|
|
||||||||
MEMBRANE TRANSPORTERS, ION CHANNELS, AND PUMPS
1-subunit expression: role of 3'-untranslated region
Departments of Medicine and of Physiology and Biophysics, Case Western Reserve University, Cleveland, Ohio 44106-4951
Submitted 31 March 2003 ; accepted in final form 21 October 2003
| ABSTRACT |
|---|
|
|
|---|
1 mRNA species containing its longest 3'-untranslated region (UTR) exhibited the lowest translational efficiency. Here, employing deletions and in vivo expression assays, using direct injection of plasmids into rat ventricular myocardium, we identified a 143-nt segment located in the distal 3'-UTR of
1 mRNA that was associated with decreased luciferase expression; interestingly, this segment contains three AUUUA motifs. Using RNA-protein binding assays and UV cross-linking of cRNA with cytosolic proteins of rat heart, we identified an
38-kDa protein that specifically bound to the cRNA encoding the 143-nt segment of
1 mRNA 3'-UTR. Mutation of three nucleotides located in the middle region of the 143-nt segment, which was predicted to greatly disrupt a putative stem-loop structure of the cRNA in this region, was associated with reduced binding of the mutated cRNA to the protein migrating at
38 kDa. The cRNA encoding a segment of cyclooxygenase-2 mRNA 3'-UTR containing six AUUUA sequences did not bind the protein migrating at
38 kDa and did not compete with the binding of the wild-type 143-nt
1 cRNA to the protein. The above results suggest that the 143-nt segment in the distal segment of the 3'-UTR of
1 mRNA may play an important role in the control of
1-subunit expression. RNA-protein binding; AUUUA sequence; plasmid expression in heart; direct myocardial injection; cardiac expression
and
, with the
-subunit being the catalytic subunit of the enzyme (2, 5, 13, 24). The available evidence indicates that the presence of the
-subunit is essential for enzyme activity and must be coexpressed and assembled with the
-subunit to form a functional enzyme complex (6, 8). The abundance of
mRNA is significantly lower than that of the
mRNA in many cells and tissues including liver, skeletal muscle, heart, brain, renal cortex, and several cell lines (2, 5, 6, 8, 15, 16, 22, 24), suggesting that the synthesis of the
-subunit might play an important regulatory role in controlling the abundance of the enzyme. Among the three
-subunits, the
1 isoform is ubiquitous (11, 22).
Previous results from this and other laboratories indicate that the expression of the
-subunit is controlled at transcriptional, posttranscriptional, and translational levels (5, 8, 20, 21). Regulation at the posttranscriptional and translational levels can occur through the action of trans-acting binding proteins usually involving the 5'- or the 3'-untranslated region (UTR) of mRNAs (1, 4, 7, 9, 17, 25). One of the best-studied examples is the regulation of expression of proteins involved in the metabolism of iron in which iron-responsive elements are present in stem-loop structures in the 5'- and 3'-UTRs of the encoding mRNAs (18, 25). Most commonly, however, the regulatory elements are present in the 3'-UTRs of mRNAs; these include AU-rich sequences that are associated with stabilization-destabilization of the mRNA or hairpin (or stem-loop) structure that interacts with a trans-acting factor that controls the turnover of the mRNA or its translational efficiency (1, 4, 9, 25).
Na+-K+-ATPase
1-subunit mRNA contains five polyadenylation [poly(A)] signals in its 3'-UTR (20, 21). We have found that the third and fourth poly(A) signals are rarely employed in the synthesis of the
1 mRNA in rat heart and other tissues, whereas poly(A) signals 1, 2, and commonly 5 are used in varying degrees in various tissues (20, 21). Using in vitro translation assays and in in vivo expression analyses in cell culture, we found that the translational efficiency of the three
1 mRNAs terminating at the first, second, or fifth poly(A) signals differed significantly, with the longest mRNA ending at the fifth signal exhibiting the lowest translation (20). The above findings suggested that a negative regulatory region is localized in a stretch of 696 nucleotides between the second and fifth poly(A) signals of
1 mRNA 3'-UTR (20). In the present study, employing deletions, mutations, binding assays, and in vivo expression in a rat heart model, we have identified a short region within the distal 3'-UTR of
1 mRNA that appears to control its translational efficiency. A preliminary report of some of the findings was presented previously (19).
| MATERIALS AND METHODS |
|---|
|
|
|---|
-32P]UTP was from Dupont NEN (Boston, MA), and CMV-Renilla vector and Dual-Luciferase Reporter Assay System kit were from Promega (Madison, WI). Deoxyoligonucleotide primers were synthesized by Integrated DNA Technologies (Coralville, IA).
Preparation of luciferase constructs containing segments of
1 3'-UTR, constructs with deletion mutations in the 3'-UTR, and a construct with an unrelated DNA fragment. Construct 1 contains the coding region of firefly luciferase inserted between the BamHI and EcoRV sites of pcDNA3 (which contains the CMV promoter) and the entire
1 3'-UTR segment (Fig. 1A) inserted between BstXI and ApaI sites of the plasmid, with both sites 5' to the bovine growth hormone (BGH) 3'-UTR-poly(A) signal of the plasmid, which is used for 3'-end formation (20). The
1 segment was designed such that it was devoid of all five poly(A) signals; details of construction of the
1 segment and its use were reported previously (20). Hence, transcripts derived in vivo from this plasmid would be expected to contain the luciferase coding region, followed by the entire Na+-K+-ATPase
1 mRNA 3'-UTR, and then followed by the plasmid's BGH 3'-UTR-poly(A) sequence. The other constructs depicted in Fig. 1 were derived from construct 1.
|
Constructs 3 and 5 were generated by restriction of construct 1 with enzymes PflMI and ApaI and with BstXI and XhoI, respectively, followed by creation of bunt ends and religation. Restriction of construct 1 with BstXI and religation produced construct 4. Constructs 2 and 8 were prepared by restriction of construct 4 with PflMI and ApaI and with XhoI and ApaI, respectively, followed by blunting of the ends and religation. Construct 9 was prepared from construct 3 by restriction with BstXI and XhoI and religation after blunting of the ends. Construct 6 was prepared by ligation of the XhoI fragment of
1 [spanning the region poly(A2) to poly(A3)] into construct 9. Construct 7 was prepared by ligation of the XhoI fragment that had also been restricted with BstXI and blunted into the "empty" vector that had been restricted with XhoI and ApaI and blunted. All the constructs were extensively verified for validity of sequence and orientation by employing a combination of restriction enzymes, PCR, and DNA sequencing of both strands. A construct containing an unrelated DNA was prepared by ligation of a 1,040-bp ApaI-XmnI fragment derived from pGEM 5z into construct 1 that was devoid of 1,176 bp of
1 sequence; the pGEM sequence was inserted 3' to the luciferase coding sequence.
In vivo expression of plasmids in rat ventricular myocardium. The transdiaphragmatic approach, using an upper abdominal incision, was employed for direct injection of the heart according to the procedure described by Wright et al. (26). Male Sprague-Dawley rats (
250 g) were anesthetized with a mixture of ketamine (36 mg/kg), acepromazine maleate (7.2 mg/kg), and xylazine (1.2 mg/kg) injected intramuscularly. After a midline abdominal incision and retraction of the lower ribs, the movement of the left ventricle superior to, and against, the diaphragm was visualized. A mixture of 1.5 µg of test plasmid and 1.0 µg of Renilla luciferase plasmid (diluted in PBS containing 0.01% Evans blue) in a total volume of 30-40 µl was injected transdiaphragmatically into the apex of the heart (left ventricular muscle), using a 28-gauge needle. After injection, the abdomen was closed. All procedures were performed using sterile techniques. There was a 1% mortality associated with the injection protocol itself.
Rats were killed 48-72 h after injection, and the apical region of the heart was collected via sharp dissection. After homogenization and centrifugation, samples were assayed by using the Dual-Luciferase reporter kit according to the manufacturer's protocol. In each experiment, groups of four to five rats were used per test plasmid, and at least three plasmids were tested in a group of rats in parallel. In all instances, one of the plasmids employed was the empty CMV-luciferase vector (control). The ratio of firefly luciferase activity to Renilla luciferase activity in each rat heart was calculated, and the results were normalized against the average value obtained for hearts injected with the empty vector (set to 1.0). The values obtained for each test plasmid were then averaged.
Introduction of point mutations and preparation of transcripts and cRNA radiolabeled probes. Except for cyclooxygenase (COX)-2 plasmid (4), the DNA template used for transcription of wild-type 143-nt
1 cRNA was generated by PCR, employing construct 2 as template, with upstream oligo with the sequence CGAGATCTTTATTAAGAACTTTATAAAAAGCAATGC (containing the T7 RNA polymerase promoter sequence) and downstream oligo with the sequence GCATTGCTTTTTATAAAGTTCTTAATAAAGATGTCG (specific for the 3'-terminal segment of Na+-K+-ATPase
1 mRNA 3'-UTR contained in construct 2). Desired point mutations were introduced into the 143-nt region of construct 2 by employing the QuikChange Site-Directed Mutagenesis kit and two synthetic complementary deoxyoligonucleotide primers containing the requisite point mutation, as well as PCR; the conditions were 95°C for 30 s, 52°C for 1 min, and 68°C for 15 min, for a total of 14 cycles. PCR products were treated with DpnI for 1 h in a 37°C water bath and transformed into supercompetent cells. Mutant colonies were selected by resistance to ampicillin on agar plates, and the sequence of plasmids was confirmed by sequencing. DNA fragments used as templates for generation of mutant 143-nt cRNAs were prepared by using PCR, the same oligos shown above, and the mutated plasmids as template. DNA products were purified by phenol-chloroform extraction and ethanol precipitation. cRNA probes were prepared by using 1 µg of the 165-nt PCR product (143 plus 22 nt of T7), 4 mM each of CTP, ATP, and GTP and 50 µCi of [
-32P]UTP (800 Ci/mmol), and T7 RNA polymerase in a final volume of 20 µl. After incubation for 50 min at 37°C and treatment with DNase I, samples were extracted with phenol-chloroform and precipitated twice with ethanol (using 10 µg of tRNA as carrier). The probe usually had an activity of 1.5 x 106 cpm/µl (1.2 ng/µl). All competitor unlabeled cRNAs were prepared by using the same procedures, except all four nucleotides were included in the reaction mix, each at a final concentration of 2.5 mM.
Preparation of cytosol fraction from rat ventricular muscle. Ventricles (20 mg wet wt) were homogenized in 4 ml of buffer (25 mM HEPES, 0.5 mM EDTA, 20 mM KCl, 2 mM MgCl2, 200 mM sucrose, 1 mM PMSF, 4 µM leupeptin, and 4 µM pepstatin; pH 7.4), using Ultra-Turrax T8 (Staufen, Germany) at speed 3 twice for 15 s, followed by centrifugation at 150,000 g for 30 min (all procedures carried out at 4°C). Protein concentration of supernatants (cytosol) were measured with the Bio-Rad protein assay kit (Hercules, CA). Samples of cytosol were aliquoted into multiple tubes, frozen at -80°C, and used within 4 wk. cRNA-protein binding assay. In RNA gel-shift analysis, 8 µg of cytosol protein were mixed with 1 x 106 cpm of cRNA probe in 20 µl of homogenization buffer (125 mM HEPES, 500 mM KCl, 7.5 mM MgCl2, and 25% glycerol; pH 7.4), and the mixture was incubated for 15 min at room temperature. To eliminate nonspecific binding, we added heparin at a final concentration of 5 µg/µl, and the incubation was continued for an additional 20 min. Samples were resolved on a 6% native polyacrylamide gel, dried, and exposed to X-ray film.
In UV cross-linking experiments, at the end of the incubation, samples were transferred to 96-well plates and exposed to UV light (UV Stratalinker 2400) for 10 min on ice. Samples were then digested with 20 µg of RNase A and 10 units of RNase T1 at 37°C for 20 min, denatured with SDS buffer at 80°C for 5 min, and fractionated by using 10% SDS-PAGE and prestained molecular markers (Invitrogen); the resulting gels were then dried, and labeled RNA-protein complexes were detected by autoradiography. All competition assays were carried out by preincubation with in vitro transcribed unlabeled competitor cRNA for 15 min before addition of the probe.
Statistical methods. All experimental results are expressed as means ± SE. Unpaired Student's t-test was employed throughout, and a P value of <0.05 was considered significant (23).
| RESULTS |
|---|
|
|
|---|
1 mRNA 3'-UTR sequences on luciferase expression of plasmids assayed in vivo in the rat heart. In our previous studies employing in vitro translation assays and luciferase expression in cell culture, we have demonstrated that Na+-K+-ATPase
1 3'-UTR negatively affects the translational efficiency of
1 mRNA (20). The regulatory region within
1 mRNA appeared to be located between the second and the fifth poly(A) signals in the 3'-UTR of the mRNA encompassing 696 nt of the mRNA (20). In the present study, we delineated the putative regulatory region(s) in greater detail by determining the expression of various constructs containing different regions of the 3'-UTR. We employed an in vivo expression system using direct injection of the plasmids into the left ventricular muscle of rat hearts, according to techniques described previously (26). Each purified construct (Fig. 1A) was mixed with Renilla luciferase and injected into rat ventricular muscle by a transdiaphragmatic approach. After 48-72 h, apical sections of the hearts were isolated and assayed for firefly luciferase and Renilla luciferase expression. The activities of all the constructs, corrected for the expression of Renilla luciferase, were normalized against firefly luciferase expression in hearts injected in parallel with the empty vector (set to 1.0).
Luciferase expression by the plasmid containing the entire 3'-UTR (construct 1) averaged 0.38 that of the empty vector, labeled as control (Fig. 1B), in agreement with our previous results employing expression in cell culture (20). To further delineate the regulatory region(s), we prepared constructs containing various regions of the 3'-UTR (Fig. 1A). Constructs 2, 3, and 4 had activities that were similar to that of construct 1; these four plasmids all contained the 143-nt segment of the 3'-UTR (contained in construct 2) flanking the position of the deleted poly(A) signals 3 and 4 located between the second BstXI and PflMI sites. The presence of the 3' half-segment of the 143-nt region in construct 5, or the 5' half-segment of the 143-nt region in construct 6, did not result in a depression of luciferase activity. In fact, construct 6 had a higher activity than the empty vector, a finding that was mimicked by construct 7. These latter two plasmids contained a segment of the 3'-UTR from the first XhoI to the second BstXI site, suggesting that a positive regulatory element might be present in this region. Plasmids only containing either the 5' or the 3' half-segments of the 143-nt region (constructs 8 and 9, respectively) exhibited luciferase activities equivalent to that of the empty vector. Insertion of 1,040 bp of unrelated DNA 3' to the luciferase coding sequence resulted in no change in luciferase expression (Fig. 1B, unrelated DNA). Taken together, the above results suggest that one or more negative regulatory elements reside in the 143-nt segment of the
1 mRNA 3'-UTR sequence and that both half-segments of this region appear to be required for the observed depression of luciferase expression.
Characterization of proteins binding to specific regions of the 143-nt cRNA located in the 3'-UTR of
1 mRNA. Recently a number of mRNA binding proteins have been described, and the function of these RNA-binding proteins is under investigation (1, 4, 9, 10, 14, 17, 18, 25). To explore the possibility that the cytosol fraction of rat ventricle contains proteins that exhibit binding activity toward the 143-nt segment, we incubated the radiolabeled 143-nt cRNA with ventricular cytosol for 15 min at room temperature and fractionated the mixture by PAGE under nondenaturing conditions (Fig. 2). As shown, the presence of cytosolic protein (lane 2) markedly retarded the migration of cRNA probe (lane 1). Furthermore, the amount of bound radiolabeled cRNA was decreased by inclusion of nonradiolabeled cRNA in the mixture (lane 3).
|
The effect of increasing amounts of nonradiolabeled 143-nt competitor cRNA on binding of proteins to radiolabeled cRNA probe was performed in experiments in which the RNA was cross-linked to proteins by UV irradiation. After digestion with RNase A and RNase T1, proteins were fractionated by SDS-PAGE and visualized by autoradiography (Fig. 3). Several protein complexes with molecular masses of
110,
85,
72, and
38 kDa were detected. However, only the intensity of the protein band with an apparent molecular mass of
38 kDa was consistently decreased with increasing amounts of the competitor cRNA. Interestingly, inclusion of the 117-nt cRNA derived from the 3'-UTR of COX-2 mRNA, which contains six AUUUA sequences (4), had no effect on the binding of the protein migrating at
38 kDa to the 143-nt sequence of
1 mRNA. Additionally, in separate experiments, the
38-kDa protein exhibited no binding to COX-2 cRNA used as probe (data not shown). Taken together, these data suggest the presence of an
38-kDa protein in cytosol of rat heart with specific binding activity toward the 143-nt RNA sequence of
1 mRNA. Furthermore, the results also imply that the protein migrating at
38 kDa probably does not bind to the AUUUA motifs present in the 143-nt segment.
|
Mapping of the protein-binding site in the 143-nt RNA sequence of
1 mRNA. We next performed experiments to further delineate the nucleotide sequences that are involved in protein-RNA complex formation. Examination of the primary sequence of the 143-nt region revealed three AUUUA sequences, as well as two stretches of nucleotides located between positions 48 and 73 and between 101 and 132 that contained inverted repeat sequences that could potentially form stem-loop structures (Fig. 4). To further examine this possibility, we utilized a modeling program to predict secondary structures at the lowest free energy levels (12). The predicted secondary structure of the wild-type 143-nt region contains three double-stranded hairpin loop structures (Fig. 5, see regions A, B, and C). To investigate the relationship between the primary sequence of the RNA, its predicted secondary structure, and RNA-protein binding, we introduced point mutations in regions A, B, and C within the 143-nt sequence and determined the effect of these mutations on RNA structure and protein binding; the resulting mutants were labeled mutant 1, 2, and 3, respectively. The mutations and their positions are shown in Fig. 4; in each instance, two or three U's were changed to C's or G's.
|
|
The effect of the above mutations in regions A, B, and C is shown in Fig. 5. Mutation of three nucleotides in region A (mutant 1) were chosen to disrupt the two AUUUA-like sequences in this region. This resulted in a dramatic disruption in the predicted stem-loop structures within region A, with minor changes in the secondary structures of regions B and C. Mutation of three nucleotides in region B (mutant 2) were selected to disrupt the AUUUUA sequence as well as prevent the formation of a possible stem-loop structure. The predicted effect was a major disruption of region B, in addition to moderate changes in regions A and C. The two-nucleotide mutation in region C (mutant 3) was selected to disrupt the presumed stem-loop structure in this region. The resulting mutant 3 is predicted to have a moderate to major disruption of region C, with regions A and B remaining relatively intact.
We then tested the effect of cRNAs bearing these mutations on the binding of the protein migrating at
38 kDa to the wild-type 143-nt cRNA probe. In these experiments, each mutated cRNA was mixed with the radiolabeled 143-nt wild-type cRNA probe, and cytosol proteins were derived from rat heart ventricles. The rationale of this approach is based on the prediction that a cRNA harboring a significant mutation in its putative protein-binding site will compete poorly with the binding of the wild-type cRNA probe to the protein migrating at
38 kDa. In contrast, cRNAs containing mutations in sites not involved in binding to the
38-kDa protein would effectively bind to the protein in question and would compete with the binding of the probe to the protein. The result of a typical experiment is shown in Fig. 6. As shown, the wild-type nonradiolabeled 143-nt cRNA competed effectively with the radiolabeled probe for binding to the protein migrating at
38 kDa (Fig 6, wild type). Inclusion of nonradiolabeled cRNAs derived from mutants 1 and 3 competed effectively with the binding of the probe to the protein migrating at
38 kDa. In contrast, inclusion of cRNA derived from either mutant 2 or COX-2 had little or no effect on the binding of the probe to the protein migrating at
38 kDa. In three independent experiments, the binding of the probe to the protein decreased by >75% with inclusion of either wild-type, mutant 1, or mutant 3 cRNAs (P < 0.05 for each), whereas the binding decreased by 20 ± 10% with inclusion of mutant 2 (P > 0.05). The results summarized in Figs. 3 and 6 suggest that the protein migrating at
38 kDa binds to region B of the 143-nt cRNA and that the binding is not to the AUUUA sequences present in this region of
1 mRNA.
|
| DISCUSSION |
|---|
|
|
|---|
1 mRNA 143-nt segment on luciferase expression by the chimeric constructs could potentially be mediated by 1) decreased transcription of the mRNA from the plasmid; 2) increased degradation of the mRNA; 3) decreased intrinsic translational efficiency of the mRNA, perhaps due to an alteration in its secondary and tertiary structure per se; 4) decreased translation of the mRNA secondary to trans-acting proteins binding to the 143-nt sequence; or 5) a combination of some of the above mechanisms. The first two possibilities seem unlikely, given our previous results in transfected cell culture system in which luciferase expression was decreased in the presence of an equivalent amount of luciferase mRNA (20). The results are consistent with the third and fourth possibilities, namely, a decrease in
1 mRNA translation due to cis elements or trans-acting factors. The finding of a protein migrating at
38 kDa present in myocardial cytosol with binding affinity toward the 143-nt region of
1 mRNA is evidence in favor of the possibility that trans-acting factors, namely, the protein migrating at
38 kDa, plays an important role in the regulation of
1-subunit expression.
It should be noted, however, that the above suggestion is based on observations employing different strategies, constructs, and assays. For example, the translational efficiencies of the different
1 mRNA species, determined in in vitro translation assays, employed cRNAs containing all the poly(A) signals contained in the
1 mRNA 3'-UTR sequence 5' to the point of the selected cRNA termination (20). In contrast, the
1 mRNA 3'-UTR sequences employed in the present study were specifically designed not to contain any poly(A) signals, because their presence might have resulted in varying and premature termination of the chimeric mRNA expressed in vivo. For consistency and for comparison of the results, the constructs employed in the in vivo myocardial injection protocols and the in vitro cRNA binding assays utilized the same DNA sequences that were devoid of poly(A) signals.
Several trans-acting factors such as AUH (14), AUF1 (3), HUR (10), and Hel-N1 (9) with binding activity toward adenylate- and uridylate-rich elements (AREs) in 3'-UTRs of mRNAs have been identified and cloned. The typical ARE motif, AUUUA, is often multiply repeated in 3'-UTRs, and binding to AREs frequently serves as a signal to target the mRNA for rapid degradation. COX-2 mRNA, with several AREs in its 3'-UTR, binds to a cytoplasmic protein that regulates COX-2 expression at the posttranscriptional level (4). In this study, we employed a 117-nt region of COX-2 mRNA as a control in the competition assays. This control provided evidence that the protein migrating at
38 kDa does not bind to AUUUA motifs present in the 3'-UTR of
1 mRNA. Taken together, our results are consistent with the premise that a putative stem-loop structure present in region B within the 143-nt segment in the 3'-UTR of
1 mRNA underlies much of the translational control exhibited by this mRNA. Whether the protein migrating at
38 kDa, and its interaction with the 143-nt region, controls the translational efficiency of
1 mRNA in vivo is not known. Likewise, the molecular identity and full characterization of this candidate protein are essential. Further studies are hence necessary to identify the protein migrating at
38 kDa and delineate its role in the control of Na+-K+-ATPase expression under various physiological conditions.
| ACKNOWLEDGMENTS |
|---|
GRANTS
This study was supported by National Heart, Lung, and Blood Institute Grant P01 HL-68738.
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
-hydroxylase mRNA. J Biol Chem 275: 19985-19991, 2000.
2. Blanco G and Mercer RW. Isozymes of the Na-K-ATPase: heterogeneity in structure, diversity in function. Am J Physiol Renal Physiol 275: F633-F650, 1998.
3. DeMaria CT, Sun Y, Long L, Wagner BJ, and Brewer G. Structural determinants in AUF1 required for high affinity binding to A + U-rich elements. J Biol Chem 272: 27635-27643, 1997.
4. Dixon DA, Kaplan CD, McIntyre TM, Zimmerman GA, and Prescott SM. Post-transcriptional control of cyclooxygenase-2 gene expression. The role of the 3'-untranslated region. J Biol Chem 275: 11750-11757, 2000.
5. Geering K. Subunit assembly and functional maturation of Na,K-ATPase. J Membr Biol 115: 109-121, 1990.[CrossRef][ISI][Medline]
6. Gick GG, Hatala MA, Chon D, and Ismail-Beigi F. Na,K-ATPase in several tissues of the rat: tissue-specific expression of subunit mRNAs and enzyme activity. J Membr Biol 131: 229-236, 1993.[CrossRef][ISI][Medline]
7. Giles KM, Daly JM, Beveridge DJ, Thomson AM, Voon DC, Furneaux HM, Jazayeri JA, and Leedman PJ. The 3'-untranslated region of p21WAF1 mRNA is a composite cis-acting sequence bound by RNA-binding proteins from breast cancer cells, including HuR and poly(C)-binding protein. J Biol Chem 278: 2937-2946, 2003.
8. Lescale-Matys L, Hensley CB, Crnkovic-Markovic R, Putnam DS, and McDonough AA. Low K+ increases Na,K-ATPase abundance in LLC-PK1/Cl4 cells by differentially increasing beta, and not alpha, subunit mRNA. J Biol Chem 265: 17935-17940, 1990.
9. Levine TD, Gao F, King PH, Andrews LG, and Keene JD. Hel-N1: an autoimmune RNA-binding protein with specificity for 3' uridylate-rich untranslated regions of growth factor mRNAs. Mol Cell Biol 13: 3494-3504, 1993.
10. Ma WJ, Cheng S, Campbell C, Wright A, and Furneaux H. Cloning and characterization of HuR, a ubiquitously expressed Elav-like protein. J Biol Chem 271: 8144-8151, 1996.
11. Malik N, Canfield VA, Beckers MC, Gros P, and Levenson R. Identification of the mammalian Na,K-ATPase beta 3 subunit. J Biol Chem 271: 22754-22758, 1996.
12. Mathews DH, Sabina J, Zuker M, and Turner DH. Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J Mol Biol 288: 911-940, 1999.[CrossRef][ISI][Medline]
13. Mercer RW, Schneider JW, and Benz EJ Jr. Molecular cloning and characterization of alpha-subunit isoforms of the Na,K-ATPase. Prog Clin Biol Res: 119-126, 1988.
14. Nakagawa J, Waldner H, Meyer-Monard S, Hofsteenge J, Jeno P, and Moroni C. AUH, a gene encoding an AU-specific RNA binding protein with intrinsic enoyl-CoA hydratase activity. Proc Natl Acad Sci USA 92: 2051-2055, 1995.
15. Orlowski J and Lingrel JB. Differential expression of the Na,K-ATPase alpha 1 and alpha 2 subunit genes in a murine myogenic cell line. Induction of the alpha 2 isozyme during myocyte differentiation. J Biol Chem 263: 17817-17821, 1988.
16. Pressley TA, Ismail-Beigi F, Gick GG, and Edelman IS. Increased abundance of Na+-K+-ATPase mRNAs in response to low external K+. Am J Physiol Cell Physiol 255: C252-C260, 1988.
17. Ranganathan G, Li C, and Kern PA. The translational regulation of lipoprotein lipase in diabetic rats involves the 3'-untranslated region of the lipoprotein lipase mRNA. J Biol Chem 275: 40986-40991, 2000.
18. Schalinske KL and Eisenstein RS. Phosphorylation and activation of both iron regulatory proteins 1 and 2 in HL-60 cells. J Biol Chem 271: 7168-7176, 1996.
19. Shao Y and Ismail-Beigi F. 40 kDa protein interacts with a 143nt segment of the 3-untranslated region (UTR) of Na,K-ATPase
1-mRNA (Abstract). FASEB J 16: A1117, 2002.
20. Shao Y and Ismail-Beigi F. Different Na, K-ATPase mRNA(beta1) species exhibit unique translational efficiencies. Arch Biochem Biophys 390: 78-86, 2001.[CrossRef][ISI][Medline]
21. Shao Y, Pressley TA, and Ismail-Beigi F. Na,K-ATPase mRNA beta 1 expression in rat myocardium effect of thyroid status. Eur J Biochem 260: 1-8, 1999.[ISI][Medline]
22. Shyjan AW, Gottardi C, and Levenson R. The Na,K-ATPase beta 2 subunit is expressed in rat brain and copurifies with Na,K-ATPase activity. J Biol Chem 265: 5166-5169, 1990.
23. Snedecor GW and Cochran WG. Statistical Methods. Ames, IA: Iowa University Press, 1976.
24. Sweadner KJ. Isozymes of the Na+/K+-ATPase. Biochim Biophys Acta 988: 185-220, 1989.[Medline]
25. Theil EC and Eisenstein RS. Combinatorial mRNA regulation: iron regulatory proteins and iso-iron-responsive elements (Iso-IREs). J Biol Chem 275: 40659-40662, 2000.
26. Wright CE, Haddad F, Qin AX, Bodell PW, and Baldwin KM. In vivo regulation of
-MHC gene in rodent heart: role of T3 and evidence for an upstream enhancer. Am J Physiol Cell Physiol 276: C883-C891, 1999.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |