|
|
||||||||
MEMBRANE TRANSPORTERS, ION CHANNELS, AND PUMPS
-subunit for nongastric H-K-ATPase in rat anterior prostate
1Department of Pharmacology, Medical College of Ohio, Toledo, Ohio 43614; and 2Shemyakin and Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences, Moscow 117871, Russia
Submitted 15 September 2003 ; accepted in final form 26 January 2004
| ABSTRACT |
|---|
|
|
|---|
-subunit (
ng) is expressed in apical membranes of rodent prostate. Its highest level, as well as relative abundance, with respect to
1-isoform of Na-K-ATPase, was observed in anterior lobe. Here, we aimed to determine the subunit composition of nongastric H-K-ATPase through the detailed analysis of the expression of all known X-K-ATPase
-subunits in rat anterior prostate (AP). RT-PCR detects transcripts of
-subunits of Na-K-ATPase only. Measurement of absolute protein content of these three
-subunit isoforms, with the use of quantitative Western blotting of AP membrane proteins, indicates that the abundance order is
1 >
3 >>
2. Immunohistochemical experiments demonstrate that
1 is present predominantly in apical membranes, coinciding with
ng, whereas
3 is localized in the basolateral compartment, coinciding with
1. This is the first direct demonstration of the
ng-
1 colocalization in situ indicating that, in rat AP,
ng associates only with
1. The existence of
ng-
1 complex has been confirmed by immunoprecipitation experiments. These results indicate that
1-isoform functions as the authentic subunit of Na-K-ATPase and nongastric H-K-ATPase. Putatively, the intracellular polarization of X-K-ATPase isoforms depends on interaction with other proteins. ATP1AL1; ATP12A; ATP1B1; X-potassium-adenosine triphosphatase; hydrogen-potassium-adenosine triphosphatase; sodium-potassium-adenosine triphosphatase; male accessory glands; potassium transport
-subunits of X-K-ATPases are large polytopic proteins (
100 kDa) that perform ATP hydrolysis and ion translocation. Six isoforms of these subunits can be classified into three groups: Na-K-ATPase (
1,
2,
3,
4), gastric H-K-ATPase (
g), and nongastric H-K-ATPase (
ng); all of the three groups are equally related to each other in terms of structure (
64% identical amino acid residues) (29, 30). The domain architecture of all X-K-ATPase
-subunits is thought to share essential elements of well-defined molecular structure of sarcoplasmic reticulum Ca-ATPase (55). However, X-K-ATPases are unique with respect to quaternary structure because they are the only animal P-ATPases that contain a second component, glycosylated
-subunit of
35 kDa, which has no analogs among subunits of other P-ATPases (1, 8, 13, 24, 30).
The
-subunit plays a crucial role in the structural and functional maturation of the functionally active X-K-ATPase molecule (13, 20, 24) and modulation of the enzymes' affinities for cations (13, 20, 24). Five closely related genes encoding
-subunits have been identified in mammals encoding three Na-K-ATPase
-isoforms (
1,
2,
3), gastric H-K-ATPase
-subunit (
g), and muscle-specific (
m) protein. All five members of the family share a common transmembrane structure of type II membrane proteins but exhibit a much lower degree of sequence similarity (
3248%) than
-subunits (13, 24, 44).
An important issue is the tissue specificity of expression of these genes, suggesting that the existence of multiple X-K-ATPase isoforms is not a consequence of a redundant gene duplication but a means to finely tune the specific features of ion homeostasis in various cell types. Indeed, there is a substantial variability of expression level of all subunits and hence a significant variability of different isoform combinations. The
1-
1 complex is a ubiquitous one but has a rather variable level of expression, being especially abundant in brain and in some ion-transporting tissues like kidney. Particular combinations are characteristic for some tissues:
3
1 for neurons,
3
2 for retina,
2
2 for glia, and
1
2 for stria vascularis of the inner ear. Some other subunits have a very strict tissue specificity:
4, only in male germ cells;
m, only in striated muscle;
g and
g, primarily in parietal cells of stomach mucosa [there are also reports on detection of gastric H-K-ATPase subunits in kidney (3) (conflicting with Ref. 11), epididymis (4), inner ear and choroid plexus (36), and heart (7, 47)]. The
3 is expressed in many tissues at relatively low levels, being somewhat more abundant in lung, testis, adrenal, brain, and colon (5, 8, 24, 47).
The catalytic
ng is encoded by gene ATP12A (alternative name ATP1AL1). Mammalian ATP12A genes have been known for a long time to be expressed in distal colon, skin, and kidney (30, 48). A broad screening of tissues has revealed that the gene is also expressed in other tissues, like preputial gland (rat) and placenta (human) (48) and, at the highest level, in rodent prostate (46), especially in the anterior lobe. The cellular location of
ng in prostate epithelium, distal colon, and kidney was shown to be the apical membranes (23, 33, 46, 49, 58).
Unlike long-known and extensively studied Na-K-ATPase and gastric H-K-ATPase (8, 53), the nongastric H-K-ATPase is not yet sufficiently characterized with respect to structural organization and functional properties. For many years, it remained unclear whether one of the known
-subunits or a hitherto unidentified member of the X-K-ATPase
-subunit family is the authentic subunit of nongastric H-K-ATPase. No unique
-subunit specific only for nongastric H-K-ATPase has been identified, despite intense efforts of our group and others. Published experimental data on this subject were controversial, and it was not clear whether one or several isoforms can function as the
-subunit for nongastric H-K-ATPase. For rat distal colon and kidney, it was reported to be either
1 (14, 34) or, in sharp contrast,
3 (52). On the other hand, in heterologous expression systems, the functional expression of nongastric H-K-ATPase can be supported by various X-K-ATPase
-subunit isoforms (1, 2, 6, 15, 18, 21, 24, 27, 30, 31, 40).
In studies reported here, we took advantage of anterior prostate (AP) as the richest source of
ng (46) and have aimed to determine the subunit composition of nongastric H-K-ATPase through the detailed analysis of the expression of all known X-K-ATPase
-subunits in rodent prostate complex. Our findings provide strong evidence that, in rat AP epithelium, X-K-ATPase
1-isoform serves as an authentic subunit of nongastric H-K-ATPase, assembling preferentially with
ng, whereas
3 appears to be selective for Na-K-ATPase
-subunit. A preliminary account of this work has been presented (40).
| MATERIALS AND METHODS |
|---|
|
|
|---|
RT-PCR and cDNA cloning.
Conditions of RT-PCR and primer sequences for tissue expression studies for
1,
2, and
3 were essentially as described before (46, 48). Primers used for
g were GFBE (gcrtctatgtgctgatgcag) and GBBE (gaggaacttgacgatcctgttc). Agarose gels were stained with ethidium bromide and imaged with the help of a Typhoon 8600 laser scanner (Amersham Pharmacia, Piscataway, NJ).
To produce recombinant ectodomains of rat
-subunits, the following primers were used: RB1-F (gcttagatctagtgagctgaaacccacgt) and RB1-B (cttgtgattagctcttaacttca) for
1; RB2-F (gctgagatctgtctctgaccatacccccaag) and RB2-B (aaggaagcttaggctttgttgattcgaagc) for
2; and RB3-F (gctcagatctctgaatgacgaggttc) and RB3-B (agacaagcttctcttaggcatgtgctatgact) for
3. The fragments were amplified from rat brain cDNA, digested with BglII and HindIII (except for
1), and cloned at BamHI/HindIII sites of pQE30 expression vector (Qiagen, Valencia, CA). The
1 fragment was blunted with T4 DNA polymerase, digested with BglII, and cloned at BamHI/SmaI sites of the pQE vector.
Antibodies. Recombinant protein expression in Escherichia coli, purification by immobilized metal affinity chromatography, and immunization of rabbits were achieved essentially as described before (45). Antibodies were affinity purified by using the antigens absorbed on polyvinylidene difluoride membrane, according to the method of Rucklidge et al. (51).
Mouse monoclonal antibody
6F against
1 (56) was obtained from the Developmental Studies Hybridoma Bank (Iowa City, IA). Rabbit polyclonal antibodies against
ng have been described before (46). Monoclonal antibody against gastric H-K-ATPase
-subunit was purchased from Affinity Bioreagents (Golden, CO). Monoclonal antibodies IEC 1/48 (37) and MAb 13 against
1 and 3PE anti-human
3 (12) were generous gifts from Andrea Quaroni, Michael J. Caplan, and Watchara Kasinrerk. Mouse monoclonal antibodies F10 against rat
3 and 2C8 against secretory pathway Ca-ATPase were from Ruslan Dmitriev (unpublished observations). Rabbit polyclonal antibodies against human
1,
2, and
3 ectodomains (59) and antibodies against NH2 terminus of rat
3 (5) were kindly provided by Pablo Martin-Vasallo and by Kathleen J. Sweadner.
Immunohistochemistry. Tissues were frozen in isopentane/liquid nitrogen and cut at 10-µm thickness. The sections were incubated in 5:3 methanol-acetone at 15°C for 30 min, air dried, and stored. The sections were treated with chloroform for 5 min at room temperature, air dried, incubated with 5% pig serum in PBS, and then immunolabeled by subsequent incubations with primary antibodies and anti-host antibodies conjugated with either Alexa Fluor-498 or Alexa Fluor-594 (Molecular Probes, Eugene, OR). For peroxidase fluorescent labeling, the sections were incubated with 3% hydrogen peroxide in PBS for 1 h, anti-guinea pig peroxidase-conjugated antibodies (Sigma), and tyramide-595 substrate (Molecular Probes). Labeled sections were mounted in SlowFade (Molecular Probes). To label nuclei, 100,000x SYBR Gold (Molecular Probes) or 0.5 µg/ml ethidium bromide plus 10 µg/ml RNase A were added to the mounting medium. Images were collected by using a Nikon Optiphot-2 fluorescent microscope equipped with a SPOT digital camera (Diagnostic Instruments, Sterling Heights, MI) with automatic exposure control. Confocal images were obtained by using an Olympus fluorescent microscope equipped with Radiance XR laser scanning head (Bio-Rad, Hercules, CA).
Preparation of membranes and deglycosylation. Membranes were prepared from rat prostate essentially as described before (46). For deglycosylation, the membranes were incubated for 1 h at 37°C in 0.05 M sodium phosphate, pH 7.4, 0.2% SDS, 2% octyl glucoside, 100 mM dithiothreitol (DTT), 1:50 protease inhibitor cocktail (Sigma), and 5 U/µg peptide N-glycosidase F (New England Biolabs). Treatment with endoglycosidase H (Endo Hf; New England Biolabs) was performed in the same conditions, except that 0.05 M sodium citrate (pH 5.5) were substituted for sodium phosphate.
Immunoprecipitation.
Membrane suspension (100 µl, 200 µg protein) in 10 mM HEPES-Na, pH 7.0, 5 mM Na-EDTA, and 0.25 M sucrose was kept on ice, diluted with water 1:1, and made subsequently 0.3 M NaCl, 0.1%
-mercaptoethanol, 1% 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate (CHAPS) (crystallized from methanol), and 0.02% benzyldimethylhexadecylammonium chloride (Sigma; from 2% solution kept at 50°C before use). The membranes were incubated with 1 µl ascites on a rotary mixer for 8 h at 4°C and centrifuged for 10 min at 16,000 g. The supernatant was diluted 1:1 with PBS and incubated with 3 µl protein A/G agarose (Novagene, Madison, WI) for 2 h at 4°C. The sorbent was spinned down and washed with PBS containing 0.2% CHAPS. The bound proteins were eluted by incubation for 5 min at 70°C in a modified electrophoresis sample-loading buffer (5% SDS, 8 M urea, 100 mM DTT, 25 mM glycylglycine, 100 mM Tris·HCl, pH 6.8, 2%
-mercaptoethanol, 1 mM Na-EDTA, 2 mM benzamidine, 1:200 protease inhibitor cocktail) before analysis by Western blotting.
Western blotting.
Membranes were dissolved in the SDS sample loading buffer, and protein concentration was measured by a modification of the Bradford procedure that includes coprecipitation of proteins with calcium phosphate (43). Proteins (10 µg per well, or 1:10 of immunoprecipitates) were electrophoresed in polyacrylamide gels (12% for analysis of
-subunits, 8% for
-subunits) and blotted onto polyvinylidene difluoride membrane (Amersham-Pharmacia). The membrane was washed in methanol and stained in 50% methanol, 1% acetic acid, and 0.03% Coomassie brilliant blue G-250 followed by washes with 50% methanol. Then the membrane was cut and destained in methanol, followed by washing with 50% methanol. The membrane was incubated in 50 mM Tris, pH 6.8, 100 mM mercaptoethanol, and 2% SDS for 15 min at room temperature; blocked in Tris-buffered saline containing 0.1% Tween-20 and 5% nonfat milk; and incubated with primary antibodies and then with peroxidase-conjugated anti-rabbit antibodies (Zymed) or peroxidase-conjugated anti-guinea pig antibodies (Sigma) for 1 h each with thorough washes in Tris-buffered saline, containing 0.1% Tween-20, between incubations. The immunoblots were visualized with a chemiluminescent substrate (ECL+Plus, Amersham Pharmacia). For quantitative determination, series of standard protein dilutions were prepared in SDS sample loading buffer supplemented with 100 mM DTT and run in parallel. Densitometry of the immunoblot films was performed by using a Bio-Rad model GS-690 imaging densitometer and Molecular Analyst software (Bio-Rad Laboratories).
| RESULTS |
|---|
|
|
|---|
-subunits in rat prostate.
Figure 1 illustrates results of RT-PCR detection of four different X-K-ATPase
-subunits in lobes of rat prostate, as well as in some other male accessory glands that were not studied before. Transcripts of all known Na-K-ATPase
-subunits (
1,
2, and
3) are readily detectable, whereas no signal can be observed in the case of
g. The absence of
m in these glands has been reported before (44). Considering the number of cycles, it appears that
1 transcripts are more abundant than
2 or
3 in all tissues studied, and
3 is more abundant than
2. The expression levels of
2 and
3 are very similar between the tissues studied. In contrast,
1 transcripts are more abundant in ventral and anterior lobes of the prostate than in dorsal and lateral lobes. Of note also is the fact that the preputial gland has a remarkably lower level of
1 than other tissues.
|
-subunits in rat prostate membranes by Western blotting.
Initial experiments on immunochemical detection of
-subunit proteins by Western blotting of rat AP using available rabbit antibodies against ectodomains of human
1,
2, and
3 showed that antibodies against
1 and
2 are suitable for this purpose, whereas anti-human
3 produced no specific bands (Fig. 2A). Antibodies against a synthetic peptide comprising an NH2-terminal fragment of rat
3 (5), on the other hand, produced a strong band of
38 kDa that showed no shift on deglycosylation, probably representing a nonspecific interaction with a prostate-specific protein (results not shown). To improve the method of detection, we have expressed recombinant proteins comprising rat
1,
2, and
3 ectodomains NH2-terminally fused with the hexahistidine tag (Fig. 3) and obtained rabbit and guinea pig polyclonal antibodies against them. For unknown reasons, rabbits produced better anti-
1 antibodies, whereas guinea pigs produced better anti-
3. Anti-rat
2 antibodies from both species were of insufficient quality (results not shown), and, therefore, anti-human
2 rabbit polyclonal antibodies developed by Pablo Martin-Vasallo were used. Crude sera can be successfully used for the detection of deglycosylated
-subunits (as shown for
3 in Fig. 2B), whereas detection sensitivity of the glyco forms was not suitable because of band smearing. Both
1 and
2 core proteins (after removal of N-glycans by glycopeptidase F) from AP have electrophoretic mobilities corresponding to apparent molecular masses slightly higher than the predicted values. The
3 has a significantly higher apparent molecular mass (36 kDa instead of theoretical 32 kDa). The same behavior of rat
3 was observed previously in many different tissues (5) but is difficult to understand because
3 sequence lacks unusual features. All recombinant
-subunit ectodomains have apparent molecular masses somewhat larger than expected (33.9 vs. 29.8 kDa for
1 and 30.7 vs. 27.1 kDa for
2), but, in the case of
3, this effect is much more significant (31.5 vs. 25.8 kDa). Because the ectodomain comprises the majority of the molecule's mass, it is clear that abnormally apparent molecular mass of rat
3 core protein from native membranes can be fully explained by the abnormal mobility of its ectodomain.
|
|
-subunits in microsomes from AP and several other tissues were measured by quantitative Western blotting by using known quantities of recombinant proteins as standards (Table 1). The
1 in most tissues and
2 in brain are easy to determine due to relatively high content. The
3 has a somewhat lower expression level, whereas
2 in AP has a very low level, which is sufficient for qualitative detection (Fig. 2A) but not for accurate quantitative measurements. For this reason, the data for
2 are presented as an upper threshold. It was of interest to check if our determinations give correct, unbiased values. The contents of
1- and
2-subunits in rat brain microsomes were determined previously as 227 ± 23 and 151 ± 32 pmol/mg for
1 and
2, respectively, by Lavoie et al. (35). These values are 1.5 and 1.2 times higher than ours for
1 and
2, respectively. In fact, this difference seems to be very little and could be explained by variations in experimental procedures. Because
1 has a 2.5-fold higher level than
3, it is reasonable to hypothesize that
1 is the predominant isoform in nongastric H-K-ATPase.
|
1 is the real partner of
ng, then may
1 from AP or any of the other prostate lobes be different from that in tissues studied previously? May the
1-isoform interacting with
ng be a product of alternative splicing or have different modifications, for example, N-glycosylation? This possibility was tested by treatment with glycopeptidase F or endoglycosidase H, the latter being active mostly against high-mannose chains. Figure 4 presents results of such an analysis and demonstrates that
1 from AP as well as from other
ng-containing lobes (47) is glycosylated to a similar extent as the reference
1 of kidney, and the amount of high-mannose sugars is negligible. The electrophoretic mobilities of core
1 proteins from kidney and AP are equal. Very surprisingly,
1 from ventral prostate was found to have a different N-glycosylation pattern: the amount of sugars is obviously lower, and significant sensitivity to endoglycosidase H indicates that
1 in ventral prostate has high-mannose chains. In contrast to the distal colon, where the existence of unusual peptide N-glycosidase F-resistant N-glycans in the
1 associated with
ng has been suggested (14), we did not observe any unusual or unexpected features of
1.
|
-subunits in rat AP.
In agreement with a previous report (46), anti-
1 antibodies produce basolateral labeling, and anti-
ng antibodies label apical membranes (Fig. 5A). Affinity-purified polyclonal anti-
1 antibodies and monoclonal antibody MAb 13 against dog
1 showed weak labeling of apical and none of basolateral membranes (Fig. 5, B and C). However, another anti-
1 monoclonal antibody, IEC 1/48 (37), known for its high-detection sensitivity in immunochemical experiments, produced a very bright labeling of apical membranes and a weak labeling of the basolateral compartment (Fig. 5, DF). Anti-
3 antibodies produced a weak basolateral labeling. Its intensity was increased by the use of tyramide fluorogenic substrate (Fig. 5G). No significant labeling of apical membranes with anti-
3 antibodies was observed. Anti-
2 antibodies did not produce any significant labeling above nonspecific background (results not shown).
|
3 is polarized laterally, whereas
1 is polarized mostly apically with detectable levels in basolateral membranes. On the basis of these data, it is possible to conclude that the
ng-
1 pair is transported to the apical side, whereas both
1-
1 and
1-
3 are transported to basolateral membranes. Importantly, these results demonstrate that, in AP epithelial cells,
ng binds
1 preferentially and does not associate with
3. These conclusions are confirmed by double-labeling experiments (
ng +
1 in Fig. 5, HJ, and
1 +
3 in Fig. 5, KM).
Immunoprecipitation.
Interestingly, both nongastric H-K-ATPase and Na-K-ATPase in AP membranes are resistant to solubilization under mild conditions with common nonionic or zwitterionic detergents, such as C12E8, digitonin, octyl glucoside, Triton X-100, CHAPS, myristyl sulfobetaine, etc. (results not shown). Such a phenomenon may be explained by a strong interaction of membrane proteins with cytoskeleton. The resistance to mild solubilization creates a strong obstacle against successful immunoprecipitation of the ATPases for direct demonstration of particular 
interactions. We were not able to immunoprecipitate
ng according to Codina et al. (14) or
1 according to Marxer et al. (37) by reproducing previously used conditions for distal colon membranes (CHAPS or Triton X-100) (results not shown). Here it should be stressed that the intersubunit interactions in X-K-ATPases are not very strong in solubilized form, for example,
-subunit retains in the complex solubilized with CHAPS and separates even in nonionic detergents, such as 1% octyl glucoside or Triton X-100 (38). It is impossible to use harsh solubilization conditions (e.g., SDS). For this reason, we tried to use mixtures of ionic detergents with nonionic or zwitterionic ones, as previously found excellent for immunoaffinity chromatography (32). As expected, additions of some ionic detergents improve solubilization, especially in the presence of salt (Fig. 6). However, the immunoprecipitation requires not only solubilization but also preservation of the interactions between the subunits, antigen-antibody, and immunoglobulin-protein A/G. For this reason, we canceled attempts for step-by-step optimization and performed a screening for the precipitation conditions using simultaneous solubilization and antibody binding (results not shown). It was found that a significant part of
ng can be co-immunoprecipitated by anti-
1 monoclonal antibody IEC 1/48 by using CHAPS supplemented with salt and a low concentration of benzyldimethylhexadecylammonium chloride, a cationic detergent. A significant portion of the total nongastric H-K-ATPase
-subunit has been detected in the fraction precipitated with anti-
1 monoclonal antibody IEC 1/48 (Fig. 7A). These results directly demonstrate that
ng is capable of interacting with
1 in the AP membranes.
|
|
1 antibody precipitates
ng much more efficiently than Na-K-ATPase
-subunit (Fig. 7B). This may be interpreted either as that
1 is initially associated with
ng predominantly or that the affinity of the
1-
ng interaction is higher than that of
1-
1. The first explanation is in line with immunohistochemical data and strongly suggests that
1 associates primarily with
ng and, to a much lesser extent, with
1. These results also provide indirect evidence that
1 is complexed mainly with
3. | DISCUSSION |
|---|
|
|
|---|
-subunit isoforms in the apparent order of their abundance
1 >
3 >
2, whereas other X-K-ATPase
-subunits are absent. No new
-subunit can exist because of the lack of any new genes in sequenced mammalian genomes. Also, both
m and
g transcripts are absent in the rat prostate. For these reasons, the search for authentic nongastric H-K-ATPase
-subunit can be narrowed to three candidates:
1,
2, and
3. Results of immunological detection of different
-subunit isoforms by Western blotting of AP membranes indicate that
1 is the most abundant isoform. Content of
1 is higher than
3, and this indirectly indicates that
1 is more likely than
3 to be the predominant isoform of nongastric H-K-ATPase. Compared with
1- and
3-,
2-isoform has a very low content, and its participation may be dismissed from consideration. The most interesting result was the comparison of immunohistochemical labeling of AP epithelium, which demonstrates that
1 is localized predominantly apically, whereas
3 is limited to basolateral membranes. These observations demonstrate directly that association of
ng with
3 does not occur in AP cells and suggest that, in these cells, nongastric H-K-ATPase exists as
ng-
1 complex, whereas Na-K-ATPase may consist of both
1-
1 and
1-
3 complexes. Importantly, results of co-immunoprecipitation of
ng and
1 with anti-
1 antibodies support these conclusions.
Thus our findings provide strong evidence that X-K-ATPase
1-subunit is not only a subunit of the Na-K-ATPase, but also serves as an authentic subunit of nongastric H-K-ATPase, a real counterpart of the
ng in apical membrane of rat AP epithelium. In these cells, a much higher portion of
1 appears to be associated with
ng than that with
1.
Our data resolve the previous contradictions on which
-subunit may be the authentic one in case of nongastric H-K-ATPase. Previously,
1 antibodies were shown to recognize a protein in immunoprecipitate of
ng from solubilized rat distal colon membranes (14) and in rat kidney membrane vesicles from immunoaffinity isolated with
ng antibodies (34). The strongest argument for
3 was that it is detected in apical membranes from rat distal colon (52). It should be noted that the detection of association with one isoform could not rule out the possibility of association with others. Hence the question remained open: whether
1 (14, 34) or
3 (52) is characteristic for the nongastric H-K-ATPase or
ng can associate with any
-subunit isoform nonselectively. Our data provide strong evidence that
ng
1 exists in AP and, more importantly, that there is a significant selectivity of 
-subunit interactions. Indeed, association between
ng and
3 does not occur in AP. On the other hand, it is impossible to completely exclude the possibility that a minor portion of
ng may be associated with
-subunits other than
1, especially in tissues different from AP.
Interestingly, although our results indicate that, in vivo, there is a strong selectivity of subunit interactions between
ng and
-subunits, the situation in vitro is more complicated. The
ng protein has been coexpressed in various heterologous systems, together with different X-K-ATPase
-subunits (1, 2, 6, 15, 17, 18, 21, 24, 2628, 30, 31, 39, 50). These studies demonstrated that several X-K-ATPase
-subunits, including the
1 (6, 15, 21), the analog of mammalian
2 from Bufo bladder (18, 21), Torpedo Na-K-ATPase
(6), as well as the
g (1, 15, 21, 24, 27, 30, 31, 39), can support proper folding of
ng and formation of functionally active nongastric H-K-ATPases. However, detailed comparison of the capability of each of the known X-K-ATPase
-subunits to form a functionally active ATPase complex with the
ng on coexpression in Xenopus oocytes revealed that
g and
2-like Bufo bladder
are able to associate with
ng much more efficiently than its real counterpart,
1 (21, 26). Formation of the active ATPase complex of
ng with
g, but not with
1 or
3, was observed in baculovirus expression system (1, 2). It is logical to assume that the phenomenon of preferential association of the
ng with
g and Bufo bladder
in heterologous expression systems is based on intrinsic structural features of these particular
-subunits, which are designed by nature to resist the harsh environmental conditions in mammalian stomach or in frog urinary bladder and, therefore, exhibit a greater ability to survive in heterologous expression systems. Native
g was found to be much less susceptible to digestion with trypsin and other proteases than the native
1 (57). Therefore, one can suggest that heavy glycosylation [seven or eight N-linked carbohydrate chains in
g and Bufo bladder
vs. three oligosaccharides in
1 (13)] is an essential feature determining more efficient formation of the recombinant
ng-
complexes.
The relatively weak association of
ng with its authentic counterpart
1 in Xenopus oocytes (21) and the absence of
ng-
1 association in Sf-21 insect cells (1, 2) may, in fact, indicate that these cells do not contain other subunits or proteins that facilitate or participate in the
ng-
1 assembly in vivo, as our laboratory suggested previously (26). This idea is supported by recent observations that
ng, in contrast to
1, is unable to assemble with endogenous
1 on expression in mammalian human embryonic kidney 293, Madin-Darby canine kidney, and LLC-PK1 cells (6, 50).
There is evidence that subunit composition and polarization of X-K-ATPases are linked. For example, abnormal expression of
2 in the kidney results in apical localization of some of the Na-K-ATPase pumps with a concomitant disease (60). It was also demonstrated that the apical localization and trafficking of the gastric H-K-ATPase in tubulovesicles is dependent on its
-subunit (19). On the other hand, the data presented here, as well as results of other studies (10, 22), demonstrate that signals of membrane sorting are encoded in the X-K-ATPase
-subunits. To explain the apparent discrepancy of the above data, it is reasonable to suggest that, at least in some tissues, the efficient formation and intracellular trafficking of a particular combination of
- and
-subunit isoforms of the X-K-ATPases requires interaction with other proteins.
What kind of other proteins may associate with
ng? One class of potential candidates is especially interesting: small transmembrane proteins known as members of the FXYD family, which includes
-subunit of Na-K-ATPase (25, 54). In the distal colon, FXYD2 interacts only with Na-K-ATPase (16). However, seven members of the FXYD family are known (25, 54), and it is possible that some of them can interact and modulate properties of nongastric H-K-ATPase. An interesting example of putative interaction with unrelated proteins is the observation that the polarity of Na-K-ATPase in retinal pigment epithelium differs in cells with different levels of junctional E-/P-cadherin (9). Thus it is quite feasible that interactions with other proteins may be responsible for the observed specificity of 
assembly and cellular polarization of X-K-ATPases (10, 42).
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
2. Adams G, Tillekeratne M, Yu C, Pestov NB, and Modyanov NN. Catalytic function of nongastric H,K-ATPase expressed in Sf-21 insect cells. Biochemistry 40: 57655776, 2001.[CrossRef][Medline]
3. Ahn KY and Kone BC. Expression and cellular localization of mRNA encoding the "gastric" isoform of H+-K+-ATPase
-subunit in rat kidney. Am J Physiol Renal Fluid Electrolyte Physiol 268: F99F109, 1995.
4. Andonian S, Adamali H, and Hermo L. Expression and regulation of H+,K+-ATPase in lysosomes of epithelial cells of the adult rat epididymis. Mol Reprod Dev 58: 398410, 2001.[CrossRef][Web of Science][Medline]
5. Arystarkhova E and Sweadner KJ. Tissue-specific expression of the Na,K-ATPase
3 subunit. The presence of
3 in lung and liver addresses the problem of the missing subunit. J Biol Chem 272: 2240522408, 1997.
6. Asano S, Hoshina S, Nakai Y, Watanabe T, Sato M, Suzuki Y, and Takeguchi N. Functional expression of putative H+-K+-ATPase from guinea pig distal colon. Am J Physiol Cell Physiol 275: C669C674, 1998.
7. Beisvag V, Falck G, Loennechen JP, Qvigstad G, Jynge P, Skomedal T, Osnes JB, Sandvik AK, and Ellingsen Ø. Identification and regulation of the gastric H+/K+-ATPase in the rat heart. Acta Physiol Scand 179: 251262, 2003.[CrossRef][Web of Science][Medline]
8. Blanco G and Mercer RW. Isozymes of the Na-K-ATPase: heterogeneity in structure, diversity in function. Am J Physiol Renal Physiol 275: F633F650, 1998.
9. Burke JM, Cao F, and Irving PE. High levels of E-/P-cadherin: correlation with decreased apical polarity of Na/K ATPase in bovine RPE cells in situ. Invest Ophthalmol Vis Sci 41: 19451952, 2000.
10. Caplan MJ. Ion pump sorting in polarized renal epithelial cells. Kidney Int 60: 427430, 2001.[CrossRef][Web of Science][Medline]
11. Cheval L, Elalouf JM, and Doucet A. Re-evaluation of the expression of the gastric H,K-ATPase
subunit along the rat nephron. Pflügers Arch 433: 539541, 1997.[CrossRef][Web of Science][Medline]
12. Chiampanichayakul S, Szekeres A, Khunkaewla P, Moonsom S, Leksa V, Drbal K, Zlabinger GJ, Hofer-Warbinek R, Stockinger H, and Kasinrerk W. Engagement of Na,K-ATPase
3 subunit by a specific mAb suppresses T and B lymphocyte activation. Int Immunol 14: 14071414, 2002.
13. Chow DC and Forte JG. Functional significance of the
-subunit for heterodimeric P-type ATPases. J Exp Biol 198: 117, 1995.[Abstract]
14. Codina J, Delmas-Mata JT, and DuBose TD Jr. The
-subunit of the colonic H,K-ATPase assembles with
1-Na,K-ATPase in kidney and distal colon. J Biol Chem 273: 78947899, 1998.
15. Codina J, Kone BC, Delmas-Mata JT, and DuBose TD Jr. Functional expression of the colonic H+,K+-ATPase
-subunit. Pharmacological properties and assembly with X+,K+-ATPase
-subunits. J Biol Chem 271: 2975929763, 1996.
16. Codina J, Li J, Hong Y, and DuBose TD Jr. The
-Na+,K+-ATPase subunit assembles selectively with
1/
1-Na+,K+-ATPase but not with the colonic H+,K+-ATPase. Kidney Int 61: 967974, 2002.[CrossRef][Web of Science][Medline]
17. Cougnon M, Bouyer P, Planelles G, and Jaisser F. Does the colonic H,K-ATPase also act as an Na,K-ATPase? Proc Natl Acad Sci USA 95: 65166520, 1998.
18. Cougnon M, Planelles G, Crowson MD, Shull GE, Rossier BC, and Jaisser F. The rat distal colon P-ATPase
subunit encodes a ouabain-sensitive H+,K+-ATPase. J Biol Chem 271: 72777280, 1996.
19. Courtois-Coutry N, Roush D, Rajendran V, McCarthy JB, Geibel J, Kashgarian M, and Caplan MJ. A tyrosine-based signal targets H/K-ATPase to a regulated compartment and is required for the cessation of gastric acid secretion. Cell 90: 501510, 1997.[CrossRef][Web of Science][Medline]
20. Crambert G, Hasler U, Beggah AT, Yu C, Modyanov NN, Horisberger JD, Lelievre L, and Geering K. Transport and pharmacological properties of nine different human Na,K-ATPase isozymes. J Biol Chem 275: 19761986, 2000.
21. Crambert G, Horisberger JD, Modyanov NN, and Geering K. Human nongastric H+-K+-ATPase: transport properties of ATP1al1 assembled with different
-subunits. Am J Physiol Cell Physiol 283: C305C314, 2002.
22. Dunbar LA and Caplan MJ. Ion pumps in polarized cells: sorting and regulation of the Na+,K+- and H+,K+-ATPases. J Biol Chem 276: 29617296120, 2001.
23. Fejes-Toth G and Naray-Fejes-Toth A. Immunohistochemical localization of colonic H-K-ATPase to the apical membrane of connecting tubule cells. Am J Physiol Renal Physiol 281: F318F325, 2001.
24. Geering K. The functional role of
-subunits in oligomeric P-type ATPases. J Bioenerg Biomembr 33: 425438, 2001.[CrossRef][Web of Science][Medline]
25. Geering K and Crambert G. FXYD proteins: new tissue-specific regulators of the ubiquitous Na,K-ATPase. SciSTKE 166: RE1, 2003.
26. Geering K, Crambert G, Yu C, Korneenko TV, Pestov NB, and Modyanov NN. Role of membrane domains M9 and M10 in the assembly process and association efficiency of human, non-gastric H,K-ATPase
subunits (ATP1AL1) with known
subunits. Biochemistry 39: 1268812698, 2000.[CrossRef][Medline]
27. Grishin AV, Bevensee MO, Modyanov NN, Rajendran V, Boron WF, and Caplan MJ. Functional expression of the cDNA encoded by the human ATP1AL1 gene. Am J Physiol Renal Fluid Electrolyte Physiol 271: F539F551, 1996.
28. Grishin AV and Caplan MJ. ATP1AL1, a member of the non-gastric H,K-ATPase family, functions as a sodium pump. J Biol Chem 273: 2777227778, 1998.
29. Grishin AV, Sverdlov VE, Kostina MB, and Modyanov NN. Cloning and characterization of the entire cDNA encoded by ATP1AL1a member of the human Na,K/H,K-ATPase gene family. FEBS Lett 349: 144150, 1994.[CrossRef][Web of Science][Medline]
30. Jaisser F and Beggah AT. The nongastric H-K-ATPases: molecular and functional properties. Am J Physiol Renal Physiol 276: F812F824, 1999.
31. Kone BC and Higham SC. A novel N-terminal splice variant of the rat H+-K+-ATPase
2 subunit. Cloning, functional expression, and renal adaptive response to chronic hypokalemia. J Biol Chem 273: 25432552, 1998.
32. Korneenko TV, Pestov NB, Egorov MV, Ivanova MV, Kostina MB, Rydström J, and Shakhparonov MI. Identification of Escherichia coli nitrate reductase as an antigen for a monoclonal antibody with previously unknown specificity. Bioorg Khim 26: 601604, 2000.[Web of Science][Medline]
33. Kraut JA, Helander KG, Helander HF, Iroezi ND, Marcus EA, and Sachs G. Detection and localization of H+-K+-ATPase isoforms in human kidney. Am J Physiol Renal Physiol 281: F763F768, 2001.
34. Kraut JA, Hiura J, Shin JM, Smolka A, Sachs G, and Scott D. The Na+-K+-ATPase
1 subunit is associated with the HK
2 protein in the rat kidney. Kidney Int 53: 958962, 1998.[CrossRef][Web of Science][Medline]
35. Lavoie L, Levenson R, Martin-Vasallo P, and Klip A. The molar ratios of
and
subunits of the Na+-K+-ATPase differ in distinct subcellular membranes from rat skeletal muscle. Biochemistry 36: 77267732, 1997.[CrossRef][Medline]
36. Lecain E, Robert JC, Thomas A, and Tran Ba Huy P. Gastric proton pump is expressed in the inner ear and choroid plexus of the rat. Hear Res 149: 147154, 2000.[CrossRef][Web of Science][Medline]
37. Marxer A, Stieger B, Quaroni A, Kashgarian M, and Hauri HP. (Na++K+)-ATPase and plasma membrane polarity of intestinal epithelial cells: presence of a brush border antigen in the distal large intestine that is immunologically related to
subunit. J Cell Biol 109: 10571069, 1989.
38. Mercer RW, Biemesderfer D, Bliss DP Jr, Collins JH, and Forbush B III. Molecular cloning and immunological characterization of the gamma polypeptide, a small protein associated with the Na,K-ATPase. J Cell Biol 121: 579586, 1993.
39. Modyanov NN, Mathews PM, Grishin AV, Beguin P, Beggah AT, Rossier BC, Horisberger JD, and Geering K. The human ATP1AL1 gene encodes a ouabain-sensitive H-K-ATPase. Am J Physiol Cell Physiol 269: C992C997, 1995.
40. Modyanov N, Pestov N, Adams G, Crambert G, Tillekeratne M, Zhao H, Korneenko T, Shakhparonov M, and Geering K. Nongastric H,K-ATPase: structure and functional properties. Ann NY Acad Sci 986: 183187, 2003.[Web of Science][Medline]
41. Moller JV, Juul B, and le Maire M. Structural organization, ion transport, and energy transduction of P-type ATPases. Biochim Biophys Acta 1286: 151, 1996.[Medline]
42. Muth TR and Caplan MJ. Transport protein trafficking in polarized cells. Annu Rev Cell Dev Biol 19: 333366, 2003.[CrossRef][Web of Science][Medline]
43. Pande SV and Murthy MS. A modified micro-Bradford procedure for elimination of interference from sodium dodecyl sulfate, other detergents, and lipids. Anal Biochem 220: 424426, 1994.[CrossRef][Web of Science][Medline]
44. Pestov NB, Adams G, Shakhparonov MI, and Modyanov NN. Identification of a novel gene of the X,K-ATPase
-subunit family that is predominantly expressed in skeletal and heart muscles. FEBS Lett 456: 243248, 1999.[CrossRef][Web of Science][Medline]
45. Pestov NB, Gusakova TV, Kostina MV, and Shakhparonov MI. Phage mimotopes for monoclonal antibodies against plasma membrane Ca2+-ATPase. Bioorg Khim 22: 567573, 1996.
46. Pestov NB, Korneenko TV, Adams G, Tillekeratne M, Shakhparonov MI, and Modyanov NN. Nongastric H-K-ATPase in rodent prostate: lobe-specific expression and apical localization. Am J Physiol Cell Physiol 282: C907C916, 2002.
47. Pestov NB, Korneenko TV, Zhao H, Adams G, Kostina MB, Shakhparonov MI, and Modyanov NN. The
m protein, a member of the X,K-ATPase
-subunits family, is located intracellularly in pig skeletal muscle. Arch Biochem Biophys 396: 8088, 2001.[CrossRef][Web of Science][Medline]
48. Pestov NB, Romanova LG, Korneenko TV, Egorov MV, Kostina MB, Sverdlov VE, Askari A, Shakhparonov MI, and Modyanov NN. Ouabain-sensitive H,K-ATPase: tissue-specific expression of the mammalian genes encoding the catalytic
subunit. FEBS Lett 440: 320324, 1998.[CrossRef][Web of Science][Medline]
49. Rajendran VM, Singh SK, Geibel J, and Binder HJ. Differential localization of colonic H+-K+-ATPase isoforms in surface and crypt cells. Am J Physiol Gastrointest Liver Physiol 274: G424G429, 1998.
50. Reinhardt J, Grishin AV, Oberleithner H, and Caplan MJ. Differential localization of human nongastric H-K-ATPase ATP1AL1 in polarized renal epithelial cells. Am J Physiol Renal Physiol 279: F417F425, 2000.
51. Rucklidge GJ, Milne G, Chaudhry SM, and Robins SP. Preparation of biotinylated, affinity-purified antibodies for enzyme-linked immunoassays using blotting membrane as an antigen support. Anal Biochem 243: 158164, 1996.[CrossRef][Web of Science][Medline]
52. Sangan P, Kolla SS, Rajendran VM, Kashgarian M, and Binder HJ. Colonic H-K-ATPase
-subunit: identification in apical membranes and regulation by dietary K depletion. Am J Physiol Cell Physiol 276: C350C360, 1999.
53. Shin JM, Besançon M, Bamberg K, and Sachs G. Structural aspects of the gastric H,K ATPase. Ann NY Acad Sci 834: 6576, 1997.[Web of Science][Medline]
54. Sweadner KJ, Arystarkhova E, Donnet C, and Wetzel RK. FXYD proteins as regulators of the Na,K-ATPase in the kidney. Ann NY Acad Sci 986: 382387, 2003.[Web of Science][Medline]
55. Sweadner KJ and Donnet C. Structural similarities of Na,K-ATPase and SERCA, the Ca2+-ATPase of the sarcoplasmic reticulum. Biochem J 356: 685704, 2001.[CrossRef][Web of Science][Medline]
56. Takeyasu K, Tamkun MM, Renaud KJ, and Fambrough DM. Ouabain-sensitive (Na++K+)-ATPase activity expressed in mouse Ltk cell by transfection with DNA encoding
-subunit of an avian sodium pump. J Biol Chem 263: 43474354, 1988.
57. Thangarajah H, Wong A, Chow DC, Crothers JM Jr, and Forte JG. Gastric H-K-ATPase and acid-resistant surface proteins. Am J Physiol Gastrointest Liver Physiol 282: G953G961, 2002.
58. Verlander JW, Moudy RM, Campbell WG, Cain BD, and Wingo CS. Immunohistochemical localization of H-K-ATPase
2c-subunit in rabbit kidney. Am J Physiol Renal Physiol 281: F357F365, 2001.
59. Wang J, Schwinger RH, Frank K, Muller-Ehmsen J, Martín-Vasallo P, Pressley TA, Xiang A, Erdmann E, and McDonough AA. Regional expression of sodium pump subunits isoforms and Na+-Ca++ exchanger in the human heart. J Clin Invest 98: 16501658, 1996.[Web of Science][Medline]
60. Wilson PD, Devuyst O, Li X, Gatti L, Falkenstein D, Robinson S, Fambrough D, and Burrow CR. Apical plasma membrane mispolarization of NaK-ATPase in polycystic kidney disease epithelia is associated with aberrant expression of the
2 isoform. Am J Pathol 156: 253268, 2000.
This article has been cited by other articles:
![]() |
T. Shibata, H. Hibino, K. Doi, T. Suzuki, Y. Hisa, and Y. Kurachi Gastric type H+,K+-ATPase in the cochlear lateral wall is critically involved in formation of the endocochlear potential Am J Physiol Cell Physiol, November 1, 2006; 291(5): C1038 - C1048. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. B. Pestov, T. V. Korneenko, M. I. Shakhparonov, G. E. Shull, and N. N. Modyanov Loss of acidification of anterior prostate fluids in Atp12a-null mutant mice indicates that nongastric H-K-ATPase functions as proton pump in vivo Am J Physiol Cell Physiol, August 1, 2006; 291(2): C366 - C374. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |