|
|
||||||||
MEMBRANE TRANSPORTERS, ION CHANNELS, AND PUMPS
Department of Biology, McMaster University, Hamilton, Ontario, Canada L8S 4K1
Submitted 18 September 2003 ; accepted in final form 16 October 2003
| ABSTRACT |
|---|
|
|
|---|
hypoxia; background K+ channels; TASK-1; MAH cells
In rat CB type I cells, acute hypoxia was initially shown to inhibit voltage-dependent Ca2+-activated K+ (BK) channels (35). More recent data implicated a role for a member of the tandem pore domain family of background K+ channels (TASK-1; 3) in initiating the hypoxic receptor potential in these cells. Background K+ channels are constitutively active ionic channels responsible for regulating cell resting membrane potential, and they play a dominant role in cell excitability and firing (12). Since the initial demonstration of the O2-sensitivity of a TASK-1-like conductance in rat CB type I cells (3), hypoxic inhibition of this and other background K+ channels has been reported in cerebellar granule neurons (36), glossopharyngeal neurons (4), the lung neuroepithelial cell line H146 (15), and recombinant expression systems (17, 19, 24). The role and importance of this family of channels in mediating chemoreception in numerous cell types has been reviewed by Bayliss et al. (1) and by Patel and Honore (31, 32). Although these roles are increasingly emerging, the mechanisms by which hypoxia inhibits background channels are unclear. However, available evidence suggests that regulation of TASK-1 at least is indirect and mediated by an intracellular effector system, because hypoxic inhibition of native TASK-1-like currents in CB type I cells is absent in excised patches (3) and may involve altered cell metabolism (41).
The use of cell lines such as H146 (29) and PC-12 (43) has aided the further identification of O2-sensitive K+ channels involved in physiological responses of neurosecretory cells. Recently, Fearon et al. (10) characterized the O2-sensing properties of immortalized rat AMC (v-myc, adrenal-derived HNK1+, or MAH) cells and demonstrated the hypoxic inhibition of both Ca2+-activated and delayed rectifier K+ channels. Here, we demonstrated the functional expression of TASK-1 in MAH cells. However, selective inhibitors of this K+ channel were without effect on either the magnitude of hypoxic inhibition of K+ current or hypoxic depolarization. Furthermore, when background K+ current was isolated, hypoxia was without effect on K+ channel activity. Thus TASK-1 was O2-insensitive in these cells. Given that other K+ channels expressed in these cells respond to hypoxia (10), these data suggest that the primary determinant underlying the O2 sensitivity of a K+ channel is not the channel itself but is the cell in which the channel is expressed. We propose that distinct cellular signaling systems mediate hypoxic regulation of individual K+ channel types and that O2 sensitivity of a given channel is determined by the presence of a particular signal transduction system required to couple the hypoxic stimulus to that specific channel. Examination of possible hypoxia signaling systems in cells expressing multiple K+ channels will require pharmacological dissection of each individual K+ current, to provide a more rigorous examination of the link between lowered O2 levels and changes in K+ channel activity. Furthermore, our observations confirm the indirect O2 sensitivity of TASK-1, which must be mediated through a cellular messenger system that was absent in MAH cells.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Electrophysiology. Electrophysiological recordings were made at room temperature using the perforated-patch configuration of the whole cell patch-clamp technique, as described previously (10). EGTA and Na2ATP were omitted from the pipette solution, and nystatin was included at 500 µg/ml. Cells were perfused with a solution composed of (in mM) 135 NaCl, 5 KCl, 1.2 MgCl2, 5 HEPES, 2.5 CaCl2, and 10 D-glucose (pH 7.4 with NaOH). When symmetrical K+ solutions (equimolar K+ on either side of the membrane) were used, cells were perfused with a similar solution containing 135 mM KCl and 5 mM NaCl. Junction potentials were calculated by using JPCalcW (Axon Instruments), and the appropriate corrections were made during data acquisition (HEKA).
In time-series studies, cells were voltage clamped at 60 mV, and currents were evoked by step depolarizations to the indicated test potential for 100 ms every 10 s. Current-voltage relationships were obtained by ramping the membrane potential between 60 and +50/+60 mV over a period of 1 s. Currents were filtered at 5 kHz and digitized at 10 kHz. Capacitative transients were minimized by analog means. Voltage protocols were executed by using an EPC 9 amplifier (HEKA) with an integrated analog-to-digital converter and an ITC-16 interface and using Pulse software (HEKA), and analysis was carried out using PulseFit software (HEKA). Results are expressed as means ± SE, and statistical comparisons were made by using paired or unpaired Student's t-tests, as appropriate. Current clamp (I = 0 pA) recordings were made using the same amplifier. Solutions were identical to the asymmetrical K+ solutions described above. Voltage output was filtered at 500 Hz and digitized at 1 kHz.
Hypoxia was produced by bubbling the perfusate with 100% N2 for 30 min, which produced no shift in pH. Bath PO2 was measured by using a depolarized (600 mV) carbon fiber electrode and was always stable at 5 mmHg within 3045 s of solution exchange. Drugs were dissolved in the perfusate to the required concentration, and pH was adjusted as necessary. 4-Aminopyridine (4-AP), anandamide, ZnCl2, and BaCl2 were obtained from Sigma (Mississauga, ON, Canada).
RT-PCR. Isolation of RNA, DNase treatment, and reverse transcription were carried out with the Cells-to-cDNA kit (Ambion, TX). DNA was amplified in a single PCR reaction as described previously (26). Two gene-specific primer sets were used to amplify TASK-1: set 1, CACCGTCATCACCACAATCG (forward) and TGCTCTGCATCACGCTTCTC (reverse); and set 2, AGTACGTGGCCTTCAGCTTC (forward) and TGGAGTACTGCAGCTTCTCG (reverse). TASK-3 primers were ATGAAGCGGCAGAATGTGCG (forward) and TCCCTCCAGAAGATCTTCATCGGTATT (reverse).
-Actin primers were AAGATCCTGACCGAGCGTGG (forward) and CAGCACTGTGTTGGCATAGAGG (reverse). Reactions were held at 94°C for 2 min and subsequently cycled 35 times (denaturation at 94°C for 30 s, annealing for 30 s, and extension at 72°C for 1 min). Final extension was 10 min at 72°C. Primer-specific annealing temperatures were 57°C (TASK-1 and
-actin) and 60°C (TASK-3). As a positive control, the ability of the TASK-3 primers to amplify the correct PCR product was confirmed by repeating the experiment under the same conditions on a rat brain genomic DNA library. All PCR products were purified (Qiagen, Mississauga, ON, Canada) and sequenced to verify their identity.
Western blotting. Proteins were extracted by homogenization and incubation at 4°C for 1 h in cold buffer (50 mM Tris, pH 8.0, 1 mM EDTA, 150 mM NaCl) with 1% Triton X-100 and 0.1% SDS, followed by centrifugation at 13,000 g for 30 min at 4°C. The supernatant was further clarified by centrifugation at 50,000 g for 30 min. Extracted proteins were analyzed by SDS-polyacrylamide gel electrophoresis and Western blot with an antibody recognizing residues 252269 of TASK-1 (1:200 dilution; Alamone, Jerusalem, Israel), followed by goat anti-rabbit horseradish peroxidase-conjugated antibody (1:10,000 dilution; Jackson ImmunoResearch Laboratories, West Grove, PA) and visualized by enhanced chemiluminescent substrate (ECL; Amersham Biosciences, Piscataway, NJ).
| RESULTS |
|---|
|
|
|---|
|
Under symmetrical K+ conditions and in the presence of 3 mM 4-AP, 3 µM anandamide caused marked inhibition of K+ current (Fig. 1C). The difference current, obtained by subtracting the current remaining in the presence of anandamide from that obtained under control conditions (Fig. 1C, inset), was linear and reversed at or close to 0 mV, the calculated Nernst equilibrium potential for K+ under these conditions. Similarly, Zn2+ (300 µM) also inhibited a voltage-independent current with a reversal potential around 0 mV (Fig. 1F). This pharmacological and biophysical profile demonstrated the functional expression of the K+-selective background channel TASK-1 in MAH cells.
Both Zn2+ (22) and anandamide (5, 9) inhibit voltage-gated Ca2+ channels, although the concentrations of anandamide required to inhibit certain types of channel may be higher than those used in the present study (9). Because of the possibility of indirect effects of anandamide and Zn2+ on BK channels, we verified the selectivity of these inhibitors for TASK-1 by examining their effects in the presence of 200 µM Cd2+. The magnitude of the Zn2+-sensitive K+ current (measured under physiological recording conditions at a test potential of +30 mV) was 14.1 ± 4.0 pA/pF in the presence of Cd2+, a value not significantly different from that seen in the absence of Cd2+ (13.8 ± 3.9 pA/pF, n = 10; P > 0.05, paired Students t-test; Fig. 2A). Similarly, 3 µM anandamide reduced currents by 11.1 ± 0.7 pA/pF under control conditions and 10.1 ± 1.5 pA/pF in the presence of 200 µM Cd2+ (n = 6; P > 0.05, unpaired Students t-test; Fig. 2B). These data confirmed the selectivity of the concentrations of Zn2+ and anandamide used as inhibitors of TASK-1 currents.
|
MAH cells lacked functional expression of TASK-3. In a cell model of O2-sensitive lung neuroepithelial bodies (H146 cells; 15), the O2 sensitivity of a further member of the background K+ channel family, TASK-3, has been shown (13). Given the similarity in the molecular identity and pharmacological profiles of TASK-1 and TASK-3, it was necessary to determine whether TASK-3 was expressed in MAH cells. Ruthenium red, at a concentration that inhibited TASK-3 while being ineffective against TASK-1 (5 µM; 7), was without effect on K+ channel currents in nine cells examined (Fig. 3A). In these cells, inhibitory responses to hypoxia were observed (Fig. 3A).
|
Differences also exist between the sensitivity of TASK-1 and TASK-3 channels to changes in extracellular pH. Thus we constructed a pH dose-response curve (Fig. 3B), in the presence of 10 mM TEA, 5 mM 4-AP, and 2.5 mM Ni2+, to eliminate pH-sensitive BK (34) and delayed rectifier K+ channels (14) expressed in MAH cells (10) and isolate background K+ current. In the presence of this cocktail of K+ channel blockers, the residual current activated instantaneously upon depolarization (Fig. 3B, inset), a characteristic of TASK-1 currents (19). This residual current exhibited strong pH sensitivity, and current was half-maximal at pH 7.55 ± 0.14, also characteristic of TASK-1 (27). Taken together, these data ruled out the possibility that TASK-3 was functionally expressed in MAH cells and gave further evidence for the expression of TASK-1.
Molecular evidence for the presence of TASK-1 in MAH cells. RT-PCR studies demonstrated the presence of mRNA for TASK-1 in MAH cells (Fig. 4A). The presence of immunoreactive TASK-1 protein was confirmed by Western blotting, using a MAH cell lysate (Fig. 4C). In accordance with the lack of effect of 5 µM ruthenium red on K+ current (Fig. 3), we were unable to detect TASK-3 mRNA (Fig. 4B). The functionality of the TASK-3 primers was confirmed by repeating the experiment on a rat genomic DNA library (not shown).
|
Selective inhibition of TASK-1 had no effect on the O2 sensitivity of K+ current. MAH cells functionally expressed O2-sensitive Ca2+-activated and delayed rectifier K+ channels (10; see also Fig. 4D). Because the "O2-sensitive" K+ channel TASK-1 was functionally expressed in MAH cells, we examined the effects of selective inhibitors of this channel on responses to hypoxia. In all cells, hypoxia caused robust inhibition of K+ current. In the presence of 3 µM anandamide, the magnitude of the O2-sensitive K+ current (IKO2, obtained by subtracting the current evoked by step depolarizing to +30 mV during hypoxia from that obtained during normoxia) was 16.3 ± 3.1 pA, a value not significantly different from that seen before the exposure to anandamide (14.3 ± 2.4 pA, n = 7; P > 0.05, paired Students t-test; Fig. 5A). Furthermore, IKO2 was not significantly altered in the presence of 300 µM Zn2+ (IKO2 was 22.1 ± 2.8 pA in control conditions and 20.9 ± 2.9 pA in the presence of Zn2+, n = 7; P > 0.05, paired Students t-test; Fig. 5B). Furthermore, hypoxia-evoked cell depolarization was 5.4 ± 0.9 mV under control conditions and 5.3 ± 1.0 mV in the presence of 3 µM anandamide (n = 5; P > 0.05, Students paired t-test). Similarly, hypoxic depolarization was 4.2 ± 0.9 mV under control conditions and 4.3 ± 1.0 mV in the presence of 300 µM Zn2+ (n = 4; P > 0.05, Students paired t-test).
|
To substantiate the finding that TASK-1 was expressed in MAH cells but was not O2 sensitive, we made recordings in Ca2+-free symmetrical K+ solutions and in the presence of 10 mM TEA, 5 mM 4-AP, and 2.5 mM Ni2+ to block voltage-and Ca2+-dependent K+ channels and thus isolate background K+ channels (3). Under these conditions, ramp depolarizations evoked a voltage-independent K+ current. Hypoxia was without effect on this current under these conditions at any test potential examined (n = 6; see Fig. 5C). Currents were still responsive to 300 µM Zn2+ under these conditions, and the similarity between the degree of inhibition observed under these conditions (currents were reduced by 58.1 ± 30.1 pA, n = 9) and that observed under physiological K+ conditions (56.7 ± 10.7 pA, n = 6; P > 0.05) demonstrated the selectivity of Zn2+ for the background K+ current in MAH cells.
| DISCUSSION |
|---|
|
|
|---|
O2 sensitivity of a TASK-1-like current in CB type I cells was initially described by Buckler et al. (3). Since this report was published, several groups have provided evidence for acute hypoxic inhibition of this and other background K+ currents in various cell types. In cerebellar granule neurons, hypoxia inhibited a background channel with characteristics similar to TASK-1 (36). In the H146 cell line, hypoxia inhibited TASK-3 (13), a related member of this K+ channel family. A further member of this family, THIK-1, was identified as an O2-sensitive channel in glossopharyngeal neurons (4). Further evidence for the O2 sensitivity of these channels comes from studies in which members of the background K+ channel family, exogenously expressed in either Xenopus oocytes (TASK-1; 19) or HEK-293 cells (TASK-1, TASK-3, and TREK-1; 15, 17, 24), responded to hypoxia.
Given the O2 sensitivity of these channels and their role in mediating hypoxic depolarization in neurosecretory cells, we examined their functional expression and involvement in O2 sensing in immortalized AMC cell-derived MAH cells. Under physiological K+ conditions, selective inhibition of TASK-1 with Zn2+ or anandamide (13, 23) markedly reduced the whole cell K+ current. The activity of TASK-1 at the resting membrane potential was confirmed because both anandamide and Zn2+ caused marked membrane depolarization. With a symmetrical K+ distribution, both anandamide and Zn2+ inhibited a voltage-independent current with a reversal potential close to 0 mV, demonstrating the K+ selectivity of the anandamide- and Zn2+-sensitive current. Furthermore, when background channels were isolated by blocking voltage- and Ca2+-dependent K+ currents with Ni2+, TEA, and 4-AP, ramp depolarizations evoked a conductance similar to that attributed to TASK-1 in CB type I cells (3) and that could be inhibited by 300 µM Zn2+. Together, these data provide unequivocal biophysical and pharmacological evidence for the functional expression of TASK-1 in MAH cells.
By examining pharmacological and biophysical characteristics of background K+ channels, we were able to exclude the expression of other O2-sensitive channels in MAH cells and also to further confirm the expression of TASK-1. In H146 cells, TASK-3 was proposed to act as an O2-sensitive K+ channel (13). However, currents in MAH cells were insensitive to 5 µM ruthenium red, a selective inhibitor of TASK-3 (7). In glossopharyngeal neurons, a THIK-1-like channel was demonstrated to mediate acute O2 sensitivity. However, the insensitivity of this channel to anandamide (4) argues strongly against the expression of a THIK-1-like channel in MAH cells. Along-side these data, the similar pH sensitivity of the isolated background current in MAH cells, compared with that reported for recombinant TASK channels (27), further suggested the expression of TASK-1.
When the effects of hypoxia were examined in the presence of selective inhibitors of TASK-1, the degree of both hypoxic inhibition of K+ current and hypoxic depolarization were unchanged. Moreover, in the absence of contaminating voltage- and Ca2+-dependent K+ conductances, hypoxia was without effect on the remaining Zn2+-sensitive background K+ current. Thus, even though TASK-1 was expressed and functional in MAH cells, it did not contribute to the O2-sensitivity of these cells. This was unanticipated, because TASK-1 was inhibited by hypoxia in all O2-sensing cells in which its expression had been demonstrated (3, 36). Furthermore, other members of the background K+ channel family, TASK-3 and THIK-1, possessed hypoxic sensitivity in other O2-sensing cell types (4, 13). Therefore, the MAH cell possessed the ability to preferentially relay a hypoxic stimulus onto Kv and BK channels while leaving TASK-1 channel activity unchanged, demonstrating the ability of the hypoxic transduction system(s) present in the cell to selectively discriminate and only regulate the K+ channels necessary for O2 sensing within that cell. Implicit from these findings is that the mechanism by which hypoxia regulates TASK-1 channels in other cell types occurs by a cellular signaling system and, as such, may require the presence of some cytosolic factor/pathway.
Several intracellular messenger systems have been proposed to transduce a hypoxia stimulus onto K+ channels. In neurosecretory cells of the CB and adrenal medulla (25, 30), inhibition of respiratory enzymes in the mitochondrial electron transport chain during hypoxia has been proposed to regulate K+ channels by modulating the levels of reactive oxygen species (ROS). Similarly, in a mechanism involving alterations of intracellular ROS levels, inhibition of a membrane-associated NADPH oxidase was suggested to convey a hypoxic signal onto K+ channels in lung neuroepithelial body cells and their immortalized counterparts, H146 cells (11, 29). Moreover, in numerous other cell types, pharmacological alterations in ROS levels regulated different types of K+ channel (16). Thus, although several hypoxia signal transduction pathways have been described, no single pathway has been coupled to regulation of a particular channel type. We suggest that during hypoxia, cells can regulate several different cellular signaling molecules, each of which can alter the activity of a different type of K+ channel. The present study supports this hypothesis, because although hypoxia regulated the activity of BK and Kv channels in MAH cells (10), it was without effect on TASK-1, despite the functional expression of this "O2-sensitive" channel. Therefore, the signaling system linking hypoxia to BK and Kv channels is different from that linking the stimulus to TASK-1, and the presence or absence of an intact hypoxia transduction pathway thus determines the ability of this stimulus to inhibit a specific channel. Importantly, these data reiterate the possibility of an indirect effect of hypoxia on background channels (3, 41), with hypoxia presumably acting through an intracellular pathway, the full components of which are absent from MAH cells. Our findings also have implications for the study of the O2 sensitivity of ion channels in expression systems, because of course the expression of a recombinant channel in a cell with demonstrated O2-sensing properties would not be a prerequisite for O2 sensitivity of that channel. Indeed, hypoxia-channel coupling may require cellular components absent from the transfected cell or, indeed, may be promoted by or require the coexpression of further components of the channel complex itself (33).
To summarize, the likelihood that specific intracellular pathways regulate distinct K+ channels in the same cell is of great significance and should impact further studies examining mechanisms of O2 sensing. Importantly, investigators utilizing inhibitors of putative O2 sensors in electrophysiological studies need to pharmacologically dissect individual K+ currents and examine the effects of these inhibitors on specific K+ channel subtypes in isolation.
| ACKNOWLEDGMENTS |
|---|
GRANTS
This work was funded by National Sciences and Engineering Research Council (NSERC) Discovery Grant 261922-03 and Grant-in-Aid NA 5230 from the Heart and Stroke Foundation of Ontario. R. P. Johnson was the recipient of a NSERC Undergraduate Student Research Award.
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
2. Birren SJ and Anderson DJ. A v-myc-immortalized sympathoadrenal progenitor cell line in which neuronal differentiation is initiated by FGF but not NGF. Neuron 4: 189201, 1990.[CrossRef][ISI][Medline]
3. Buckler KJ, Williams BA, and Honore E. An oxygen-, acid- and anaesthetic-sensitive TASK-like background potassium channel in rat arterial chemoreceptor cells. J Physiol 525: 135142, 2000.
4. Campanucci VA, Fearon IM, and Nurse CA. A novel O2-sensing mechanism in rat glossopharyngeal neurones mediated by a halothane-inhibitable background K+ conductance. J Physiol 548: 731743, 2003.
5. Chemin J, Monteil A, Perez-Reyes E, Nargeot J, and Lory P. Direct inhibition of T-type calcium channels by the endogenous cannabinoid anandamide. EMBO J 20: 70337040, 2001.[CrossRef][ISI][Medline]
6. Coppock EA, Martens JR, and Tamkun MM. Molecular basis of hypoxia-induced pulmonary vasoconstriction: role of voltage-gated K+ channels. Am J Physiol Lung Cell Mol Physiol 281: L1L12, 2001.
7. Czirjak G and Enyedi P. Formation of functional heterodimers between the TASK-1 and TASK-3 two-pore domain potassium channel subunits. J Biol Chem 277: 54265432, 2002.
8. Delpiano MA and Hescheler J. Evidence for a PO2-sensitive K+ channel in the type I cell of the rabbit carotid body. FEBS Lett 249: 195198, 1989.[CrossRef][ISI][Medline]
9. Di Marzo V, De Petrocellis L, Fezza F, Ligresti A, and Bisogno T. Anandamide receptors. Prostaglandins Leukot Essent Fatty Acids 66: 377391, 2002.[CrossRef][ISI][Medline]
10. Fearon IM, Thompson RJ, Samjoo I, Vollmer C, Doering LC, and Nurse CA. O2-sensitive K+ channels in immortalised rat chromaffin-cell-derived MAH cells. J Physiol 545: 807818, 2002.
11. Fu XW, Wang D, Nurse CA, Dinauer MC, and Cutz E. NADPH oxidase is an O2 sensor in airway chemoreceptors: evidence from K+ current modulation in wild-type and oxidase-deficient mice. Proc Natl Acad Sci USA 97: 43744379, 2000.
12. Goldstein SA, Bockenhauer D, O'Kelly I, and Zilberberg N. Potassium leak channels and the KCNK family of two-P-domain subunits. Nat Rev Neurosci 2: 175184, 2001.[ISI][Medline]
13. Hartness ME, Lewis A, Searle GJ, O'Kelly I, Peers C, and Kemp PJ. Combined antisense and pharmacological approaches implicate hTASK as an airway O2 sensing K+ channel. J Biol Chem 276: 2649926508, 2001.
14. Kehl SJ, Eduljee C, Kwan DC, Zhang S, and Fedida D. Molecular determinants of the inhibition of human Kv1.5 potassium currents by external protons and Zn2+. J Physiol 541: 924, 2002.
15. Kemp PJ, Lewis A, Hartness ME, Searle GJ, Miller P, O'Kelly I, and Peers C. Airway chemotransduction: from oxygen sensor to cellular effector. Am J Respir Crit Care Med 166: S17S24, 2002.
16. Kourie JI. Interaction of reactive oxygen species with ion transport mechanisms. Am J Physiol Cell Physiol 275: C1C24, 1998.
17. Lewis A, Hartness ME, Chapman CG, Fearon IM, Meadows HJ, Peers C, and Kemp PJ. Recombinant hTASK1 is an O2-sensitive K+ channel. Biochem Biophys Res Commun 285: 12901294, 2001.[CrossRef][ISI][Medline]
18. Liu H, Moczydlowski E, and Haddad GG. O2 deprivation inhibits Ca2+-activated K+ channels via cytosolic factors in mice neocortical neurons. J Clin Invest 104: 577588, 1999.[ISI][Medline]
19. Lopes CM, Zilberberg N, and Goldstein SA. Block of Kcnk3 by protons. Evidence that 2-P-domain potassium channel subunits function as homodimers. J Biol Chem 276: 2444924452, 2001.
20. Lopez-Barneo J, Lopez-Lopez JR, Urena J, and Gonzalez C. Chemotransduction in the carotid body: K+ current modulated by PO2 in type I chemoreceptor cells. Science 241: 580582, 1988.
21. Lopez-Barneo J, Pardal R, Montoro RJ, Smani T, Garcia-Hirschfeld J, and Urena J. K+ and Ca2+ channel activity and cytosolic [Ca2+] in oxygen-sensing tissues. Respir Physiol 115: 215227, 1999.[CrossRef][ISI][Medline]
22. Magistretti J, Castelli L, Taglietti V, Tanzi F. Dual effect of Zn2+ on multiple types of voltage-dependent Ca2+ currents in rat palaeocortical neurons. Neuroscience 117: 249264, 2003.[CrossRef][ISI][Medline]
23. Maingret F, Patel AJ, Lazdunski M, and Honore E. The endocannabinoid anandamide is a direct and selective blocker of the background K+ channel TASK-1. EMBO J 20: 4754, 2001.[CrossRef][ISI][Medline]
24. Miller P, Kemp PJ, Lewis A, Chapman CG, Meadows HJ, and Peers C. Acute hypoxia occludes hTREK-1 modulation: re-evaluation of the potential role of tandem P domain K+ channels in central neuroprotection. J Physiol 548: 3137, 2003.
25. Mojet MH, Mills E, and Duchen MR. Hypoxia-induced catecholamine secretion in isolated newborn rat adrenal chromaffin cells is mimicked by inhibition of mitochondrial respiration. J Physiol 504: 175189, 1997.
26. Nurse CA and Fearon IM. Carotid body chemoreceptors in dissociated cell culture. Microsc Res Tech 59: 249255, 2002.[CrossRef][ISI][Medline]
27. O'Connell AD, Morton MJ, and Hunter M. Two-pore domain K+ channels-molecular sensors. Biochim Biophys Acta 1566: 152161, 2002.[Medline]
28. O'Kelly I, Lewis A, Peers C, and Kemp PJ. O2 sensing by airway chemoreceptor-derived cells. Protein kinase C activation reveals functional evidence for involvement of NADPH oxidase. J Biol Chem 275: 76847692, 2000.
29. O'Kelly I, Peers C, and Kemp PJ. O2-sensitive K+ channels in neuroepithelial body-derived small cell carcinoma cells of the human lung. Am J Physiol Lung Cell Mol Physiol 275: L709L716, 1998.
30. Ortega-Saenz P, Pardal R, Garcia-Fernandez M, and Lopez-Barneo J. Rotenone selectively occludes sensitivity to hypoxia in rat carotid body glomus cells. J Physiol 548: 789800, 2003.
31. Patel AJ and Honore E. Molecular physiology of oxygen-sensitive potassium channels. Eur Respir J 18: 221227, 2001.
32. Patel AJ and Honore E. Properties and modulation of mammalian 2P domain K+ channels. Trends Neurosci 24: 339346, 2001.[CrossRef][ISI][Medline]
33. Patel AJ, Lazdunski M, and Honore E. Kv2.1/Kv9.3, a novel ATP-dependent delayed-rectifier K+ channel in oxygen-sensitive pulmonary artery myocytes. EMBO J 16: 66156625, 1997.[CrossRef][ISI][Medline]
34. Peers C. Effect of lowered extracellular pH on Ca2+-dependent K+ currents in type I cells from the neonatal rat carotid body. J Physiol 422: 381395, 1990.
35. Peers C. Hypoxic suppression of K+ currents in type I carotid body cells: selective effect on the Ca2+-activated K+ current. Neurosci Lett 119: 253256, 1990.[CrossRef][ISI][Medline]
36. Plant LD, Kemp PJ, Peers C, Henderson Z, and Pearson HA. Hypoxic depolarization of cerebellar granule neurons by specific inhibition of TASK-1. Stroke 33: 23242328, 2002.
37. Poling JS, Rogawski MA, Salem N, and Vicini S. Anandamide, an endogenous cannabinoid, inhibits Shaker-related voltage-gated K+ channels. Neuropharmacology 35: 983991, 1996.[CrossRef][ISI][Medline]
38. Thompson RJ and Nurse CA. Anoxia differentially modulates multiple K+ currents and depolarizes neonatal rat adrenal chromaffin cells. J Physiol 512: 421434, 1998.
39. Urena J, Fernandez-Chacon R, Benot AR, Alvarez de Toledo GA, and Lopez-Barneo J. Hypoxia induces voltage-dependent Ca2+ entry and quantal dopamine secretion in carotid body glomus cells. Proc Natl Acad Sci USA 91: 1020810211, 1994.
40. Weir EK, Reeve HL, Cornfield DN, Tristani-Firouzi M, Peterson DA, and Archer SL. Diversity of response in vascular smooth muscle cells to changes in oxygen tension. Kidney Int 51: 462466, 1997.[ISI][Medline]
41. Williams BA and Buckler KJ. Biophysical properties and metabolic regulation of a TASK-like potassium channel in rat carotid body type 1 cells. Am J Physiol Lung Cell Mol Physiol 286: L221L230, 2004.
42. Youngson C, Nurse C, Yeger H, and Cutz E. Oxygen sensing in airway chemoreceptors. Nature 365: 153155, 1993.[CrossRef][Medline]
43. Zhu WH, Conforti L, Czyzyk-Krzeska MF, and Millhorn DE. Membrane depolarization in PC-12 cells during hypoxia is regulated by an O2-sensitive K+ current. Am J Physiol Cell Physiol 271: C658C665, 1996.
This article has been cited by other articles:
![]() |
S. C. Hebert, G. Desir, G. Giebisch, and W. Wang Molecular Diversity and Regulation of Renal Potassium Channels Physiol Rev, January 1, 2005; 85(1): 319 - 371. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |