattacharya S, and Bitner-Glindzicz M. IsK and KvLQT1: mutation in either of the two subunits of the slow component of the delayed rectifier potassium channel can cause Jervell and Lange-Nielsen syndrome. Hum Mol Genet 6: 2179–2185, 1997.[Abstract/Free Full Text]

36. Tzounopoulos T, Guy HR, Durell S, Adelman JP, and Maylie J. min K channels form by assembly of at least 14 subunits. Proc Natl Acad Sci USA 92: 9593–9597, 1995.[Abstract/Free Full Text]

37. Vincent GM. The molecular genetics of the long QT syndrome: genes causing fainting and sudden death. Annu Rev Med 49: 263–274, 1998.[CrossRef][Web of Science][Medline]

38. Wang KW and Goldstein SAN. Subunit composition of minK potassium channels. Neuron 14: 1303–1309, 1995.[CrossRef][Web of Science][Medline]

39. Wang W, Xia J, and Kass RS. MinK-KvLQT1 fusion proteins, evidence for mutiple stoichimetries of the assembled IsK channel. J Biol Chem 273: 34069–34074, 1998.[Abstract/Free Full Text]

40. Yamashita F, Horie M, Kubota T, Yoshida H, Yumoto Y, Kobori A, Ninomiya T, Kono Y, Haruna T, Tsuji K, Washizuka T, Takano M, Otani H, Sasayama S, and Aizawa Y. Characterization and subcellularlocalization of KCNQ1 with a heterozygous mutation in the C terminus. J Mol Cell Cardiol 33: 197–207, 2001.[CrossRef][Web of Science][Medline]

41. Yang Y and Sigworth FJ. Single-channel properties of IKs potassium channels. J Gen Physiol 112: 665–678, 1998. [Corrigenda. J Gen Physiol 113: March 1999, p. 505.][Abstract/Free Full Text]

42. Zerangue N, Malan MJ, Fried SR, Dazin PF, Jan YN, Jan LY, and Schwappach B. Analysis of endoplasmic reticulum trafficking signals by combinatorial screening in mammalian cells. Proc Natl Acad Sci USA 98: 2431–2436, 2001.[Abstract/Free Full Text]

43. Zerangue N, Schwappach B, Jan YN, and Jan LY. A new ER trafficking signal regulates the subunit stoichiometry of plasma membrane KATP channels. Neuron 22: 537–548, 1999.[CrossRef][Web of Science][Medline]

44. Zhou Z, Gong Q, Epstein ML, and January CT. HERG channel dysfunction in human long QT syndrome. J Biol Chem 273: 21061–21066, 1998.[Abstract/Free Full Text]

45. Zhou Z, Gong Q, and January CT. Correction of defective protein trafficking of a mutant HERG potassium channel in human long QT syndrome. J Biol Chem 274: 31123–31126, 1999.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
S. C. Harmer, A. J. Wilson, R. Aldridge, and A. Tinker
Mechanisms of disease pathogenesis in long QT syndrome type 5
Am J Physiol Cell Physiol, February 1, 2010; 298(2): C263 - C273.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
L. Sole, M. Roura-Ferrer, M. Perez-Verdaguer, A. Oliveras, M. Calvo, J. M. Fernandez-Fernandez, and A. Felipe
KCNE4 suppresses Kv1.3 currents by modulating trafficking, surface expression and channel gating
J. Cell Sci., October 15, 2009; 122(20): 3738 - 3748.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. R. Silva, H. Pan, D. Wu, A. Nekouzadeh, K. F. Decker, J. Cui, N. A. Baker, D. Sept, and Y. Rudy
A multiscale model linking ion-channel molecular dynamics and electrostatics to the cardiac action potential
PNAS, July 7, 2009; 106(27): 11102 - 11106.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
X. Xu, V. A. Kanda, E. Choi, G. Panaghie, T. K. Roepke, S. A. Gaeta, D. J. Christini, D. J. Lerner, and G. W. Abbott
MinK-dependent internalization of the IKs potassium channel
Cardiovasc Res, June 1, 2009; 82(3): 430 - 438.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
A. C.G. van Ginneken
MinK: a double-hearted partner in cardiac repolarization
Cardiovasc Res, June 1, 2009; 82(3): 390 - 391.
[Full Text] [PDF]


Home page
JCBHome page
J. S. Lowe, O. Palygin, N. Bhasin, T. J. Hund, P. A. Boyden, E. Shibata, M. E. Anderson, and P. J. Mohler
Voltage-gated Nav channel targeting in the heart requires an ankyrin-G dependent cellular pathway
J. Cell Biol., January 10, 2008; 180(1): 173 - 186.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
G. S. Pitt
Calmodulin and CaMKII as molecular switches for cardiac ion channels
Cardiovasc Res, March 1, 2007; 73(4): 641 - 647.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
Z. Mustapha, L. Pang, and S. Nattel
Characterization of the cardiac KCNE1 gene promoter
Cardiovasc Res, January 1, 2007; 73(1): 82 - 91.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
A. J. Wilson, K. V. Quinn, F. M. Graves, M. Bitner-Glindzicz, and A. Tinker
Abnormal KCNQ1 trafficking influences disease pathogenesis in hereditary long QT syndromes (LQT1)
Cardiovasc Res, August 15, 2005; 67(3): 476 - 486.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
J. R. Ehrlich, S. Zicha, P. Coutu, T. E. Hebert, and S. Nattel
Atrial fibrillation-associated minK38G/S polymorphism modulates delayed rectifier current and membrane localization
Cardiovasc Res, August 15, 2005; 67(3): 520 - 528.
[Abstract] [Full Text] [PDF]


Home page
JGPHome page
S. D. Gage and W. R. Kobertz
KCNE3 Truncation Mutants Reveal a Bipartite Modulation of KCNQ1 K+ Channels
J. Gen. Physiol., November 29, 2004; 124(6): 759 - 771.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/6/C1453    most recent
00275.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (18)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Krumerman, A.
Right arrow Articles by McDonald, T. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Krumerman, A.
Right arrow Articles by McDonald, T. V.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.