Am J Physiol Cell Physiol Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 285: C1349-C1355, 2003. First published July 30, 2003; doi:10.1152/ajpcell.00173.2003
0363-6143/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/6/C1349    most recent
00173.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (14)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kuang, P.-P.
Right arrow Articles by Goldstein, R. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kuang, P.-P.
Right arrow Articles by Goldstein, R. H.

EXTRACELLULAR MATRIX, CELL INTERACTIONS

Regulation of elastin gene transcription by interleukin-1{beta}-induced C/EBP{beta} isoforms

Ping-Ping Kuang and Ronald H. Goldstein

Pulmonary Center and Department of Biochemistry, Boston University School of Medicine, and Boston Department of Veterans Affairs Medical Center, Boston, Massachusetts 02118

Submitted 1 May 2003 ; accepted in final form 21 July 2003


    ABSTRACT
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
We previously showed that interleukin (IL)-1{beta} decreases elastin gene transcription through activation of the NF-{kappa}B subunit p65 in neonatal rat lung fibroblasts. The present study was undertaken to further explore the molecular mechanisms responsible for the inhibitory effect of IL-1{beta} on elastin gene transcription. We found that cycloheximide blocked IL-1{beta}-induced downregulation of elastin mRNA but did not inhibit IL-1{beta}-induced translocation of p65 into the nucleus. IL-1{beta} treatment increased CCAAT/enhancer-binding protein (C/EBP){beta} mRNA and protein levels including liver-enriched activating protein (LAP) and liver-enriched inhibitory protein (LIP), which was cycloheximide sensitive. C/EBP{beta} isoforms bound a GCAAT-containing sequence in the proximal elastin promoter as determined by electrophoretic gel shift studies and confirmed by using specific anti-C/EBP{beta} antibodies and by competition studies with oligonucleotides. Transient transfection of LIP expression vectors strongly decreased the transcriptional activity of the cotransfected elastin promoter and decreased levels of endogenous elastin mRNA. We demonstrated that IL-1{beta}-induced downregulation of elastin mRNA is dependent on NF-{kappa}B activation and C/EBP{beta} expression. These results indicate that IL-1{beta} treatment activates NF-{kappa}B, which subsequently induces LIP expression and inhibition of elastin gene transcription.

lung; fibroblasts; emphysema; nuclear factor-{kappa}B


ELASTIN is a key structural component in the lung and other elastic tissues. Tropoelastin, a soluble precursor, is synthesized by interstitial fibroblasts in alveolar structures and by smooth muscle cells in vascular tissue (4, 34, 39). Proteolytic damage to lung elastin results in airspace enlargement and the development of emphysema in humans. In the adult lung parenchyma, elastin mRNA was not detected by in situ hybridization in the normal lung but was expressed during the development of pulmonary emphysema or fibrosis (19, 22). After elastolytic injury to the lung, elastin resynthesis is not sufficient to repair alveolar structures and airway enlargement ensues. The failure of resynthesis may result from the inhibition of elastin production by inflammatory substances including interleukin (IL)-1{beta} and tumor necrosis factor (TNF)-{alpha} (3, 17). Airway enlargement after elastolytic injury was less severe in mice deficient in the IL-1{beta} and TNF-{alpha} receptors (21), supporting the potential role of elastin resynthesis in alveolar repair.

We previously reported (3, 18) that IL-1{beta} reduces the steady-state levels for elastin mRNA in neonatal rat lung fibroblasts by a mechanism that involves activation of NF-{kappa}B and subsequent decreases in the rate of elastin gene transcription. Activation of NF-{kappa}B by a variety of inflammatory or stress-related events is usually followed by nuclear translocation and transactivation or inhibition of target genes. NF-{kappa}B can also affect gene expression indirectly via interactions with other transcription factors. IL-1{beta} activates NF-{kappa}B by inducing phosphorylation of I{kappa}B with subsequent release and nuclear translocation of NF-{kappa}B (10, 31). We found that IL-1{beta} treatment induced a large and sustained increase in intranuclear NF-{kappa}B in neonatal lung fibroblasts (18). Transfection of expression plasmids encoding the NF-{kappa}B p65 subunit, but not the p50 subunit, decreased the transcriptional activity of the elastin promoter and levels of elastin mRNA. Our results (18) together with other reports (30) indicate that NF-{kappa}B, particularly the p65 component, can interfere with the transcription of certain matrix components including elastin and {alpha}1(I) collagen. We now demonstrate that IL-1{beta}-induced activation of NF-{kappa}B requires production of CCAAT/enhancer-binding protein (C/EBP){beta} isoforms to downregulate elastin mRNA expression.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Materials and cell culture. IL-1{beta} was obtained from R&D. Cycloheximide (CHX), PD-98059, helenalin, and U-0126 were obtained from Calbiochem. Polyclonal antibodies against p65, C/EBP{beta}, and C/EBP{alpha} were obtained from Santa Cruz Biotechnology, and anti-V5 antibody was purchased from Invitrogen. Neonatal lung fibroblasts, also referred to as lung interstitial cells (LIC), were isolated from the lungs of 8-day-old Sprague-Dawley rat pups (Charles River Breeding Laboratory, Wilmington, MA) by digestion with 0.25% trypsin IX and collagenase type II (Sigma) and Percoll-gradient centrifugation as previously described (3). After isolation, LIC were grown in minimal essential medium (MEM; Invitrogen) with 10% fetal bovine serum (FBS) and cultured in a 75-cm2 T flask (Falcon Plastics, Los Angeles, CA). Cultures were maintained in a humidified 5% CO2-95% air incubator at 37°C for 3-5 days until confluence. Confluent cultures were rendered quiescent by reducing the serum content of the medium to 0.4% for 24 h. The purity of the cultures was assessed with phase microscopy and Oil Red O staining. Preadipocyte cell lines (3T3.L1-LAP and 3T3.L1-LIP) (provided by Dr. S. Farmer; Ref. 13) were grown in Dulbecco's modified Eagle's medium (DMEM; Invitrogen) supplemented with 10% calf serum (Sigma).

Plasmid constructs. The rat elastin promoter sequence from -1 to -118 bp was cloned into a luciferase basic reporter PGL-2 (PGL-2/118; Promega) as described previously (18). C/EBP{beta} cDNA fragments were generated by PCR from the C/EBP{beta} LAP pBabe viral vector (kindly provided by Dr. S. Farmer) with 5'-end primers for LAP, 5'-CGCGGATCCCCACCAT-GGAAGTGGCCAACTT-3', and LIP, 5'-CGCGGATCCCCACCATGGCGGCCG-GCTT-3', based on published sequences (13) and the 3'-end primer 5'-GCAGT-GACCCGCCGAGGCCAGCAGC-3'. The resulting open reading frame (ORF) sequences for LAP and LIP without stop codon was cloned into V5-tagged pcDNA TOPO (Invitrogen). A Kozak sequence was introduced into C/EBP{beta} expression vectors (13). All constructs were verified by DNA sequencing.

Transient transfection and luciferase assay. Transient transfection was performed with PGL-2/118 linked to firefly luciferase as a reporter gene (1 µg), C/EBP{beta} expression vectors (1 µg), and pEGFP-N1 (0.5 µg; Clontech) or pRLTK expressing Renilla luciferase as an internal control (0.5 µg; Promega) by LipofectAMINE 2000 (Invitrogen) according to the manufacturer's protocol. At 48 h after transfection, cells were harvested in lysis buffer (100 µl). Firefly and Renilla luciferase (10 µl of lysate) activity was determined with the Dual-Luciferase Reporter system (Promega) and by scintillation counting. Firefly luciferase values were normalized to Renilla luciferase values and expressed as relative firefly/Renilla luciferase activity. The percentage of green fluorescent protein (GFP)-positive cells was assessed to monitor transfection efficiency. Experiments were performed in triplicate and repeated at least three times. In some cases, transfected cells were used for immunoprecipitation with anti-V5 antibody. For Northern analysis, LIC were seeded into 100-mm dishes and transfected with 8 µg of empty vector (pcDNA 3.1) or C/EBP{beta} expression vectors (4 and 8 µg of pcDNA LAP or pcDNA LIP) with LipofectAMINE 2000. After 48 h, total RNA was isolated for Northern blot analysis.

RNA isolation and Northern blot analysis. Total RNAs were prepared with the RNeasy mini kit (Qiagen) according to the manufacturer's protocol. Equal amounts of RNAs (10 µg/lane) were electrophoresed in 1% agarose gel with formaldehyde and transferred to Hybond-N+ membrane (Amersham). RNA membrane was ultraviolet cross-linked and sequentially hybridized with 32P-labeled cDNA probes for elastin, p56, C/EBP{beta}, or oligonucleotides that bind the 18S or 28S ribosome subunits in Rapid Hybridization Buffer (Amersham), followed by washing twice in 2x SSC-0.1% SDS at room temperature (RT) for 15 min and once in 0.1x SSC-0.1% SDS at 65°C for cDNA probes and at 37°C for oligonucleotide probes for 20 min. The 18S- and 28S-specific oligonucleotides were synthesized by IDT (Coralville, IA).

Preparation of nuclear extracts and electrophoretic mobility shift assay. Nuclear extracts were prepared on ice at 4°C according to Dignam et al. (11) with modifications, and electrophoretic mobility shift assay (EMSA) was performed as previously described (18). Elastin promoter fragments generated by restriction enzyme digestion were gel purified and end labeled by 3' recessed end fill-in with [{alpha}-32P]dCTP and Klenow (New England Biolabs). Nuclear extracts (20 µg) were incubated with 1 x 105 cpm of labeled elastin promoter fragments (1 ng). To identify non-zinc finger DNA binding proteins, 1 or 10 mM EDTA-EGTA was included in the reaction buffer. To perform supershift experiments, we used an anti-C/EBP{beta} antibody (C-19, 4 µg; Santa Cruz Biotechnology) that was generated against the leucine zipper region of C/EBP{beta} at the COOH terminus and recognizes both LAP and LIP (36). For competition studies, 100 ng of unlabeled double-stranded DNA oligonucleotides was preincubated before addition of 32P-labeled elastin promoter fragments. DNA-nucleoprotein complexes were resolved on a preelectrophoresed 4% nondenaturing polyacrylamide gel (acrylamide-bisacrylamide, 40:1) in 1x TBE (45 mM Tris-borate, 1 mM EDTA) at 150 V for 2.5 h. The double-stranded DNA oligonucleotide sequences (5' to 3'; sense strand) used are shown below. C/EBP{beta} (TGCAGATTGCGCAATCTGCA; Santa Cruz Biotechnology) and Sp1 (ATTCGATCGGGGCGGG-GCGAGC; Promega) oligonucleotides correspond to their consensus sequences, respectively. The GCAAT (-70TACCAGGCAGC-AATTACGCTTTGGGGA-44) and the ATAAA (-55AC-GCTTTGGGGATAAAACGAG-GCGCAG-29) oligonucleotides encoding a C/EBP binding element and a RNA polymerase recognition element of rat elastin promoter, respectively, were synthesized by IDT. Boldfaced sequences are composed of the consensus binding motifs.

Western blot analysis and immunoprecipitation. Nuclear extracts (30 µg) were resolved by 4-12% gradient of SDS-PAGE (Invitrogen) and transferred to nitrocellulose membrane (0.2 µm; Schleicher & Schuell). Milk (0.5%)-blocked membranes were incubated with anti-p65 antibody (1:1,000; Santa Cruz Biotechnology) or anti-C/EBP{beta} antibody (1:1,000; Santa Cruz Biotechnology) overnight at 4°C with shaking. After incubation with the specific secondary horseradish peroxidase-conjugated antibody (1:2,500 dilution; Amersham) at RT for 1 h, membrane was extensively washed and proteins were detected with an enhanced chemiluminescence (ECL) kit (Amersham).

For immunoprecipitation studies, LIC were harvested in 0.5 ml of ice-cold lysis buffer (150 mM NaCl, 1% NP-40, 0.5% deoxycholate, 0.1% SDS, 50 mM Tris, pH 7.5, 1 mM EDTA, 1 mM Na3VO4, 1 mM phenylmethylsulfonyl fluoride, 5 µg/ml aprotinin, and 5 µg/ml leupeptin). The cell lysates were cleared by centrifugation, and supernatants were precleared with protein A/G Sepharose (Santa Cruz Biotechnology) before immunoprecipitation with 2 µg of anti-V5 antibodies (Invitrogen) and 50 µl of protein A/G Sepharose for 24 h at 4°C. The immunoprecipitates were extensively washed, separated by 4-12% gradient SDS-PAGE (Invitrogen), and transferred to nitrocellulose membranes (0.2 µm; Schleicher & Schuell). C/EBP{beta}-V5 fusion proteins were detected with anti-V5 antibodies (Invitrogen).


    RESULTS
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
We used CHX to examine the effect of protein synthesis inhibition on IL-1{beta}-induced downregulation of elastin mRNA levels (Fig. 1A). IL-1{beta} induced a 60% decrease in elastin mRNA levels as determined by densitometry as previously shown (3). CHX alone did not affect basal elastin mRNA levels but completely inhibited the downregulation of elastin mRNA levels by IL-1{beta} treatment. The data shown are representative of three experiments. In contrast, CHX did not affect IL-1{beta}-induced increases in nuclear levels of p65, a NF-{kappa}B subunit containing the DNA binding domain, at 20 h after treatment as determined by Western blotting (Fig. 1B). IL-1{beta} induces persistent increases in NF-{kappa}B levels in the nucleus in lung fibroblasts (16, 18). These results suggested that NF-{kappa}B stimulated or cooperatively interacted with other IL-1{beta}-activated downstream signaling intermediaries.



View larger version (49K):
[in this window]
[in a new window]
 
Fig. 1. Effect of cycloheximide (CHX) on interleukin (IL)-1{beta}-induced downregulation of elastin mRNA and translocation of p65 into the nucleus. A: quiescent lung interstitial cells (LIC) were untreated (C) or treated with IL-1{beta} (250 ng/ml; IL), CHX (10 µg/ml), or both (CHX/IL). After 20 h, total RNA was isolated and Northern blot analysis was performed with 32P-labeled rat elastin cDNA and an oligonucleotide that binds to the 18S ribosome subunit as probes. B: nuclear extracts were isolated from LIC treated with IL-1{beta}, CHX, or both for different time periods as indicated. Western blot analysis was performed with anti-p65 antibody. A cross-reactive protein (CRP) was shown, demonstrating equal loading.

 

IL-1{beta} treatment decreased the activity of the proximal rat elastin promoter (PGL-2/118) in transient transfection assays using neonatal rat fibroblasts (18). We reported (18) that Sp1, Sp3, and another unidentified zinc finger transcriptional factor bound to the elastin promoter region between -66 to -118 bp were unchanged by IL-1{beta} treatment. To identify other potential IL-1{beta}-regulated transcription factors involved in the downregulation of elastin mRNA, we examined the binding of nuclear proteins to a larger promoter fragment (-1 to -118 bp). Proteins binding to the promoter fragment (-1 to -118 bp) were identified by EMSA using nuclear extracts isolated from IL-1{beta}-treated or untreated neonatal lung fibroblasts. With the use of this larger promoter fragment, several nuclear proteins were induced by IL-1{beta} (Fig. 2A). To better resolve these complexes, we used EDTA-EGTA to disrupt the binding of zinc finger proteins (Fig. 2A). Three protein complexes were identified that were up-regulated by IL-1{beta} (designated as C1, C2, and C3). Deletion studies confirmed that these IL-1{beta}-induced proteins bind to the proximal elastin promoter (-1 to -66 bp; Fig. 2B). Computer analysis (38) of the proximal fragment sequence (-1to -118) indicated that the GCAAT sequence located at -56 to -62 bp may function as a putative binding site for C/EBP-related proteins.



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 2. IL-1{beta}-induced proteins bind to the elastin promoter. A: electrophoretic mobility shift assay (EMSA) was performed with 32P-labeled elastin promoter fragment (-1 to -118 bp) and nuclear extracts (NE) from LIC that were untreated (C) or treated with IL-1{beta} for 20 h (IL). The position of Sp1 and the 2 Sp3 isoforms are shown. Reaction mixtures were incubated with or without EDTA-EGTA at 1 (lanes 4 and 5) and 10 mM (lanes 6 and 7) as indicated. IL-1{beta} induced 3 protein complexes, as indicated by arrows {C1 [liver-enhanced activating protein (LAP)-LAP], C2 [LAP-liver-enhanced inhibitory protein (LIP)], and C3 (LIP-LIP)}. B: EMSA was performed with 32P-labeled elastin promoter fragments encoding either -1 to -102 bp (102) or -1 to -66 bp (66) with NE from LIC that were untreated (C) or treated with IL-1{beta} for 20 h (IL). IL-1{beta} induced 3 protein complexes that bind to the proximal elastin fragment (-1 to -66 bp) (lane 6), as indicated by arrows [C1 (LAP-LAP), C2 (LAP-LIP), and C3 (LIP-LIP)].

 

To determine whether proteins binding to the proximal elastin promoter were related to C/EBP, we performed competition studies using oligonucleotides encoding the C/EBP binding sequence found in the elastin proximal promoter, the consensus sequences for C/EBP or Sp1, or the binding sequence in the elastin promoter for the RNA polymerase II ATAAA (Fig. 3). The oligonucleotides were incubated with nuclear extracts before addition of the radiolabeled elastin promoter fragment (-1 to -66 bp) in EMSA. We found that C/EBP-encoding oligonucleotides, but not Sp1- or ATAAA-encoding oligonucleotides, abolished the binding of three proteins induced by IL-1{beta} treatment (Fig. 3, lanes 6-13). The three C/EBP complexes were supershifted by anti-C/EBP{beta} antibodies (Fig. 3, lane 5) but not anti-C/EBP{alpha} antibodies (data not shown). Previous studies demonstrated that this electrophoretic pattern represents the dimerization of two C/EBP isoforms consisting of LAP and the truncated fragment termed LIP [the dimers were designated as C1 (LAP-LAP), C2 (LAP-LIP), and C3 (LIP-LIP)] (26-28, 37, 39, 40).



View larger version (87K):
[in this window]
[in a new window]
 
Fig. 3. IL-1{beta}-induced C/EBP{beta} binds to the GCAAT-containing sequence region in rat elastin promoter. EMSA was performed with 32P-labeled promoter fragment (-1 to -66 bp) by incubation without nuclear extract (F; lane 1) or with nuclear extracts from untreated (C; lane 2) or from IL-1{beta}-treated LIC (IL; lane 3). Supershift and competition studies were performed with a specific anti-C/EBP{beta} antibody (C/EBP{beta} Ab; lanes 4 and 5, supershifted complexes indicated by arrowhead) or 100-fold molar excess of unlabeled double-stranded DNA oligonucleotides (oligo; lanes 6-13), respectively. IL-1{beta}-induced complexes [C1 (LAP-LAP), C2 (LAP-LIP), and C3 (LIP-LIP)] are indicated by arrows.

 

To examine the effect of IL-1{beta} treatment on C/EBP{beta} mRNA and protein levels, we performed Northern and Western blot analyses. We found that IL-1{beta} induced large increases in the levels of both p65 and C/EBP{beta} mRNAs (Fig. 4A). Western blot analysis of nuclear extracts from LIC demonstrated that IL-1{beta} treatment increased levels of C/EBP{beta} proteins in the nucleus (Fig. 4B). The identity of the proteins was confirmed as LAP and LIP with nuclear extracts from 3T3.L1 murine cell lines that constitutively express LAP and LIP (13). The full-length C/EBP{beta} proteins from rat and mouse differ by three amino acid substitutions and generate C/EBP{beta} isoforms with the same mechanisms (5, 6, 8, 28). The addition of CHX abolished both LIP and LAP protein expression (Fig. 4B).



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 4. IL-1{beta} stimulated expression of C/EBP{beta}. A: quiescent LIC were untreated (control) or treated with IL-1{beta} (250 ng/ml). After 20 h, RNA was isolated and Northern blot analysis was performed with 32P-labeled elastin, C/EBP{beta}, p65 cDNAs, and 18S oligonucleotides as probes. B: quiescent LIC were untreated (C) or treated with IL-1{beta} and CHX for 20 h. Nuclear protein isolation and Western blot analysis were performed as described in EXPERIMENTAL PROCEDURES. Preadipocytes that constitutively expressed C/EBP{beta} proteins (L1.LAP and L1.LIP) were used to confirm identify of the proteins. Full-length C/EBP{beta} (FL) and a CRP were also shown as indicated.

 

To examine the functional role of IL-1{beta}-induced C/EBP{beta} proteins on the transcriptional activity of the elastin promoter, we carried out cotransfection experiments. PGL-2/118 elastin luciferase reporter was cotransfected with pcDNA expression vectors for the transcriptionally active LAP or the transcriptional repressor LIP into neonatal lung fibroblasts (9, 29, 36). We found that cotransfection with LAP or LIP decreased luciferase activity of PGL-2/118 by 26% and 50%, respectively (Fig. 5A, top). Immunoprecipitation with anti-V5 antibody indicated that LAP and LIP were expressed in transfected neonatal lung fibroblasts (Fig. 5A, bottom). We transfected LAP or LIP pcDNA expression plasmids into neonatal lung fibroblasts and examined endogenous elastin mRNA levels by Northern blot analysis. We found that LAP decreased endogenous elastin mRNA after transfection at a high dose of plasmid DNA, whereas LIP decreased elastin mRNA after transfection at a low dose (Fig. 5B).



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 5. Overexpression of C/EBP{beta} proteins decreased elastin promoter activity and endogenous elastin mRNA expression. A: elastin promoter luciferase reporter PGL-2/118 was cotransfected with empty vector (PC) or pcDNA3 LAP or pcDNA3 LIP expression vector into neonatal lung fibroblasts. After 48 h, luciferase activity was determined and data were normalized for transfection efficiency by measuring Renilla luciferase expression (mean ± SD of 3 independent experiments performed in triplicates) (top). Immunoprecipitation and Western blot analysis were performed with whole cell lysates from transfected cultures with anti-V5 antibody (bottom). B: neonatal lung fibroblasts were transfected with either empty vector (PC, 8 µg) or C/EBP{beta} expression vectors (LAP or LIP, at 2 different doses, 4 and 8 µg). After 48 h, total RNA was isolated and Northern blot analysis was performed with rat 32P-labeled elastin cDNA and an oligonucleotide that binds to the 28S ribosome subunit as probes.

 

We used helenalin, a specific inhibitor of NF-{kappa}B activation, to examine whether IL-1{beta}-induced C/EBP expression is dependent on NF-{kappa}B activation. Helenalin irreversibly alkylates the p65 subunit and thereby inhibits the association of p65 with promoter elements (15, 23). The addition of helenalin (10 µM) inhibited IL-1{beta}-induced increases in C/EBP mRNA and decreases in elastin mRNA (Fig. 6).



View larger version (101K):
[in this window]
[in a new window]
 
Fig. 6. Inhibition of NF-{kappa}B activation blocks IL-1{beta}-induced increases in C/EBP{beta} mRNA and downregulation of elastin mRNA. Quiescent confluent fibroblasts were treated with helenalin (10 µM) without (C) or with IL-1{beta} (IL) for 20 h. RNA was isolated and analyzed by Northern blotting with rat 32P-labeled elastin cDNA and an oligonucleotide that binds to the 28S ribosome subunit as probes.

 


    DISCUSSION
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
We previously demonstrated (18) that activation of NF-{kappa}B is required for IL-1{beta}-induced downregulation of elastin promoter transcriptional activity. We now report that this downregulation was CHX dependent, indicating a requirement for new protein synthesis and suggesting an interaction between NF-{kappa}B and another transcription factor. Experiments using nuclear proteins derived from IL-1{beta}-treated fibroblasts identified several C/EBP{beta} complexes that bind to the proximal elastin promoter. NF-{kappa}B and C/EBP{beta} proteins function cooperatively to regulate certain genes by physical association and regulate other genes by independently binding to their respective promoter elements (7). For example, NF-{kappa}B and C/EBP{beta} appear to mediate IL-1{beta}-induced type II nitric oxide synthase (iNOS) expression (32).

C/EBP{beta} is a basic leucine zipper transcription factor encoded by a single intronless gene that generates several isoforms (full-length LAP 38 kDa, LAP 35 kDa, LIP 20 kDa and a smaller 16-kDa form) that bind to DNA as homodimers or heterodimers (9). The isoforms may arise by two potential mechanisms depending on the cell type and culture conditions (2, 9). The truncated isoform (LIP) can be generated by a leaky ribosomal scanning mechanism with initiation of translation at the third AUG. The regulation of LIP translation may involve RNA binding proteins and the influence of a short ORF (sORF) located in the 5' region of the C/EBP{beta}mRNA (33). The LAP isoform contains an activation domain, a DNA binding domain, and a leucine zipper domain. The truncated protein (LIP) is generated from the downstream AUG containing only the DNA binding domain and leucine zipper domain and inhibits transcription either by competing with the LAP isoforms for binding sites or by interfering with the binding of the transcriptional apparatus (12). In addition, formation of heterodimers of LIP with LAP decreases transcriptional activation (9, 20). The C/EBP fragments are also formed by a proteolytic cleavage mechanism in certain cell types (2). This mechanism requires nuclear localization and is increased during certain extraction procedures for isolation of nuclear proteins (2). We did not detect LIP in nuclear proteins isolated from a stable preadipocyte cell line (13) with a mutated third AUG in the C/EBP{beta} gene, indicating that our isolation procedure for nuclear proteins did not result in proteolytic production of LIP.

Overexpression of LAP and LIP in a transient transfection assay decreased elastin promoter activity and elastin mRNA levels. Deletion analysis and competition studies with oligonucleotides encoding portions of the proximal elastin promoter indicate that C/EBP binds to the GCAAT sequence located at -56 to -62 bp in the elastin promoter. Because we could not detect C/EBP isoforms in untreated cultures, LIP likely inhibits elastin transcription by blocking the binding of RNA polymerase II as shown for phosphoenolpyruvate carboxykinase gene promoter (12). Transfection of LAP also decreased the activity of the elastin promoter, but to a lesser extent than LIP. Western blot analysis of nuclear lysates indicates that both LAP and LIP are generated after transfection of LAP at a higher dose.

Our results suggest that the inhibitory activity of C/EBP{beta} expression on elastin promoter activity is the result of binding of LIP-LIP homodimers and LAP-LIP heterodimers. IL-1{beta} treatment induced larger amounts of LAP than LIP (Fig. 4B). However, only low levels of LAP-LAP DNA binding complexes were formed (Figs. 2 and 3). Acetylation of C/EBP{beta} proteins decreases the formation of the transcriptional activator LAP-LAP but not transcriptional repressors LAP-LIP and LIP-LIP (39). These results suggest that IL-1{beta}-induced C/EBP{beta} proteins may be acetylated in rat neonatal lung fibroblasts. Overexpressed LAP may be acetylated and fail to form the active LAP-LAP homodimer.

IL-1{beta} increases C/EBP mRNA levels in liver and kidney in vivo (1, 24) and in rat chondrogenic (26) and osteoblastic (14) cells in vitro. IL-1{beta} also affects C/EBP activity by altering phosphorylation on serine in hepatocytes (35). We find that IL-1{beta} treatment increases the levels of C/EBP{beta} mRNA and protein. This induction is mediated by NF-{kappa}B. In rat hepatoma cells, NF-{kappa}B increased the activity of the rat C/EBP{beta} promoter (25). Together, our results indicate that IL-1{beta}-induced downregulation of elastin mRNA involves an initial activation of NF-{kappa}B. Translocation of the p65 subunit into the nucleus induced expression of C/EBP{beta} mRNA and the subsequent expression of C/EBP{beta} proteins. These isoforms, especially LIP, bind to the proximal elastin promoter and decrease transcriptional activity. This pathway can be inhibited by blocking either activation of NF-{kappa}B or production of C/EBP{beta} isoforms. Regulation of elastin production by IL-1{beta} during inflammatory reactions may contribute to the impaired elastin resynthesis that results in airway enlargement (19, 21).


    DISCLOSURES
 
This work was supported by National Heart, Lung, and Blood Institute Grants P01-HL-46902 and R01-HL-66547 and a Research Enhancement Award Program Grant from the Department of Veterans Affairs Research Service.


    FOOTNOTES
 

Address for reprint requests and other correspondence: P.-P. Kuang, Pulmonary Center, R 304, Boston Univ. School of Medicine, 80 E. Concord St., Boston, MA 02118 (E-mail: pkuang{at}lung.bumc.bu.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
1. Akira S, Isshiki H, Sugita T, Tanabe O, Kinoshita S, Nishio Y, Nakajima T, Hirano T, and Kishimoto T. A nuclear factor for IL-6 expression (NF-IL6) is a member of a C/EBP family. EMBO J 9: 1897-1906, 1990.[Web of Science][Medline]

2. Baer M and Johnson PF. Generation of truncated C/EBPbeta isoforms by in vitro proteolysis. J Biol Chem 275: 26582-26590, 2000.[Abstract/Free Full Text]

3. Berk JL, Franzblau C, and Goldstein RH. Recombinant interleukin-1{beta} inhibits elastin formation by a rat lung fibroblast subtype. J Biol Chem 266: 3192-3197, 1991.[Abstract/Free Full Text]

4. Bruce MC and Honaker CE. Transcriptional regulation of tropoelastin expression in rat lung fibroblasts: changes with age and hyperoxia. Am J Physiol Lung Cell Mol Physiol 274: L940-L950, 1998.[Abstract/Free Full Text]

5. Cao Z, Umek RM, and McKnight SL. Regulated expression of three C/EBP isoforms during adipose conversion of 3T3-L1 cells. Genes Dev 5: 1538-1552, 1991.[Abstract/Free Full Text]

6. Chang CJ, Chen TT, Lei HY, Chen DS, and Lee SC. Molecular cloning of a transcription factor, AGP/EBP, that belongs to members of the C/EBP family. Mol Cell Biol 10: 6642-6653, 1990.[Abstract/Free Full Text]

7. Darville MI and Eizirik DL. Cytokine induction of Fas gene expression in insulin producing cells requires the transcription factors NF-{kappa}B and C/EBP. Diabetes 50: 1741-1748, 2001.[Abstract/Free Full Text]

8. Descombes P, Chojkier M, Lichtsteiner S, Falvey E, and Schibler U. LAP, a novel member of the C/EBP gene family, encodes a liver-enriched transcriptional activator protein. Genes Dev 4: 1541-1551, 1990.[Abstract/Free Full Text]

9. Descombes P and Schibler U. A liver-enriched transcriptional activator protein, LAP, and a transcriptional inhibitory protein, LIP, are translated from the same mRNA. Cell 67: 569-579, 1991.[Web of Science][Medline]

10. DiDonato J, Mercurio F, Rosette C, Wu-Li J, Suyang H, Ghosh S, and Karin M. Mapping of the inducible IkappaB phosphorylation sites that signal its ubiquitination and degradation. Mol Cell Biol 16: 1295-304, 1996.[Abstract]

11. Dignam JD, Lebovitz RM, and Roeder RG. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11: 1475-1489, 1983.[Abstract/Free Full Text]

12. Duong DT, Waltner-Law ME, Sears R, Sealy L, and Granner DK. Insulin inhibits hepatocellular glucose production by utilizing liver-enriched transcriptional inhibitory protein to disrupt the association of CREB-binding protein and RNA polymerase II with the phosphoenolpyruvate carboxykinase gene promoter. J Biol Chem 277: 32234-32242, 2002.[Abstract/Free Full Text]

13. Hamm JK, Park BH, and Farmer SR. A role for C/EBPbeta in regulating peroxisome proliferator-activated receptor gamma activity during adipogenesis in 3T3-L1 preadipocytes. J Biol Chem 276: 18464-18471, 2001.[Abstract/Free Full Text]

14. Harrison JR, Kelly PL, and Pilbeam CC. Involvement of CCAAT enhancer binding protein transcription factors in the regulation of prostaglandin G/H synthase 2 expression by interleukin-1{beta} in osteoblastic MC3T3-E1 cells. J Bone Miner Res 15: 1138-1146, 2000.[Web of Science][Medline]

15. Hodgson L, Henderson AJ, and Dong C. Melanoma cell migration to type IV collagen require activation of NF-{kappa}B. Oncogene 22: 98-108, 2003.[Web of Science][Medline]

16. Hohmann HP, Remy R, Scheidereit C, and van Loon AP. Maintenance of NF-kappa B activity is dependent on protein synthesis and the continuous presence of external stimuli. Mol Cell Biol 11: 259-266, 1991.[Abstract/Free Full Text]

17. Kahari VM, Chen YQ, Bashir MM, Rosenbloom J, and Uitto J. Tumor necrosis factor-alpha down-regulates human elastin gene expression. Evidence for the role of AP-1 in the suppression of promoter activity. J Biol Chem 267: 26134-26141, 1992.[Abstract/Free Full Text]

18. Kuang PP, Berk JL, Rishikof DC, Foster JA, Humphries DE, Ricupero DA, and Goldstein RH. NF-{kappa}B induced by IL-1{beta} inhibits elastin transcription and the myofibroblast phenotype. Am J Physiol Cell Physiol 283: C58-C65, 2002.[Abstract/Free Full Text]

19. Kuhn C, Yu SY, Chraplyvy M, Linder HE, and Senior RM. Induction of emphysema with elastase. II. Changes in connective tissue. Lab Invest 34: 372-380, 1976.[Web of Science][Medline]

20. Lekstrom-Himes J and Xanthopoulos KG. Biological role of the CCAAT/enhancer-binding protein family of transcription factors. J Biol Chem 273: 28545-28548, 1998.[Abstract/Free Full Text]

21. Lucey EC, Keane J, Kuang PP, Snider GL, and Goldstein RH. Severity of elastase induced emphysema is decreased in TNF-{alpha} and IL-1{beta} receptor deficient mice. Lab Invest 82: 79-85, 2002.[Web of Science][Medline]

22. Lucey EC, Ngo HQ, Agarwal A, Smith BD, Snider BD, Snider GL, and Goldstein RH. Differential expression of elastin and {alpha}1(I) collagen mRNA in mice with bleomycin induced fibrosis. Lab Invest 74: 12-20, 1996.[Web of Science][Medline]

23. Lyss G, Knorre A, Schmidt TJ, Pahl HL, and Merfort I. The anti-inflammatory sesquiterpene lactone helenalin inhibits the transcription factor NF-{kappa}B by directly targeting p65. J Biol Chem 273: 33508-33516, 1998.[Abstract/Free Full Text]

24. Magalini A, Savoldi G, Ferrari F, Garnier M, Ghezzi P, Albertini A, and Di Lorenzo D. Role of IL-1 beta and corticosteroids in the regulation of the C/EBP-alpha, beta and delta genes in vivo. Cytokine 7: 753-758, 1995.[Web of Science][Medline]

25. Niehof M, Kubicka S, Zender L, Manns MP, and Trautwein C. Autoregulation enables different pathways to control CCAAT/enhancer binding protein beta (C/EBPbeta) transcription. J Mol Biol 309: 855-868, 2001.[Web of Science][Medline]

26. Okazakji K, Li J, Yu H, Fukui N, and Sandell LJ. CCAAT/Enhancer-binding proteins B and G mediate the repression of gene transcription of cartilage derived retinoic acid sensitive protein induced by interleukin-1{beta}. J Biol Chem 277: 31526-31533, 2002.[Abstract/Free Full Text]

27. Parkin SE, Baer M, Copeland TD, Schwartz RC, Johnson PF. Regulation of CCAAT/enhancer-binding protein (C/EBP) activator proteins by heterodimerization with C/EBPgamma (Ig/EBP). J Biol Chem 277: 23563-23572, 2002.[Abstract/Free Full Text]

28. Poli V, Mancini FP, and Cortese R. IL-6DBP, a nuclear protein involved in interleukin-6 signal transduction, defines a new family of leucine zipper proteins related to C/EBP. Cell 63: 643-653, 1990.[Web of Science][Medline]

29. Ramji DP and Foka P. CCAAT/enhancer-binding proteins: structure, function and regulation. Biochem J 365: 561-575, 2002.[Web of Science][Medline]

30. Rippe RA, Schrum LW, Stefanovic B, Solis-Herruzo JA, and Brenner DA. NF-kappaB inhibits expression of the alpha1(I) collagen gene. DNA Cell Biol 18: 751-761, 1999.[Web of Science][Medline]

31. Scherer DC, Brockman JA, Chen Z, Maniatis T, and Ballard DW. Signal-induced degradation of I{kappa}B{alpha} requires site-specific ubiquitination. Proc Natl Acad Sci USA 92: 11259-11263, 1995.[Abstract/Free Full Text]

32. Teng X, Zhang H, Snead C, and Catravas JD. Molecular mechanisms of iNOS induction by IL-1{beta} and IFN-{gamma} in rat aortic smooth muscle cells. Am J Physiol Cell Physiol 282: C144-C152, 2002.[Abstract/Free Full Text]

33. Timchenko NA, Cai ZJ, Welm AL, Reddy S, Ashizawa T, and Timchenko LT. RNA CUG repeats sequester CUGBP1 and alter protein levels and activity of CUGBP1. J Biol Chem 276: 7820-7826, 2001.[Abstract/Free Full Text]

34. Vrhovski B and Weiss AS. Biochemistry of tropoelastin. Eur J Biochem 258: 1-18, 1998.[Web of Science][Medline]

35. Wegner M, Cao Z, and Rosenfeld MG. Calcium-regulated phosphorylation within the leucine zipper of C/EBP beta. Science 256: 370-373, 1992.[Abstract/Free Full Text]

36. Welm AL, Mackey SL, Timchenko LT, Darlington GJ, and Timchenko NA. Translational induction of liver-enriched transcriptional inhibitory protein during acute phase response leads to repression of CCAAT/enhancer binding protein alpha mRNA. J Biol Chem 275: 27406-27413, 2002.

37. Welm AL, Timchenko NA, and Darlington GJ. C/EBP alpha regulates generation of C/EBP beta isoforms through activation of specific proteolytic cleavage. Mol Cell Biol 19: 1695-1704, 1999.[Abstract/Free Full Text]

38. Wingender E, Chen X, Hehl R, Karas H, Liebich I, Matys V, Meinhardt T, Prüß M, Reuter I, and Schacherer F. TRANSFAC: an integrated system for gene expression regulation. Nucleic Acids Res 28: 316-319, 2000.[Abstract/Free Full Text]

39. Wolfe BL, Rich CB, Gould HD, Terpstra AJ, Bashir M, Rosenbloom J, Sonnenshein GE, and Foster JA. Insulin-like growth factor-I regulates transcription of the elastin gene. J Biol Chem 268: 12418-12426, 1993.[Abstract/Free Full Text]

40. Xu M, Nie L, Kim SH, and Sun XH. STAT5-induced Id-1 transcription involves recruitment of HDAC1 and deacetylation of C/EBP{beta}. EMBO J 22: 893-904, 2003.[Web of Science][Medline]




This article has been cited by other articles:


Home page
Am. J. Respir. Cell Mol. Bio.Home page
A. Churg, S. Zhou, X. Wang, R. Wang, and J. L. Wright
The Role of Interleukin-1{beta} in Murine Cigarette Smoke-Induced Emphysema and Small Airway Remodeling
Am. J. Respir. Cell Mol. Biol., April 1, 2009; 40(4): 482 - 490.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
P.-P. Kuang, X.-H. Zhang, C. B. Rich, J. A. Foster, M. Subramanian, and R. H. Goldstein
Activation of elastin transcription by transforming growth factor-beta in human lung fibroblasts
Am J Physiol Lung Cell Mol Physiol, April 1, 2007; 292(4): L944 - L952.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
R. A. Pierce, C. H. Moore, and M. C. Arikan
Positive transcriptional regulatory element located within exon 1 of elastin gene.
Am J Physiol Lung Cell Mol Physiol, September 1, 2006; 291(3): L391 - L399.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
P.-P. Kuang, E. Lucey, D. C. Rishikof, D. E. Humphries, D. Bronsnick, and R. H. Goldstein
Engraftment of Neonatal Lung Fibroblasts into the Normal and Elastase-Injured Lung
Am. J. Respir. Cell Mol. Biol., October 1, 2005; 33(4): 371 - 377.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
P.-P. Kuang and R. H. Goldstein
Regulation of elastin gene transcription by proteasome dysfunction
Am J Physiol Cell Physiol, September 1, 2005; 289(3): C766 - C773.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
G. A. Darnell, T. M. Antalis, B. R. Rose, and A. Suhrbier
Silencing of Integrated Human Papillomavirus Type 18 Oncogene Transcription in Cells Expressing SerpinB2
J. Virol., April 1, 2005; 79(7): 4246 - 4256.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
U. Lappalainen, J. A. Whitsett, S. E. Wert, J. W. Tichelaar, and K. Bry
Interleukin-1{beta} Causes Pulmonary Inflammation, Emphysema, and Airway Remodeling in the Adult Murine Lung
Am. J. Respir. Cell Mol. Biol., April 1, 2005; 32(4): 311 - 318.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/6/C1349    most recent
00173.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (14)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kuang, P.-P.
Right arrow Articles by Goldstein, R. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kuang, P.-P.
Right arrow Articles by Goldstein, R. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the American Physiological Society.