Am J Physiol Cell Physiol Add DOIs to your references at manuscript stage!
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 285: C1255-C1262, 2003. First published July 2, 2003; doi:10.1152/ajpcell.00149.2003
0363-6143/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/5/C1255    most recent
00149.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zubare-Samuelov, M.
Right arrow Articles by Naim, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zubare-Samuelov, M.
Right arrow Articles by Naim, M.

RECEPTORS AND SIGNAL TRANSDUCTION

Some sweet and bitter tastants stimulate inhibitory pathway of adenylyl cyclase via melatonin and {alpha}2-adrenergic receptors in Xenopus laevis melanophores

Meirav Zubare-Samuelov,1 Irena Peri,1 Michael Tal,2 Mark Tarshish,3 Andrew I. Spielman,4 and Michael Naim1

1Institute of Biochemistry, Food Science and Nutrition, Faculty of Agricultural, Food and Environmental Quality Sciences, The Hebrew University of Jerusalem, Rehovot 76-100; 2Integrated Genetic Devices, Yavne 81104; and 3Hadassah School of Medicine, Hebrew University of Jerusalem, Jerusalem 91120, Israel; and 4Department of Basic Science and Craniofacial Biology, New York University College of Dentistry, New York, New York 10010

Submitted 15 April 2003 ; accepted in final form 27 June 2003


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The sweeteners saccharin, D-tryptophan, and neohesperidin dihydrochalcone (NHD) and the bitter tastant cyclo(Leu-Trp) stimulated concentration-dependent pigment aggregation in a Xenopus laevis melanophore cell line similar to melatonin. Like melatonin, these tastants inhibited (by 45-92%) cAMP formation in melanophores; pertussis toxin pretreatment almost completely abolished the tastant-induced cAMP inhibition, suggesting the involvement of the inhibitory pathway (Gi) of adenylyl cyclase. The presence of luzindole (melatonin receptor antagonist) almost completely abolished the inhibition of cAMP formation induced by saccharin, D-tryptophan, and cyclo(Leu-Trp) but only slightly affected the inhibitory effect of NHD. In contrast, the presence of an {alpha}2-adrenergic receptor antagonist, yohimbine, almost completely abolished the inhibition of cAMP formation induced by NHD but had only a minor effect on that induced by the other tastants. Thus saccharin, D-tryptophan, and cyclo(Leu-Trp) are melatonin receptor agonists whereas NHD is an {alpha}2-adrenergic receptor agonist, but both pathways lead to the same transduction output and cellular response. Formation of D-myo-inositol 1,4,5-trisphosphate (IP3) in melanophores was reduced (15-58%, no concentration dependence) by saccharin, D-tryptophan, and cyclo(Leu-Trp) stimulation but increased by NHD stimulation. Tastant stimulation did not affect cGMP. Although some of the above tastants were found to be membrane permeant, their direct activation of downstream transduction components in this experimental system is questionable. MT1 and MT2 melatonin receptor mRNAs were identified in rat circumvallate papilla taste buds and nonsensory epithelium, suggesting the occurrence of MT1 and MT2 receptors in these tissues. Melatonin stimulation reduced the cellular content of cAMP in taste cells, which may or may not be related to taste sensation.

pigment aggregation; adenosine 3',5'-cyclic monophosphate; D-myo-inositol 1,4,5-trisphosphate; permeation


THE NEWLY DISCOVERED G protein-coupled taste receptors (GPCRs; Refs. 4, 7, 20, 21, 27) are likely to play a major role in the exertion of sweet and bitter tastant taste stimulation. Proposed pathways for the downstream transduction of sweet taste include increases in cAMP (40, 41), and more recently cGMP (15), in response to stimulation by sugars and in D-myo-inositol 1,4,5-trisphosphate (IP3) in response to nonsugar stimulation (2). Apparently, bitter taste transduction involves stimulation of the PLC-IP3 pathway, a reduction in cAMP, and an increase in cGMP (32, 34, 38). Very recently (46), sweet, bitter, and amino acid tastes, but not sour and salty tastes, were proposed to be transduced by a common pathway involving PLC-{beta}2 and the TRPM5 ion channel. In addition, some amphipathic (possessing both hydrophobic and hydrophilic domains) bitter tastants and nonsugar sweeteners can rapidly permeate taste cells against a concentration gradient (29) and, like other amphipathic compounds (22, 37), can activate G proteins directly in vitro (26). Furthermore, some odorants were shown to induce pigment dispersion and activation of adenylyl cyclase (AC) pathway (increase in cAMP content) in Xenopus laevis melanophores, which are nonolfactory by nature, suggesting nonspecific effects by such odorants (17). These results led to the hypothesis that amphipathic tastants stimulate transduction pathways by means of receptor-dependent and receptor-independent mechanisms, as proposed for other systems (1, 6), which in the taste system may be related to the delayed temporal properties (e.g., lingering aftertaste) induced by such tastants (24).

In view of this hypothesis, the present study made use of X. laevis melanophores as a model for studying cellular and signal transduction pathways in response to stimulation by amphipathic tastants. If they permeate into the melanophore cells, which are expected to lack taste receptors, such tastants may stimulate downstream transduction components. The X. laevis melanophores are epithelial skin pigment cells that contain GPCRs, which are coupled via G proteins to AC or PLC (10, 30). Stimulation of melanophores by MSH or by {beta}1-adrenergic receptor agonists increases the cellular content of cAMP, which leads to melanosome pigment dispersion, whereas stimulation of {alpha}2-adrenergic or melatonin receptors causes pigment aggregation via the activation of the inhibitory pathway of AC (30, 42). Preliminary experiments indicated that our tested tastants produce pigment aggregation rather than dispersion in this melanophore cell line, and therefore the pigment aggregation experimental system was used throughout the present investigation. The melanophore melanosome system has been found to be a rapid, excellent bioassay for various adrenergic drugs (30).


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell line culture. X. laevis dermal melanophores and fibroblasts were propagated in culture as described previously (8). Both cell types were kindly provided by the Bunsen Rush Laboratories (Newton, MA).

Fibroblasts were grown in 800-ml tissue culture flasks (Nunc, Roskilde, Denmark) containing the following growth medium: 50% (vol/vol) L-15, 20% (vol/vol) fetal calf serum, 100 IU/ml penicillin, and 100 µg/ml streptomycin in double-distilled water (DDW). Growth medium was replaced twice a week, collected, and filter sterilized to produce conditioned medium (CM, 50% or 100%). Frog melanophores were grown in 50% or 100% CM.

Aggregation of pigments in melanophore cell line: microtiter plate assay. Melanophores were seeded on standard 96-well tissue culture plates (Nunc), 8,000-12,000 cells per well, in 50% CM and grown for 48 h. Before the experiment, the medium was replaced with 70% (vol/vol) L-15 Leibovitz medium (Sigma, St. Louis, MO) diluted in DDW and plates were exposed to light for 1-h preincubation. Melatonin as a control, the sweeteners sodium saccharin, neohesperidin dihydrochalcone (NHD), and D-tryptophan (all from Sigma), or the bitter stimulus cyclo(Leu-Trp) (Bachem, Bubendorf, Switzerland) were added at the indicated concentrations (see Fig. 1), and plates were kept in the dark during the experiments (which lasted 60 min). Samples containing cyclo(Leu-Trp) (and their corresponding controls) were dissolved in 70% L-15 medium containing 0.1% DMSO. With some modifications of protocols previously described (10, 30), light absorbance was measured at 630 nm in a 340 ATTC microtiter plate reader (Spectra II Elisa Reader, SLT, Salzburg, Austria) with the agglutination mode of the SOFT 2000 program (SLT/Tecan). The agglutination mode acquires 20 separate readings from each well for each time point. Light absorbance measured before (Ai) and after (Af) 60-min incubation was used to calculate changes in absorbance with the equation [(Af - Ai)/Ai] to quantify pigment aggregation.



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 1. Concentration-dependent stimulation of pigment aggregation in Xenopus laevis melanophores after incubation with D-tryptophan (D-Trp), neohesperidin dihydrochalcone (NHD), saccharin (Sacc), and cyclo(Leu-Trp) (CLT) at the indicated concentrations. Melatonin (1 nM) was used as the control stimulus. Levels of light absorbance in response to stimulation by melatonin were between -0.08 and -0.64 {[absorbance after incubation (Af) - absorbance before incubation (Ai)]/Ai}. Basal (BAS) levels express the light absorbance with no tastant stimulation. Values are means and SE of 7-8 replicates for each data point. *Minimal concentration of tastant at which light absorbance was significantly (P < 0.05 or less) higher than that of basal.

 

Monitoring cAMP and cGMP in melanophore cell line in response to tastant stimulation. Cells were seeded on a 24-well standard tissue culture plate (35,000 cells per well) in 50% CM and grown for 72 h. Before the experiment, the medium was replaced with aggregation medium containing (in DDW) 70% L-15 medium, 100 IU/ml penicillin, 100 µg/ml streptomycin, and 0.75% CM and plates were preincubated for 2 h in the light. The aforementioned tastants (see Fig. 2 for concentrations) or melatonin (1 nM) was added for a 15-min incubation in the dark in the presence of 0.1 µM (-)-isoproterenol (Sigma) to elevate the basal level of cAMP (14). Samples containing cyclo(Leu-Trp) (and their corresponding controls) also contained 0.1% DMSO. The reaction was terminated by adding 0.45 ml of 5% (vol/vol) trichloroacetic acid (TCA) (8). After 30 min TCA was removed and an additional 0.45 ml of fresh 5% TCA was added, and after 30 min the two extracts were combined and the resulting mixture was extracted twice with 4.5 ml of ether. The ether was removed, and the aqueous layer was frozen and stored at -20°C until analysis. Frozen samples were lyophilized under vacuum and resuspended in 0.5 ml of 0.1 M sodium acetate buffer, pH 6.2 (8).



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 2. Concentration-dependent inhibition of cAMP formation in Xenopus melanophores after incubation with tastants or melatonin. Tastants were added at the indicated concentrations, and melatonin (MEL, 1 nM) was used as a positive reference. Values are the means and SE of 7-8 replicates for each data point. *Minimal level of tastant at which cAMP level was significantly (P < 0.05 or less) lower than that of the control [100% (-)-isoproterenol-stimulated level]. Control levels were between 141 and 444 fmol cAMP/µg protein after 15-min incubation.

 

To monitor the formation of cGMP, IBMX (a phosphodiesterase inhibitor, 0.5 mM; Sigma) was added for 10-min preincubation to elevate the basal level of cGMP (14). Experiments were then conducted as described above for cAMP.

RIA was used to determine the intracellular levels of cAMP or cGMP (13). 125I-labeled cAMP and 125I-labeled cGMP (Amersham, Little Chalfont, UK) and anti-cAMP-BSA or anti-cGMP-BSA sera (Sigma) were used. Protein concentration was determined according to Bradford (3) after cells were disrupted in 0.3 ml of 0.1 M NaOH. Values of cAMP and cGMP are expressed per microgram of protein.

Pertussis toxin treatment. Melanophore cells were treated with pertussis toxin (PTX, 150 nM; Sigma) to verify the participation of the Gi pathway in the tastant-induced pigment aggregation and reduction of cAMP (14). Except for PTX exposure, treatment of cells for monitoring both pigment aggregation and cAMP changes in the presence of 100 nM MSH were carried out as already described. In the aggregation experiment, cells were preincubated for 23 h in 50% CM in the presence (or absence) of PTX and then for an additional 1 h in 70% L-15 with or without PTX. To monitor the effect of PTX on cAMP levels, cells were preincubated for 22 h in 50% CM in the presence (or absence) of PTX and then for an additional 2 h in aggregation medium, again with or without PTX.

Monitoring IP3 levels. Cells were seeded on a 24-well standard tissue culture plate (100,000 cells per well) in 50% CM and grown for 5 days. Before the experiment, medium was replaced with aggregation medium and plates were preincubated for 1 h in the light. Cyclo(Leu-Trp), D-tryptophan, saccharin, and NHD (see Fig. 4 for concentrations) or melatonin (1 nM) was added for 30-s incubation. To terminate the reaction, the medium was quickly removed and 150 µl/well of 6% (vol/vol) ice-cold perchloric acid (PCA) containing 250 µg/ml phytic acid (to increase the basal level of IP3; Ref. 10) was added. The solution from each well was removed, neutralized with 2 M K2CO3 to pH 7.5, and micro-centrifuged (10). IP3 level was measured according to the method described by Spielman et al. (39). Specific IP3-binding protein was prepared from bovine adrenal glands according to Palmer and Wakelam (28); 3H-labeled IP3 was obtained from NEN (Boston, MA). Protein concentration was determined according to Bradford (3) after cells were disrupted in 0.5 ml of 0.1 M NaOH. Values of IP3 are expressed per microgram of protein.



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 4. Effects of stimulation by tastants and melatonin on D-myo-inositol 1,4,5-trisphosphate (IP3) level in Xenopus melanophores. Tastants were added at the indicated concentrations, and melatonin was used at 1 nM. Control levels of IP3 (in the presence of phytic acid) were between 22 and 56 fmol IP3/µg protein after 30-s incubation. Values are the means and SE of 4-6 replicates for each data point. *Significantly (P < 0.05 or less) lower values than control; **significantly (P < 0.05 or less) higher values than control.

 

Receptor antagonists. Melanophores were seeded on 24-well plates as described for cAMP. The melatonin receptor antagonist luzindole (10 µM; Tocris Cookson, Bristol, UK; Ref. 43), the {alpha}2-adrenergic-receptor antagonist yohimbine (1 µM; Sigma; Ref. 31), or the {alpha}1-adrenergic receptor antagonist prazosin (1 µM; Sigma; Ref. 19), was added for 10-min preincubation (18). Samples containing luzindole (and their corresponding controls) also contained 0.05% DMSO. Incubation for 30 min in the dark was started by adding tastants (as above, see concentrations in Fig. 5) or melatonin (1 nM) in the presence of 100 nM MSH. Incubation was terminated with 5% TCA as already described.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 5. Tastant- and melatonin-induced reduction in cAMP level in Xenopus melanophores (open bars) and the effects of the receptor antagonists luzindole (melatonin, A), yohimbine ({alpha}2-adrenergic, B), and prazosin ({alpha}1-adrenergic, C) (filled bars) on tastant-induced cAMP inhibition. Concentrations were 250 µM cyclo(Leu-Trp), 30 mM D-tryptophan, 10 mM saccharin, 3 mM neohesperidin dihydrochalcone, and 1 nM melatonin. Values are the means and SE of 7-8 replicates for each data point. *Significant (P < 0.05 or less) difference between each pair of bars representing cAMP level with and without the presence of receptor antagonist. Control levels (in the presence of MSH) were between 950 and 2,500 and between 600 and 1,250 fmol cAMP/µg protein after 30-min incubation in the absence and in the presence of luzindole, respectively (A), between 1,060 and 1,280 and between 950 and 1,100 in the absence and in the presence of yohimbine, respectively (B), and between 680 and 1,350 and between 770 and 1,475 in the absence and in the presence of prazosin, respectively (C).

 

Imaging of in situ permeation of tastants into melanophores. The autofluorescence of the amphipathic tastants cyclo(Leu-Trp) (100 µM), D-tryptophan (30 mM), and saccharin (20 mM) was used to monitor their permeation into melanophores (10,000 cells/well) seeded on 24-well plates with cover glasses (12 mm, 1/well). Cells were incubated with each tastant in aggregation medium for 30 s or 5 or 10 min. After incubation, cells were washed with 0.7% PBS and fixed with 1% (vol/vol) formaldehyde for 15 min and washed again with PBS. Slides were mounted with 1,4-diazabicyclo [2.2.2]octane-containing glycerol solution (to reduce photo-bleaching) for confocal microscopy. Cells were then viewed under a Zeiss LSM 410 confocal laser scanning system as previously described (29). The autofluorescence of the aggregation medium was set to background level.

Identification of mRNA melatonin receptors in rat circumvallate taste bud cells. Circumvallate (CV) taste buds and nonsensory epithelial (EP) sheets were prepared from rat tongue by means of subepithelial collagenase treatment (15, 40). Total RNA was isolated from pools of 15 CV papillae with an RNeasy mini isolation kit, including DNase treatment (Qiagen, Hilden, Germany) according to the manufacturer's instructions. cDNA was synthesized from 1 µg of RNA with Super Script II RNase H- reverse transcriptase (Qiagen). The cDNA was then amplified with a polymerase chain reaction (PCR) kit (Qiagen) and oligonucleotide primers specific for MT1 and MT2 (mel-1b) rat melatonin receptor subtypes (MBC, Rehovot, Israel) or with primers specific for {beta}-actin as an internal control. PCR was based on mRNA sequences for the MT1 receptor: the 5' primer sequence was 5' TCGCTATGAACCGCTACTGCTAC 3' and the 3' primer sequence was 5' GGATCTGAGGCCACAATAAGACC 3', corresponding to positions 352-374 and 761-784, to generate a PCR product of 432 bp. Another pair, 5' primer sequence 5' CGGATCTACTCCTGTACCTTCAC 3' and 3' primer sequence 5' CGCCAGGTAGTAACTAGCCACGA 3', corresponding to positions 507-529 and 819-842, was used to generate a PCR product of 335 bp (GenBank accession no. AF130341 [GenBank] ). The sequences for the MT2 receptor were 5' primer sequence 5' CTGTCACAGTGCGACCTACC 3' and 3' primer sequence 5' AGAGCCATTGCCTCTGGATT 3', corresponding to positions 12-31 and 415-434, to generate a PCR product of 422 bp, and 5' primer sequence 5' CCTCTACATCAGCCTCATCT 3' and 3' primer sequence 5' TCAGGCGTAGCTTTCTCTCA 3', corresponding to positions 60-79 and 294-313, to generate a PCR product of 254 bp (GenBank accession no. AF141863 [GenBank] ). PCR was performed with one cycle at 94°C for 3 min, then 39 cycles at 94°C for 30 s, 56°C for 1 min, and 72°C for 1 min, followed by 1 cycle at 72°C for 5 min. cDNA was electrophoresed on a 1.5% agarose gel and stained with ethidium bromide (45). To control for DNA contamination during RNA preparation, samples of total RNA were subjected to PCR with MT2 primers without using the reverse transcriptase.

Changes in cAMP levels in CV taste buds and EP sheets after melatonin stimulation. Each half of the CV taste bud and EP sheets was preincubated in 200 µl of 0.3 mM IBMX for 5 min at 30°C (40). Incubation was started by adding (-)-isoproterenol (10 µM final concentration) with or without melatonin (100 µM final concentration) for 6 min at 30°C. Intracellular content of cAMP was extracted (40) and determined by RIA as already described. Membranes of the permeabilized CV taste buds and EP sheets were used for protein determination by Bradford procedure with modifications (40).

Brief exposure, two-choice preference tests. Brief-exposure preference tests, in which the taste stimuli are available for only a few minutes, are considered valid measurements of taste with little confounding by postingestional factors (5). Twenty-nine naive Sprague-Dawley male rats, weighing 180-200 g, were trained over a 5-day period (1 h daily) to approach and sample a preferred solution of 10 mM sodium saccharin vs. water in a two-choice situation (25). At the end of the training period, >90% of the liquid intake was from the saccharin solution. All rats were then subjected to a preference test between a solution containing 100 µM melatonin and water (both choices also contained 0.05% DMSO) for a period of 10 min. Tests were conducted between 1800 and 1900 during the dark cycle with a red lamp for illumination. Positional effects were avoided by randomizing the location of the taste solution. Preference was expressed as % preference = (intake of taste solution/total liquid intake) x 100.

Data analysis. Analysis of variance (ANOVA) was performed with JMP statistical software (SAS Institute, Cary, NC). The Tukey-Kramer honestly significant difference (HSD) and Student's t-test were used for post hoc comparisons to determine differences between treatments.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Aggregation of melanophores. The sweeteners NHD, saccharin, and D-tryptophan and the bitter tastant cyclo(Leu-Trp) induced significant pigment aggregation in Xenopus melanophores, as did melatonin, and these effects were concentration dependent (Fig. 1). For the four tastants, these physiological responses appeared to show some saturation at high concentrations, although a typical sigmoid curve was not apparent. The lowest and highest concentrations of tastants that produced significant aggregations, respectively, were 16 and 125 µM cyclo(Leu-Trp), 0.08 and 0.63 mM NHD, 0.16 and 7.5 mM saccharin, and 20 mM D-tryptophan.

Changes in cAMP and cGMP in response to tastant stimulation. Similar to the native hormone melatonin, stimulation of melanophores by the four amphipathic tastants significantly inhibited isoproterenol-induced cAMP formation (Fig. 2). The lowest tastant concentrations producing significant inhibition of cAMP formation were 20 µM cyclo(Leu-Trp), 500 µM NHD; 1 mM saccharin, and 10 mM D-tryptophan. Maximal inhibition of cAMP formation was cyclo(Leu-Trp) (100 µM) 62%, NHD (500 µM) 45%, saccharin (10 mM) 92%, and D-tryptophan (30 mM) 57%. Melatonin (1 nM) inhibited cAMP formation by an average of ~80%. The cellular levels of cGMP were not affected by melatonin or the above tastants under the experimental conditions and the entire range of tastant concentrations (data not shown).

Effect of PTX on tastant-induced pigment aggregation and cellular cAMP reduction. Preincubation of melanophores with PTX significantly inhibited pigment aggregation stimulated by all four tested tastants and melatonin (Fig. 3A). The inhibition in pigment aggregation amounted to cyclo(Leu-Trp) (300 µM) 55%, NHD (3 mM) 57%, saccharin (10 mM) 75%, D-tryptophan (30 mM) 36%, and melatonin (1 nM) 36%.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 3. Pigment aggregation (A) and inhibition of cAMP formation (B) induced by tastants and melatonin in Xenopus melanophores in the presence (filled bars; 150 nM) and absence (open bars) of pertussis toxin (PTX). Concentrations were 500 µM cyclo(Leu-Trp), 30 mM D-tryptophan, 20 mM saccharin, 3 mM neohesperidin dihydrochalcone, and 1 nM melatonin. Control (CON;) level in A is the unstimulated level of pigment aggregation. Control level in B is the 100% MSH-stimulated level. Control levels were from 992 to 1,863 and from 1,966 to 4,202 fmol cAMP/µg protein after 15-min incubation in the absence and presence of PTX, respectively. Values are the means and SE of 7-8 replicates for each data point. *Significant (P < 0.05 or less) difference between PTX-treated and non-PTX-treated samples.

 

PTX pretreatment also significantly inhibited the tastants' effect of reducing cellular cAMP (Fig. 3B). In the presence of PTX, the saccharin-, NHD- and cyclo-(Leu-Trp)-induced reduction in cellular cAMP was practically abolished. On the other hand, the presence of PTX inhibited, but did not abolish, the D-tryptophanand melatonin-induced cAMP reduction. Together, these results clearly suggest the involvement of Gi in tastant-induced reduction of cellular cAMP.

Changes in IP3 level. Stimulation by melatonin and the tastants, except NHD, reduced (15-58%) the cellular level of IP3 (Fig. 4). This effect, however, was not concentration dependent. The lowest concentrations of tastants that produced a significant reduction in IP3 level were 1.25 µM cyclo(Leu-Trp) (58%), 250 µM saccharin (35%), and 20 mM D-tryptophan (18%). Higher concentrations did not further inhibit IP3 formation. Melatonin (1 nM) reduced IP3 level by ~35%. Stimulation by 5 mM NHD increased the cellular level of IP3 by 42%.

Effect of antagonists of melatonin and {alpha}2- and {alpha}1-adrenergic receptors on tastant-induced inhibition of cAMP formation. In the presence of luzindole (melatonin receptor antagonist; Fig. 5A), the cyclo(Leu-Trp)-, saccharin-, D-tryptophan-, and melatonin-induced inhibition in cAMP formation was nearly abolished (70-100%). However, whereas NHD induced an ~90% reduction in cAMP level (Fig. 5A), luzindole did not restore it. On the other hand, the presence of yohimbine ({alpha}2-adrenergic receptor antagonist; Fig. 5B) had either no or only a slight effect on melatonin-, cyclo-(Leu-Trp)-, D-tryptophan-, and saccharin-induced inhibition of cAMP formation, but it significantly inhibited the NHD-induced cAMP reduction. These results suggest that cyclo(Leu-Trp), saccharin, D-tryptophan, and melatonin inhibit cAMP formation via stimulation of the melatonin receptors, whereas NHD does so by stimulation of the {alpha}2-adrenergic receptor. The presence of prazosin ({alpha}1-adrenergic receptor antagonist; Fig. 5C) did not affect melatonin- or tastant-induced inhibition of cAMP formation.

Permeation of amphipathic tastants into melanophores. After incubation of melanophores with the fluorescent tastants saccharin, cyclo(Leu-Trp), and D-tryptophan, the presence of these tastants inside the cells was clearly visible by confocal microscopy (Fig. 6). It took only a few seconds to observe the rising of autofluorescence of saccharin inside the melanophore cells, especially around the nucleus, whereas it took 5 or 10 min for D-tryptophan or cyclo(Leu-Trp), respectively, to produce such fluorescence.



View larger version (93K):
[in this window]
[in a new window]
 
Fig. 6. Confocal microscopy of control Xenopus melanophores (A, C, E) and the corresponding melanophores exposed to cyclo(Leu-Trp) (10 min after exposure to 100 µM, B), D-tryptophan (5 min after exposure to 30 mM, D), and saccharin (30 s after exposure to 20 mM, F). Each image represents at least 4 experiments.

 

Expression of melatonin receptor in rat CV papillae. Both taste CV and nonsensory EP sheets were found to contain the melatonin receptor(s). PCR primers specific for MT1 and MT2 (mel 1b) rat melatonin receptors were subjected to RT-PCR with RNA isolated from CV and EP tissues. Agarose gel electrophoresis indicated PCR products of the expected size in both melatonin receptor subtypes. Parallel PCR of RNA without reverse transcriptase did not show MT1 and MT2 receptor bands, indicating no DNA contamination (Fig. 7). PCR DNA products were sequenced (MBC) and found identical to those of MT1 and MT2 melatonin receptors in rats with the BLAST program [GenBank, National Center for Biotechnology Information (NCBI)].



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 7. RT-polymerase chain reaction (PCR) analysis of melatonin receptor (MT1, MT2) mRNAs in circumvallate (CV) taste buds and epithelial (EP) sheets: MT2 (422 and 254 bp), MT1 (432 and 335 bp); {beta}-actin ({beta}-act) was used as an internal reference gene. CON designates parallel PCR with RNA without RT (see MATERIALS AND METHODS).

 

Changes in cAMP level in CV taste buds and EP sheets after melatonin stimulation and behavioral preference tests. Melatonin (100 µM) significantly inhibited (P < 0.034, paired t-test) the isoproterenol-induced cAMP elevation in CV taste buds (from 17.02 ± 3.01 to 13.19 ± 2.01 fmol cAMP/µg protein). Melatonin did not affect the cellular level of cAMP in EP sheets (28.1 ± 5.7 to 29.0 ± 6.4 fmol cAMP/µg protein). A brief-exposure (10 min) preference test showed a percent preference of 35.5 ± 6.9, indicating significantly (P < 0.05, paired t-test) lower intake from the melatonin solution than from water.


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The nonsugar sweeteners saccharin, D-tryptophan, and NHD and the casein-derived bitter tastant cyclo-(Leu-Trp) stimulated pigment aggregation in a X. laevis melanophore cell line, similar to the effect of the native hormone melatonin (30, 42). These tastant-induced aggregation responses were concentration dependent. Furthermore, the tastant concentrations needed to stimulate pigment aggregation were compatible with those needed to elicit taste sensation in humans and animals (11, 33, 35, 36). For the four tastants, pigment aggregation appeared to show some saturation at high concentrations, although a typical sigmoidal concentration response was not apparent, probably because of the difficulties involved in introducing high concentrations of these amphipathic compounds. Limonin (100 µM), a citrus-derived bitter compound, also induced pigment aggregation and a reduction in cAMP (data not shown), but because of its low solubility, it was difficult to obtain a concentration-dependent curve.

Similar to melatonin, all of the above tastants inhibited the isoproterenol- or MSH-stimulated increase in cellular cAMP level, and this effect was also concentration dependent. Pretreatment with PTX either abolished or significantly reduced both pigment aggregation and the inhibitory effect of tastants on cAMP formation. Thus the tastant effects are associated with PTX-sensitive inhibition of cAMP, likely through the inhibitory pathway (Gi) of AC. In the melanophore system, the tastant concentrations needed to stimulate the above receptors, although compatible with their affinity to taste receptors, were 100- to 1,000-fold higher than those needed by the native hormones of these receptors.

The almost complete abolishment of the saccharin, D-tryptophan, and cyclo(Leu-Trp) inhibition of cAMP formation (also true for melatonin) by the melatonin MT1 and MT2 receptor antagonist luzindole strongly suggests that these tastants, at millimolar levels and below, are agonists of these receptors in X. laevis melanophores. On the other hand, luzindole had only a very minor effect on NHD inhibition of cAMP formation, indicating that this sweetener is not a melatonin receptor ligand. However, the {alpha}2-adrenergic receptor antagonist yohimbine, although having only a minimal effect on the inhibition of cAMP formation induced by saccharin, cyclo(Leu-Trp), D-tryptophan, and melatonin, significantly reduced NHD inhibition of cAMP formation. Therefore, it becomes clear that saccharin, cyclo(Leu-Trp), and D-tryptophan are melatonin receptor agonists in Xenopus melanophores, whereas NHD is an {alpha}2-adrenergic receptor agonist; nevertheless, all have the same ultimate effect, i.e., reduction in the cellular level of cAMP, which in turn produces pigment aggregation at the cellular level. Interestingly, the citrus-derived bitter tastant naringin, a very close structurally related flavonoid of NHD, has also been reported (among some other flavonoids) to be an {alpha}2-adrenergic receptor agonist (9). Therefore, tastants may stimulate GPCRs that are not taste receptors. Many drugs are known to taste bitter even though they stimulate other receptors. One reason for their bitter taste may be their ability to activate downstream transduction components directly (e.g., G proteins) (12). Alternatively, such drugs may stimulate taste receptors or other receptors in taste cells, which may modulate taste sensation. Therefore, these results call for an examination of the similarity between the melatonin receptors and those of newly identified sweet and bitter GPCRs (4, 7, 20, 21, 27). Interestingly, some odorants have been shown to induce pigment dispersion and AC activation in X. laevis melanophores (17). These results were interpreted as nonreceptor activation of AC. The present results introduce the possibility that these odorants may also activate AC via MSH or {beta}-adrenergic receptors, which have been suggested to induce pigment dispersion in these melanophores (10). The {alpha}1-adrenergic receptor antagonist prazosin did not affect the inhibition of cAMP induced by any of the tastants, indicating that the {alpha}1-adrenergic receptors are not involved in the tastant-induced inhibition of cAMP formation.

The aforementioned tastants did not have any effects on the cellular level of cGMP. On the other hand, the results indicated that stimulation of these cells with saccharin, cyclo(Leu-Trp), D-tryptophan, and melatonin reduces the cellular level of IP3, whereas NHD (which, as shown above, does not seem to be a melatonin receptor agonist) induces an increase in the cellular level of IP3. However, these effects were not concentration dependent, and therefore, their physiological significance (e.g., to pigment aggregation) under the experimental conditions described here remains to be elucidated. Although X. laevis melanophores possess melatonin-binding sites that are linked to phosphoinositide hydrolysis (10, 23), modulation of cellular IP3 level, in addition to PLC, may also be related to 1-phosphatidylinositol (PI) and phosphatidylinositol 4-monophosphate (PIP) kinases (44). Reduction of cellular IP3 (downregulation of signal transduction) by several flavonoids and some other compounds has been proposed for murine and human carcinomas and cell lines. Therefore, under some circumstances, the control of phosphatidylinositol 4,5-bisphosphate (PIP2) rather than PLC activity may be the factor regulating IP3 (44).

One of the objectives of the present study was to investigate the effect of amphipathic, membrane-permeant tastants on signal transduction in cells that are not taste cells and therefore are expected to lack taste receptors. Indeed, three of the tested tastants were shown to be membrane permeant (Fig. 6) as in taste cells (29) and were hypothesized to stimulate downstream transduction components (24). This hypothesis is also supported by the finding that bitter stimuli such as quinine, naringin, and phenylthiocarbamide (PTC) can depolarize cells that are not taste cells, e.g., neuroblastoma cells (16), and that some sweet and bitter tastants are direct activators of G proteins (26). However, the effectiveness of the receptor antagonists luzindole and yohimbine at selectively blocking the tastant-induced reduction in cellular cAMP suggests that the signal pathways stimulated (at least under the experimental conditions) by the amphipathic tastants were due to receptor-dependent rather than receptor-independent mechanisms, even though these tastants are membrane permeant. This should not exclude the possibility of cellular response stimulation in other systems by direct activation of G proteins as previously proposed (e.g., histamine secretion) (1, 6).

In this study, we identified MT1 and MT2 melatonin receptors in rat CV taste and EP nonsensory cells (Fig. 7), and stimulation by melatonin reduced cAMP in CV taste bud cells. Furthermore, a brief-exposure, two-choice preference test indicated that melatonin at the concentration tested is an aversive taste stimulus to these animals. It remains to be elucidated whether melatonin produced the aforementioned cAMP reduction via the melatonin receptors. Alignment of the entire sequence and of several extracellular and intracellular domains of the melatonin and {alpha}2-adrenergic receptors vs. those of the newly identified bitter and sweet taste receptors showed no similarities (data not shown). Thus the fact that these tastants are agonists of melatonin or {alpha}2-adrenergic receptors in melanophores should not necessarily be related to their ability to function as sweet or bitter taste receptor agonists in taste cells. Nevertheless, this phenomenon, i.e., the stimulation of different receptors (melatonin and {alpha}2-adrenergic) by different tastants leading to the activation of the same signal pathway (reduced cellular cAMP) and the same physiological response (pigment aggregation), suggests that some tastants may interact with similar receptors in taste cells, independently of taste receptor stimulation. If so, the resultant changes in the transduction output within the taste cells may involve taste modulation.

In conclusion, from a physiological standpoint, tastants that are components of our daily diet and that can be natural, produced during processing and cooking [cyclo(Leu-Trp)], or synthetic (saccharin and NHD) may stimulate multiple receptors, different pathways, and cellular responses that are not related to taste. On access to other target tissues, their stimulation of other transduction pathways and cellular responses may result in different biological effects. The reverse may also be true. Many compounds that produce various biological effects also possess taste. The present results, although suggesting no obvious similarity among the melatonin, {alpha}2-adrenergic, and taste receptors, may lead to additional studies using the melanophore model to explore possible similarities in the microenvironment of the binding sites of these receptors.


    DISCLOSURES
 
This study was supported by grants IS-2518 and IS-3366 from The US-Israel Binational Agricultural Research and Development Fund.


    ACKNOWLEDGMENTS
 
Helpful comments and the continued supply of melanophores by Prof. E. Lerner of the Bunsen Rush Laboratories are highly appreciated. We also thank Prof. A. Friedman and Dr. M. Schonfeld for assisting us with light absorbance measurements and Dr. R. Reifen for allowing us to use his PCR apparatus.

Preliminary data from this manuscript were presented at the annual meeting of the Israel Society of Biochemistry and Molecular Biology, Tel Aviv, Israel, 2003.


    FOOTNOTES
 

Address for reprint requests and other correspondence: M. Naim, Institute of Biochemistry, Food Science and Nutrition, Faculty of Agricultural, Food and Environmental Quality Sciences, The Hebrew Univ. of Jerusalem, PO Box 12, Rehovot 76-100, Israel (E-mail: naim{at}agri.huji.ac.il).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
1. Aridor M, Rajmilevich G, Beaven MA, and Sagi-Eisenberg R. Activation of exocytosis by the heterotrimeric G protein Gi3. Science 262: 1569-1572, 1993.[Abstract/Free Full Text]

2. Bernhardt SJ, Naim M, Zehavi U, and Lindemann B. Changes in IP3 and Ca2+ in response to sugars and non-sugar sweeteners in transduction of sweet taste in the rat. J Physiol 490: 325-336, 1996.[Abstract/Free Full Text]

3. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248-254, 1976.[Web of Science][Medline]

4. Bufe B, Hofmann T, Krautwurst D, Raguse JD, and Meyerhof W. The human TAS2R16 receptor mediates bitter taste in response to {beta}-glucopyranosides. Nat Genet 32: 397-401, 2002.[Web of Science][Medline]

5. Cagan RH and Maller O. Taste of sugars: brief exposure single-stimulus behavioral method. J Comp Physiol Psychol 87: 47-55, 1974.[Web of Science][Medline]

6. Chahdi A, Mousli M, and Landry Y. Substance P-related inhibitors of mast cell exocytosis act on G-proteins or on cell surface. Eur J Pharmacol 341: 329-335, 1998.[Web of Science][Medline]

7. Chandrashekar J, Mueller KL, Hoon MA, Adler E, Feng L, Guo W, Zuker CS, and Ryba NJP. T2Rs function as bitter taste receptors. Cell 100: 703-711, 2000.[Web of Science][Medline]

8. Daniolos A, Lerner AB, and Lerner MR. Action of light on frog pigment cells in culture. Pigment Cell Res 3: 38-43, 1990.[Web of Science][Medline]

9. Di Carlo G, Autore G, Izzo AA, Maiolino P, Mascolo N, Viola P, Diurno MV, and Capasso F. Inhibition of intestinal motility and secretion by flavonoids in mice and rats: structure-activity relationships. J Pharm Pharmacol 45: 1054-1059, 1993.[Web of Science][Medline]

10. Graminski GF, Jayawickreme CK, Potenza MN, and Lerner MR. Pigment dispersion in frog melanophores can be induced by a phorbol ester or stimulation of a recombinant receptor that activates phospholipase C. J Biol Chem 268: 5957-5964, 1993.[Abstract/Free Full Text]

11. Grill HJ and Norgren R. The taste reactivity test. I. Mimetic responses to gustatory stimuli in neurologically normal rats. Brain Res 143: 263-279, 1978.[Web of Science][Medline]

12. Hagelueken A, Gruenbaum L, Nuernberg B, Harhammer R, Schunack W, and Seifert R. Lipophilic {beta}-adrenoceptor antagonists and local anesthetics are effective direct activators of G-proteins. Biochem Pharmacol 47: 1789-1795, 1994.[Web of Science][Medline]

13. Harper JF and Brooker G. Femtomole sensitive radioimmunoassay for cyclic AMP and cyclic GMP after 2'-O-acetylation by acetic anhydride in aqueous solution. J Cyclic Nucleotide Res 1: 207-218, 1975.[Web of Science][Medline]

14. Jockers R, Petit L, Lacroix I, de Coppet P, Barrett P, Morgan PJ, Guardiola B, Delagrange P, Marullo S, and Strosberg AD. Novel isoforms of Mel1c melatonin receptors modulating intracellular cyclic guanosine 3',5'-monophosphate levels. Mol Endocrinol 11: 1070-1081, 1997.[Abstract/Free Full Text]

15. Krizhanovsky V, Agamy O, and Naim M. Sucrose-stimulated subsecond transient increase in cGMP level in rat intact circumvallate taste bud cells. Am J Physiol Cell Physiol 279: C120-C125, 2000.[Abstract/Free Full Text]

16. Kumazawa T, Kashiwayanagi M, and Kurihara K. Neuroblastoma cell as a model for a taste cell: mechanism of depolarization in response to various bitter substances. Brain Res 333: 27-33, 1985.[Web of Science][Medline]

17. Lerner MR, Reagan J, Gyorgyi T, and Roby A. Olfaction by melanophores: what does it mean? Proc Natl Acad Sci USA 85: 261-264, 1988.[Abstract/Free Full Text]

18. Martensson LGE and Andersson RGG. Denervation of pigment cells lead to receptor that is ultrasensitive to melatonin and noradrenaline. Life Sci 60: 1575-1582, 1997.[Web of Science][Medline]

19. Mathe JM, Nomikos GG, Hilderbrand BE, Hertel P, and Svensson TH. Prazosin inhibits MK-801 hyperlocomotion and dopamine release in the nucleus accumbens. Eur J Pharmacol 309: 1-11, 1996.[Web of Science][Medline]

20. Max M, Shanker YG, Huang L, Rong M, Liu Z, Campagne F, Weinstein H, Damak S, and Margolskee RF. Tas1r3, encoding a new candidate taste receptor, is allelic to the sweet responsiveness locus Sac. Nat Genet 28: 58-63, 2001.[Web of Science][Medline]

21. Montmayeur JP, Liberles SD, Matsunami H, and Buck LB. A candidate taste receptor gene near a sweet taste locus. Nat Neurosci 4: 492-498, 2001.[Web of Science][Medline]

22. Mousli M, Bueb JL, Bronner C, Rouot B, and Landry Y. G protein activation: a receptor-independent mode of action for cationic amphiphilic neuropeptides and venom peptides. Trends Pharmacol Sci 11: 358-362, 1990.[Medline]

23. Mullins UL, Fernandes PB, and Eison AS. Melatonin agonists induce phosphoinositide hydrolysis in Xenopus laevis melanophores. Cell Signal 9: 169-173, 1997.[Web of Science][Medline]

24. Naim M, Nir S, Spielman AI, Noble AC, Peri I, Rodin S, and Samuelov-Zubare M. Hypothesis of receptor-dependent and receptor-independent mechanisms for bitter and sweet taste transduction: implications for slow taste onset and lingering aftertaste. In: Chemistry of Taste: Mechanisms, Behaviors and Mimics, edited by Given P and Paredes D. Washington, DC: American Chemical Society, 2002, p. 2-17.

25. Naim M, Rogatka H, Yamamoto T, and Zehavi U. Taste responses to neohesperidin dihydrochalcone in rats and baboon monkeys. Physiol Behav 28: 979-986, 1982.[Medline]

26. Naim M, Seifert R, Nürnberg B, Grünbaum L, and Schultz G. Some taste substances are direct activators of G-proteins. Biochem J 297: 451-454, 1994.[Web of Science][Medline]

27. Nelson G, Hoon MA, Chandrashekar J, Zhang Y, Ryba NJP, and Zuker CS. Mammalian sweet taste receptors. Cell 106: 381-390, 2001.[Web of Science][Medline]

28. Palmer S and Wakelam MJO. Mass measurement of inositol 1,4,5-trisphosphate using a specific binding assay. In: Methods in Inositide Research, edited by Irvine RF. New York: Raven, 1990, p. 127-134.

29. Peri I, Mamrud-Brains H, Rodin S, Krizhanovsky V, Shai Y, Nir S, and Naim M. Rapid entry of bitter and sweet tastants into liposomes and taste cells: implications for signal transduction. Am J Physiol Cell Physiol 278: C17-C25, 2000.[Abstract/Free Full Text]

30. Potenza MN and Lerner MR. A rapid quantitative bioassay for evaluating the effects of ligands upon receptors that modulate cAMP levels in a melanophore cell line. Pigment Cell Res 5: 372-378, 1992.[Web of Science][Medline]

31. Robertson D, Goldberg MR, Tung CS, Hollister AS, and Robertson RM. Use of {alpha}2 adrenoreceptor agonists and antagonists in the functional assessment of the sympathetic nervous system. J Clin Invest 78: 576-581, 1986.[Web of Science][Medline]

32. Rosenzweig S, Yan W, Dasso M, and Spielman AI. Possible novel mechanism for bitter taste mediated through cGMP. J Neurophysiol 81: 1661-1665, 1999.[Abstract/Free Full Text]

33. Rouseff RL. Bitterness in Foods and Beverages. Amsterdam: Elsevier, 1990.

34. Ruiz-Avila L, McLaughlin SK, Wildman D, McKinnon PJ, Robichon A, Spickofsky N, and Margolskee RF. Coupling of bitter receptor to phosphodiesterase through transducin in taste receptor cells. Nature 376: 80-85, 1995.[Medline]

35. Schiffman SS, Reilly DA, and Clark TB. Qualitative differences among sweeteners. Physiol Behav 23: 1-9, 1979.[Medline]

36. Shiba T and Nunami KI. Structure of a bitter peptide in casein hydrolyzate by bacterial proteinase. Tetrahedron Lett 6: 509-512, 1974.

37. Spielman AI, Huque T, Whitney G, and Brand JG. The diversity of bitter taste signal transduction mechanisms. In: Sensory Transduction, edited by Corey DP and Roper SD. New York: Rockefeller Univ. Press, 1992, p. 307-324.

38. Spielman AI, Nagai H, Sunavala G, Dasso M, Breer H, Boekhoff I, Huque T, Whitney G, and Brand JG. Rapid kinetics of second messenger production in bitter taste. Am J Physiol Cell Physiol 270: C926-C931, 1996.[Abstract/Free Full Text]

39. Spielman AI, Nagai H, Sunavala G, Dasso M, Huque T, and Brand JG. Second messenger assays. In: Experimental Cell Biology of Taste and Olfaction. Current Techniques and Protocols, edited by Spielman AI and Brand JG. Boca Raton: CRC, 1995, p. 203-210.

40. Striem BJ, Naim M, and Lindemann B. Generation of cyclic AMP in taste buds of the rat circumvallate papilla in response to sucrose. Cell Physiol Biochem 1: 46-54, 1991.

41. Striem BJ, Pace U, Zehavi U, Naim M, and Lancet D. Sweet tastants stimulate adenylate cyclase coupled to GTP-binding protein in rat tongue membranes. Biochem J 260: 121-126, 1989.[Web of Science][Medline]

42. Sugden D. Aggregation of pigment granules in single cultured Xenopus laevis melanophores by melatonin analogues. Br J Pharmacol 104: 922-927, 1991.[Web of Science]

43. Sugden D. Effect of putative melatonin receptor antagonists on melatonin-induced pigment aggregation in isolated Xenopus laevis melanophores. Eur J Pharmacol 213: 405-408, 1992.[Web of Science][Medline]

44. Weber G, Shen F, Prajda N, Yang H, Li W, Yeh A, Csokay B, Olah E, and Look KY. Regulation of the signal transduction program by drugs. Adv Enzyme Regul 37: 35-55, 1997.[Web of Science][Medline]

45. Wiechmann AF, Cambell LD, and Defoe DM. Melatonin receptor RNA expression in Xenopus retina. Mol Brain Res 63: 297-303, 1999.[Medline]

46. Zhang Y, Hoon MA, Chandrashekar J, Mueller KL, Cook B, Wu D, Zuker CS, and Ryba NJP. Coding of sweet, bitter, and umami tastes: different receptor cells sharing similar signaling pathways. Cell 112: 293-301, 2003.[Web of Science][Medline]




This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
C. E. Riera, H. Vogel, S. A. Simon, and J. l. Coutre
Artificial sweeteners and salts producing a metallic taste sensation activate TRPV1 receptors
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2007; 293(2): R626 - R634.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
M. Zubare-Samuelov, M. E. Shaul, I. Peri, A. Aliluiko, O. Tirosh, and M. Naim
Inhibition of signal termination-related kinases by membrane-permeant bitter and sweet tastants: potential role in taste signal termination
Am J Physiol Cell Physiol, August 1, 2005; 289(2): C483 - C492.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/5/C1255    most recent
00149.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zubare-Samuelov, M.
Right arrow Articles by Naim, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zubare-Samuelov, M.
Right arrow Articles by Naim, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the American Physiological Society.