|
|
||||||||
MUSCLE CELL BIOLOGY AND CELL MOTILITY
3 subunit
Research Division, Joslin Diabetes Center, and Department of Medicine, Brigham and Women's Hospital and Harvard Medical School, Boston, Massachusetts 02215
Submitted 25 July 2003 ; accepted in final form 17 September 2003
| ABSTRACT |
|---|
|
|
|---|
-subunit of 5'-AMP-activated protein kinase (AMPK) can result in pronounced pathological changes that may stem from increases in muscle glycogen levels, making it critical to understand the role(s) of the
-subunit in AMPK function. In this study we cloned the mouse AMPK
3 subunit and revealed that there are two transcription start sites, which result in a long form,
3L (AF525500
[GenBank]
) and a short form,
3S (AF525501
[GenBank]
). AMPK
3L is the predominant form in mouse and is specifically expressed in mouse skeletal muscle at the protein level. In skeletal muscle, AMPK
3 shows higher levels of expression in fast-twitch white glycolytic muscle (type IIb) compared with fast-twitch red oxidative glycolytic muscle (type IIa), whereas
3 is undetectable in soleus muscle, a slow-twitch oxidative muscle with predominantly type I fibers. AMPK
3 can coimmunoprecipititate with both
and
AMPK subunits. Overexpression of
3S and
3L in mouse tibialis anterior muscle in vivo has no effect on
1 and
2 subunit expression and does not alter AMPK
2 catalytic activity. However,
3S and
3L overexpression significantly increases AMPK
1 phosphorylation and activity by
50%. The increase in AMPK
1 activity is not associated with alterations in glycogen accumulation or glycogen synthase expression. In conclusion, the
3 subunit of AMPK is highly expressed in fast-twitch glycolytic skeletal muscle, and wild-type
3 functions in the regulation of
1 catalytic activity, but it is not associated with changes in muscle glycogen concentrations.
adenosine 5'-monophosphate-activated protein kinase; AMPK
3 short form; AMPK
3 long form; cystathionine
-synthase domain
) and two noncatalytic and presumably regulatory subunits (
,
) (33, 40). Each of the subunits has multiple isoforms, and various configurations of the heterotrimer have been reported, including
1
1
1,
1
2
1,
2
1
1, and
2
2
1 (10, 44).
Although the two
catalytic subunit isoforms of AMPK have been the major focus of AMPK research over the last 10 years, there is now increasing interest in understanding the roles of the
- and
-subunits in AMPK function. Three
-isoforms have been identified,
1,
2, and
3. Northern blot analysis of human tissues reveals that
1 is widely distributed, whereas AMPK
2 is also widely distributed but has very high expression levels in heart (11, 31). Interestingly,
3 is almost exclusively expressed in the skeletal muscle of humans (11, 31). The divergent expression patterns of the
isoforms among tissues suggest that the different isoforms have tissue-specific functions (11, 44). In comparing the human
1,
2, and
3 amino acid sequences, the NH2 termini have significant variations in length and identity, suggesting that this region may play an important role in conferring isoform specificity either by targeting different downstream molecules or by responding to different upstream stimuli. However, specific functions of the NH2-terminal region have not been identified for all three
-subunits, and there are no known protein motifs in this region. In contrast, the COOH-terminal region contains four consecutive cystathionine
-synthase (CBS) domains that are highly conserved in all
isoforms (11, 41). These CBS domains occupy approximately half of the
-subunit, suggesting that these domains are also critical for
-subunit function (7). Indeed, mutations of CBS domains in a number of proteins, including the CBS domains of the
-subunit of AMPK, are associated with various disease states (4, 8, 20, 28, 31). In skeletal muscle and heart, mutations of the CBS domains in
2 and
3 have been shown to be associated with alterations in glycogen metabolism (3, 4, 12, 31).
In recent years, skeletal muscle has become a major focus of the AMPK field because AMPK may be involved in the regulation of glucose uptake, glycogen metabolism, fatty acid oxidation, and gene transcription in this tissue (5, 21, 23, 25, 34, 36, 43, 47, 49). Although mutations in
-subunit CBS domains, including
3, lead to pathological conditions, very little is known about the mechanisms by which the
-isoforms may regulate AMPK activity, cellular metabolism, and tissue phenotype. There have been discrepancies in reports of tissue distributions of
3 mRNA and protein (11, 31), as well as conflicting reports of the translation initiation sites of the human AMPK
3 gene (11, 31). In this study we have cloned the full-length mouse AMPK
3 gene and, by determining its translation initiation sites, have revealed that there are two splice variants of
3. We have also characterized the AMPK
3 isoforms and investigated the effects of overexpressing the wild-type AMPK
3 subunit in vivo on AMPK activity and glycogen metabolism in skeletal muscle.
| METHODS |
|---|
|
|
|---|
-32P]ATP was obtained from Perkin-Elmer. Affinity purified polyclonal antibody against AMPK
3 was raised against mouse AMPK
3 peptide NH2-CLVDETQHLLGV-COOH (
3L; 457467), which is also conserved in mouse
3S, human
3, and pig
3. Polyclonal antibodies against AMPK
1 and AMPK
2 were produced against the peptide sequence 339358 of AMPK
1 and 352366 of AMPK
2 (35); anti-AMPK
1/2 antibody was raised against the peptide sequence 216 of AMPK
1/2 (AEKQKHDGRVKIGHY), which is conserved in AMPK
1 and AMPK
2 isoforms. Anti-phospho-AMPK
antibody was from Cell Signaling Technology; anti-glycogen synthase antibody was provided by Dr. John C. Lawrence, Jr. (University of Virginia, Charlottesville, VA); anti-phospho-glycogen synthase antibody was from Oncogene Research Products; the pCAGGS vector was a gift from Dr. J. Miyazaki (Osaka University, Osaka, Japan); and pMT-AMPK
1 vector and anti-AMPK
1 antibody were provided by Dr. Lee A. Witters (Dartmouth Medical School, Hanover, NH). Animals. Female (8 wk) ICR mice (30 g) were purchased from Taconic. Protocols for animal use were reviewed and approved by the Institutional Animal Care and Use Committee of the Joslin Diabetes Center and were in accordance with National Institutes of Health guidelines.
Human muscle. The experiment using a human muscle lysate study with human subjects was approved by the Ethical Committee at the Karolinska (35).
Cloning of mouse AMPK
3 cDNA. Total RNA was extracted from 100 mg of mouse skeletal muscle using Tri Reagent (Molecular Research Center). Total RNA (5 µg) was subjected to the oligo(dT) primer reverse transcription (RT) reaction (Invitrogen), and the cDNA products were used as a source for polymerase chain reaction (PCR) templates. The primers were designed on the basis of conserved regions of pig and human AMPK
3: sense, 5'-tgctgagtccaccggg-3'; and antisense, 5'-agcagggctgagcacc-3'. The PCR product was subcloned into pCR 2.1-TOPO vector (Invitrogen) and sequenced. To obtain the upstream extension of 5'-end and the downstream extension of 3'-end of RT-PCR product, 5'- and 3'-rapid amplification of cDNA ends (RACE) was performed using a Marathon-Ready cDNA kit (Clontech). The antisense primer for 5'-RACE, 5'-agccatggcatcataacaggtgtgttcc-3', and sense primer for 3'-RACE, 5'-tctggagggagttctctcctgccagc-3', were designed on the basis of the DNA sequence of RT-PCR product as described above. 5'-RACE was performed between the anchor sense primer AP1 (Clontech) and the 5'-RACE antisense primer. The resulting PCR products were reamplified by using the nested sense primer AP2 (Clontech) and the same reverse primer, and the PCR products were cloned into pCR 2.1-TOPO vector for cloning and sequencing. 3'-RACE was performed between the 3'-RACE sense primer and anchor antisense primer AP1, and the resulting PCR products were reamplified by using the same sense primer and nested antisense primer AP2. The PCR products were also cloned into pCR 2.1-TOPO vector and further sequenced.
Cloning of mouse genomic AMPK
3. An AMPK
3L cDNA fragment (246822) was used as a probe to screen the mouse genomic DNA library (IncyteGenomics). The
3-containing clones were confirmed by Southern Blotting using the same probe. The genomic organization was identified by comparing cDNA and genomic sequences.
Muscle processing. Muscles were dissected and snap frozen in liquid nitrogen. The pulverized samples were weighed and Polytron homogenized (Brinkmann Instruments) in ice-cold lysis buffer (1:10, wt/vol) containing 20 mM Tris·HCl (pH 7.4), 1% Triton-X 100, 50 mM NaCl, 250 mM sucrose, 50 mM NaF, 5 mM sodium pyrophosphate, 2 mM dithiothreitol (DTT), 4 mg/l leupeptin, 50 mg/l trypsin inhibitor, 0.1 mM benzamidine, and 0.5 mM PMSF, followed by centrifuging at 14,000 g for 20 min at 4°C. Supernatants were removed and used for protein concentration measurements, Western blotting, and AMPK activity assay.
Cell culture. L6 myoblast cells (1 x 10 6 cells; gift from Dr. Amira Klip, University of Toronto, Toronto, ON, Canada) were plated on 60-mm dishes and grown in
-MEM with 10% fetal bovine serum. Each plasmid DNA (7 µg) was introduced into cells with Lipofectamine 2000 reagent (Invitrogen). Cells were then cultured for another 48 h and then harvested with ice-cold AMPK lysis buffer.
Immunoblotting. Protein (20 µg) from cells and muscle lysates was separated by 8% SDS-PAGE and transferred to nitrocellulose membranes. The membranes were blocked in Tris-buffered saline with 0.05% Tween 20 (TBST) and 5% nonfat milk for 1 h at room temperature. The membranes were incubated overnight at 4°C with the appropriate primary antibodies. Bound primary antibodies were detected with anti-rabbit (Amersham) or mouse immunoglobulinhorseradish peroxidase-linked whole antibody (Transduction Laboratories, Lexington, KY). The membranes were washed with TBST and then incubated with enhanced chemiluminescence reagents (Perkin-Elmer) and exposed to film. Bands were visualized and quantified using Image-Quant software (Molecular Dynamics).
mRNA levels of AMPK
3L and AMPK
3S. The mRNA levels were determined on the basis of PCR. cDNA was synthesized from mouse quadriceps muscle mRNA by reverse transcription, adaptor-ligated double-strand cDNA was used as a template (Clontech), and the adaptor sequence (5'-ccatcctaatacgactcactatagggc-3') attached to the 5'-end of cDNA including both
3S and
3L cDNA was used as the sense primer. The sequence 5'-agccatggcatcataacaggtgtgttcc-3', conserved in both
3L and
3S, was used as the antisense primer. The two resulting products from the unsaturated PCR reaction were separated by 1% agarose gel and confirmed by DNA sequencing.
Immunoprecipitation. Muscle lysates (200 µg) were incubated with anti-AMPK
1/2 or -AMPK
antibody-bound protein A/G beads (Santa Cruz Biotechnology, Santa Cruz, CA) overnight at 4°C. The immunocomplex was washed with lysis buffer and boiled in Laemmli's buffer. The samples were separated by 8% SDS-PAGE, transferred to nitrocellulose membranes, and then immunoblotted with appropriate antibodies.
AMPK activity assay and glycogen content. AMPK activity assay was performed as described by Musi et al. (35). Briefly, muscle lysates were immunoprecipitated with specific antibodies to the
1 and
2 catalytic subunits of AMPK and protein A/G beads. Immunoprecipitates were assayed for AMPK activity in assay buffer containing 0.2 mM AMP, 0.2 mM ATP (2 µCi [
-32P]ATP), and 0.2 mM synthetic AMPK substrate peptide (SAMS) with the sequence HMRSAMSGLHLVKRR for 20 min at 30°C (14, 35). For glycogen measurements, a muscle piece was weighed and hydrolyzed in 2 N HCl at 100°C for 2 h, followed by neutralization with 2 N NaOH. Glycogen concentrations were then determined by the hexokinase enzymatic method, using the glucose HK reagent (Sigma, St. Louis, MO).
Generation of recombinant AMPK
3. The coding region of AMPK
3S or AMPK
3L was obtained by PCR with the sense primer spanning the start codon containing a Kozac sequence, with or without a Flag-tag sequence and antisense primer spanning the stop codon. The purified PCR product was subcloned into pCR 2.1-TOPO vector and sequenced. The EcoI fragment containing the AMPK
3 in the pCR 2.1-TOPO vector was excised and subcloned into the pCAGGS vector. Sense primers were as follows:
3S, 5'-gcggccgcgccaccatggacttcttagaacaaggagaaaactcatggc-3'; Flag-
3S, 5'-gcggccgcgccaccatggactacaaggacgacgatgacaagatggacttcttagaacaaggagaaaactcatggc-3';
3L, 5'-gcggccgcgccaccatggagcccgagctggagcacac-3'; and Flag-
3L, gcggccgcgccaccatggactacaaggacgacgatgacaagatggagcccgagctggagcacac-3'; and the antisense primer for
3S, Flag-
3S,
3L, and Flag-
3L was 5'-gaggccgctcaggcgctgagggcatcga-3'.
Expression of AMPK
3S and AMPK
3L in tibialis anterior muscle. DNA injection and in vivo electroporation were done by a modification (18) of the method of Aihara and Miyazaki (2). Mice were anesthetized with pentobarbital sodium (90 mg/kg body wt ip), and 100 µg of pCAGGS-AMPK
3S, pCAGGS-AMPK
3L, or an equal amount of empty pCAGGS vector in 25 µl of saline was injected into the tibialis anterior (TA) muscle, using an insulin syringe with a 29-gauge needle. For the control, an equal amount of pCAGGS alone was injected into the opposite leg. With the use of an electric pulse generator, square-wave electrical pulses (200 V/cm) were applied eight times at a rate of 1 pulse/s with each pulse being 20 ms in duration. The electrodes used were a pair of stainless steel needles inserted and fixed 5 mm apart into the TA muscle. Nine days after gene delivery, the muscles were removed and prepared for AMPK activity, Western blotting, and the measurements of glycogen content.
Muscle contraction. pCAGGS-AMPK
3S, pCAGGS-AMPK
3L, or an equal amount of empty pCAGGS vector was injected into the TA muscle, followed by electroporation. Nine days later, mice were anesthetized with pentobarbital sodium (90 mg/kg body wt ip), the sciatic nerves of both legs were surgically exposed, and subminiature electrodes were attached to the nerves (22, 39). Hindlimb muscles of one leg were electrically stimulated to contract for 20 min (train rate 1/s, train duration 500 ms, rate 100 pulses/s, duration 0.1 ms, 13 V), using a Grass S88 pulse generator, and the other leg served as a sham-operated control. Immediately after nerve stimulation, mice were killed and tibialis muscles were rapidly dissected and frozen in liquid nitrogen.
Statistical analysis. Data are presented as means ± SE. One-way analysis of variance was used for statistical evaluation. Differences between means were determined using the Student-Newman-Keuls test.
| RESULTS |
|---|
|
|
|---|
3 gene. The full-length sequence of the mouse AMPK
3 gene was obtained by a combination of RT-PCR and 5'- and 3'-RACE. Sequence analysis of the 1,197-bp fragment from RT-PCR revealed a sequence similar to human and pig AMPK
3 that was used to design primers for both 5'- and 3'-RACE. The 3'-RACE products were 1,500 bp; sequencing and contiguous analysis revealed that they overlapped with the RT-PCR core 1,197-bp fragment. This demonstrated that the fragment from 3'-RACE is an extension of the core fragment of the mouse AMPK
3 gene. The 5'-RACE product contained 600- and 630-bp bands. Sequencing and contiguous analysis revealed that the two fragments shared the same sequence at their 3'-region and that this region also overlapped with the core 1,197-bp fragment of mouse AMPK
3 gene, with the remaining 5'-regions being different (Fig. 1B). The RT-PCR and 3'- and 5'-RACE results suggest that there are two variants of the mouse AMPK
3 gene that have distinct 5'-regions but are identical throughout the remainder of the gene. Sequence analysis showed that variant 1 contains a 1,392-bp open reading frame. The initiation methionine in variant 1 was designed by an upstream in-frame stop codon and the Kozac sequence surrounding it, and no obvious poly(A) tail or polyadenylation site consensus sequence was found in the 3'-noncoding region. The sequence analysis of variant 2 showed that it contains a 1,467-bp open reading frame (Fig. 1B) and shared the same 3'-noncoding region with variant 1. The first methionine in variant 2 was identified by the preceding stop codon (Fig. 1B). Genomic DNA analysis demonstrated that the two variants are the result of different splicing of the first exon (Fig. 1B). On the basis of the length of the open reading frame, we named variants 1 and 2 the AMPK
3 short form (AMPK
3S; AF525501
[GenBank]
) and the AMPK
3 long form (AMPK
3L; AF525500
[GenBank]
), respectively. The Mouse Genome Informatics ID for both
3S and
3L is MGI:1891343.
3S contains 465 deduced amino acids, whereas
3L contains 490 amino acids. The two splice isoforms share 100% identity except for an extra 25 amino acids at the NH2-terminal of
3L (Fig. 1B). Both AMPK
3S and AMPK
3L share high identity and similar overall protein structure with pig and human AMPK
3 subunits, and little identity with the
1 and
2 subunits.
|
Figure 1C shows the deduced amino acid sequence alignment of mouse
3S and
3L compared with pig
3, the two different human
3 sequences that were reported with different initiation sites, and rat
3 (XM_237293
[GenBank]
). Mouse
3S shows overall 85.5% identity to human (AF214519
[GenBank]
) and pig
3. Mouse
3L is most similar to another reported human
3 gene (NM_017431
[GenBank]
) that contains an altered initiation site and also has 85.5% identity. The four CBS domains are highly conserved, showing 96% identity in all species, whereas the remainder of the NH2-terminal region shows 66% identity. Interestingly, both AMPK
3 splice variants are rich in serine and threonine at the NH2-terminal region; these are potential phosphorylation sites for a number of protein kinases including glycogen synthase kinase 3, protein kinase A, and protein kinase C, based on consensus sequence searches for these kinases using PhosphoBase (http://www.cbs.dtu.dk/databases/PhosphoBase/).
AMPK
3 protein expression. To determine the expression pattern of AMPK
3, we generated an antibody against a conserved sequence within COOH termini of mouse
3S and
3L, human
3, and pig
3 (Fig. 1C). Immunoblotting with
3 antibody revealed that AMPK
3 is highly expressed in gastrocnemius muscle, with no detectable signal in heart, brain, lung, liver, kidney, pancreas, spleen, white fat, or brown fat (Fig. 2A). These results are consistent with Northern hybridization data from human tissues, which showed that AMPK
3 is specifically expressed in skeletal muscle (11, 31). Interestingly, white fast-twitch glycolytic skeletal muscle that contains mostly type IIb fibers (white quadriceps and white gastrocnemius) showed higher levels of AMPK
3 expression compared with the red fast-twitch oxidative-glycolytic muscle, which contains primarily type IIa fibers (red quadriceps and red gastrocnemius). AMPK
3 was not detectable in soleus, a muscle that is composed almost exclusively of red slow-twitch oxidative type I fibers. This expression pattern suggests that AMPK
3 plays a unique role in skeletal muscle, especially in the more fast-twitch glycolytic fiber types.
|
Immunoblotting of mouse skeletal muscle (quadriceps) and human skeletal muscle with
3 antibody reveals a single band (Fig. 2B). To determine whether
3S or
3L is expressed in mouse and human skeletal muscle, we overexpressed recombinant mouse
3S and
3L in L6 myoblast cells that do not express endogenous AMPK
3. Cell lysates were compared with endogenous
3 from mouse and human muscle lysates. As shown in Fig. 2B, mouse endogenous AMPK
3 had the same molecular size as
3L, suggesting that AMPK
3L is the predominant form in mouse muscle. On the other hand, human AMPK
3 had the same molecular size as
3S, although this finding will need to be confirmed in future studies using overexpressed human
3. The double band on SDS-PAGE of overexpressed
3S suggests that the expressed protein in the cells was partially degraded.
In addition,
3L is more abundant compared with
3S at the mRNA level (Fig. 2C), and this is consistent with Western blotting data showing that
3L is the predominant form in skeletal muscle (Fig. 2B). The
3S variant was detected by PCR (5'-RACE), but protein was not expressed. This may be explained by the following possibilities: 1) the lower
3S mRNA results in very low levels of
3S protein, beyond the detection of the
3 antibody; 2) there may be an inhibitory mechanism at the translational or posttranslational steps that suppresses
3S protein expression; and/or 3)
3S protein is less stable and is more rapidly degraded.
The molecular masses of
3S and
3L in SDS-PAGE were 64 and 67 kDa, respectively, different from their predicted molecular masses of 51 and 54 kDa. The reason for the mobility shift of
3 in a denatured gel is unclear, although interestingly, the same phenomenon has been observed in the AMPK
1 subunit. In SDS-PAGE the molecular mass of AMPK
1 isolated from rat liver is 38 kDa higher than the predicted molecular mass of 30 kDa (50).
Association of
3 subunit with
- and
-subunits. To determine whether the
3 subunit associates with the
catalytic subunit, we used mouse muscle lysates for the immunoprecipitation of AMPK
, using an anti-AMPK
-specific antibody that recognizes both
1 and
2. As shown in Fig. 3A, the anti-AMPK
1/2 antibody immunoprecipitates
1/2 and coprecipitates both the
1 subunit and the
3 subunit from mouse skeletal muscle lysates. There was also concomitant immunodepletion of AMPK
1/2, AMPK
1, and the AMPK
3 subunits from the immunosupernatant. In contrast, control IgG did not pull down any of these proteins, and AMPK
1/2, AMPK
1, and AMPK
3 are preserved in the supernatant. This experiment also confirms that AMPK
3 runs as a 67-kDa band in SDS-PAGE (Fig. 2, A and B, and Fig. 3A). When AMPK
1 was immunoprecipitated in skeletal muscle lysates with the use of a commercially available antibody, AMPK
1 was barely detectable (not shown), and because an antibody for the immunoprecipitation of AMPK
2 was not commercially available, the potential association of
with
3 was determined by expressing exogenous AMPK
1 and
3L in L6 myoblast cells. We chose
3L because this is the endogenous splice isoform of AMPK
3 in mouse skeletal muscle. This experiment revealed that expressed AMPK
3 could be coimmunoprecipitated with the
1 subunit (Fig. 3B).
|
Overexpression of AMPK
3S and AMPK
3L in mouse TA muscle in vivo. To determine the effects of
3S and
3L on AMPK activity and glycogen metabolism in skeletal muscle, we used a gene transfer/electroporation system to express the two splice variants in mouse TA muscle in vivo. By using this method in preliminary experiments using the LacZ gene, 85.7 ± 2.3% (n = 6) of fibers were determined to express
-galactosidase (18). AMPK
3S and AMPK
3L expression levels were measured at days 7, 9, and 14 after gene transfer/electroporation, and maximal expression occurred at day 9 (
1.5- to 2.5-fold greater than endogenous AMPK
3); thus all subsequent experiments were done using this time point. Figure 4A, top, shows that, as predicted, Flag-tagged AMPK
3L ran at a higher molecular mass compared with Flag-tagged
3S. Figure 4A, middle, shows the degree of overexpression of
3S and
3L compared with endogenous
3 and also confirms the experimental results shown in Fig. 2B, demonstrating that the
3L splice variant is endogenously expressed in mouse skeletal muscle. Figure 4A, bottom, shows that recombinant AMPK
3S and AMPK
3L did not affect endogenous
1 protein levels, suggesting that
3 overexpression does not replace this isoform. Endogenous
2 isoform was not determined because anti-
2 antibodies were not commercially available. In lysates from TA muscle, overexpressed AMPK
3S and AMPK
3L could be coimmunoprecipitated with the
-subunit (Fig. 4B).
|
Overexpression of both AMPK
3S and AMPK
3L in vivo resulted in a significant increase in AMPK
1 catalytic activity (Fig. 5A, left). The increase in AMPK
1 activity was associated with an increase in AMPK
1 Thr172 phosphorylation, determined by AMPK
1 immunoprecipitation followed by Western blotting using a phosphospecific AMPK
antibody (Fig. 5A, right). The increases in AMPK
1 activity and phosphorylation were not due to an increase in AMPK
1 protein expression (Fig. 5A, right). In contrast, AMPK
3S and AMPK
3L expression in vivo had no effect on AMPK
2 activity, phosphorylation, and expression (Fig. 5B), although the phosphorylation of AMPK
2 in the basal condition was barely detectable. The increase in AMPK
1 activity was not associated with changes in glycogen concentrations in the muscle (Fig. 5C). Consistent with this finding, overexpression of AMPK
3S and AMPK
3L had no effect on glycogen synthase protein expression or the phosphorylation state of glycogen synthase (Fig. 5C). Several other muscle proteins were also not altered by expression of AMPK
3S and AMPK
3L, including GLUT-4, citrate synthase, and phosphoacetyl CoA carboxylase proteins known to be involved in the regulation of glucose uptake, mitochondria biogenesis, and fatty acid oxidation, respectively (data not shown).
|
In addition, AMPK
3L or AMPK
3S overexpression did not change the susceptibility of AMPK to activation by contraction. As we and others have previously reported (19, 46), in situ contraction resulted in a very modest increase in AMPK
1 activity, and this increase was not different among the three groups (vector control: 33.4 ± 14.8% over basal,
3S: 27.6 ± 14.8%,
3L: 26.7 ± 13.4%, n = 8/group). The increase in AMPK
2 activity in response to in situ contraction was also similar among the three groups (vector control: 116.7 ± 14.5%,
3S: 90.3 ± 23.5%,
3L: 121.8 ± 26.5%, n = 8/group).
3L and
3S expression was confirmed by Western blotting of muscle lysates.
| DISCUSSION |
|---|
|
|
|---|
3 gene and determined that there are two translation initiation sites that lead to two different AMPK
3 splice isoforms, a short form,
3S, and a long form,
3L (Fig. 1, AC). Both
3L and
3S are full-length genes (Fig. 1B) and, by genomic DNA analysis, are identified as two splice isoforms (Fig. 1B). Western blot analysis of mouse and human muscle lysates suggests that
3L is the predominant form in mouse skeletal muscle (Fig. 2B), whereas
3S is probably the predominant form in human skeletal muscle (Fig. 5). The finding suggests that both splice variants are physiologically relevant. This finding also clarifies discrepancies in previous reports showing differences in translation initiation sites for the human
3 gene (11, 31). By immunoprecipitation with anti-
- and
-subunit antibodies, our data also show that the
3 subunit is associated with the
- and
-subunits (Fig. 3, A and B). Thus the
3 subunit can be a component of the AMPK heterotrimeric complexes, similar to what has been demonstrated for the
1 subunit (50) and the yeast isoform of the
-subunit, SNF4 (9).
Western blot analysis of mouse tissue lysates using a
3-specific antibody clearly showed that AMPK
3 was only detected in skeletal muscle. However, another report has suggested that
3 is mainly distributed in brain and testis, by measuring the proportion of total AMPK activity (11). Although we do not have an explanation for the difference between our work and that of Cheung et al. (11), our data are consistent with Northern blotting results from two independent groups showing
3 mRNA only in skeletal muscle (11, 31). Though
3 is only present in skeletal muscle, we found different levels of expression of
3 in muscle composed of various muscle fiber types. White muscles, which contain predominantly fast-twitch glycolytic (type IIb) fibers, showed the highest levels of
3 expression. The red muscles, which contain predominantly fast-twitch oxidative glycolytic (type IIa) fibers, had lower levels of expression, whereas
3 was undetectable in soleus muscle, which is a slow-twitch oxidative muscle with predominantly type I fibers. The type IIb fibers present predominantly in white muscles are abundant in fasttwitch myosin isoforms and have a more glycolytic metabolic phenotype. These fibers are recruited during high-intensity types of contractions, rapidly providing energy through glycogenolysis. Whether wild-type
3 regulates AMPK activity in a manner that promotes the rapid utilization of glycogen is not known, but this is an interesting hypothesis to test in future studies. The lower levels of
3 expression in the red oxidative fibers provide an explanation for the previous observation that excess glycogen accumulation specifically occurs in white muscles in pigs with the RN mutation in the PRKAG3 gene (R200Q mutation in AMPK
3) (17). Interestingly, incubation of muscles with the AMPK activator 5-aminoimidazole-4-carboxamide ribonucleoside (AICAR) only increases AMPK activity in the highly glycolytic white epitrochlearis muscle but has no effect in the red oxidative (type I) soleus muscle (1, 27), (Hirshman MF, Goodyear LJ, and Hayashi T, unpublished observation). It is not known whether
3 expression is needed for AMPK to respond to AICAR in mouse skeletal muscle.
We successfully overexpressed AMPK
3S and AMPK
3L in mouse skeletal muscle by using a gene transfer and electroporation system and found that both splice variants associate with the endogenous AMPK
subunit (Fig. 4B). Using this experimental system, we found that expression of AMPK
3S and AMPK
3L increased AMPK
1 activity and phosphorylation but had no effect on AMPK
2 activity and phosphorylation. The increase in AMPK
1 activity was not due to an increase in AMPK
1 protein, suggesting that the increase in phosphorylation of AMPK
1 is responsible for the increase in AMPK
1 activity. The mechanism by which
3 overexpression increases
1 phosphorylation and activity in vivo is unclear. Different
-subunits have been reported to account for different proportions of total AMPK activity (11), and therefore an exchange between isoforms could lead to a change in AMPK activity. However, endogenous
1 expression was not changed in response to
3 overexpression (Fig. 4A), making this mechanism unlikely to account for the increase in AMPK
1 activity. Another possibility is that
3 could favorably alter the conformation of
1-containing AMPK heterotrimer, which in turn could enhance
1 phosphorylation by upstream signals such as AMPK kinase or retard dephosphorylation by phosphatases. Unfortunately, we are not able to directly compare the amount of
3 subunit associated with
1 and
2, because anti-AMPK
1 and anti-AMPK
2 antibodies have different affinities to
1 and
2 subunits.
There are now multiple examples demonstrating
1- and
2-specific AMPK regulation in response to various perturbations (6, 27, 45). One example is in cardiac hypertrophy, where AMPK
1 activity and expression are increased whereas
2 expression is decreased (45). Exercise training also specifically upregulates AMPK
1 in skeletal muscle (6). Another example is the recent report that obesity-related insulin resistance is associated with a specific impairment in contraction-stimulated
1 activity in skeletal muscle in rats (6). Because we found that
3 overexpression results in an
1-specific activation, in future studies it will be interesting to determine whether altered
3 expression plays a role in the impaired
1 response observed in these insulin resistant animals.
The AMPK
3 mutation from arginine to glutamine at position 200 (R200Q) results in muscle glycogen accumulation in the Hampshire pig. In contrast, the valine-to-isoleucine mutation at position 199 in the same species reduces muscle glycogen content (3, 12). The fact that adjacent mutations at V199 and R200 in the CBS domain of the
3 subunit cause opposite effects on muscle glycogen content suggests that structural changes in this part of the CBS domain alter enzyme function. In our study, modest overexpression of wild-type AMPK
3 did not change muscle glycogen concentrations and had no effect on the expression and phosphorylation of glycogen synthase (Fig. 5C), despite significant increases in AMPK
1 activity. Furthermore, despite major differences in the amount of endogenous
3 protein among muscles of different fiber types, we did not observe a significant difference in muscle glycogen concentrations in these various muscles (Yu H, Hirshman MF, and Goodyear LJ, unpublished observation). These results suggest that wild-type AMPK
3 does not directly regulate muscle glycogen concentrations and that the mutations are the cause of the alterations in glycogen metabolism.
In summary, we have cloned the full-length mouse AMPK
3 gene and identified two
3 splice variants,
3S and
3L. Both
3S and
3L can associate with the
- and
-subunits of AMPK. These two splice variants appear to be differentially expressed in human and mouse skeletal muscle. Overexpression of either
3S or
3L results in a specific increase in AMPK
1 activity and phosphorylation, but these changes are not associated with alterations in muscle glycogen.
| ACKNOWLEDGMENTS |
|---|
1 vector and anti-AMPK
1 antibody, and Dr. John C. Lawrence, Jr. (University of Virginia, Charlottesville, VA) for providing anti-glycogen synthase antibody. GRANTS
This work was supported by National Institute of Arthritis and Musculoskeletal and Skin Diseases Grants AR-42338 and AR-45670 and by grants from the American Diabetes Association (to L. J. Goodyear). H. Yu is supported by a mentor-based fellowship awarded to L. J. Goodyear from the American Diabetes Association.
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
2. Aihara H and Miyazaki J. Gene transfer into muscle by electroporation in vivo. Nat Biotechnol 16: 867870, 1998.[CrossRef][Web of Science][Medline]
3. Andersson L. Identification and characterization of AMPK gamma3 mutations in the pig. Biochem Soc Trans 31: 232235, 2003.[Web of Science][Medline]
4. Arad M, Benson DW, Perez-Atayde AR, McKenna WJ, Sparks EA, Kanter RJ, McGarry K, Seidman JG, and Seidman CE. Constitutively active AMP kinase mutations cause glycogen storage disease mimicking hypertrophic cardiomyopathy. J Clin Invest 109: 357362, 2002.[CrossRef][Web of Science][Medline]
5. Aschenbach WG, Suzuki Y, Breeden K, Prats C, Hirshman MF, Dufresne SD, Sakamoto K, Vilardo PG, Steele M, Kim JH, Jing SS, Goodyear LJ, and DePaoli-Roach AA. The muscle-specific protein phosphatase PP1G/RGL(GM) is essential for activation of glycogen synthase by exercise. J Biol Chem 276: 3995939967, 2001.
6. Barnes BR, Ryder JW, Steiler TL, Fryer LG, Carling D, and Zierath JR. Isoform-specific regulation of 5' AMP-activated protein kinase in skeletal muscle from obese Zucker (fa/fa) rats in response to contraction. Diabetes 51: 27032708, 2002.
7. Bateman A. The structure of a domain common to archaebacteria and the homocystinuria disease protein. Trends Biochem Sci 22: 1213, 1997.[Web of Science][Medline]
8. Blair E, Redwood C, Ashrafian H, Oliveira M, Broxholme J, Kerr B, Salmon A, Ostman-Smith I, and Watkins H. Mutations in the
2 subunit of AMP-activated protein kinase cause familial hypertrophic cardiomyopathy: evidence for the central role of energy compromise in disease pathogenesis. Hum Mol Genet 10: 12151220, 2001.
9. Celenza JL, Eng FJ, and Carlson M. Molecular analysis of the SNF4 gene of Saccharomyces cerevisiae: evidence for physical association of the SNF4 protein with the SNF1 protein kinase. Mol Cell Biol 9: 50455054, 1989.
10. Chen Z, Heierhorst J, Mann RJ, Mitchelhill KI, Michell BJ, Witters LA, Lynch GS, Kemp BE, and Stapleton D. Expression of the AMP-activated protein kinase
1 and
2 subunits in skeletal muscle. FEBS Lett 460: 343348, 1999.[CrossRef][Web of Science][Medline]
11. Cheung PC, Salt IP, Davies SP, Hardie DG, and Carling D. Characterization of AMP-activated protein kinase
-subunit isoforms and their role in AMP binding. Biochem J 346: 659669, 2000.[CrossRef][Web of Science][Medline]
12. Ciobanu D, Bastiaansen J, Malek M, Helm J, Woollard J, Plastow G, and Rothschild M. Evidence for new alleles in the protein kinase adenosine monophosphate-activated
3-subunit gene associated with low glycogen content in pig skeletal muscle and improved meat quality. Genetics 159: 11511162, 2001.
13. Crute BE, Seefeld K, Gamble J, Kemp BE, and Witters LA. Functional domains of the
1 catalytic subunit of the AMP-activated protein kinase. J Biol Chem 273: 3534735354, 1998.
14. Davies SP, Carling D, and Hardie DG. Tissue distribution of the AMP-activated protein kinase, and lack of activation by cyclic-AMP-dependent protein kinase, studied using a specific and sensitive peptide assay. Eur J Biochem 186: 123128, 1989.[Web of Science][Medline]
15. Davies SP, Helps NR, Cohen PT, and Hardie DG. 5'-AMP inhibits dephosphorylation, as well as promoting phosphorylation, of the AMP-activated protein kinase. Studies using bacterially expressed human protein phosphatase-2C
and native bovine protein phosphatase-2AC. FEBS Lett 377: 421425, 1995.[CrossRef][Web of Science][Medline]
16. Dean D, Daugaard JR, Young ME, Saha A, Vavvas D, Asp S, Kiens B, Kim KH, Witters L, Richter EA, and Ruderman N. Exercise diminishes the activity of acetyl-CoA carboxylase in human muscle. Diabetes 49: 12951300, 2000.[Abstract]
17. Estrade M, Vignon X, Rock E, and Monin G. Glycogen hyperaccumulation in white muscle fibres of RNcarrier pigs. A biochemical and ultrastructural study. Comp Biochem Physiol B 104: 321326, 1993.[CrossRef][Medline]
18. Fujii N, Boppart MD, Dufresne SD, Jozsi AC, Crowley PF, Hirshman MF, and Goodyear LJ. Overexpression of JNK in skeletal muscle does not alter glycogen synthase activity (Abstract). Diabetes 50, Suppl 2: A276, 2001.
19. Fujii N, Hayashi T, Hirshman MF, Smith JT, Habinowski SA, Kaijser L, Mu J, Ljungqvist O, Birnbaum MJ, Witters LA, Thorell A, and Goodyear LJ. Exercise induces isoform-specific increase in 5' AMP-activated protein kinase activity in human skeletal muscle. Biochem Biophys Res Commun 273: 11501155, 2000.[CrossRef][Web of Science][Medline]
20. Gollob MH, Green MS, Tang AS, Gollob T, Karibe A, Hassan AS, Ahmad F, Lozado R, Shah G, Fananapazir L, Bachinski LL, and Roberts R. Identification of a gene responsible for familial Wolff-Parkinson-White syndrome. N Engl J Med 344: 18231831, 2001.
21. Goodyear LJ. AMP-activated protein kinase: a critical signaling intermediary for exercise-stimulated glucose transport? Exerc Sport Sci Rev 28: 113116, 2000.[Medline]
22. Goodyear LJ, Giorgino F, Balon TW, Condorelli G, and Smith RJ. Effects of contractile activity on tyrosine phosphoproteins and PI 3-kinase activity in rat skeletal muscle. Am J Physiol Endocrinol Metab 268: E987E995, 1995.
23. Hardie DG and Hawley SA. AMP-activated protein kinase: the energy charge hypothesis revisited. Bioessays 23: 11121119, 2001.[CrossRef][Web of Science][Medline]
24. Hawley SA, Davison M, Woods A, Davies SP, Beri RK, Carling D, and Hardie DG. Characterization of the AMP-activated protein kinase kinase from rat liver and identification of threonine 172 as the major site at which it phosphorylates AMP-activated protein kinase. J Biol Chem 271: 2787927887, 1996.
25. Holmes BE, Kurth-Kraczek EJ, and Winder WW. Chronic activation of 5'-AMP-activated protein kinase increases GLUT4, hexokinase, and glycogen in muscle. J Appl Physiol 87: 19901995, 1999.
26. Hutber CA, Hardie DG, and Winder WW. Electrical stimulation inactivates muscle acetyl-CoA carboxylase and increases AMP-activated protein kinase. Am J Physiol Endocrinol Metab 272: E262E266, 1997.
27. Jessen N, Pold R, Buhl ES, Jensen LS, Schmitz O, and Lund S. Effects of AICAR and exercise on insulin-stimulated glucose uptake, signaling, and GLUT-4 content in rat muscles. J Appl Physiol 94: 13731379, 2003.
28. Kraus JP, Janosik M, Kozich V, Mandell R, Shih V, Sperandeo MP, Sebastio G, de Franchis R, Andria G, Kluijtmans LA, Blom H, Boers GH, Gordon RB, Kamoun P, Tsai MY, Kruger WD, Koch HG, Ohura T, and Gaustadnes M. Cystathionine
-synthase mutations in homocystinuria. Hum Mutat 13: 362375, 1999.[CrossRef][Web of Science][Medline]
29. Leclerc I, Lenzner C, Gourdon L, Vaulont S, Kahn A, and Viollet B. Hepatocyte nuclear factor-4
involved in type 1 maturity-onset diabetes of the young is a novel target of AMP-activated protein kinase. Diabetes 50: 15151521, 2001.
30. Merrill GF, Kurth EJ, Hardie DG, and Winder WW. AICA riboside increases AMP-activated protein kinase, fatty acid oxidation, and glucose uptake in rat muscle. Am J Physiol Endocrinol Metab 273: E1107E1112, 1997.
31. Milan D, Jeon JT, Looft C, Amarger V, Robic A, Thelander M, Rogel-Gaillard C, Paul S, Iannuccelli N, Rask L, Ronne H, Lundstrom K, Reinsch N, Gellin J, Kalm E, Roy PL, Chardon P, and Andersson L. A mutation in PRKAG3 associated with excess glycogen content in pig skeletal muscle. Science 288: 12481251, 2000.
32. Minokoshi Y, Kim YB, Peroni OD, Fryer LG, Muller C, Carling D, and Kahn BB. Leptin stimulates fatty-acid oxidation by activating AMP-activated protein kinase. Nature 415: 339343, 2002.[CrossRef][Medline]
33. Mitchelhill KI, Stapleton D, Gao G, House C, Michell B, Katsis F, Witters LA, and Kemp BE. Mammalian AMP-activated protein kinase shares structural and functional homology with the catalytic domain of yeast Snf1 protein kinase. J Biol Chem 269: 23612364, 1994.
34. Mu J, Brozinick JT Jr, Valladares O, Bucan M, and Birnbaum MJ. A role for AMP-activated protein kinase in contraction- and hypoxia-regulated glucose transport in skeletal muscle. Mol Cell 7: 10851094, 2001.[CrossRef][Web of Science][Medline]
35. Musi N, Fujii N, Hirshman MF, Ekberg I, Froberg S, Ljungqvist O, Thorell A, and Goodyear LJ. AMP-activated protein kinase (AMPK) is activated in muscle of subjects with type 2 diabetes during exercise. Diabetes 50: 921927, 2001.
36. Nielsen JN, Wojtaszewski JF, Haller RG, Hardie DG, Kemp BE, Richter EA, and Vissing J. Role of 5'AMP-activated protein kinase in glycogen synthase activity and glucose utilization: insights from patients with McArdle's disease. J Physiol 541: 979989, 2002.
37. Park SH, Gammon SR, Knippers JD, Paulsen SR, Rubink DS, and Winder WW. Phosphorylation-activity relationships of AMPK and acetyl-CoA carboxylase in muscle. J Appl Physiol 92: 24752482, 2002.
38. Ponticos M, Lu QL, Morgan JE, Hardie DG, Partridge TA, and Carling D. Dual regulation of the AMP-activated protein kinase provides a novel mechanism for the control of creatine kinase in skeletal muscle. EMBO J 17: 16881699, 1998.[CrossRef][Web of Science][Medline]
39. Ruderman NB, Houghton CRS, and Hems R. Evaluation of the isolated perfused rat hindquarter for the study of muscle metabolism. Biochem J 124: 639651, 1971.[Web of Science][Medline]
40. Stapleton D, Gao G, Michell BJ, Widmer J, Mitchelhill K, Teh T, House CM, Witters LA, and Kemp BE. Mammalian 5'-AMP-activated protein kinase non-catalytic subunits are homologs of proteins that interact with yeast Snf1 protein kinase. J Biol Chem 269: 2934329346, 1994.
41. Stein SC, Woods A, Jones NA, Davison MD, and Carling D. The regulation of AMP-activated protein kinase by phosphorylation. Biochem J 345: 437443, 2000.[CrossRef][Web of Science][Medline]
42. Stephens TJ, Chen ZP, Canny BJ, Michell BJ, Kemp BE, and McConell GK. Progressive increase in human skeletal muscle AMPK
2 activity and ACC phosphorylation during exercise. Am J Physiol Endocrinol Metab 282: E688E694, 2002.
43. Stoppani J, Hildebrandt AL, Sakamoto K, Cameron-Smith D, Goodyear LJ, and Neufer PD. AMP-activated protein kinase activates transcription of the UCP3 and HKII genes in rat skeletal muscle. Am J Physiol Endocrinol Metab 283: E1239E1248, 2002.
44. Thornton C, Snowden MA, and Carling D. Identification of a novel AMP-activated protein kinase
subunit isoform that is highly expressed in skeletal muscle. J Biol Chem 273: 1244312450, 1998.
45. Tian R, Musi N, D'Agostino J, Hirshman MF, and Goodyear LJ. Increased adenosine monophosphate-activated protein kinase activity in rat hearts with pressure-overload hypertrophy. Circulation 104: 16641669, 2001.
46. Vavvas D, Apazidis A, Saha AK, Gamble J, Patel A, Kemp BE, Witters LA, and Ruderman NB. Contraction-induced changes in acetyl-CoA carboxylase and 5'-AMP-activated kinase in skeletal muscle. J Biol Chem 272: 1325513261, 1997.
47. Winder WW. Energy-sensing and signaling by AMP-activated protein kinase in skeletal muscle. J Appl Physiol 91: 10171028, 2001.
48. Winder WW and Hardie DG. Inactivation of acetyl-CoA carboxylase and activation of AMP-activated protein kinase in muscle during exercise. Am J Physiol Endocrinol Metab 270: E299E304, 1996.
49. Wojtaszewski JF, Jorgensen SB, Hellsten Y, Hardie DG, and Richter EA. Glycogen-dependent effects of 5-aminoimidazole-4-carboxamide (AICA)-riboside on AMP-activated protein kinase and glycogen synthase activities in rat skeletal muscle. Diabetes 51: 284292, 2002.
50. Woods A, Cheung PC, Smith FC, Davison MD, Scott J, Beri RK, and Carling D. Characterization of AMP-activated protein kinase
and
subunits. Assembly of the heterotrimeric complex in vitro. J Biol Chem 271: 1028210290, 1996.
51. Yang W, Hong YH, Shen XQ, Frankowski C, Camp HS, and Leff T. Regulation of transcription by AMP-activated protein kinase. Phosphorylation of p300 blocks its interaction with nuclear receptors. J Biol Chem 276: 3834138344, 2001.
This article has been cited by other articles:
![]() |
V. W. Dolinsky and J. R. B. Dyck Role of AMP-activated protein kinase in healthy and diseased hearts Am J Physiol Heart Circ Physiol, December 1, 2006; 291(6): H2557 - H2569. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-J. Koh, D. E. Arnolds, N. Fujii, T. T. Tran, M. J. Rogers, N. Jessen, Y. Li, C. W. Liew, R. C. Ho, M. F. Hirshman, et al. Skeletal Muscle-Selective Knockout of LKB1 Increases Insulin Sensitivity, Improves Glucose Homeostasis, and Decreases TRB3 Mol. Cell. Biol., November 15, 2006; 26(22): 8217 - 8227. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yu, M. F. Hirshman, N. Fujii, J. M. Pomerleau, L. E. Peter, and L. J. Goodyear Muscle-specific overexpression of wild type and R225Q mutant AMP-activated protein kinase {gamma}3-subunit differentially regulates glycogen accumulation Am J Physiol Endocrinol Metab, September 1, 2006; 291(3): E557 - E565. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. B. Jorgensen, E. A. Richter, and J. F. P. Wojtaszewski Role of AMPK in skeletal muscle metabolic regulation and adaptation in relation to exercise J. Physiol., July 1, 2006; 574(1): 17 - 31. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sriwijitkamol, J. L. Ivy, C. Christ-Roberts, R. A. DeFronzo, L. J. Mandarino, and N. Musi LKB1-AMPK signaling in muscle from obese insulin-resistant Zucker rats and effects of training Am J Physiol Endocrinol Metab, May 1, 2006; 290(5): E925 - E932. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Ryder, Y. C. Long, E. Nilsson, M. Mahlapuu, and J. R. Zierath Effects of calcineurin activation on insulin-, AICAR- and contraction-induced glucose transport in skeletal muscle J. Physiol., September 1, 2005; 567(2): 379 - 386. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. P Wojtaszewski, J. B Birk, C. Frosig, M. Holten, H. Pilegaard, and F. Dela 5'AMP activated protein kinase expression in human skeletal muscle: effects of strength training and type 2 diabetes J. Physiol., April 15, 2005; 564(2): 563 - 573. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Pold, L. S. Jensen, N. Jessen, E. S. Buhl, O. Schmitz, A. Flyvbjerg, N. Fujii, L. J. Goodyear, C. F. Gotfredsen, C. L. Brand, et al. Long-Term AICAR Administration and Exercise Prevents Diabetes in ZDF Rats Diabetes, April 1, 2005; 54(4): 928 - 934. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |