Am J Physiol Cell Physiol Watch the video to see how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 286: C1229-C1237, 2004. First published January 28, 2004; doi:10.1152/ajpcell.00393.2003
0363-6143/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/6/C1229    most recent
00393.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pestov, N. B.
Right arrow Articles by Modyanov, N. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pestov, N. B.
Right arrow Articles by Modyanov, N. N.

MEMBRANE TRANSPORTERS, ION CHANNELS, AND PUMPS

Identification of the {beta}-subunit for nongastric H-K-ATPase in rat anterior prostate

Nikolay B. Pestov,1,2 Tatyana V. Korneenko,1,2 Rossen Radkov,1 Hao Zhao,1 Mikhail I. Shakhparonov,2 and Nikolai N. Modyanov1

1Department of Pharmacology, Medical College of Ohio, Toledo, Ohio 43614; and 2Shemyakin and Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences, Moscow 117871, Russia

Submitted 15 September 2003 ; accepted in final form 26 January 2004


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The structural organization of nongastric H-K-ATPase, unlike that of closely related Na-K-ATPase and gastric H-K-ATPase, is not well characterized. Recently, we demonstrated that nongastric H-K-ATPase {alpha}-subunit ({alpha}ng) is expressed in apical membranes of rodent prostate. Its highest level, as well as relative abundance, with respect to {alpha}1-isoform of Na-K-ATPase, was observed in anterior lobe. Here, we aimed to determine the subunit composition of nongastric H-K-ATPase through the detailed analysis of the expression of all known X-K-ATPase {beta}-subunits in rat anterior prostate (AP). RT-PCR detects transcripts of {beta}-subunits of Na-K-ATPase only. Measurement of absolute protein content of these three {beta}-subunit isoforms, with the use of quantitative Western blotting of AP membrane proteins, indicates that the abundance order is {beta}1 > {beta}3 >> {beta}2. Immunohistochemical experiments demonstrate that {beta}1 is present predominantly in apical membranes, coinciding with {alpha}ng, whereas {beta}3 is localized in the basolateral compartment, coinciding with {alpha}1. This is the first direct demonstration of the {alpha}ng-{beta}1 colocalization in situ indicating that, in rat AP, {alpha}ng associates only with {beta}1. The existence of {alpha}ng-{beta}1 complex has been confirmed by immunoprecipitation experiments. These results indicate that {beta}1-isoform functions as the authentic subunit of Na-K-ATPase and nongastric H-K-ATPase. Putatively, the intracellular polarization of X-K-ATPase isoforms depends on interaction with other proteins.

ATP1AL1; ATP12A; ATP1B1; X-potassium-adenosine triphosphatase; hydrogen-potassium-adenosine triphosphatase; sodium-potassium-adenosine triphosphatase; male accessory glands; potassium transport


NONGASTRIC H-K-ATPASE IS A member of the X-K-ATPase family that also includes Na-K-ATPase and gastric H-K-ATPase. X-K-ATPases are the most closely related among the various P-ATPases (1, 8, 29, 30, 41, 55). These ion pumps are located in plasma membranes and function as cation pumps that transport K+ into the cell in exchange for Na+ and/or H+. Catalytic {alpha}-subunits of X-K-ATPases are large polytopic proteins (~100 kDa) that perform ATP hydrolysis and ion translocation. Six isoforms of these subunits can be classified into three groups: Na-K-ATPase ({alpha}1, {alpha}2, {alpha}3, {alpha}4), gastric H-K-ATPase ({alpha}g), and nongastric H-K-ATPase ({alpha}ng); all of the three groups are equally related to each other in terms of structure (~64% identical amino acid residues) (29, 30). The domain architecture of all X-K-ATPase {alpha}-subunits is thought to share essential elements of well-defined molecular structure of sarcoplasmic reticulum Ca-ATPase (55). However, X-K-ATPases are unique with respect to quaternary structure because they are the only animal P-ATPases that contain a second component, glycosylated {beta}-subunit of ~35 kDa, which has no analogs among subunits of other P-ATPases (1, 8, 13, 24, 30).

The {beta}-subunit plays a crucial role in the structural and functional maturation of the functionally active X-K-ATPase molecule (13, 20, 24) and modulation of the enzymes' affinities for cations (13, 20, 24). Five closely related genes encoding {beta}-subunits have been identified in mammals encoding three Na-K-ATPase {beta}-isoforms ({beta}1, {beta}2, {beta}3), gastric H-K-ATPase {beta}-subunit ({beta}g), and muscle-specific ({beta}m) protein. All five members of the family share a common transmembrane structure of type II membrane proteins but exhibit a much lower degree of sequence similarity (~32–48%) than {alpha}-subunits (13, 24, 44).

An important issue is the tissue specificity of expression of these genes, suggesting that the existence of multiple X-K-ATPase isoforms is not a consequence of a redundant gene duplication but a means to finely tune the specific features of ion homeostasis in various cell types. Indeed, there is a substantial variability of expression level of all subunits and hence a significant variability of different isoform combinations. The {alpha}1-{beta}1 complex is a ubiquitous one but has a rather variable level of expression, being especially abundant in brain and in some ion-transporting tissues like kidney. Particular combinations are characteristic for some tissues: {alpha}3{beta}1 for neurons, {alpha}3{beta}2 for retina, {alpha}2{beta}2 for glia, and {alpha}1{beta}2 for stria vascularis of the inner ear. Some other subunits have a very strict tissue specificity: {alpha}4, only in male germ cells; {beta}m, only in striated muscle; {alpha}g and {beta}g, primarily in parietal cells of stomach mucosa [there are also reports on detection of gastric H-K-ATPase subunits in kidney (3) (conflicting with Ref. 11), epididymis (4), inner ear and choroid plexus (36), and heart (7, 47)]. The {beta}3 is expressed in many tissues at relatively low levels, being somewhat more abundant in lung, testis, adrenal, brain, and colon (5, 8, 24, 47).

The catalytic {alpha}ng is encoded by gene ATP12A (alternative name ATP1AL1). Mammalian ATP12A genes have been known for a long time to be expressed in distal colon, skin, and kidney (30, 48). A broad screening of tissues has revealed that the gene is also expressed in other tissues, like preputial gland (rat) and placenta (human) (48) and, at the highest level, in rodent prostate (46), especially in the anterior lobe. The cellular location of {alpha}ng in prostate epithelium, distal colon, and kidney was shown to be the apical membranes (23, 33, 46, 49, 58).

Unlike long-known and extensively studied Na-K-ATPase and gastric H-K-ATPase (8, 53), the nongastric H-K-ATPase is not yet sufficiently characterized with respect to structural organization and functional properties. For many years, it remained unclear whether one of the known {beta}-subunits or a hitherto unidentified member of the X-K-ATPase {beta}-subunit family is the authentic subunit of nongastric H-K-ATPase. No unique {beta}-subunit specific only for nongastric H-K-ATPase has been identified, despite intense efforts of our group and others. Published experimental data on this subject were controversial, and it was not clear whether one or several isoforms can function as the {beta}-subunit for nongastric H-K-ATPase. For rat distal colon and kidney, it was reported to be either {beta}1 (14, 34) or, in sharp contrast, {beta}3 (52). On the other hand, in heterologous expression systems, the functional expression of nongastric H-K-ATPase can be supported by various X-K-ATPase {beta}-subunit isoforms (1, 2, 6, 15, 18, 21, 24, 27, 30, 31, 40).

In studies reported here, we took advantage of anterior prostate (AP) as the richest source of {alpha}ng (46) and have aimed to determine the subunit composition of nongastric H-K-ATPase through the detailed analysis of the expression of all known X-K-ATPase {beta}-subunits in rodent prostate complex. Our findings provide strong evidence that, in rat AP epithelium, X-K-ATPase {beta}1-isoform serves as an authentic subunit of nongastric H-K-ATPase, assembling preferentially with {alpha}ng, whereas {beta}3 appears to be selective for Na-K-ATPase {alpha}-subunit. A preliminary account of this work has been presented (40).


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animals and tissues. Male Sprague-Dawley rats (60–90 days old) were killed by CO2 inhalation, and APs (coagulating glands) were dissected as soon as possible.

RT-PCR and cDNA cloning. Conditions of RT-PCR and primer sequences for tissue expression studies for {beta}1, {beta}2, and {beta}3 were essentially as described before (46, 48). Primers used for {beta}g were GFBE (gcrtctatgtgctgatgcag) and GBBE (gaggaacttgacgatcctgttc). Agarose gels were stained with ethidium bromide and imaged with the help of a Typhoon 8600 laser scanner (Amersham Pharmacia, Piscataway, NJ).

To produce recombinant ectodomains of rat {beta}-subunits, the following primers were used: RB1-F (gcttagatctagtgagctgaaacccacgt) and RB1-B (cttgtgattagctcttaacttca) for {beta}1; RB2-F (gctgagatctgtctctgaccatacccccaag) and RB2-B (aaggaagcttaggctttgttgattcgaagc) for {beta}2; and RB3-F (gctcagatctctgaatgacgaggttc) and RB3-B (agacaagcttctcttaggcatgtgctatgact) for {beta}3. The fragments were amplified from rat brain cDNA, digested with BglII and HindIII (except for {beta}1), and cloned at BamHI/HindIII sites of pQE30 expression vector (Qiagen, Valencia, CA). The {beta}1 fragment was blunted with T4 DNA polymerase, digested with BglII, and cloned at BamHI/SmaI sites of the pQE vector.

Antibodies. Recombinant protein expression in Escherichia coli, purification by immobilized metal affinity chromatography, and immunization of rabbits were achieved essentially as described before (45). Antibodies were affinity purified by using the antigens absorbed on polyvinylidene difluoride membrane, according to the method of Rucklidge et al. (51).

Mouse monoclonal antibody {alpha}6F against {alpha}1 (56) was obtained from the Developmental Studies Hybridoma Bank (Iowa City, IA). Rabbit polyclonal antibodies against {alpha}ng have been described before (46). Monoclonal antibody against gastric H-K-ATPase {beta}-subunit was purchased from Affinity Bioreagents (Golden, CO). Monoclonal antibodies IEC 1/48 (37) and MAb 13 against {beta}1 and 3PE anti-human {beta}3 (12) were generous gifts from Andrea Quaroni, Michael J. Caplan, and Watchara Kasinrerk. Mouse monoclonal antibodies F10 against rat {beta}3 and 2C8 against secretory pathway Ca-ATPase were from Ruslan Dmitriev (unpublished observations). Rabbit polyclonal antibodies against human {beta}1, {beta}2, and {beta}3 ectodomains (59) and antibodies against NH2 terminus of rat {beta}3 (5) were kindly provided by Pablo Martin-Vasallo and by Kathleen J. Sweadner.

Immunohistochemistry. Tissues were frozen in isopentane/liquid nitrogen and cut at 10-µm thickness. The sections were incubated in 5:3 methanol-acetone at –15°C for 30 min, air dried, and stored. The sections were treated with chloroform for 5 min at room temperature, air dried, incubated with 5% pig serum in PBS, and then immunolabeled by subsequent incubations with primary antibodies and anti-host antibodies conjugated with either Alexa Fluor-498 or Alexa Fluor-594 (Molecular Probes, Eugene, OR). For peroxidase fluorescent labeling, the sections were incubated with 3% hydrogen peroxide in PBS for 1 h, anti-guinea pig peroxidase-conjugated antibodies (Sigma), and tyramide-595 substrate (Molecular Probes). Labeled sections were mounted in SlowFade (Molecular Probes). To label nuclei, 100,000x SYBR Gold (Molecular Probes) or 0.5 µg/ml ethidium bromide plus 10 µg/ml RNase A were added to the mounting medium. Images were collected by using a Nikon Optiphot-2 fluorescent microscope equipped with a SPOT digital camera (Diagnostic Instruments, Sterling Heights, MI) with automatic exposure control. Confocal images were obtained by using an Olympus fluorescent microscope equipped with Radiance XR laser scanning head (Bio-Rad, Hercules, CA).

Preparation of membranes and deglycosylation. Membranes were prepared from rat prostate essentially as described before (46). For deglycosylation, the membranes were incubated for 1 h at 37°C in 0.05 M sodium phosphate, pH 7.4, 0.2% SDS, 2% octyl glucoside, 100 mM dithiothreitol (DTT), 1:50 protease inhibitor cocktail (Sigma), and 5 U/µg peptide N-glycosidase F (New England Biolabs). Treatment with endoglycosidase H (Endo Hf; New England Biolabs) was performed in the same conditions, except that 0.05 M sodium citrate (pH 5.5) were substituted for sodium phosphate.

Immunoprecipitation. Membrane suspension (100 µl, 200 µg protein) in 10 mM HEPES-Na, pH 7.0, 5 mM Na-EDTA, and 0.25 M sucrose was kept on ice, diluted with water 1:1, and made subsequently 0.3 M NaCl, 0.1% {beta}-mercaptoethanol, 1% 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate (CHAPS) (crystallized from methanol), and 0.02% benzyldimethylhexadecylammonium chloride (Sigma; from 2% solution kept at 50°C before use). The membranes were incubated with 1 µl ascites on a rotary mixer for 8 h at 4°C and centrifuged for 10 min at 16,000 g. The supernatant was diluted 1:1 with PBS and incubated with 3 µl protein A/G agarose (Novagene, Madison, WI) for 2 h at 4°C. The sorbent was spinned down and washed with PBS containing 0.2% CHAPS. The bound proteins were eluted by incubation for 5 min at 70°C in a modified electrophoresis sample-loading buffer (5% SDS, 8 M urea, 100 mM DTT, 25 mM glycylglycine, 100 mM Tris·HCl, pH 6.8, 2% {beta}-mercaptoethanol, 1 mM Na-EDTA, 2 mM benzamidine, 1:200 protease inhibitor cocktail) before analysis by Western blotting.

Western blotting. Membranes were dissolved in the SDS sample loading buffer, and protein concentration was measured by a modification of the Bradford procedure that includes coprecipitation of proteins with calcium phosphate (43). Proteins (10 µg per well, or 1:10 of immunoprecipitates) were electrophoresed in polyacrylamide gels (12% for analysis of {beta}-subunits, 8% for {alpha}-subunits) and blotted onto polyvinylidene difluoride membrane (Amersham-Pharmacia). The membrane was washed in methanol and stained in 50% methanol, 1% acetic acid, and 0.03% Coomassie brilliant blue G-250 followed by washes with 50% methanol. Then the membrane was cut and destained in methanol, followed by washing with 50% methanol. The membrane was incubated in 50 mM Tris, pH 6.8, 100 mM mercaptoethanol, and 2% SDS for 15 min at room temperature; blocked in Tris-buffered saline containing 0.1% Tween-20 and 5% nonfat milk; and incubated with primary antibodies and then with peroxidase-conjugated anti-rabbit antibodies (Zymed) or peroxidase-conjugated anti-guinea pig antibodies (Sigma) for 1 h each with thorough washes in Tris-buffered saline, containing 0.1% Tween-20, between incubations. The immunoblots were visualized with a chemiluminescent substrate (ECL+Plus, Amersham Pharmacia). For quantitative determination, series of standard protein dilutions were prepared in SDS sample loading buffer supplemented with 100 mM DTT and run in parallel. Densitometry of the immunoblot films was performed by using a Bio-Rad model GS-690 imaging densitometer and Molecular Analyst software (Bio-Rad Laboratories).


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Analysis of lobe-specific expression of the X-K-ATPase {beta}-subunits in rat prostate. Figure 1 illustrates results of RT-PCR detection of four different X-K-ATPase {beta}-subunits in lobes of rat prostate, as well as in some other male accessory glands that were not studied before. Transcripts of all known Na-K-ATPase {beta}-subunits ({beta}1, {beta}2, and {beta}3) are readily detectable, whereas no signal can be observed in the case of {beta}g. The absence of {beta}m in these glands has been reported before (44). Considering the number of cycles, it appears that {beta}1 transcripts are more abundant than {beta}2 or {beta}3 in all tissues studied, and {beta}3 is more abundant than {beta}2. The expression levels of {beta}2 and {beta}3 are very similar between the tissues studied. In contrast, {beta}1 transcripts are more abundant in ventral and anterior lobes of the prostate than in dorsal and lateral lobes. Of note also is the fact that the preputial gland has a remarkably lower level of {beta}1 than other tissues.



View larger version (54K):
[in this window]
[in a new window]
 
Fig. 1. RT-PCR analysis of lobe-specific expression of X-K-ATPase {beta}-subunit isoforms in rat prostate. No. of cycles used are indicated on the right. {beta}1, {beta}2, and {beta}3: amplification products of mRNAs of Na-K-ATPase {beta}1-, {beta}2-, and {beta}3-isoforms, respectively; {beta}g, amplification products of the gastric H-K-ATPase {beta} mRNA; control, rat brain cDNA for {beta}1, {beta}2, and {beta}3 and rat stomach cDNA for {beta}g; VP, ventral prostate; LP, lateral prostate; DP, dorsal prostate; AP, anterior prostate; PG, preputial gland; AG, ampullary gland; SV, seminal vesicles.

 
Detection of X-K-ATPase {beta}-subunits in rat prostate membranes by Western blotting. Initial experiments on immunochemical detection of {beta}-subunit proteins by Western blotting of rat AP using available rabbit antibodies against ectodomains of human {beta}1, {beta}2, and {beta}3 showed that antibodies against {beta}1 and {beta}2 are suitable for this purpose, whereas anti-human {beta}3 produced no specific bands (Fig. 2A). Antibodies against a synthetic peptide comprising an NH2-terminal fragment of rat {beta}3 (5), on the other hand, produced a strong band of ~38 kDa that showed no shift on deglycosylation, probably representing a nonspecific interaction with a prostate-specific protein (results not shown). To improve the method of detection, we have expressed recombinant proteins comprising rat {beta}1, {beta}2, and {beta}3 ectodomains NH2-terminally fused with the hexahistidine tag (Fig. 3) and obtained rabbit and guinea pig polyclonal antibodies against them. For unknown reasons, rabbits produced better anti-{beta}1 antibodies, whereas guinea pigs produced better anti-{beta}3. Anti-rat {beta}2 antibodies from both species were of insufficient quality (results not shown), and, therefore, anti-human {beta}2 rabbit polyclonal antibodies developed by Pablo Martin-Vasallo were used. Crude sera can be successfully used for the detection of deglycosylated {beta}-subunits (as shown for {beta}3 in Fig. 2B), whereas detection sensitivity of the glyco forms was not suitable because of band smearing. Both {beta}1 and {beta}2 core proteins (after removal of N-glycans by glycopeptidase F) from AP have electrophoretic mobilities corresponding to apparent molecular masses slightly higher than the predicted values. The {beta}3 has a significantly higher apparent molecular mass (36 kDa instead of theoretical 32 kDa). The same behavior of rat {beta}3 was observed previously in many different tissues (5) but is difficult to understand because {beta}3 sequence lacks unusual features. All recombinant {beta}-subunit ectodomains have apparent molecular masses somewhat larger than expected (33.9 vs. 29.8 kDa for {beta}1 and 30.7 vs. 27.1 kDa for {beta}2), but, in the case of {beta}3, this effect is much more significant (31.5 vs. 25.8 kDa). Because the ectodomain comprises the majority of the molecule's mass, it is clear that abnormally apparent molecular mass of rat {beta}3 core protein from native membranes can be fully explained by the abnormal mobility of its ectodomain.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 2. Immunoblotting of membrane proteins from rat AP with antibodies against X-K-ATPase {beta}1-, {beta}2-, and {beta}3-subunits. A: immunoblotting with rabbit antibodies against recombinant ectodomains of human {beta}-subunit isoforms {beta}1, {beta}2, and {beta}3 (59). B: immunoblotting with guinea pig antibodies against recombinant protein comprising ectodomain of rat {beta}3-isoform. PNGase F, peptide N-glycosidase F.

 


View larger version (92K):
[in this window]
[in a new window]
 
Fig. 3. Electrophoretic analysis of recombinant proteins comprising ectodomains of rat Na-K-ATPase {beta}-subunit isoforms. Lane 1, molecular mass standards; lane 2, {beta}1; lane 3, {beta}2; lane 4, {beta}3; lane 5, mouse muscle-specific protein ({beta}m).

 
Concentrations of different isoforms of {beta}-subunits in microsomes from AP and several other tissues were measured by quantitative Western blotting by using known quantities of recombinant proteins as standards (Table 1). The {beta}1 in most tissues and {beta}2 in brain are easy to determine due to relatively high content. The {beta}3 has a somewhat lower expression level, whereas {beta}2 in AP has a very low level, which is sufficient for qualitative detection (Fig. 2A) but not for accurate quantitative measurements. For this reason, the data for {beta}2 are presented as an upper threshold. It was of interest to check if our determinations give correct, unbiased values. The contents of {beta}1- and {beta}2-subunits in rat brain microsomes were determined previously as 227 ± 23 and 151 ± 32 pmol/mg for {beta}1 and {beta}2, respectively, by Lavoie et al. (35). These values are 1.5 and 1.2 times higher than ours for {beta}1 and {beta}2, respectively. In fact, this difference seems to be very little and could be explained by variations in experimental procedures. Because {beta}1 has a 2.5-fold higher level than {beta}3, it is reasonable to hypothesize that {beta}1 is the predominant isoform in nongastric H-K-ATPase.


View this table:
[in this window]
[in a new window]
 
Table 1. Quantification of {beta}-subunit proteins

 
If {beta}1 is the real partner of {alpha}ng, then may {beta}1 from AP or any of the other prostate lobes be different from that in tissues studied previously? May the {beta}1-isoform interacting with {alpha}ng be a product of alternative splicing or have different modifications, for example, N-glycosylation? This possibility was tested by treatment with glycopeptidase F or endoglycosidase H, the latter being active mostly against high-mannose chains. Figure 4 presents results of such an analysis and demonstrates that {beta}1 from AP as well as from other {alpha}ng-containing lobes (47) is glycosylated to a similar extent as the reference {beta}1 of kidney, and the amount of high-mannose sugars is negligible. The electrophoretic mobilities of core {beta}1 proteins from kidney and AP are equal. Very surprisingly, {beta}1 from ventral prostate was found to have a different N-glycosylation pattern: the amount of sugars is obviously lower, and significant sensitivity to endoglycosidase H indicates that {beta}1 in ventral prostate has high-mannose chains. In contrast to the distal colon, where the existence of unusual peptide N-glycosidase F-resistant N-glycans in the {beta}1 associated with {alpha}ng has been suggested (14), we did not observe any unusual or unexpected features of {beta}1.



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 4. Immunoblotting of membrane proteins from different lobes of rat prostate with antibodies against X-K-ATPase {beta}1-subunit. Affinity-purified rabbit polyclonal antibodies against recombinant ectodomain of rat {beta}1 were used.

 
Immunohistochemical localization of the X-K-ATPase {beta}-subunits in rat AP. In agreement with a previous report (46), anti-{alpha}1 antibodies produce basolateral labeling, and anti-{alpha}ng antibodies label apical membranes (Fig. 5A). Affinity-purified polyclonal anti-{beta}1 antibodies and monoclonal antibody MAb 13 against dog {beta}1 showed weak labeling of apical and none of basolateral membranes (Fig. 5, B and C). However, another anti-{beta}1 monoclonal antibody, IEC 1/48 (37), known for its high-detection sensitivity in immunochemical experiments, produced a very bright labeling of apical membranes and a weak labeling of the basolateral compartment (Fig. 5, DF). Anti-{beta}3 antibodies produced a weak basolateral labeling. Its intensity was increased by the use of tyramide fluorogenic substrate (Fig. 5G). No significant labeling of apical membranes with anti-{beta}3 antibodies was observed. Anti-{beta}2 antibodies did not produce any significant labeling above nonspecific background (results not shown).



View larger version (116K):
[in this window]
[in a new window]
 
Fig. 5. Immunohistochemical detection of {alpha}- and {beta}-subunit isoforms of X-K-ATPases in rat AP. A: double labeling with rabbit anti-nongastric H-K-ATPase subunit ({alpha}ng) antibodies (red) and mouse monoclonal anti-{alpha}1 (green). B: labeling with anti-{beta}1 monoclonal antibody 13 (red). C: labeling with anti-{beta}1 affinity-purified polyclonal rabbit antibodies with tyramide-488 (green). D–F: labeling with anti-{beta}1 monoclonal antibody IEC 1/48 (red). F: false color image of red fluorescence in E (increasing intensity form the bottom to the top, according to the look-up table). G: labeling with anti-{beta}3 affinity-purified rabbit polyclonal antibodies and tyramide-595 (red). HJ: colocalization of {alpha}ng (rabbit antibodies, red fluorescence) and {beta}1 (IEC 1/48, green fluorescence). KM: colocalization of {beta}3 (guinea pig antibodies, tyramide-595, red fluorescence) and {alpha}1 ({alpha}6F monoclonal antibody, green fluorescence). A, B, and DM: confocal images; C: conventional microscope images. A, B, D, E, and G: nuclei stained in green with SYBR Gold; C: nuclei stained in red with ethidium bromide. Bars: 20 µm (A, C, and D) and 10 µm (B and EM).

 
Thus it is obvious that {beta}3 is polarized laterally, whereas {beta}1 is polarized mostly apically with detectable levels in basolateral membranes. On the basis of these data, it is possible to conclude that the {alpha}ng-{beta}1 pair is transported to the apical side, whereas both {alpha}1-{beta}1 and {alpha}1-{beta}3 are transported to basolateral membranes. Importantly, these results demonstrate that, in AP epithelial cells, {alpha}ng binds {beta}1 preferentially and does not associate with {beta}3. These conclusions are confirmed by double-labeling experiments ({alpha}ng + {beta}1 in Fig. 5, HJ, and {alpha}1 + {beta}3 in Fig. 5, KM).

Immunoprecipitation. Interestingly, both nongastric H-K-ATPase and Na-K-ATPase in AP membranes are resistant to solubilization under mild conditions with common nonionic or zwitterionic detergents, such as C12E8, digitonin, octyl glucoside, Triton X-100, CHAPS, myristyl sulfobetaine, etc. (results not shown). Such a phenomenon may be explained by a strong interaction of membrane proteins with cytoskeleton. The resistance to mild solubilization creates a strong obstacle against successful immunoprecipitation of the ATPases for direct demonstration of particular {alpha}{beta} interactions. We were not able to immunoprecipitate {alpha}ng according to Codina et al. (14) or {beta}1 according to Marxer et al. (37) by reproducing previously used conditions for distal colon membranes (CHAPS or Triton X-100) (results not shown). Here it should be stressed that the intersubunit interactions in X-K-ATPases are not very strong in solubilized form, for example, {gamma}-subunit retains in the complex solubilized with CHAPS and separates even in nonionic detergents, such as 1% octyl glucoside or Triton X-100 (38). It is impossible to use harsh solubilization conditions (e.g., SDS). For this reason, we tried to use mixtures of ionic detergents with nonionic or zwitterionic ones, as previously found excellent for immunoaffinity chromatography (32). As expected, additions of some ionic detergents improve solubilization, especially in the presence of salt (Fig. 6). However, the immunoprecipitation requires not only solubilization but also preservation of the interactions between the subunits, antigen-antibody, and immunoglobulin-protein A/G. For this reason, we canceled attempts for step-by-step optimization and performed a screening for the precipitation conditions using simultaneous solubilization and antibody binding (results not shown). It was found that a significant part of {alpha}ng can be co-immunoprecipitated by anti-{beta}1 monoclonal antibody IEC 1/48 by using CHAPS supplemented with salt and a low concentration of benzyldimethylhexadecylammonium chloride, a cationic detergent. A significant portion of the total nongastric H-K-ATPase {alpha}-subunit has been detected in the fraction precipitated with anti-{beta}1 monoclonal antibody IEC 1/48 (Fig. 7A). These results directly demonstrate that {alpha}ng is capable of interacting with {beta}1 in the AP membranes.



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 6. Solubilization of nongastric H-K-ATPase and Na-K-ATPase from rat AP membranes with 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate (CHAPS) supplemented with other detergents and salt. The membranes were treated for 2 h at 0°C with detergents and salts indicated below and centrifuged for 15 min at 16,000 g, and then supernatants were immunoblotted with anti-{alpha}ng rabbit polyclonal antibodies (top; {alpha}ng) or anti-Na-K-ATPase {alpha}-subunit rabbit polyclonal antibodies (bottom; {alpha} Na-K). 16-BAC, benzyldimethylhexadecylammonium chloride; DC, sodium deoxycholate; LS, sodium laurylsarcosine.

 


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 7. Co-immunoprecipitation of {alpha}ng from rat AP membranes with monoclonal antibody against {beta}1. A: immunoprecipitation of {alpha}ng with monoclonal antibodies using simultaneous solubilization by CHAPS/16-BAC/NaCl as described in MATERIALS AND METHODS. Lane 1, AP membranes; lane 2, anti-{beta}g; lane 3, anti-{alpha}1 ({alpha}6F); lane 4, anti-{beta}1 (IEC 1/48); lane 5, anti-rat {beta}3 (F10); lane 6, anti-human {beta}3 (3PE). *Reaction of secondary antibodies with the antibodies used for the immunoprecipitation. B: comparison of efficiency of co-immunoprecipitation of {alpha}ng and Na-K-ATPase {alpha}-subunit by anti-{beta}1 monoclonal antibody IEC 1/48. Equal parts of immunoprecipitates (P) and remaining solubilizates (S) were analyzed by Western blotting with rabbit polyclonal antibodies against {alpha}ng (top) or Na-K-ATPase {alpha}-subunit (bottom; {alpha} Na-K). Lanes 1 and 2, anti-{beta}1 (IEC 1/48), remaining solubilizate (S), and resulting precipitate (P), respectively; lanes 3 and 4, negative control [solubilizate (S) and precipitate (P) with an unrelated monoclonal antibody 2C8]. Note that a long exposure was used to detect {alpha} Na-K in the immunoprecipitate.

 
A comparison of the signal intensities in the solubilizates and eluates indicates that the anti-{beta}1 antibody precipitates {alpha}ng much more efficiently than Na-K-ATPase {alpha}-subunit (Fig. 7B). This may be interpreted either as that {beta}1 is initially associated with {alpha}ng predominantly or that the affinity of the {beta}1-{alpha}ng interaction is higher than that of {beta}1-{alpha}1. The first explanation is in line with immunohistochemical data and strongly suggests that {beta}1 associates primarily with {alpha}ng and, to a much lesser extent, with {alpha}1. These results also provide indirect evidence that {alpha}1 is complexed mainly with {beta}3.


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
AP has three Na-K-ATPase {beta}-subunit isoforms in the apparent order of their abundance {beta}1 > {beta}3 > {beta}2, whereas other X-K-ATPase {beta}-subunits are absent. No new {beta}-subunit can exist because of the lack of any new genes in sequenced mammalian genomes. Also, both {beta}m and {beta}g transcripts are absent in the rat prostate. For these reasons, the search for authentic nongastric H-K-ATPase {beta}-subunit can be narrowed to three candidates: {beta}1, {beta}2, and {beta}3. Results of immunological detection of different {beta}-subunit isoforms by Western blotting of AP membranes indicate that {beta}1 is the most abundant isoform. Content of {beta}1 is higher than {beta}3, and this indirectly indicates that {beta}1 is more likely than {beta}3 to be the predominant isoform of nongastric H-K-ATPase. Compared with {beta}1- and {beta}3-, {beta}2-isoform has a very low content, and its participation may be dismissed from consideration. The most interesting result was the comparison of immunohistochemical labeling of AP epithelium, which demonstrates that {beta}1 is localized predominantly apically, whereas {beta}3 is limited to basolateral membranes. These observations demonstrate directly that association of {alpha}ng with {beta}3 does not occur in AP cells and suggest that, in these cells, nongastric H-K-ATPase exists as {alpha}ng-{beta}1 complex, whereas Na-K-ATPase may consist of both {alpha}1-{beta}1 and {alpha}1-{beta}3 complexes. Importantly, results of co-immunoprecipitation of {alpha}ng and {alpha}1 with anti-{beta}1 antibodies support these conclusions.

Thus our findings provide strong evidence that X-K-ATPase {beta}1-subunit is not only a subunit of the Na-K-ATPase, but also serves as an authentic subunit of nongastric H-K-ATPase, a real counterpart of the {alpha}ng in apical membrane of rat AP epithelium. In these cells, a much higher portion of {beta}1 appears to be associated with {alpha}ng than that with {alpha}1.

Our data resolve the previous contradictions on which {beta}-subunit may be the authentic one in case of nongastric H-K-ATPase. Previously, {beta}1 antibodies were shown to recognize a protein in immunoprecipitate of {alpha}ng from solubilized rat distal colon membranes (14) and in rat kidney membrane vesicles from immunoaffinity isolated with {alpha}ng antibodies (34). The strongest argument for {beta}3 was that it is detected in apical membranes from rat distal colon (52). It should be noted that the detection of association with one isoform could not rule out the possibility of association with others. Hence the question remained open: whether {beta}1 (14, 34) or {beta}3 (52) is characteristic for the nongastric H-K-ATPase or {alpha}ng can associate with any {beta}-subunit isoform nonselectively. Our data provide strong evidence that {alpha}ng{beta}1 exists in AP and, more importantly, that there is a significant selectivity of {alpha}{beta}-subunit interactions. Indeed, association between {alpha}ng and {beta}3 does not occur in AP. On the other hand, it is impossible to completely exclude the possibility that a minor portion of {alpha}ng may be associated with {beta}-subunits other than {beta}1, especially in tissues different from AP.

Interestingly, although our results indicate that, in vivo, there is a strong selectivity of subunit interactions between {alpha}ng and {beta}-subunits, the situation in vitro is more complicated. The {alpha}ng protein has been coexpressed in various heterologous systems, together with different X-K-ATPase {beta}-subunits (1, 2, 6, 15, 17, 18, 21, 24, 2628, 30, 31, 39, 50). These studies demonstrated that several X-K-ATPase {beta}-subunits, including the {beta}1 (6, 15, 21), the analog of mammalian {beta}2 from Bufo bladder (18, 21), Torpedo Na-K-ATPase {beta} (6), as well as the {beta}g (1, 15, 21, 24, 27, 30, 31, 39), can support proper folding of {alpha}ng and formation of functionally active nongastric H-K-ATPases. However, detailed comparison of the capability of each of the known X-K-ATPase {beta}-subunits to form a functionally active ATPase complex with the {alpha}ng on coexpression in Xenopus oocytes revealed that {beta}g and {beta}2-like Bufo bladder {beta} are able to associate with {alpha}ng much more efficiently than its real counterpart, {beta}1 (21, 26). Formation of the active ATPase complex of {alpha}ng with {beta}g, but not with {beta}1 or {beta}3, was observed in baculovirus expression system (1, 2). It is logical to assume that the phenomenon of preferential association of the {alpha}ng with {beta}g and Bufo bladder {beta} in heterologous expression systems is based on intrinsic structural features of these particular {beta}-subunits, which are designed by nature to resist the harsh environmental conditions in mammalian stomach or in frog urinary bladder and, therefore, exhibit a greater ability to survive in heterologous expression systems. Native {beta}g was found to be much less susceptible to digestion with trypsin and other proteases than the native {beta}1 (57). Therefore, one can suggest that heavy glycosylation [seven or eight N-linked carbohydrate chains in {beta}g and Bufo bladder {beta} vs. three oligosaccharides in {beta}1 (13)] is an essential feature determining more efficient formation of the recombinant {alpha}ng-{beta} complexes.

The relatively weak association of {alpha}ng with its authentic counterpart {beta}1 in Xenopus oocytes (21) and the absence of {alpha}ng-{beta}1 association in Sf-21 insect cells (1, 2) may, in fact, indicate that these cells do not contain other subunits or proteins that facilitate or participate in the {alpha}ng-{beta}1 assembly in vivo, as our laboratory suggested previously (26). This idea is supported by recent observations that {alpha}ng, in contrast to {alpha}1, is unable to assemble with endogenous {beta}1 on expression in mammalian human embryonic kidney 293, Madin-Darby canine kidney, and LLC-PK1 cells (6, 50).

There is evidence that subunit composition and polarization of X-K-ATPases are linked. For example, abnormal expression of {beta}2 in the kidney results in apical localization of some of the Na-K-ATPase pumps with a concomitant disease (60). It was also demonstrated that the apical localization and trafficking of the gastric H-K-ATPase in tubulovesicles is dependent on its {beta}-subunit (19). On the other hand, the data presented here, as well as results of other studies (10, 22), demonstrate that signals of membrane sorting are encoded in the X-K-ATPase {alpha}-subunits. To explain the apparent discrepancy of the above data, it is reasonable to suggest that, at least in some tissues, the efficient formation and intracellular trafficking of a particular combination of {alpha}- and {beta}-subunit isoforms of the X-K-ATPases requires interaction with other proteins.

What kind of other proteins may associate with {alpha}ng? One class of potential candidates is especially interesting: small transmembrane proteins known as members of the FXYD family, which includes {gamma}-subunit of Na-K-ATPase (25, 54). In the distal colon, FXYD2 interacts only with Na-K-ATPase (16). However, seven members of the FXYD family are known (25, 54), and it is possible that some of them can interact and modulate properties of nongastric H-K-ATPase. An interesting example of putative interaction with unrelated proteins is the observation that the polarity of Na-K-ATPase in retinal pigment epithelium differs in cells with different levels of junctional E-/P-cadherin (9). Thus it is quite feasible that interactions with other proteins may be responsible for the observed specificity of {alpha}{beta} assembly and cellular polarization of X-K-ATPases (10, 42).


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by National Insitutes of Health Grants HL-36573 and GM-54997 and by Russian Foundation for Basic Research Grants 03-04-49059 and 03-04-49046.


    ACKNOWLEDGMENTS
 
We are grateful to Kathleen J. Sweadner, Michael J. Caplan, Pablo Martin-Vasallo, Ruslan Dmitriev, Watchara Kasinrerk, and Andrea Quaroni for the generous gifts of antibodies, and to Ronald Mellgren for critical reading of the manuscript.


    FOOTNOTES
 

Address for reprint requests and other correspondence: N. N. Modyanov. Dept. of Pharmacology, Medical College of Ohio, 3035 Arlington Ave., Toledo, OH 43614 (E-mail: nmodyanov{at}mco.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Adams G, Tillekeratne M, Pestov NB, and Modyanov NN. Human nongastric H,K-ATPase: current view on structure and functional properties. In: Mechanisms and Consequences of Proton Transport, edited by Urushidani T and Forte JG. Boston, MA: Kluwer, 2002, p. 19–31.

2. Adams G, Tillekeratne M, Yu C, Pestov NB, and Modyanov NN. Catalytic function of nongastric H,K-ATPase expressed in Sf-21 insect cells. Biochemistry 40: 5765–5776, 2001.[CrossRef][Medline]

3. Ahn KY and Kone BC. Expression and cellular localization of mRNA encoding the "gastric" isoform of H+-K+-ATPase {alpha}-subunit in rat kidney. Am J Physiol Renal Fluid Electrolyte Physiol 268: F99–F109, 1995.[Abstract/Free Full Text]

4. Andonian S, Adamali H, and Hermo L. Expression and regulation of H+,K+-ATPase in lysosomes of epithelial cells of the adult rat epididymis. Mol Reprod Dev 58: 398–410, 2001.[CrossRef][Web of Science][Medline]

5. Arystarkhova E and Sweadner KJ. Tissue-specific expression of the Na,K-ATPase {beta}3 subunit. The presence of {beta}3 in lung and liver addresses the problem of the missing subunit. J Biol Chem 272: 22405–22408, 1997.[Abstract/Free Full Text]

6. Asano S, Hoshina S, Nakai Y, Watanabe T, Sato M, Suzuki Y, and Takeguchi N. Functional expression of putative H+-K+-ATPase from guinea pig distal colon. Am J Physiol Cell Physiol 275: C669–C674, 1998.[Abstract/Free Full Text]

7. Beisvag V, Falck G, Loennechen JP, Qvigstad G, Jynge P, Skomedal T, Osnes JB, Sandvik AK, and Ellingsen Ø. Identification and regulation of the gastric H+/K+-ATPase in the rat heart. Acta Physiol Scand 179: 251–262, 2003.[CrossRef][Web of Science][Medline]

8. Blanco G and Mercer RW. Isozymes of the Na-K-ATPase: heterogeneity in structure, diversity in function. Am J Physiol Renal Physiol 275: F633–F650, 1998.[Abstract/Free Full Text]

9. Burke JM, Cao F, and Irving PE. High levels of E-/P-cadherin: correlation with decreased apical polarity of Na/K ATPase in bovine RPE cells in situ. Invest Ophthalmol Vis Sci 41: 1945–1952, 2000.[Abstract/Free Full Text]

10. Caplan MJ. Ion pump sorting in polarized renal epithelial cells. Kidney Int 60: 427–430, 2001.[CrossRef][Web of Science][Medline]

11. Cheval L, Elalouf JM, and Doucet A. Re-evaluation of the expression of the gastric H,K-ATPase {alpha} subunit along the rat nephron. Pflügers Arch 433: 539–541, 1997.[CrossRef][Web of Science][Medline]

12. Chiampanichayakul S, Szekeres A, Khunkaewla P, Moonsom S, Leksa V, Drbal K, Zlabinger GJ, Hofer-Warbinek R, Stockinger H, and Kasinrerk W. Engagement of Na,K-ATPase {beta}3 subunit by a specific mAb suppresses T and B lymphocyte activation. Int Immunol 14: 1407–1414, 2002.[Abstract/Free Full Text]

13. Chow DC and Forte JG. Functional significance of the {beta}-subunit for heterodimeric P-type ATPases. J Exp Biol 198: 1–17, 1995.[Abstract]

14. Codina J, Delmas-Mata JT, and DuBose TD Jr. The {alpha}-subunit of the colonic H,K-ATPase assembles with {beta}1-Na,K-ATPase in kidney and distal colon. J Biol Chem 273: 7894–7899, 1998.[Abstract/Free Full Text]

15. Codina J, Kone BC, Delmas-Mata JT, and DuBose TD Jr. Functional expression of the colonic H+,K+-ATPase {alpha}-subunit. Pharmacological properties and assembly with X+,K+-ATPase {beta}-subunits. J Biol Chem 271: 29759–29763, 1996.[Abstract/Free Full Text]

16. Codina J, Li J, Hong Y, and DuBose TD Jr. The {gamma}-Na+,K+-ATPase subunit assembles selectively with {alpha}1/{beta}1-Na+,K+-ATPase but not with the colonic H+,K+-ATPase. Kidney Int 61: 967–974, 2002.[CrossRef][Web of Science][Medline]

17. Cougnon M, Bouyer P, Planelles G, and Jaisser F. Does the colonic H,K-ATPase also act as an Na,K-ATPase? Proc Natl Acad Sci USA 95: 6516–6520, 1998.[Abstract/Free Full Text]

18. Cougnon M, Planelles G, Crowson MD, Shull GE, Rossier BC, and Jaisser F. The rat distal colon P-ATPase {alpha} subunit encodes a ouabain-sensitive H+,K+-ATPase. J Biol Chem 271: 7277–7280, 1996.[Abstract/Free Full Text]

19. Courtois-Coutry N, Roush D, Rajendran V, McCarthy JB, Geibel J, Kashgarian M, and Caplan MJ. A tyrosine-based signal targets H/K-ATPase to a regulated compartment and is required for the cessation of gastric acid secretion. Cell 90: 501–510, 1997.[CrossRef][Web of Science][Medline]

20. Crambert G, Hasler U, Beggah AT, Yu C, Modyanov NN, Horisberger JD, Lelievre L, and Geering K. Transport and pharmacological properties of nine different human Na,K-ATPase isozymes. J Biol Chem 275: 1976–1986, 2000.[Abstract/Free Full Text]

21. Crambert G, Horisberger JD, Modyanov NN, and Geering K. Human nongastric H+-K+-ATPase: transport properties of ATP1al1 assembled with different {beta}-subunits. Am J Physiol Cell Physiol 283: C305–C314, 2002.[Abstract/Free Full Text]

22. Dunbar LA and Caplan MJ. Ion pumps in polarized cells: sorting and regulation of the Na+,K+- and H+,K+-ATPases. J Biol Chem 276: 29617–296120, 2001.[Abstract/Free Full Text]

23. Fejes-Toth G and Naray-Fejes-Toth A. Immunohistochemical localization of colonic H-K-ATPase to the apical membrane of connecting tubule cells. Am J Physiol Renal Physiol 281: F318–F325, 2001.[Abstract/Free Full Text]

24. Geering K. The functional role of {beta}-subunits in oligomeric P-type ATPases. J Bioenerg Biomembr 33: 425–438, 2001.[CrossRef][Web of Science][Medline]

25. Geering K and Crambert G. FXYD proteins: new tissue-specific regulators of the ubiquitous Na,K-ATPase. SciSTKE 166: RE1, 2003.

26. Geering K, Crambert G, Yu C, Korneenko TV, Pestov NB, and Modyanov NN. Role of membrane domains M9 and M10 in the assembly process and association efficiency of human, non-gastric H,K-ATPase {alpha} subunits (ATP1AL1) with known {beta} subunits. Biochemistry 39: 12688–12698, 2000.[CrossRef][Medline]

27. Grishin AV, Bevensee MO, Modyanov NN, Rajendran V, Boron WF, and Caplan MJ. Functional expression of the cDNA encoded by the human ATP1AL1 gene. Am J Physiol Renal Fluid Electrolyte Physiol 271: F539–F551, 1996.[Abstract/Free Full Text]

28. Grishin AV and Caplan MJ. ATP1AL1, a member of the non-gastric H,K-ATPase family, functions as a sodium pump. J Biol Chem 273: 27772–27778, 1998.[Abstract/Free Full Text]

29. Grishin AV, Sverdlov VE, Kostina MB, and Modyanov NN. Cloning and characterization of the entire cDNA encoded by ATP1AL1–a member of the human Na,K/H,K-ATPase gene family. FEBS Lett 349: 144–150, 1994.[CrossRef][Web of Science][Medline]

30. Jaisser F and Beggah AT. The nongastric H-K-ATPases: molecular and functional properties. Am J Physiol Renal Physiol 276: F812–F824, 1999.[Abstract/Free Full Text]

31. Kone BC and Higham SC. A novel N-terminal splice variant of the rat H+-K+-ATPase {alpha}2 subunit. Cloning, functional expression, and renal adaptive response to chronic hypokalemia. J Biol Chem 273: 2543–2552, 1998.[Abstract/Free Full Text]

32. Korneenko TV, Pestov NB, Egorov MV, Ivanova MV, Kostina MB, Rydström J, and Shakhparonov MI. Identification of Escherichia coli nitrate reductase as an antigen for a monoclonal antibody with previously unknown specificity. Bioorg Khim 26: 601–604, 2000.[Web of Science][Medline]

33. Kraut JA, Helander KG, Helander HF, Iroezi ND, Marcus EA, and Sachs G. Detection and localization of H+-K+-ATPase isoforms in human kidney. Am J Physiol Renal Physiol 281: F763–F768, 2001.[Abstract/Free Full Text]

34. Kraut JA, Hiura J, Shin JM, Smolka A, Sachs G, and Scott D. The Na+-K+-ATPase {beta}1 subunit is associated with the HK{alpha}2 protein in the rat kidney. Kidney Int 53: 958–962, 1998.[CrossRef][Web of Science][Medline]

35. Lavoie L, Levenson R, Martin-Vasallo P, and Klip A. The molar ratios of {alpha} and {beta} subunits of the Na+-K+-ATPase differ in distinct subcellular membranes from rat skeletal muscle. Biochemistry 36: 7726–7732, 1997.[CrossRef][Medline]

36. Lecain E, Robert JC, Thomas A, and Tran Ba Huy P. Gastric proton pump is expressed in the inner ear and choroid plexus of the rat. Hear Res 149: 147–154, 2000.[CrossRef][Web of Science][Medline]

37. Marxer A, Stieger B, Quaroni A, Kashgarian M, and Hauri HP. (Na++K+)-ATPase and plasma membrane polarity of intestinal epithelial cells: presence of a brush border antigen in the distal large intestine that is immunologically related to {beta} subunit. J Cell Biol 109: 1057–1069, 1989.[Abstract/Free Full Text]

38. Mercer RW, Biemesderfer D, Bliss DP Jr, Collins JH, and Forbush B III. Molecular cloning and immunological characterization of the gamma polypeptide, a small protein associated with the Na,K-ATPase. J Cell Biol 121: 579–586, 1993.[Abstract/Free Full Text]

39. Modyanov NN, Mathews PM, Grishin AV, Beguin P, Beggah AT, Rossier BC, Horisberger JD, and Geering K. The human ATP1AL1 gene encodes a ouabain-sensitive H-K-ATPase. Am J Physiol Cell Physiol 269: C992–C997, 1995.[Abstract/Free Full Text]

40. Modyanov N, Pestov N, Adams G, Crambert G, Tillekeratne M, Zhao H, Korneenko T, Shakhparonov M, and Geering K. Nongastric H,K-ATPase: structure and functional properties. Ann NY Acad Sci 986: 183–187, 2003.[Web of Science][Medline]

41. Moller JV, Juul B, and le Maire M. Structural organization, ion transport, and energy transduction of P-type ATPases. Biochim Biophys Acta 1286: 1–51, 1996.[Medline]

42. Muth TR and Caplan MJ. Transport protein trafficking in polarized cells. Annu Rev Cell Dev Biol 19: 333–366, 2003.[CrossRef][Web of Science][Medline]

43. Pande SV and Murthy MS. A modified micro-Bradford procedure for elimination of interference from sodium dodecyl sulfate, other detergents, and lipids. Anal Biochem 220: 424–426, 1994.[CrossRef][Web of Science][Medline]

44. Pestov NB, Adams G, Shakhparonov MI, and Modyanov NN. Identification of a novel gene of the X,K-ATPase {beta}-subunit family that is predominantly expressed in skeletal and heart muscles. FEBS Lett 456: 243–248, 1999.[CrossRef][Web of Science][Medline]

45. Pestov NB, Gusakova TV, Kostina MV, and Shakhparonov MI. Phage mimotopes for monoclonal antibodies against plasma membrane Ca2+-ATPase. Bioorg Khim 22: 567–573, 1996.

46. Pestov NB, Korneenko TV, Adams G, Tillekeratne M, Shakhparonov MI, and Modyanov NN. Nongastric H-K-ATPase in rodent prostate: lobe-specific expression and apical localization. Am J Physiol Cell Physiol 282: C907–C916, 2002.[Abstract/Free Full Text]

47. Pestov NB, Korneenko TV, Zhao H, Adams G, Kostina MB, Shakhparonov MI, and Modyanov NN. The {beta}m protein, a member of the X,K-ATPase {beta}-subunits family, is located intracellularly in pig skeletal muscle. Arch Biochem Biophys 396: 80–88, 2001.[CrossRef][Web of Science][Medline]

48. Pestov NB, Romanova LG, Korneenko TV, Egorov MV, Kostina MB, Sverdlov VE, Askari A, Shakhparonov MI, and Modyanov NN. Ouabain-sensitive H,K-ATPase: tissue-specific expression of the mammalian genes encoding the catalytic {alpha} subunit. FEBS Lett 440: 320–324, 1998.[CrossRef][Web of Science][Medline]

49. Rajendran VM, Singh SK, Geibel J, and Binder HJ. Differential localization of colonic H+-K+-ATPase isoforms in surface and crypt cells. Am J Physiol Gastrointest Liver Physiol 274: G424–G429, 1998.[Abstract/Free Full Text]

50. Reinhardt J, Grishin AV, Oberleithner H, and Caplan MJ. Differential localization of human nongastric H-K-ATPase ATP1AL1 in polarized renal epithelial cells. Am J Physiol Renal Physiol 279: F417–F425, 2000.[Abstract/Free Full Text]

51. Rucklidge GJ, Milne G, Chaudhry SM, and Robins SP. Preparation of biotinylated, affinity-purified antibodies for enzyme-linked immunoassays using blotting membrane as an antigen support. Anal Biochem 243: 158–164, 1996.[CrossRef][Web of Science][Medline]

52. Sangan P, Kolla SS, Rajendran VM, Kashgarian M, and Binder HJ. Colonic H-K-ATPase {beta}-subunit: identification in apical membranes and regulation by dietary K depletion. Am J Physiol Cell Physiol 276: C350–C360, 1999.[Abstract/Free Full Text]

53. Shin JM, Besançon M, Bamberg K, and Sachs G. Structural aspects of the gastric H,K ATPase. Ann NY Acad Sci 834: 65–76, 1997.[Web of Science][Medline]

54. Sweadner KJ, Arystarkhova E, Donnet C, and Wetzel RK. FXYD proteins as regulators of the Na,K-ATPase in the kidney. Ann NY Acad Sci 986: 382–387, 2003.[Web of Science][Medline]

55. Sweadner KJ and Donnet C. Structural similarities of Na,K-ATPase and SERCA, the Ca2+-ATPase of the sarcoplasmic reticulum. Biochem J 356: 685–704, 2001.[CrossRef][Web of Science][Medline]

56. Takeyasu K, Tamkun MM, Renaud KJ, and Fambrough DM. Ouabain-sensitive (Na++K+)-ATPase activity expressed in mouse Ltk cell by transfection with DNA encoding {alpha}-subunit of an avian sodium pump. J Biol Chem 263: 4347–4354, 1988.[Abstract/Free Full Text]

57. Thangarajah H, Wong A, Chow DC, Crothers JM Jr, and Forte JG. Gastric H-K-ATPase and acid-resistant surface proteins. Am J Physiol Gastrointest Liver Physiol 282: G953–G961, 2002.[Abstract/Free Full Text]

58. Verlander JW, Moudy RM, Campbell WG, Cain BD, and Wingo CS. Immunohistochemical localization of H-K-ATPase {alpha}2c-subunit in rabbit kidney. Am J Physiol Renal Physiol 281: F357–F365, 2001.[Abstract/Free Full Text]

59. Wang J, Schwinger RH, Frank K, Muller-Ehmsen J, Martín-Vasallo P, Pressley TA, Xiang A, Erdmann E, and McDonough AA. Regional expression of sodium pump subunits isoforms and Na+-Ca++ exchanger in the human heart. J Clin Invest 98: 1650–1658, 1996.[Web of Science][Medline]

60. Wilson PD, Devuyst O, Li X, Gatti L, Falkenstein D, Robinson S, Fambrough D, and Burrow CR. Apical plasma membrane mispolarization of NaK-ATPase in polycystic kidney disease epithelia is associated with aberrant expression of the {beta}2 isoform. Am J Pathol 156: 253–268, 2000.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
T. Shibata, H. Hibino, K. Doi, T. Suzuki, Y. Hisa, and Y. Kurachi
Gastric type H+,K+-ATPase in the cochlear lateral wall is critically involved in formation of the endocochlear potential
Am J Physiol Cell Physiol, November 1, 2006; 291(5): C1038 - C1048.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
N. B. Pestov, T. V. Korneenko, M. I. Shakhparonov, G. E. Shull, and N. N. Modyanov
Loss of acidification of anterior prostate fluids in Atp12a-null mutant mice indicates that nongastric H-K-ATPase functions as proton pump in vivo
Am J Physiol Cell Physiol, August 1, 2006; 291(2): C366 - C374.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/6/C1229    most recent
00393.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pestov, N. B.
Right arrow Articles by Modyanov, N. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pestov, N. B.
Right arrow Articles by Modyanov, N. N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.