Am J Physiol Cell Physiol Add DOIs to your references at manuscript stage!
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 285: C1356-C1366, 2003. First published July 30, 2003; doi:10.1152/ajpcell.00179.2003
0363-6143/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/6/C1356    most recent
00179.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zou, A.
Right arrow Articles by Wickenden, A. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zou, A.
Right arrow Articles by Wickenden, A. D.

MEMBRANE TRANSPORTERS, ION CHANNELS, AND PUMPS

Distribution and functional properties of human KCNH8 (Elk1) potassium channels

Anruo Zou, Zhixin Lin, Margaret Humble, Christopher D. Creech, P. Kay Wagoner, Douglas Krafte, Timothy J. Jegla, and Alan D. Wickenden

Icagen Inc., Durham, North Carolina 27703

Submitted 2 May 2003 ; accepted in final form 22 July 2003


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The Elk subfamily of the Eag K+ channel gene family is represented in mammals by three genes that are highly conserved between humans and rodents. Here we report the distribution and functional properties of a member of the human Elk K+ channel gene family, KCNH8. Quantitative RT-PCR analysis of mRNA expression patterns showed that KCNH8, along with the other Elk family genes, KCNH3 and KCNH4, are primarily expressed in the human nervous system. KCNH8 was expressed at high levels, and the distribution showed substantial overlap with KCNH3. In Xenopus oocytes, KCNH8 gives rise to slowly activating, voltage-dependent K+ currents that open at hyperpolarized potentials (half-maximal activation at -62 mV). Coexpression of KCNH8 with dominant-negative KCNH8, KCNH3, and KCNH4 subunits led to suppression of the KCNH8 currents, suggesting that Elk channels can form heteromultimers. Similar experiments imply that KCNH8 subunits are not able to form heteromultimers with Eag, Erg, or Kv family K+ channels.

electrophysiology; human nervous system; potassium current


SEVERAL IMPORTANT FAMILIES of K+ channel genes were originally discovered in Drosophila through the characterization of mutations that caused hyperexcitability. These include the voltage-gated K+ (Kv) channels, large-conductance Ca2+-activated K+ (BK) channels, and Eag family K+ channels (2, 22, 35). The Eag K+ channel gene family derives its name from the Drosophila behavioral mutant ether-à-go-go, which exhibits abnormal neuromuscular transmission (8). Ether-à-go-go was found to have mutations in a novel K+ channel gene that is distantly related to Kv channels and cyclic nucleotide-gated channels (35). A combination of genetic analysis, homology screening, and database mining has shown that the Eag gene represents a family of K+ channel genes conserved between Drosophila and mammals (6, 7, 28, 30, 36). These Eag family channels share substantial sequence homology in a region of ~700 amino acids extending from the NH2 terminus through a canonical Kv channel motif of six transmembrane domains and a K+ channel pore to a COOH-terminal region with a cyclic nucleotide-binding domain (cNBD). It has more recently been shown that most Eag family channels also contain an NH2-terminal PAS domain (20). Because of the structural homology to Kv channels, it is very likely that members of the Eag family channels function as tetramers. This likely structure leaves open the possibility that Eag family channels function as heterotetramers in at least some situations, as is the case for several other K+ channel families. Cyclic nucleotides are not necessary for channel activity, as they are for cyclic nucleotide-gated channels (24). Although the role of cyclic nucleotides in Eag channel gating has not been extensively studied, it is possible that cyclic nucleotides play a subtle role in Eag channel gating, as they do in the structurally related hyperpolarization-activated cation channels from the HCN gene family (27).

The Eag family consists of three closely related subfamilies of genes defined by sequence homology, Eag, Erg (ether-à-go-go related gene), and Elk (ether-à-gogo-like K+ channel). Each of the three subfamilies is defined by the high degree of homology shared among members in the conserved region described above (from 60% to >=80% amino acid identity). A somewhat lower level of homology is shared between subfamilies (~40% amino acid identity). All three subfamilies are conserved between Drosophila and mammals, suggesting an early origin in metazoan evolution. The Elk subfamily of K+ channels was first discovered in Drosophila on the basis of homology to the Drosophila Eag K+ channel (36). Subsequently, three distinct mammalian Elk K+ channel genes have been identified (6, 19, 28). Some level of confusion has been generated in the naming of these Elk genes, because the same names were given to distinct genes in two of these publications. Here we refer to the Elk gene presented by Shi et al. (28) as KCNH8. The gene presented as Elk1 by Engeland et al. (6) and as BEC2 by Miyake et al. (19) is referred to as KCNH4, and the gene presented as Elk2 by Engeland et al. and BEC1 by Miyake et al. is referred to as KCNH3. Here we show that human KCNH8 is widely expressed in the human central nervous system and appears to overlap the distribution of human KCNH3 and KCNH4, which are also predominantly expressed in the nervous system. Because Elk channels are likely to function as tetramers, the overlapping distribution raises the possibility that heteromultimeric Elk channels may be functionally relevant in vivo. Therefore, we investigated the possibility that Elk channels can form heterotetramers through the coexpression of wild-type (WT) and dominant-negative (DN) Elk family subunits. We report here that distinct Elk channel subunits can coassemble with each other but that they likely do not coassemble with Eag and Erg family subunits.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cloning. The human KCNH8 gene was cloned by using a combination of degenerate PCR and RACE (rapid amplification of cDNA ends) techniques, using a partial genomic sequence and knowledge of conserved Elk family motifs. The complete KCNH8 PCR fragment was TA cloned, and several clones were sequenced completely to establish a consensus sequence and to identify a mutation-free clone. The final KCNH8 cDNA was identical to GenBank accession number AY053503 [GenBank] . Human KCNH3, KCNH4, KCNH5 (Eag2), KCNH7 (Erg3), and KCNB1 (Kv2.1) genes were cloned from human brain cDNA using similar PCR strategies. The KCNH3 and KCNH4 clones encode proteins identical to those described by Miyake et al. (19) (GenBank accession nos. BA83590 and BA83592). The KCNH5, KCNH7, and KCNB1 clones encode proteins identical to GenBank accession nos. AF032897 [GenBank] , AF418206 [GenBank] , and L02840 [GenBank] (11), respectively. Clones were moved to the pOX vector (13) for expression in Xenopus oocytes.

DN subunits of human KCNH8, KCNH3, and KCNH4 were constructed using the Quickchange site-directed mutagenesis kit (Stratagene). Briefly, the GFG amino acid sequence contained in the pore motif of each channel was replaced with the amino acid sequence AAA (16). Sequences of clones were confirmed to ensure incorporation of the intended mutations and absence of second-site mutations.

Phylogenetic analysis. Amino acid sequences used in the phylogenetic analysis were limited to a region stretching from the NH2 terminus to the COOH-terminal side of the cNBD, and alignments were produced using the CLUSTALW algorithm in Megalign (DNASTAR). Phylogenetic trees of Eag family amino acid sequences were built using MEGA2.1 (15). The analysis shown in Fig. 2 was conducted using the minimum evolution algorithm with Poisson correction and pairwise deletion of gaps; 1,000 bootstrap replications were used to test the phylogeny. Accession numbers and references for sequences not described above are as follows: AJ007627 [GenBank] for rat Kcnh3 (6), AJ007628 [GenBank] for rat Kcnh4 (6), AK048629 [GenBank] for mouse Kcnh8, AY380579 [GenBank] for mouse Kcnh3, XM_204529 for mouse Kcnh4, U04270 [GenBank] for human KCNH2 (hErg1) (36), AF012868 [GenBank] for mouse Kcnh2 (mErg1) (17), mouse genome draft for mouse Kcnh6 (mErg2) (37), XM_130310 [GenBank] for mouse Kcnh7 (mErg3), Z96106 [GenBank] for rat Kcnh2 (rErg1) (4), AF311913 [GenBank] for human KCNH6 (hErg2), AF016192 [GenBank] for rat Kcnh6 (rErg2) (29), AF016191 [GenBank] for rat Kcnh7 (rErg3) (29), AJ001366 [GenBank] for human KCNH1 (hEag1) (21), U04294 [GenBank] for mouse Kcnh1 (mEag1) (36), AK032438 [GenBank] for mouse Kcnh5 (mEag2), Z34264 [GenBank] for rat Kcnh1 (rEag1) (18), AF185637 [GenBank] for rat Kcnh5 (rEag2) (26), M61157 [GenBank] for Drosophila Eag (35), U04246 [GenBank] for Drosophila Elk (36), U42204 [GenBank] for Drosophila Erg (30), AF130443 [GenBank] for Caenorhabditis elegans Eag (39), AF257518 [GenBank] for C. elegans Erg (23), Caenorhabditis briggsae genome draft assembly for C. briggsae Eag and C. briggsae Erg (The Wellcome Trust Sanger Institute and Genome Sequencing Center, Washington University, St. Louis, MO); and Anopheles gambiae genome draft assembly (10) for the Anopheles gambiae sequences.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 2. Phylogenetic tree of the Eag gene family. Gene names are given at right of terminal branches; prefix indicates species: Caenorhabditis briggsae (cb), Caenorhabditis elegans (ce), Drosophila melanogaster (dm), Anopheles gambiae (ag), human (h), mouse (m), and rat (r). Branch lengths indicate relative degree of divergence, and numbers indicate percent occurrence of the branch point in bootstrap tests of the phylogeny. Tree was constructed using the minimum evolution algorithm in MEGA2.1.

 

Real-time RT-PCR analysis. Total RNA and poly(A)+ mRNA samples from various human tissues were obtained from Clontech, and cDNA synthesis was performed by standard oligo(dT) priming methods using PowerScript RT (Clontech). Total RNA samples were treated with DNase I before use. All samples were treated with RNase H before amplification. Parallel reactions for each of the RNA samples were run in the absence of PowerScript RT to serve as controls for contamination during subsequent amplification.

The expression patterns of the human Elk genes were determined by real-time quantitative PCR techniques (9) using the Prism 7900HT sequence detection system (Applied Biosystems). Primers and TaqMan probes for each Elk gene and a reference housekeeping gene (RS9, accession no. NM_001013 [GenBank] ) were designed using Primer Express 2.0 (Applied Biosystems) and purchased from Integrated DNA Technologies. TaqMan probes were labeled on the 5' end with a fluorescent reporter dye (FAM, 6-carboxyfluorescein) and on the 3' end with a quencher dye (BH-1, black hole). Amplicons were designed to span intron-exon boundaries to minimize contamination from genomic DNA and were shorter than 150 bp to allow for efficient amplification. The primers and probes used for each gene were as follows: GCTTTGCAGGCCATCTACTTTG (+), GGTCTTGATCACTTGGTCCTTAA (-), and TTTCCCAAGAATAGCCAGCACCATGCT (probe) for KCNH8; CGAGGCAAGGAACACAGACA (+), CACAGCCTGGCGAAGTGA (-), and AGGTGCTGCAGATGCGGGAAGGA (probe) for KCNH3; CCAACGAGTTACTGCGTGACTTC (+), TGCAGGATCTCCCGATTCA (-), and CGAGCTGAGAGCTGACATTGCTATGCAC (probe) for KCNH4; and CGCCAGCGCCATATCAG (+), CGATGTGCTTCTGGGAATCC (-), and AGCAGGTGGTGAACATCCCGTCCTTC (probe) for RS9.

All amplifications were preceded by steps to 50°C for 2 min and then 95°C for 10 min. Forty-two-step amplification cycles of 95°C for 15 s and 60°C for 1 min were used to generate the data. Reactions were performed in 20 µl using TaqMan Universal Master Mix (Perkin-Elmer), primers at 300 nM each, and 200 nM probe. Quantification of gene expression in the sample RNAs was achieved by comparing the threshold cycle (Ct) values for each sample with a standard curve of Ct vs. copy number (9). Control plasmids for standard curve generation were designed for each primer-probe set and quantified using optical density at 260 nm. Copy numbers were determined using the molecular weight of each plasmid, and samples containing 10-108 copies were used to generate standard curves. Copy numbers in experimental samples were determined using the following equation: log copy number = (Ct - I)/S, where Ct is the threshold cycle value of the sample, I is the intercept, and S is the slope of a linear fit of the standard curve data. To allow for comparisons across tissues, the results for each RNA sample were then normalized by dividing the copy numbers obtained for each Elk gene by the copy number obtained for the reference gene RS9. All assays were performed in duplicate, and the average values are reported.

Functional expression in Xenopus oocytes. Capped cRNAs were prepared by run-off transcription with T3 RNA polymerase using the mMessage mMachine kit (Ambion, Austin, TX) and diluted in RNase-free double-distilled H2O to desired concentrations before injection. Mature Xenopus oocytes were prepared for injection as described by Wei et al. (38) according to a protocol approved by the Icagen Institutional Animal Care and Use Committee. Briefly, Xenopus laevis (Nasco, Ft. Atkinson, WI) were anesthetized by immersion in tricaine solution [0.2% (wt/vol); Sigma Chemical, St. Louis, MO]. Ovarian lobes were removed through a small incision in the abdominal wall. Oocytes were freed from ovarian lobes by gentle mechanical agitation in Ca2+-free ND96 solution (96 mM NaCl, 2 mM KCl, 1 mM MgCl2, and 5 mM HEPES, with pH adjusted to 7.5 with NaOH) containing 1.5 mg/ml collagenase (type 1A, Sigma Chemical) for 45-60 min. Oocytes were stored overnight in ND96 solution supplemented with 1.8 mM CaCl2, 100 U/ml penicillin, 100 µg/ml streptomycin, and 2.5 mM sodium pyruvate. Oocytes were injected with 55 nl of cRNA (0.1-1 ng/nl) and incubated at 18°C for 1-5 days before currents were recorded.

Functional properties of KCNH8. The two-electrode voltage-clamp technique was used to record human KCNH8 currents in Xenopus oocytes 2-5 days after injection. Micro-electrodes were filled with 3 M KCl; tip resistance was ~1 M{Omega}. During recording, oocytes were continually perfused with regular ND96 solution (see above) or high-K+ ND96 solution (78 mM NaCl, 20 mM KCl, 1 mM MgCl2, 5 mM HEPES, and 0.1 mM CaCl2, with pH adjusted to 7.5 with NaOH). All recordings were made at room temperature (22-24°C) using a voltage-clamp amplifier (model TEV-200A, Dagan). Data collection and analysis were performed using pCLAMP software (Axon Instruments, Union City, CA). To study the voltage dependence of activation, the deactivating tail current amplitude was measured at -60 mV after a series of 3-s depolarizing steps (from -100 to +10 mV in 10-mV increments) from a holding potential of -100 mV. Activation curves were generated by plotting normalized tail current amplitude against the step potential and were fit with a Boltzmann distribution according to the following equation

(1)
where A is amplitude of the relation, V1/2 is voltage for half-activation, Vm is step potential, and k is slope factor.

To describe the time course of human KCNH8 activation, currents were elicited with a series of 3-s depolarizing steps from -60 to +10 mV in 10-mV increments in regular ND96 solution from a holding potential of -100 mV, and the activation phase was fit with a double-exponential function according to the following equation

(2)
where Afast and Aslow are the amplitudes of the fast and slow components and {tau}fast and {tau}slow are the activation time constants.

To describe the time course of KCNH8 current deactivation, tail currents were elicited by repolarization to voltages from -110 to -150 mV after a 3-s depolarization to +20 mV. Tail current decay was best fit with a double-exponential function, according to Eq. 2.

To determine the KCNH8 current reversal potential, tail currents were elicited by repolarizing the membrane to potentials from -120 to -40 or 0 mV in 10-mV increments after a 3-s voltage step to 20 mV. Tail currents were measured in regular ND96 solution and in high-K+ ND96 solution. Reversal potentials were calculated from linear fits of instantaneous tail current amplitude against repolarization potential.

To study the effects of Ba2+, KCNH8 currents were elicited by depolarizing the membrane to 0 mV for 500 ms from a holding potential of -100 mV. Ba2+ was applied by perfusing the bath with ND96 solution supplemented with BaCl2 at the desired final concentration. Up to six concentrations of Ba2+ were tested on each oocyte with washout after each drug application. Semilogarithmic plots of Ba2+ concentration against effect were fit with a logistic function (Origin, Micro-Cal Software, Northampton, MA), and IC50 values were determined from the fitted data.

In all studies, linear leak was subtracted using a P/4 or P/8 protocol employing voltage steps of the opposite polarity to the test steps from a holding potential of -100 mV.

DN expression. The concentration of cRNAs encoding the WT ion channels used in the present experiments was empirically determined to generate current amplitudes between 1 and 10 µA on the day of study (typically 0.1-1 ng/nl for Elk, Erg, and Eag channels and 1 pg/nl for KCNB1). cRNA encoding WT human KCNH8, human KCNH5 (hEag2), and human KCNH7 (hErg3) was coinjected with a fixed amount (0.1 ng/nl) of cRNA encoding a DN Elk subunit. KCNH8, Eag, or Erg current amplitude was determined in oocytes injected with WT cRNA alone, and this was compared with current amplitude in oocytes coinjected with WT and DN cRNAs. To determine whether coinjection of DN cRNAs could suppress WT ion channel gene expression in a nonspecific manner (e.g., by saturation of translation or protein synthesis), DN cRNAs were coinjected with an unrelated K+ channel, Kv2.1.

Statistics. Values are means ± SE for at least three observations. Statistical significance was determined using a suitable (hetero- or homoscedastic) two-tailed unpaired t-test. P < 0.05 was considered significant.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Molecular conservation of KCNH8. Human KCNH8 encodes a protein of 1,107 amino acids containing all the key features of an Eag family channel. An alignment of the deduced amino acid sequence of KCNH8 to the rat Kcnh8 ortholog, human KCNH3, and human KCNH4 is shown in Fig. 1. The amino acid sequences of human KCNH8 and rat Kcnh8 are >90% identical, with the vast majority of divergence occurring downstream of a potential cNBD in the COOH-terminal cytoplasmic region. A very similar pattern of sequence conservation is observed between human and rat KCNH3 and KCNH4 genes, with amino acid identities of 95 and 89%, respectively. The amino acid identity shared between Elk family paralogs is much lower at 45-55% across the entire proteins. Conservation is higher (60-70% amino acid identity) when the comparison is limited to a highly conserved region extending from the NH2 terminus through the cNBD. Members of the Eag (KCNH1 and KCNH5) and Erg (KCNH2, KCNH6, and KCNH7) channel subfamilies share only 35-44% amino acid identity with Elk subfamily channels over this region, providing a clear molecular definition of an Elk channel subfamily.



View larger version (113K):
[in this window]
[in a new window]
 
Fig. 1. Alignment of deduced amino acid sequences of human KCNH8, rat Kcnh8, human KCNH3, and human KCNH4. Amino acid positions are given at right, and identical residues are shaded. Dashes indicate gaps in alignment. Transmembrane domains S1-S6 are underlined with a thick black line, and K+ channel pore motif is underlined with a thin black line. An NH2-terminal PAS domain (dotted lines) and a cyclic nucleotide-binding domain (dashed lines) are also underlined. Sources of rat Kcnh8, human KCNH4, and human KCNH3 sequences are GenBank accession nos. AF061957 [GenBank] , BA83590, and BA83592, respectively.

 

A phylogenetic analysis of the Eag K+ channel family is shown in Fig. 2. The three gene subfamilies (Eag, Elk, and Erg) are clearly defined by three separate branches. Each subfamily is represented by multiple genes in mammals. The mammalian genes group separately from the insect and worm genes in each subfamily, suggesting that the diversification of the Eag, Elk, and Erg subfamilies in mammals occurred after the divergence of vertebrates and invertebrates. Although insects and worms have highly conserved Eag family genes, they do not have specific orthologs of the eight mammalian Eag family genes. Interestingly, we did not find Elk orthologs in the C. elegans or C. briggsae genomes, suggesting that the Elk subfamily has been lost in nematodes. We could not determine the order of divergence of the three subfamilies from a common ancestor, because no two subfamilies consistently grouped together in bootstrap tests of phylogenies.

Using real-time quantitative PCR, we assessed the mRNA expression patterns of human Elk channels. Comparisons of the expression levels of the genes were facilitated by normalization of the results to standard curves for each gene, and comparisons of expression levels in different tissues were made possible by normalization to the housekeeping gene RS9. We have found RS9 to be a reliable housekeeping gene over a wide range of tissues. The results presented here agree very well with the results of Northern hybridizations performed for each gene (data not shown). All three Elk genes are primarily expressed in the nervous system and are especially prominent in the forebrain (Fig. 3). KCNH3 was the predominant Elk gene expressed in the cerebral cortex, hippocampus, amygdala, caudate, and nucleus accumbens. Nevertheless, the other Elk genes, KCNH8 and KCNH4, were also expressed in these tissues, suggesting the possibility of coexpression at the cellular level in at least some subpopulations of neurons. KCNH8 and KCNH3 genes were also expressed together in the thalamus, substantia nigra, pons, and cerebellum, but in these tissues the balance of expression level is shifted toward KCNH8. Expression of all three genes was very low in nonneuronal tissues (data not shown). In each case, testis showed the most significant expression at 0.59, 1.13, and 0.11% of RS9 for KCNH8, KCNH3, and KCNH4, respectively. The unique, yet overlapping, expression patterns of the human Elk genes suggested to us that homomultimeric and heteromultimeric Elk channels may be functionally relevant in the human brain.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 3. Expression patterns of human Elk family genes [human KCNH8 (A), human KCNH3 (B), and human KCNH4 (C)] in the nervous system as determined by real-time quantitative PCR. Tissues for RNA samples (horizontal axis in C) were identical for each. Values are reported as percentage of expression level of ribosomal protein RS9, a housekeeping gene. Percentages were calculated on the basis of determinations of copy number for each gene. DRG, dorsal root ganglion.

 

Functional properties of human KCNH8. To characterize the biophysical properties of the human KCNH8 gene product, we expressed KCNH8 in Xenopus oocytes. Robust, slowly activating currents were routinely recorded from oocytes injected with human KCNH8 cRNA (Fig. 4A). KCNH8 currents exhibited a small amount of inactivation at test potentials of >=10 mV, and similar currents were never recorded from uninjected oocytes (data not shown). In regular ND96 solution, KCNH8 outward currents could be resolved at potentials positive to -90 mV. However, the true threshold for activation of KCNH8 channels was difficult to determine in regular ND96 solution, because the threshold voltage occurred at potentials that were close to the reversal potential for K+ under these conditions. To study the voltage dependence of channel activation, deactivating tail current amplitude was measured at -60 mV after a series of 3-s depolarizing steps (-100 to +10 mV in 10-mV increments). The KCNH8 activation curve (Fig. 4C) was constructed by plotting normalized tail current amplitude against the step potential and fitting the data with a Boltzmann distribution. These studies confirmed that KCNH8 activated at voltages above -90 mV, and, on average, V1/2 was -62.4 ± 1.2 mV (k = 10.7 ± 0.3 mV, n = 10). KCNH8 currents were also recorded in high-K+ ND96 solution (Fig. 4B). Under these conditions, inward currents were observed at voltages between -90 and -50 mV, whereas outward currents were observed at voltages above -40 mV. Repolarization to -60 mV after 3-s depolarizing steps (-100 to +10 mV in 10-mV increments) elicited inward tail currents. Activation curves generated from these inward tail currents were similar to those generated in normal ND96 solution (threshold for activation = -90 mV and V1/2 = -68.0 ± 1.2 mV, k = 10.4 ± 0.7 mV, n = 8).



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 4. Characterization of human KCNH8 in Xenopus oocytes. A and B: representative 2-electrode whole cell voltage-clamp recordings from a Xenopus oocyte injected with KCNH8 cRNA. Currents were elicited with a series of 3-s depolarizing steps (-100 to +10 mV in 10-mV increments) from a holding potential of -100 mV in regular ND96 (A) and high-K+ ND96 (B) solutions. Horizontal lines, 0 µA. C: activation curve for KCNH8 expressed in Xenopus oocytes. Average normalized tail current amplitude at -60 mV from 10 oocytes in normal ND96 solution ({bullet}) and 8 oocytes in high-K+ ND96 solution ({blacksquare}) are plotted against step potential. Half-maximal activation of KCNH8 occurred at -62.4 ± 1.2 and -68.0 ± 1.2 mV in regular ND96 and high-K+ ND96 solution, respectively. D: KCNH8 reversal potentials. Reversal potentials were calculated from linear fits of instantaneous tail currents (see METHODS) against repolarization potential in normal ND96 and high-K+ ND96 solutions. Reversal potentials ({blacksquare}) are plotted against extracellular K+ concentration ([K+]e) and fitted with a logarithmic regression (solid line), yielding a slope of 48 mV/decade. Dashed line, relation for a purely K+-selective channel with a slope of 58 mV/decade (with assumption of 100 mM intracellular K+ concentration). E: average fast ({bullet}) and slow ({blacksquare}) fast activation time constants ({tau}act) from oocytes injected with KCNH8 cRNA. F: average fast ({bullet}) and slow ({blacksquare}) deactivation time constants ({tau}deact) from oocytes injected with KCNH8 cRNA.

 

To confirm that the currents measured were K+ currents, we measured the reversal potential of voltage-activated currents in KCNH8-injected oocytes in normal and elevated extracellular K+. Currents were elicited by 3-s voltage steps to 20 mV, and tail currents were obtained by repolarization to a series of potentials in the range -120 to -40 or 0 mV in 10-mV increments. Reversal potentials were calculated from linear fits of instantaneous tail currents (see METHODS) against repolarization potential. The KCNH8 reversal potentials were calculated as -93 ± 1.5 mV (n = 10) and -44.4 ± 3.0 mV (n = 5) in normal ND96 solution and high-K+ ND96 solution, respectively (Fig. 4D). These values were plotted against the extracellular K+ concentration and fitted with a logarithmic regression, yielding a slope of 48 mV/decade. These results indicate that KCNH8 encodes a K+-selective channel, although the slope value was marginally less than that predicted for a purely K+-selective channel (58 mV/decade; Fig. 4D).

KCNH8 current activation at voltages between -60 and +10 mV (activation time courses could not be accurately fit above +10 mV because of inactivation) was fit using an exponential function, and two distinct kinetic components were identified. Both activation time constants ({tau}act,slow and {tau}act,fast) were voltage dependent (Fig. 4E). For example, {tau}act,slow decreased from 1,674 ± 102 ms (n = 12) at -60 mV to 259 ± 29 ms (n = 12) at +10 mV. Similarly, {tau}act,fast decreased from 293 ± 19 ms (n = 12) at -60 mV to 44.7 ± 3.6 ms (n = 12) at +10 mV. To describe the time course of KCNH8 current deactivation, tail currents were elicited by repolarization to -110 to -150 mV after a 3-s depolarization to +20 mV, and tail current decay was fit with an exponential function. As for activation, deactivation was best described by the sum of two kinetically distinct and voltage-dependent components ({tau}deact,slow and {tau}deact,fast): {tau}deact,slow increased from 260 ± 25 ms (n = 10) at -150 mV to 331 ± 33 ms (n = 10) at -110 mV, whereas {tau}deact,fast increased from 28 ± 2.2 ms (n = 10) at -150 mV to 65.6 ± 4.4 ms (n = 10) at -110 mV (Fig. 4F).

In pharmacological experiments, Ba2+ inhibited KCNH8 currents with an IC50 of 0.18 ± 0.03 mM (slope = 0.82 ± 0.03, n = 6).

KCNH8 coassembles with KCNH3 and KCNH4. Our quantitative PCR data demonstrate that KCNH8 is coexpressed with other members of the Elk family in many brain regions. These data raise the possibility that human KCNH8 may form heteromultimeric channel complexes with human KCNH3 and/or human KCNH4 in the brain. To investigate this possibility further, we used a DN strategy to determine whether KCNH8 channels are capable of coassembling with KCNH3 and KCNH4 in the Xenopus oocyte expression system. WT human KCNH8 cRNA was injected at a concentration sufficient to generate submaximal KCNH8 currents, similar to those shown in Fig. 5A. KCNH8 currents were elicited with a series of 3-s depolarizing steps (-100 to +40 mV in 10-mV increments), and current amplitude (mean ± SE) is plotted against voltage in Fig. 5E. On average, KCNH8 current amplitude at +40 mV was 6.6 ± 0.34 µA (n = 8) after injection of KCNH8 cRNA alone (Fig. 5E). Coinjection of the same amount of WT KCNH8 cRNA with DN KCNH3 (Fig. 5C) or KCNH4 (Fig. 5D) resulted in a marked decrease in current amplitude. KCNH8 current amplitude at +40 mV was significantly (P < 0.05) reduced from 6.6 ± 0.34 µA (n = 8) in oocytes injected with KCNH8 alone to 2.9 ± 0.6 µA (n = 8) or 1.5 ± 0.1 µA (n = 8) in oocytes injected with KCNH8-KCNH3-DN or KCNH8-KCNH4-DN, respectively (Fig. 5E). Comparable reductions in KCNH8 current amplitude were also observed when oocytes were injected with KCNH8-KCNH8-DN (Fig. 5, B and E). The results of these DN experiments suggest that closely related human Elk family subunits are capable of coassembling in Xenopus oocytes.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 5. Human KCNH8, KCNH3, and KCNH4 dominant-negative (DN) constructs depress KCNH8 expression. A-D: representative 2-electrode voltage-clamp recordings from Xenopus oocytes injected with human KCNH8 alone, KCNH8 + KCNH8-DN, KCNH8 + KCNH3-DN, or KCNH8 + KCNH4-DN. To elicit KCNH8 currents, oocytes were depolarized to +40 mV for 3 s and repolarized to -60 mV for 1 s from a holding potential of -100 mV. Horizontal lines, 0 µA. E: current-voltage relations constructed for KCNH8 in the absence ({blacksquare}) or presence of KCNH8-DN ({blacktriangleup}), KCNH3-DN ({blacktriangledown}), or KCNH4-DN ({bullet}). Values are means ± SE of 8-10 oocytes/group.

 

Using the same DN strategy, we next sought to determine whether human Elk subunits were also capable of coassembling with the more distantly related members of the Eag K+ channel family, human KCNH5 (hEag2) and human KCNH7 (hErg3). Current amplitudes (means ± SE) measured in oocytes expressing KCNH5 alone, KCNH5-KCNH3-DN, or KCNH5-KCNH4-DN are plotted against voltage in Fig. 6A. hElk DN subunits did not reduce KCNH5 current amplitude at any voltage. Peak KCNH5 current amplitude at +40 mV was 10.4 ± 0.4 µA (n = 13) in oocytes injected with KCNH5 alone and 10.3 ± 0.4 µA (n = 10) and 10.4 ± 0.5 µA (n = 9) in oocytes injected with KCNH5-KCNH3-DN and hKCNH5-KCNH4-DN, respectively (P > 0.05). hElk DN subunits were similarly without effect on KCNH7 currents. Current-voltage relations for KCNH7 in the absence or presence of hElk DN subunits are shown in Fig. 6B. Peak KCNH7 current amplitude was 2.6 ± 0.2 µA (n = 8) in oocytes injected with KCNH7 alone and 2.5 ± 0.2 µA (n = 7) and 2.4 ± 0.2 µA (n = 8) in oocytes injected with KCNH7-KCNH3-DN and hErg3-hKCNH8-DN, respectively (P > 0.05). The findings of these studies indicate that hElk family subunits are incapable of coassembling with more distantly related members of the hEag family in Xenopus oocytes. To determine whether coinjection of DN cRNAs could suppress ion channel gene expression in a nonspecific manner, DN hElk constructs were coinjected with an unrelated K+ channel, human KCNB1 (Kv2.1). At the concentrations used in the present study, hElk DN subunits did not reduce KCNB1 expression (Fig. 6C), suggesting that the DN constructs used in the present study did not exert a nonspecific inhibitory effect on K+ channel gene expression.



View larger version (12K):
[in this window]
[in a new window]
 
Fig. 6. Human Elk DN constructs do not affect KCNH5 (hEag2), KCNH7 (hErg3), or KCNB1 (hKv2.1) expression. A: current-voltage relations for KCNH5 alone ({blacksquare}) or in the presence of KCNH3-DN ({bullet}) or KCNH4-DN ({blacktriangleup}). B: current-voltage relations for KCNH7 alone ({blacksquare}) or in the presence of KCNH8-DN ({blacktriangledown}) or KCNH3-DN ({bullet}). C: current-voltage relations for KCNB1 alone ({blacksquare}) or in the presence of KCNH8-DN ({blacktriangledown}), KCNH3-DN ({bullet}), or KCNH4-DN ({blacktriangleup}). Values are means ± SE of 8-13 oocytes/group.

 


    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Three distinct mammalian Elk K+ channel genes, KCNH8, KCNH3, and KCNH4, have been identified (6, 19, 28). In the present study, we have measured KCNH8 gene expression in the human brain using real-time RT-PCR analysis, and we have characterized the functional properties of the KCNH8 gene product. Our results show that the sequence and structure of the KCNH8 gene are highly conserved between human and rat. The ~90% amino acid identity shared between human and rat KCNH8 is a rather typical level of conservation for ion channel genes and is seen for human-rodent comparisons of the other Elk subfamily genes.

The Drosophila Elk gene provides evidence that the Elk subfamily is conserved in invertebrates, but the level of conservation of biophysical properties is not known, because this gene has not been heterologously expressed. Interestingly, the Elk family appears to be absent in nematodes. Because two distinct nematode genomes have been sequenced virtually to completion, it is highly unlikely that a nematode Elk gene was missed. Although the majority of ion channel types that are conserved between mammals and Drosophila are also found in nematodes, there are other cases similar to this. For instance, voltage-gated Na+ channels also appear to be missing in nematodes. Without a clear definition of the physiological role of Elk subfamily channels, it is difficult to speculate why the Elk family is absent in nematodes.

The results presented here and elsewhere suggest that KCNH8, along with KCNH3 and KCNH4, are primarily expressed in the nervous system. Furthermore, in situ hybridization in the rat shows that the Elk genes are expressed almost exclusively in neurons (25). In the human brain, KCNH3 was the predominant Elk gene expressed. KCNH3 has also been shown to be the most abundant Elk gene expressed in the rat brain (25). The distribution of human and rat KCNH3 appears to be very similar, with both being highly expressed in many forebrain structures. In contrast, our data show distinct distributions for the human and rat KCNH8 and KCNH4. In the rat, KCNH4 is expressed in many forebrain regions, whereas KCNH8 is virtually absent (25). In humans, almost the opposite appears to be the case, with KCNH8 more highly and widely expressed. Such divergent distributions of human and rat orthologs are not unknown in the ion channel field. Another example of this phenomenon is found in DRASIC, or ASIC3, a pH-sensitive member of the amiloride-sensitive Na+ channel gene family. DRASIC appears to be expressed almost exclusively in sensory neurons in rats (33), whereas its human ortholog (ASIC3) is highly expressed in a wide variety of neuronal and nonneuronal tissues (3).

Human KCNH8 currents in Xenopus oocytes activate slowly over a hyperpolarized voltage range, exhibit little inactivation near the resting potential, and are inhibited by Ba2+. Although slow kinetics, lack of inactivation, and Ba2+ sensitivity have also been noted for rat Kcnh8, it is interesting to note that the rat ortholog appears to activate over a more depolarized voltage range: midpoint for activation of rat Kcnh8 was +9.3 mV in the study of Shi et al. (28) compared with -62 mV for human KCNH8 in the present study. This observation was somewhat surprising given the high degree of sequence homology between human and rat KCNH8 genes. The biophysical properties of human KCNH8 are very similar to those reported for rat Kcnh4 (6), and thus it seems likely that these channels serve similar physiological roles. In contrast, human KCNH8 currents exhibit properties that are quite distinct from those reported for KCNH3 currents, that activate at slightly more depolarized potentials, and that undergo substantial inactivation at depolarized potentials (5, 6, 19, 31). The precise physiological role of Elk channels is not known, because so little is known about their modulation and there are no pharmacological tools to isolate Elk currents in primary neurons. We can guess from their distribution and biophysical properties that Elk channels likely play a role in modulating the overall excitability of neurons. Their hyperpolarized activation, lack of inactivation near the resting potential, and slow kinetics are reminiscent of the M currents encoded by KCNQ family genes (34).

As noted above, KCNH3 is the predominant Elk gene expressed in the human central nervous system. This finding suggests that KCNH3 homomultimeric channels may play a significant role in the control of central nervous system excitability. Nevertheless, the other Elk genes, KCNH8 and KCNH4, were also expressed in the human central nervous system, with KCNH8 expression overlapping that of KCNH3 and KCNH4 in some regions. Because Elk channels, similar to other K+ channels, are likely to function as tetramers, the overlapping distribution raises the possibility that heteromultimeric Elk channels may exist in many brain regions in vivo. We investigated the possibility that Elk channels can form heterotetramers through the coexpression of WT and DN Elk family subunits. Our findings show that DN Elk channel subunits reduce expression of full-length Elk, but not Eag or Erg, channels. These findings indicate that Elk channel subunits are able to form heterotetramers with other members of the Elk family but not with members of the Eag or Erg family. Our observations support the findings of Wimmers et al. (40), who used a similar DN strategy to demonstrate subfamily-selective heterotetramerization among Erg channel subunits.

In conclusion, we have found that KCNH8, along with other Elk family genes, are primarily expressed in the human nervous system. Elk channel subunits can coassemble with each other, but they do not coassemble with Eag and Erg family subunits. Given the overlapping expression of the three human Elk genes and the observation that they can form heteromultimers, it is possible that heteromultimers contribute to native Elk currents in at least some regions of the human brain.


    ACKNOWLEDGMENTS
 
Present address of T. J. Jegla: Genomics Institute of the Novartis Research Foundation, 10675 John Jay Hopkins Dr., San Diego, CA 92121.


    FOOTNOTES
 

Address for reprint requests and other correspondence: A. D. Wickenden, Icagen, Inc., 4222 Emperor Blvd., Durham, NC 27703 (E-mail: awickenden{at}icagen.com).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
1. Adams MD, Celniker SE, Holt RA, Evans CA, Gocayne JD, Amanatides PG, Scherer SE, Li PW, Hoskins RA, Galle RF, George RA, Lewis SE, Richards S, Ashburner M, Henderson SN, Sutton GG, Wortman JR, Yandell MD, Zhang Q, Chen LX, Brandon RC, Rogers YH, Blazej RG, Champe M, Pfeiffer BD, Wan KH, Doyle C, Baxter EG, Helt G, Nelson CR, Gabor GL, Abril JF, Agbayani A, An HJ, Andrews-Pfannkoch C, Baldwin D, Ballew RM, Basu A, Baxendale J, Bayraktaroglu L, Beasley EM, Beeson KY, Benos PV, Berman BP, Bhandari D, Bolshakov S, Borkova D, Botchan MR, Bouck J, Brokstein P, Brottier P, Burtis KC, Busam DA, Butler H, Cadieu E, Center A, Chandra I, Cherry JM, Cawley S, Dahlke C, Davenport LB, Davies P, de Pablos B, Delcher A, Deng Z, Mays AD, Dew I, Dietz SM, Dodson K, Doup LE, Downes M, Dugan-Rocha S, Dunkov BC, Dunn P, Durbin KJ, Evangelista CC, Ferraz C, Ferriera S, Fleischmann W, Fosler C, Gabrielian AE, Garg NS, Gelbart WM, Glasser K, Glodek A, Gong F, Gorrell JH, Gu Z, Guan P, Harris M, Harris NL, Harvey D, Heiman TJ, Hernandez JR, Houck J, Hostin D, Houston KA, Howland TJ, Wei MH, Ibegwam C, Jalali M, Kalush F, Karpen GH, Ke Z, Kennison JA, Ketchum KA, Kimmel BE, Kodira CD, Kraft C, Kravitz S, Kulp D, Lai Z, Lasko P, Lei Y, Levitsky AA, Li J, Li Z, Liang Y, Lin X, Liu X, Mattei B, McIntosh TC, McLeod MP, McPherson D, Merkulov G, Milshina NV, Mobarry C, Morris J, Moshrefi A, Mount SM, Moy M, Murphy B, Murphy L, Muzny DM, Nelson DL, Nelson DR, Nelson KA, Nixon K, Nusskern DR, Pacleb JM, Palazzolo M, Pittman GS, Pan S, Pollard J, Puri V, Reese MG, Reinert K, Remington K, Saunders RD, Scheeler F, Shen H, Shue BC, Siden-Kiamos I, Simpson M, Skupski MP, Smith T, Spier E, Spradling AC, Stapleton M, Strong R, Sun E, Svirskas R, Tector C, Turner R, Venter E, Wang AH, Wang X, Wang ZY, Wassarman DA, Weinstock GM, Weissenbach J, Williams SM, Woodage T, Worley KC, Wu D, Yang S, Yao QA, Ye J, Yeh RF, Zaveri JS, Zhan M, Zhang G, Zhao Q, Zheng L, Zheng XH, Zhong FN, Zhong W, Zhou X, Zhu S, Zhu X, Smith HO, Gibbs RA, Myers EW, Rubin GM, and Venter JC. The genome sequence of Drosophila melanogaster. Science 287: 2185-2195, 2000.[Abstract/Free Full Text]

2. Atkinson NS, Robertson GA, and Ganetzky B. A component of calcium-activated potassium channels encoded by the Drosophila slo locus. Science 253: 551-555, 1991.[Abstract/Free Full Text]

3. Babinski K, Le KT, and Seguela P. Molecular cloning and regional distribution of a human proton receptor subunit with biphasic functional properties. J Neurochem 72: 51-57, 1999.[Web of Science][Medline]

4. Bauer CK, Engeland B, Wulfsen I, Ludwig J, Pongs O, and Schwarz JR. RERG is a molecular correlate of the inward-rectifying K current in clonal rat pituitary cells. Receptors Channels 6: 19-29, 1998.[Web of Science][Medline]

5. Becchetti A, De Fusco M, Crociani O, Cherubini A, Restano-Cassulini R, Lecchi M, Masi A, Arcangeli A, Casari G, and Wanke E. The functional properties of the human ether-àgo-go-like (HELK2) K+ channel. Eur J Neurosci 16: 415-428, 2002.[Web of Science][Medline]

6. Engeland B, Neu A, Ludwig J, Roeper J, and Pongs O. Cloning and functional expression of rat ether-à-go-go-like K+ channel genes. J Physiol 513: 647-654, 1998.[Abstract/Free Full Text]

7. Ganetzky B, Robertson GA, Wilson GF, Trudeau MC, and Titus SA. The eag family of K+ channels in Drosophila and mammals. Ann NY Acad Sci 868: 356-369, 1999.[Web of Science][Medline]

8. Ganetzky B and Wu CF. Neurogenetic analysis of potassium currents in Drosophila: synergistic effects on neuromuscular transmission in double mutants. J Neurogenet 1: 17-28, 1983.[Medline]

9. Heid CA, Stevens J, Livak KJ, and Williams PM. Real-time quantitative PCR. Genet Res 6: 986-994, 1996.

10. Holt RA, Subramanian GM, Halpern A, Sutton GG, Charlab R, Nusskern DR, Wincker P, Clark AG, Ribeiro JM, Wides R, Salzberg SL, Loftus B, Yandell M, Majoros WH, Rusch DB, Lai Z, Kraft CL, Abril JF, Anthouard V, Arensburger P, Atkinson PW, Baden H, de Berardinis V, Baldwin D, Benes V, Biedler J, Blass C, Bolanos R, Boscus D, Barnstead M, Cai S, Center A, Chatuverdi K, Christophides GK, Chrystal MA, Clamp M, Cravchik A, Curwen V, Dana A, Delcher A, Dew I, Evans CA, Flanigan M, Grundschober-Freimoser A, Friedli L, Gu Z, Guan P, Guigo R, Hillenmeyer ME, Hladun SL, Hogan JR, Hong YS, Hoover J, Jaillon O, Ke Z, Kodira C, Kokoza E, Koutsos A, Letunic I, Levitsky A, Liang Y, Lin JJ, Lobo NF, Lopez JR, Malek JA, McIntosh TC, Meister S, Miller J, Mobarry C, Mongin E, Murphy SD, O'Brochta DA, Pfannkoch C, Qi R, Regier MA, Remington K, Shao H, Sharakhova MV, Sitter CD, Shetty J, Smith TJ, Strong R, Sun J, Thomasova D, Ton LQ, Topalis P, Tu Z, Unger MF, Walenz B, Wang A, Wang J, Wang M, Wang X, Woodford KJ, Wortman JR, Wu M, Yao A, Zdobnov EM, Zhang H, Zhao Q, Zhao S, Zhu SC, Zhimulev I, Coluzzi M, della Torre A, Roth CW, Louis C, Kalush F, Mural RJ, Myers EW, Adams MD, Smith HO, Broder S, Gardner MJ, Fraser CM, Birney E, Bork P, Brey PT, Venter JC, Weissenbach J, Kafatos FC, Collins FH, and Hoffman SL. The genome sequence of the malaria mosquito Anopheles gambiae. Science 298: 129-149, 2002.[Abstract/Free Full Text]

11. Ikeda SR, Soler F, Zuhlke RD, Joho RH, and Lewis DL. Heterologous expression of the human potassium channel Kv2.1 in clonal mammalian cells by direct cytoplasmic microinjection of cRNA. Pflügers Arch 422: 201-203, 1992.[Web of Science][Medline]

12. International Human Genome Sequencing Consortium. Initial sequencing and analysis of the human genome. Nature 409: 860-921, 2001.[Medline]

13. Jegla T and Salkoff L. A novel subunit for shal K+ channels radically alters activation and inactivation. J Neurosci 17: 32-44, 1997.[Abstract/Free Full Text]

14. Kent WJ and Haussler D. Assembly of the working draft of the human genome with GigAssembler. Genet Res 11: 1541-1548, 2001.

15. Kumar S, Tamura K, Jakobsen IB, and Nei M. MEGA2: molecular evolutionary genetics analysis software. Bioinformatics 17: 1244-1245, 2001.[Abstract/Free Full Text]

16. Kuzhikandathil EV and Oxford GS. Dominant-negative mutants identify a role for GIRK channels in D3 dopamine receptor-mediated regulation of spontaneous secretory activity. J Gen Physiol 115: 697-706, 2000.[Abstract/Free Full Text]

17. London B, Trudeau MC, Newton KP, Beyer AK, Copeland NG, Gilbert DJ, Jenkins NA, Satler CA, and Robertson GA. Two isoforms of the mouse ether-à-go-go-related gene coassemble to form channels with properties similar to the rapidly activating component of the cardiac delayed rectifier K+ current. Circ Res 81: 870-878, 1997.[Abstract/Free Full Text]

18. Ludwig J, Terlau H, Wunder F, Bruggemann A, Pardo LA, Marquardt A, Stuhmer W, and Pongs O. Functional expression of a rat homologue of the voltage-gated ether-à-go-go potassium channel reveals differences in selectivity and activation kinetics between the Drosophila channel and its mammalian counterpart. EMBO J 13: 4451-4458, 1994.[Web of Science][Medline]

19. Miyake A, Mochizuki S, Yokoi H, Kohda M, and Furuichi K. New ether-à-go-go K+ channel family members localized in human telencephelon. J Biol Chem 274: 25018-25025, 1999.[Abstract/Free Full Text]

20. Morais Cabral JH, Lee A, Cohen SL, Chait BT, Li M, and Mackinnon R. Crystal structure and functional analysis of the HERG potassium channel N terminus: a eukaryotic PAS domain. Cell 95: 649-655, 1998.[Web of Science][Medline]

21. Occhiodoro T, Bernheim L, Liu JH, Bijlenga P, Sinnreich M, Bader CR, and Fischer-Lougheed J. Cloning of a human ether-à-go-go potassium channel expressed in myoblasts at the onset of fusion. FEBS Lett 434: 177-182, 1998.[Web of Science][Medline]

22. Papazian DM, Schwarz TL, Tempel BL, Jan YN, and Jan LY. Cloning of genomic and complementary DNA from Shaker,a putative potassium channel gene from Drosophila. Science 237: 749-753, 1987.[Abstract/Free Full Text]

23. Reiner DJ, Newton EM, Tian H, and Thomas JH. Diverse behavioural defects caused by mutations in Caenorhabditis elegans unc-43 CaM kinase II. Nature 402: 199-203, 1999.[Medline]

24. Roberston GA, Warmke JW, and Ganetsky B. Potassium currents expressed from Drosophila and mouse eag in Xenopus oocytes. Neuropharmacology 35: 841-850, 1996.[Web of Science][Medline]

25. Saganich MJ, Machado E, and Rudy B. Differential expression of genes encoding subthreshold-operating voltage-gated K+ channels in brain. J Neurosci 21: 4609-4624, 2001.[Abstract/Free Full Text]

26. Saganich MJ, Vega-Saenz de Miera E, Nadal MS, Baker H, Coetzee WA, and Rudy B. Cloning of components of a novel subthreshold-activating K+ channel with a unique pattern of expression in the cerebral cortex. J Neurosci 19: 10789-10802, 1999.[Abstract/Free Full Text]

27. Santoro B and Tibbs GR. The HCN gene family: molecular basis of the hyperpolarization-activated pacemaker channels. Ann NY Acad Sci 868: 741-764, 1999.[Web of Science][Medline]

28. Shi W, Wang HS, Pan Z, Wymore RS, Cohen IS, McKinnon D, and Dixon JE. Cloning of a mammalian elk potassium channel gene and EAG mRNA distribution in rat sympathetic ganglia. J Physiol 511: 675-682, 1998.[Abstract/Free Full Text]

29. Shi W, Wymore RS, Wang HS, Pan Z, Cohen IS, McKinnon D, and Dixon JE. Identification of two nervous system-specific members of the erg potassium channel gene family. J Neurosci 17: 9423-9432, 1997.[Abstract/Free Full Text]

30. Titus SA, Warmke JW, and Ganetzky B. The Drosophila erg K+ channel polypeptide is encoded by the seizure locus. J Neurosci 17: 875-881, 1997.[Abstract/Free Full Text]

31. Trudeau MC, Titus SA, Branchaw JL, Ganetzky B, and Robertson GA. Functional analysis of a mouse brain Elk-type K+ channel. J Neurosci 19: 2906-2918, 1999.[Abstract/Free Full Text]

32. Trudeau MC, Warmke JW, Ganatzky B, and Robertson GA. HERG, a human inward rectifier in the voltage-gated potassium channel family. Science 269: 92-95, 1995.[Abstract/Free Full Text]

33. Waldmann R, Bassilana F, de Weille J, Champigny G, Heurteaux C, and Lazdunski M. Molecular cloning of a noninactivating proton-gated Na+ channel specific for sensory neurons. J Biol Chem 272: 20975-20978, 1997.[Abstract/Free Full Text]

34. Wang HS, Pan Z, Shi W, Brown BS, Wymore RS, Cohen IS, Dixon JE, and McKinnon D. KCNQ2 and KCNQ3 potassium channel subunits: molecular correlates of the M-channel. Science 282: 1890-1893, 1998.[Abstract/Free Full Text]

35. Warmke J, Drysdale R, and Ganetzky B. A distinct potassium channel polypeptide encoded by the Drosophila eag locus. Science 252: 1560-1562, 1991.[Abstract/Free Full Text]

36. Warmke J and Ganetzky B. A family of potassium channel genes related to eag in Drosophila and mammals. Proc Natl Acad Sci USA 91: 3438-3442, 1994.[Abstract/Free Full Text]

37. Waterston RH, Lindblad-Toh K, Birney E, Rogers J, Abril JF, Agarwal P, Agarwala R, Ainscough R, Alexandersson M, An P, Antonarakis SE, Attwood J, Baertsch R, Bailey J, Barlow K, Beck S, Berry E, Birren B, Bloom T, Bork P, Botcherby M, Bray N, Brent MR, Brown DG, Brown SD, Bult C, Burton J, Butler J, Campbell RD, Carninci P, Cawley S, Chiaromonte F, Chinwalla AT, Church DM, Clamp M, Clee C, Collins FS, Cook LL, Copley RR, Coulson A, Couronne O, Cuff J, Curwen V, Cutts T, Daly M, David R, Davies J, Delehaunty KD, Deri J, Dermitzakis ET, Dewey C, Dickens NJ, Diekhans M, Dodge S, Dubchak I, Dunn DM, Eddy SR, Elnitski L, Emes RD, Eswara P, Eyras E, Felsenfeld A, Fewell GA, Flicek P, Foley K, Frankel WN, Fulton LA, Fulton RS, Furey TS, Gage D, Gibbs RA, Glusman G, Gnerre S, Goldman N, Goodstadt L, Grafham D, Graves TA, Green ED, Gregory S, Guigo R, Guyer M, Hardison RC, Haussler D, Hayashizaki Y, Hillier LW, Hinrichs A, Hlavina W, Holzer T, Hsu F, Hua A, Hubbard T, Hunt A, Jackson I, Jaffe DB, Johnson LS, Jones M, Jones TA, Joy A, Kamal M, Karlsson EK, Karolchik D, Kasprzyk A, Kawai J, Keibler E, Kells C, Kent WJ, Kirby A, Kolbe DL, Korf I, Kucherlapati RS, Kulbokas EJ, Kulp D, Landers T, Leger JP, Leonard S, Letunic I, Levine R, Li J, Li M, Lloyd C, Lucas S, Ma B, Maglott DR, Mardis ER, Matthews L, Mauceli E, Mayer JH, McCarthy M, McCombie WR, McLaren S, McLay K, McPherson JD, Meldrim J, Meredith B, Mesirov JP, Miller W, Miner TL, Mongin E, Montgomery KT, Morgan M, Mott R, Mullikin JC, Muzny DM, Nash WE, Nelson JO, Nhan MN, Nicol R, Ning Z, Nusbaum C, O'Connor MJ, Okazaki Y, Oliver K, Overton-Larty E, Pachter L, Parra G, Pepin KH, Peterson J, Pevzner P, Plumb R, Pohl CS, Poliakov A, Ponce TC, Ponting CP, Potter S, Quail M, Reymond A, Roe BA, Roskin KM, Rubin EM, Rust AG, Santos R, Sapojnikov V, Schultz B, Schultz J, Schwartz MS, Schwartz S, Scott C, Seaman S, Searle S, Sharpe T, Sheridan A, Shownkeen R, Sims S, Singer JB, Slater G, Smit A, Smith DR, Spencer B, Stabenau A, Stange-Thomann N, Sugnet C, Suyama M, Tesler G, Thompson J, Torrents D, Trevaskis E, Tromp J, Ucla C, Ureta-Vidal A, Vinson JP, Von Niederhausern AC, Wade CM, Wall M, Weber RJ, Weiss RB, Wendl MC, West AP, Wetterstrand K, Wheeler R, Whelan S, Wierzbowski J, Willey D, Williams S, Wilson RK, Winter E, Worley KC, Wyman D, Yang S, Yang SP, Zdobnov EM, Zody MC, and Lander ES. Initial sequencing and comparative analysis of the mouse genome. Nature 420: 520-562, 2002.[Medline]

38. Wei A, Covarrubias M, Butler A, Baker K, Pak M, and Salkoff L. K+ current diversity is produced by an extended gene family conserved in Drosophila and mouse. Science 248: 599-603, 1990.[Abstract/Free Full Text]

39. Weinshenker D, Wei A, Salkoff L, and Thomas JH. Block of an ether-à-go-go-like K+ channel by imipramine rescues egl-2 excitation defects in Caenorhabditis elegans. J Neurosci 19: 9831-9840, 1999.[Abstract/Free Full Text]

40. Wimmers S, Wulfsen I, Bauer CK, Schwarz JR. Erg1, erg2 and erg3 K channel subunits are able to form heteromultimers. Pflügers Arch 441: 450-455, 2001.[Web of Science][Medline]




This article has been cited by other articles:


Home page
Physiol. Rev.Home page
H. Vacher, D. P. Mohapatra, and J. S. Trimmer
Localization and Targeting of Voltage-Dependent Ion Channels in Mammalian Central Neurons
Physiol Rev, October 1, 2008; 88(4): 1407 - 1447.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/6/C1356    most recent
00179.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zou, A.
Right arrow Articles by Wickenden, A. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zou, A.
Right arrow Articles by Wickenden, A. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the American Physiological Society.