Am J Physiol Cell Physiol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 285: C1091-C1100, 2003. First published July 2, 2003; doi:10.1152/ajpcell.00021.2003
0363-6143/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/5/C1091    most recent
00021.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kempson, S. A.
Right arrow Articles by Montrose, M. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kempson, S. A.
Right arrow Articles by Montrose, M. H.

MEMBRANE TRANSPORTERS, ION CHANNELS, AND PUMPS

Subcellular redistribution of the renal betaine transporter during hypertonic stress

Stephen A. Kempson, Vaibhave Parikh, Lixuan Xi, Shaoyou Chu, and Marshall H. Montrose

Department of Cellular and Integrative Physiology, Indiana University School of Medicine, Indianapolis, Indiana 46202-5120

Submitted 15 January 2003 ; accepted in final form 30 June 2003


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The betaine transporter (BGT1) protects cells in the hypertonic renal inner medulla by mediating uptake and accumulation of the osmolyte betaine. Transcriptional regulation plays an essential role in upregulation of BGT1 transport when renal cells are exposed to hypertonic medium for 24 h. Posttranscriptional regulation of the BGT1 protein is largely unexplored. We have investigated the distribution of BGT1 protein in live cells after transfection with BGT1 tagged with enhanced green fluorescent protein (EGFP). Fusion of EGFP to the NH2 terminus of BGT1 produced a fusion protein (EGFP-BGT) with transport properties identical to normal BGT1, as determined by ion dependence, inhibitor sensitivity, and apparent Km for GABA. Confocal microscopy of EGFP-BGT fluorescence in transfected Madin-Darby canine kidney (MDCK) cells showed that hypertonic stress for 24 h induced a shift in subcellular distribution from cytoplasm to plasma membrane. This was confirmed by colocalization with anti-BGT1 antibody staining. In fibroblasts, transfected EGFP-BGT caused increased transport in response to hypertonic stress. The activation of transport was not accompanied by increased expression of EGFP-BGT, as determined by Western blotting. Membrane insertion of EGFP-BGT protein in MDCK cells began within 2-3 h after onset of hypertonic stress and was blocked by cycloheximide. We conclude that posttranscriptional regulation of BGT1 is essential for adaptation to hypertonic stress and that insertion of BGT1 protein to the plasma membrane may require accessory proteins.

Madin-Darby canine kidney cells; fibroblasts; enhanced green fluorescent protein; fluorescence; transfection; laser scanning confocal microscopy


CELLS REGULATE VOLUME BY ADJUSTING their solute content to drive osmotic gain or loss of water. Organic solutes (osmolytes) such as betaine are centrally important for long-term volume adjustments because they do not perturb normal cell functions (8). BGT1 is a betaine/GABA transporter that protects cells in the hypertonic inner medulla by mediating basolateral betaine uptake and accumulation. BGT1 also transports {gamma}-aminobutyric acid (GABA) (30) and, in fact, has a higher affinity for GABA than betaine (1). Renal BGT1 was cloned from Madin-Darby canine kidney (MDCK) cells (52) and is expressed in many mammalian tissues, including the brain (5, 30). In the kidney, BGT1 mRNA is most abundant in the medullary thick ascending limb and the inner medullary collecting duct (31). The predicted structure of BGT1 contains 12 membrane-spanning {alpha}-helices with both NH2 and COOH termini facing the cytoplasm. The cytosolic COOH terminus contains both a basolateral sorting signal (38) and a PDZ domain that regulates internalization of the protein (39).

BGT1 transport activity is low in MDCK cells maintained in isotonic medium but is strongly induced in response to prolonged (24 h) hypertonic stress (23, 35, 51). Research on the cellular regulation of BGT1 during hypertonic stress has focused on the mechanisms that trigger increased transcription of the BGT1 gene. Transcription plays an essential role in upregulation of BGT1 transport activity. There is a marked increase in BGT1 gene transcription when cells are exposed to hypertonic medium (48). A 13-bp tonicity-responsive enhancer (TonE) sequence in the 5'-flanking region of the BGT1 gene confers responsiveness to hypertonicity (22). A TonE binding protein (TonEBP) specifically binds to TonE and is presumably a transcription factor. The abundance of TonEBP in the nucleus is dramatically increased by hypertonicity, a step that occurs before the increase in BGT1 mRNA (33, 50). TonEBP is also increased in the nucleus in response to amino acid deprivation under isotonic conditions, another situation that leads to a decrease in cell volume (12), suggesting that TonEBP may play a key role in the regulation of cell volume under both isosmotic and anisosmotic conditions. Several different kinase signaling pathways may play an important role in initiating the cellular responses to osmotic challenge (12, 34, 45, 49), although they may not be required to maintain the adaptation (2, 9, 27).

Our previous results (3) revealed the presence of intracellular BGT1 protein in MDCK cells that had been maintained in isotonic medium. This observation raises the possibility that insertion of preexisting BGT1 into the plasma membrane may be an important posttranscriptional step in the upregulation of the BGT1 transport capacity of the cell. There is ample evidence for posttranslational regulation and recycling of plasma membrane transporters in kidney and other tissues, such as the NaPi2 phosphate transporter (17, 25), GLUT1 and GLUT4 glucose transporters (18, 37), and the AQP2 aquaporin water channel (16). Little attention has been paid to posttranscriptional regulation of the BGT1 transporter during adaptation to hypertonic stress. We have investigated the subcellular distribution of BGT1 protein in live cells by transfection with BGT1 tagged with enhanced green fluorescent protein (EGFP). The functional properties of the fusion proteins and their response to hypertonic stress reveal that posttranscriptional regulation of BGT1 protein is a crucial component in cellular adaptation to hypertonic stress.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell culture, transfections, and transport measurement. MDCK cells (CCL-34; American Type Culture Collection, Rockville, MD) were used between passages 10-30 and were grown as monolayers in a 1:1 mixture of DMEM:Ham's F-12K containing 10% bovine calf serum, 10 mM HEPES, 25 mM NaHCO3 (pH 7.4), and penicillin G (100 U/ml), as in previous studies (3, 23). C3H/10T1/2 mouse embryo fibroblasts (43) (CCL-226; American Type Culture Collection) were cultured in DMEM containing 10% heat-inactivated fetal bovine serum, 25 mM NaHCO3, 5 mM HEPES, penicillin (50 U/ml), and streptomycin (50 µg/ml). The cells were maintained as subconfluent monolayers and were used between passages 5-15. Both cell lines were maintained at 37°C in an atmosphere of 5% CO2 in air. Cells were grown on glass coverslips for immunofluorescence studies and in six-well plates for transport measurements.

Cells were transfected 2 h after plating in isotonic medium in six-well plates by using 1 µg of plasmid DNA/well and Fugene 6 (Boehringer Mannheim), according to the manufacturer's instructions. Cells were used 24 h later. Transfection efficiency, typically 20%, was monitored by direct visualization of fluorescence.

Hypertonic stress was induced by replacing normal growth medium with growth medium made hypertonic by the addition of sucrose to achieve a final osmolarity of 500 mosmol/l, as in previous studies (3). The osmolarity of all solutions used for transport was matched to the osmolarity of the growth medium. The transport function of endogenous and transfected BGT1 in cell monolayers was determined by measuring cell uptake of [3H]GABA, as described previously in detail (3, 23). Briefly, [3H]GABA uptake was determined both in medium containing Na+ and also in medium in which Na+ was replaced by methyl-D-glucamine-HCl. The difference, which is referred to as the Na+-dependent component, represents transport specifically via BGT1.

EGFP-tagged BGT1 fusion proteins. The 1.87-kb coding sequence of the renal BGT1 gene was amplified from the pSPORT-BGT1 plasmid (51) by polymerase chain reaction by using Taq polymerase (Takara Biomedicals). The primers were 5'CTCCCAGTCCATCTCGAGGCTATGG3' and 5'CACAGGATCCAAGTGGGTCTCCTTCTCC3' and were designed to introduce XhoI and BamHI sites and to eliminate the BGT1 stop codon. The restricted product was cloned into the XhoI and BamHI sites of the mammalian expression vector pEGFPC3 (Clontech, Palo Alto, CA) so that the resulting fusion protein (EGFP-BGT) would have the NH2 terminus of BGT1 fused to the COOH terminus of EGFP, with an intermediate spacer of six amino acids. The BGT1 coding sequence in this construct was verified through double-strand primer walk sequencing (SeqWright, Houston, TX). The 1.87-kb full-length BGT1 coding sequence was excised from the construct by double digestion with XhoI and BamHI and cloned into the XhoI and BamHI sites of the mammalian expression vector pEGFPN1 (Clontech) to make a plasmid encoding a fusion protein (BGT-EGFP) in which the COOH terminus of BGT1 was fused to the NH2 terminus of EGFP with a spacer of six amino acids.

Visualization of BGT1 protein in cultured cells. Endogenous BGT1 in MDCK cell monolayers on glass coverslips was detected by immunofluorescence after fixation in cold methanol, as described previously (3). After being blocked with 2% gelatin for 30 min, the cells were incubated for 2 h with affinity-purified anti-dog BGT1 polyclonal antibody, diluted 1:100 in 1% gelatin. The primary antibody was detected by a 1-h incubation with affinity-purified goat anti-rabbit IgG conjugated to Cy5 (Jackson ImmunoResearch, West Grove, PA), diluted 1:100 in 1% gelatin. All solutions contained Tris-buffered saline and all incubations were at 37°C. Cells were mounted in 9% Mowiol solution, and fluorescent images were acquired with a LSM 510 laser scanning confocal microscope (Carl Zeiss Microimaging, Thornwood, NY) by using a water immersion x40 lens with 1.2 numerical aperture and 220 µm working distance. The optical section thickness was 1 µm, and the instrument gain and offset were the same for all samples. The excitation for Cy5 was at 633 nm, and emission was collected at >650 nm.

EGFP-tagged BGT1 proteins were detected in live cells on glass coverslips mounted in a chamber on the stage of the confocal microscope. The chamber contained a solution of 25 mM glucose in buffered physiological saline, pH 7.4 (15, 29). For detection of EGFP fluorescence, the excitation was at 488 nm and emission was collected at 500-550 nm.

Online studies of EGFP-BGT distribution in live cells at various times during hypertonic stress were conducted on cells grown on glass coverslips that were mounted across a 1-cm hole in the bottom of a standard 35-mm dish. At 24 h posttransfection, the dish was clamped to the stage of the confocal microscope by using a x40 water-immersion lens with silicone oil (Dow Corning 200) that has the same refractive properties as water. An appropriate group of cells was located, and the normal cell culture medium in the dish was carefully replaced by 5 ml of hypertonic medium (500 mosmol/l). The hypertonic medium was a 1:1 mixture of DMEM:Hams F12 lacking bicarbonate and phenol red (Sigma), buffered to pH 7.4 with 30 mM HEPES, and contained 10% bovine calf serum and sucrose. Preliminary tests showed that the pH was stable within 0.1 pH unit for 24 h, and the cells showed no adverse reaction (rounding, vacuolization, blebbing, etc.). A timed series (30-min intervals) of z-section images was begun immediately. Each z-stack was six images at 2 µm intervals.

All images were stored on CD-RW by using Zeiss LSM software and imported into Adobe Photoshop 5.0 (Adobe Systems, San Jose, CA).

Biotinylation and Western blotting of cell lysates. Surface biotinylation of MDCK cells transfected with EGFP-BGT was performed exactly as described previously in detail (7). An aliquot of the Triton lysate was removed before treatment with streptavidin beads. Both this fraction and the fraction recovered on the beads were analyzed for EGFP-BGT protein by Western blotting.

Cell monolayers in six-well plates were placed on ice and, if necessary, were washed twice with isotonic or hypertonic (as appropriate) Tris-buffered saline. The cells were lysed by the addition of 1% Triton X-100 solution containing 150 mM NaCl, 5 mM EDTA, 10% glycerol, 50 mM Tris, pH 7.5, and protease inhibitors (Halt cocktail; Pierce, Rockford, IL). Cells were collected by scraping, sonicated for 5 s, incubated for 15 min at 4°C, and centrifuged at 13,000 g for 15 min. The supernatant was removed and stored at -80°C. Aliquots were assayed for protein content by the BCA method (Pierce). Before being loaded (5-10 µg/lane) on a 10% polyacrylamide/SDS gel, samples of the supernatant were incubated in SDS sample buffer, containing 100 mM dithiothreitol, for 10 min at 65°C. Prestained molecular weight markers (Bio-Rad, Hercules, CA) were run in parallel. The separated proteins were electrotransferred to nitrocellulose membrane overnight using the Bio-Rad minigel system, as in previous studies (3, 24). The membranes were blocked with 5% milk powder and blotted for 2 h with affinity-purified rabbit polyclonal antibody to GFP (Abcam, Cambridge, UK), diluted 1:20,000 in 5% bovine serum albumin. This antibody recognizes all variants of GFP, including EGFP. The GFP antibody was detected by blotting for 45 min with goat anti-rabbit IgG coupled to horseradish peroxidase (Jackson ImmunoResearch), diluted 1:2,500 in 5% milk powder, and enhanced chemiluminescence (ECL system; Amersham Pharmacia Biotech, Piscataway, NJ). Short exposures to BioMax MR film (Eastman Kodak, Rochester, NY) that were not saturating were used for quantitation. The blots were stripped and reprobed with mouse monoclonal antibody to {beta}-actin (1:1,000, AC-40; Sigma, St. Louis, MO) and HRP-conjugated donkey anti-mouse IgG (1:5,000, Jackson ImmunoResearch), as an internal control for sample loading. In biotinylation experiments, E-cadherin was used as the internal control, as described previously (7). Films were scanned with a Bio-Rad GS-670 imaging densitometer.

Where appropriate, the data from different groups were analyzed by the Student t-test or by ANOVA for multiple comparisons.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
MDCK cells transiently transfected with the pEGFPN1 or pEGFPC3 vectors expressed unmodified EGFP that was distributed homogeneously throughout the cytosol and nucleus (Fig. 1, top row). In contrast, expression of EGFP-BGT and BGT-EGFP fusion proteins was restricted to compartments in the cytoplasm under isotonic conditions (Fig. 1, rows 2 and 3). Only a small proportion of EGFP fluorescence was found at the plasma membrane with either construct under isotonic conditions. In most cells, hypertonic stress for 24 h produced a marked change in the subcellular distribution of these proteins from cytoplasm to plasma membrane (Fig. 1, rows 4 and 5).



View larger version (76K):
[in this window]
[in a new window]
 
Fig. 1. Confocal micrographs of fluorescence distribution in MDCK cells transiently transfected with either enhanced green fluorescent protein (EGFP)-BGT (left column), BGT-EGFP (right column), or empty vector (top row). Representative cells from 2 separate transfections (labeled 1 and 2) are shown at 48 h posttransfection. Cells were either maintained in isotonic (Iso) growth medium throughout or were switched to hypertonic (Hyp) growth medium for the final 24 h. Scale bar is 20 µm.

 

The normal hypertonic upregulation of endogenous BGT1 transport in MDCK cells was not altered by expression of foreign proteins such as EGFP (Fig. 2), suggesting there were no nonspecific effects on transport. Redistribution of the fusion proteins to the plasma membrane during hypertonic stress was correlated with an increase in hypertonic upregulation of GABA transport, at least in the case of EGFP-BGT (Fig. 2), indicating that the fusion proteins may retain normal transport functions.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 2. Na+-dependent GABA transport by MDCK cells. The cells were either nontransfected (Non-Tx) or were transiently transfected (Tx) 48 h previously with empty vector (EGFP), EGFP-BGT, or BGT-EGFP. Some cells from each group were switched to hypertonic growth medium (Hyp) for the last 24 h before transport measurements. The remainder were maintained in isotonic (Iso) growth medium. Data are means ± SE from 3 separate experiments. *Significantly different (P < 0.05) compared with uptake in hypertonic group expressing free EGFP.

 

To avoid the complication due to endogenous BGT1 transporters, the transport functions of the fusion proteins were tested more rigorously after transient transfection into mouse embryo fibroblasts (C3H/10T1/2). Nontransfected fibroblasts exhibited little endogenous Na+-dependent uptake of GABA under isotonic conditions, and GABA uptake was not activated by hypertonic stress for 24 h (Fig. 3, nontransfected). Expression of EGFP alone produced no change in GABA uptake. Expression of either EGFP-BGT or BGT-EGFP caused an increase in Na+-dependent GABA transport in normal isotonic medium. Importantly, there was a three- to fourfold increase in transport after 24 h hypertonic stress (Fig. 3, transfected). Thus the hypertonic upregulation of BGT1 transport in MDCK cells was reproduced in C3H/10T1/2 fibroblasts expressing EGFP-tagged BGT1 transporters.



View larger version (12K):
[in this window]
[in a new window]
 
Fig. 3. Na+-dependent GABA transport by mouse embryo fibroblasts. Data are means ± SE from 3 separate experiments. Other details are as in Fig. 2. *Significantly different (P < 0.01) compared with corresponding isotonic group.

 

The transport functions of the fusion proteins were characterized further by determining their sensitivity to a number of inhibitors. Cells were first exposed to 24 h hypertonic stress to induce full expression of transport activity. As previously reported (52), the Na+/Cl--dependent uptake of GABA by normal MDCK cells was markedly inhibited by omission of either Na+ or Cl-, or by the addition of {beta}-alanine, nipecotic acid, phloretin, and quinidine to the uptake medium. Nipecotic acid, {beta}-alanine, and quinidine are potent inhibitors of the related Na+/Cl--dependent neurotransmitter (GAT) transporters (47). GABA uptake was also inhibited by the substrate betaine but not by phlorizin (Fig. 4A). This pattern of inhibitor sensitivity was closely reproduced in fibroblasts expressing the EGFPBGT fusion protein (Fig. 4B), but, in contrast, only quinidine was an effective inhibitor of uptake by the BGT-EGFP fusion protein (Fig. 4C).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 4. Ion dependence and inhibitor sensitivity of Na+-dependent GABA cotransport in nontransfected MDCK cells (A) and in fibroblasts transfected with either EGFP-BGT (B) or BGT-EGFP (C). BGT1 transport activity was induced by exposure to hypertonic growth medium for 24 h before transport measurements. Control medium (C) used for the 10-min GABA uptakes was also hypertonic and contained 100 mM NaCl. It was modified by either deletion of Na+ (lane 1) or Cl- (lane 2), or by the addition of 4 mM {beta}-alanine (lane 3), 2 mM betaine (lane 4), 2 mM nipecotic acid (lane 5), 0.6 mM phloretin (lane 6), 0.6 mM phlorizin (lane 7), or 1 mM quinidine (lane 8). Data are means ± SE from 3 separate experiments. *Significantly different from uptake in corresponding control group (P < 0.05, paired t-test).

 

Additional experiments focused on the EGFP-BGT fusion protein because it retained normal transport functions. The kinetics of GABA uptake after hypertonic stress for 24 h were analyzed by double-reciprocal plots, as in previous studies (10, 23), by using GABA concentrations in the range 0.01-0.10 mM (Fig. 4). The apparent Km value for EGFP-BGT transiently expressed in fibroblasts was identical to the apparent Km for endogenous BGT1 in normal MDCK cells (Fig. 5). These values were derived from the Na+-dependent component of GABA uptake, and their similarity provides further evidence that the transport function of BGT1 was not altered when EGFP was attached to the NH2 terminus.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 5. Kinetics of Na+-dependent GABA transport compared in nontransfected MDCK cells (native BGT1) and in mouse embryo fibroblasts transiently expressing EGFP-BGT fusion protein. Apparent Km and Vmax values were derived from double-reciprocal plots (top panel), and data are means ± SE from 2 to 3 separate experiments, as indicated.

 

MDCK cells transiently expressing EGFP-BGT fusion protein were used to directly compare the subcellular distribution of this protein with that of endogenous BGT1, after hypertonic stress. Endogenous BGT1 was detected by immunostaining by using a secondary antibody tagged with Cy5. The two fluorescent signals showed almost complete overlap and were colocalized in the plasma membranes (Figs. 6, A and B). This overlap is also an important control that demonstrates that EGFP fluorescence represents the intact EGFPBGT protein because it will be detected by both EGFP fluorescence and immunostaining. The antibody also stained nontransfected cells, but, as expected, the signal was much more intense in the cells that had been transfected with EGFP-BGT (Fig. 6C). This panel provides a direct comparison of endogenous BGT1 and EGFP-BGT in the same group of cells. Note that endogenous BGT1 in the nontransfected cells is also located predominantly in the plasma membranes (Fig. 6C). These observations strongly suggest that the EGFP-BGT protein is trafficked normally when MDCK cells adapt to hypertonic stress.



View larger version (68K):
[in this window]
[in a new window]
 
Fig. 6. Colocalization of EGFP-BGT fusion protein (A) and endogenous BGT1 protein (B) in the plasma membranes of MDCK cells after 24 h of hypertonic stress. The fluorescent signal from the antibody stain (B) was present in every cell, as expected, but nontransfected cells were not visible in this image due to the much stronger signal in the cells that coexpress EGFP-BGT. However, when the brightness of this field was increased (C), the endogenous BGT1 protein in nontransfected cells can be seen in a similar plasma membrane location. Scale bar is 20 µm.

 

Western blotting of cell lysates with anti-GFP antibody was used to determine whether hypertonic upregulation of transport was accompanied by a change in the abundance of expressed EGFP-BGT protein. Antibody specificity was validated by the absence of any binding to lysates from nontransfected fibroblasts. As expected, the antibody bound to a 26-kDa band, corresponding to free EGFP, in lysates from fibroblasts transfected with pEGFPC3 vector (Fig. 7). The expressed EGFP-BGT was detected as a broad band at 95-100 kDa, a size consistent with 70 kDa for BGT1 (HM Kwon, personal communication) plus 26 kDa for EGFP, and there was no increase in abundance after 24 h of hypertonic stress (Fig. 7). Reprobing with anti-actin antibodies revealed no consistent difference in sample loading. These findings were confirmed in four separate experiments. In each experiment, the abundance of EGFP-BGT in Western blots of lysates from hypertonic cells was compared with isotonic controls by densitometry. The hypertonic:isotonic ratio was 1.02 ± 0.24 (means ± SE, n = 4). The same ratio for actin was 0.98 ± 0.18.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 7. Western blot comparing expression of EGFP-BGT protein in fibroblasts exposed to isotonic or hypertonic (HYP) growth medium for 24 h. C, nontransfected cells; V, transfected with empty vector; E-B, transfected with EGFP-BGT fusion protein. Actin was used as a loading control.

 

Presumably, the previous data reflect redistribution of EGFP-BGT from cytosol to plasma membrane. This might indicate that overexpression of EGFP-BGT in transfected cells provides the cell with abundant protein so that de novo synthesis is not essential during the subsequent onset of hypertonic stress. In theory, under these circumstances, the EGFP-BGT protein would be available for early insertion in the plasma membrane. The time course of membrane insertion during hypertonic stress was studied online in live MDCK cells at 24 h posttransfection (Fig. 8). At time 0, the fluorescence was excluded from the nucleus but restricted to an area in the cytosol close to the nucleus, possibly the endoplasmic reticulum (ER)-Golgi region. The fluorescence is most likely due to EGFP-BGT rather than free EGFP, which floods all cell compartments (Fig. 1). Close inspection reveals that EGFPBGT fluorescence appeared in the plasma membrane of the upper cell after 2.5 h (arrowhead) of hypertonic stress, possibly earlier (1.5-2.0 h). By 3 h, the plasma membrane location of EGFP-BGT was quite distinct (arrowhead), and by 4 h the cytosol adjacent to the plasma membrane appeared empty of fluorescence (upper cell). The response in the lower cell was the same but slower. By 14 h, both cells showed the same plasma membrane fluorescence with none in adjacent cytosol. A second study confirmed the time course shown here in Fig. 8.



View larger version (111K):
[in this window]
[in a new window]
 
Fig. 8. Time course of EGFP-BGT trafficking to the plasma membrane of MDCK cells. At 24 h posttransfection, the cells were placed on the stage of a confocal microscope and the growth medium was switched to hypertonic medium buffered with HEPES instead of bicarbonate. A timed series (30-min intervals) of z-section images was begun immediately; each z-stack was 6 images at 2-µm intervals. A single section at different times is shown. EGFP-BGT fluorescence was detected in the plasma membrane of the upper cell by 2.5 h (arrowhead). Scale bar is 20 µm.

 

Independent verification of these data was obtained by surface biotinylation of transfected MDCK cells after exposure to hypertonic growth medium for 1-6 h (Fig. 9). The cells were used at 24 h after transfection with EGFP-BGT and, as expected, EGFP-BGT protein was abundant in the Triton lysate at all time points. Due to relatively low transfection efficiency (20%), only a small amount of surface EGFP-BGT was available for biotin labeling. Nevertheless, a weak signal for EGFPBGT was detectable in the streptavidin bead fractions obtained at 3-6 h, but none was detected at 1-2 h. Cadherin was readily biotinylated at all time points. These findings are based on a population of cells and confirm the time course observed in individual cells by microscopy (Fig. 8). Taken together, the data show that an increase in surface expression of EGFP-BGT protein in MDCK cells can be detected within 2-3 h of hypertonic stress.



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 9. Detection of EGFP-BGT protein at the surface of MDCK cells by biotin labeling. At 24 h posttransfection, the cells were switched to hypertonic medium and biotinylated at intervals from 1 to 6 h later. Both the triton lysates (B) and streptavidin bead fractions (A) were analyzed. EGFP-BGT (E-B) was detected by blotting with anti-GFP antibodies. As a negative control, some cells were transfected with empty EGFP vector (V). E-cadherin (CAD) was used as a loading control.

 

When the time course study (Fig. 8) was repeated in the presence of cycloheximide at 10 µM (32), the membrane insertion of EGFP-BGT protein was blocked completely (not shown). Cycloheximide was added when the cells were switched to the hypertonic medium and there was no pretreatment. However, over the 14-h treatment period, there was significant cell detachment. To reduce adverse effects on cell viability, the experiment was repeated with a lower cycloheximide concentration (3 µM), and the cells were incubated for 14 h in normal isotonic or hypertonic growth medium (±cycloheximide) in a CO2 incubator. The results confirmed that cycloheximide blocked translocation of EFGP-BGT to the plasma membrane in response to hypertonicity. No cell rounding or detachment occurred, and representative confocal images are shown in Fig. 10.



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 10. Representative confocal images of MDCK cells that, at 24 h posttransfection with EGFP-BGT, were treated for 14 h with normal growth medium that was either isotonic (A), hypertonic (B), or hypertonic containing 3 µM cycloheximide (C). Scale bar is 20 µm.

 


    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Much is known about transcriptional regulation after hypertonic stress in both eukaryotes and prokaryotes. Specific signaling pathways, DNA response elements, transcription factors, and target genes have been identified (4, 13, 26, 36). However, there is evidence to suggest that posttranscriptional regulation may also be important. For example, our previous studies in MDCK cells demonstrated that the hypertonic upregulation of BGT1 transport requires intact microtubules (3), and the upregulation is enhanced by disruption of the actin cytoskeleton (7). Initial studies on downregulation of BGT1 transport, after returning cells from hypertonic to isotonic medium, suggest indirectly that functional BGT1 transporters are retrieved from the plasma membrane and retained in an intracellular pool for at least 24 h (3). Regulation of BGT1 may also occur through phosphorylation pathways because the primary structure of BGT1 protein contains two potential sites for phosphorylation on intracellular loops (52). Recent studies in astrocytoma cells have shown that the transport function of the BGT1 transporter can be regulated by protein kinase C, resulting in changes in transport Vmax with no change in Km (44). A Vmax change could occur through either an intrinsic change in transporter activity or a change in transporter number in the plasma membrane. The related brain GABA transporter GAT1 expressed in oocytes showed redistribution from intracellular vesicles to the plasma membrane in response to activation of protein kinase C (42). This was accompanied by an increase in transport Vmax with no change in Km.

Regulated insertion of proteins into the plasma membrane has been implicated in the control of numerous membrane transporters. Most recently, tagging membrane transporters with fluorescent proteins has been used successfully to monitor such events for the Na+/phosphate cotransporter (NaPi2) (17), the Na+/H+ exchanger (NHE3) (19, 20), the cystic fibrosis transmembrane conductance regulator (21, 28), subunits of the epithelial sodium channel (6), and the glucose transporter (GLUT4) (41). In the cited studies, the fluorescent tag did not interfere with the normal behavior and transport function of the proteins.

One aim of the present work was to document the transport properties of BGT1 after fusion with EGFP. Such work could not be done with precision in MDCK cells due to endogenous BGT1, so this work introduced the use of fibroblasts with low endogenous BGT1 activity (Fig. 3). The fusion protein formed by attachment of EGFP to the NH2 terminus of BGT1 (EGFP-BGT) functioned normally when expressed in C3H/10T1/2 fibroblasts. The Na+- and Cl--dependent transport of GABA, the hypertonic upregulation of transport, the sensitivity to several inhibitors of normal BGT1, and the apparent Km for GABA were indistinguishable from normal BGT1. The EGFP-BGT protein also trafficked normally in response to hypertonic stress, based on its localization vs. normal BGT1 in the plasma membrane of MDCK cells. The low but measurable level of BGT1 transport activity in nontransfected cells in isotonic solution (Fig. 2) was entirely consistent with the findings of previous studies (3, 7, 34) and suggests that a small amount of BGT1 protein must reside in the plasma membrane even in the absence of osmotic stress. It was therefore not surprising to observe a small amount of EGFP-BGT fluorescence associated with the plasma membrane under isotonic conditions (Fig. 1).

Interestingly, the COOH-terminal fusion protein (BGT-EGFP) had showed similar trafficking in response to hypertonic stress despite having clearly compromised sensitivity to inhibitors. Nipecotic acid, a cyclic analog of GABA, and {beta}-alanine are competitive inhibitors of GABA transporters (14) and likely bind to the same site as the GABA (or betaine) substrate (46). These results suggest that the conformational stability of the transport site, or the fidelity of the transport function, is not required for the signals that regulate insertion of protein into the plasma membrane. Given the altered behavior of BGT-EGFP, only the EGFPBGT protein was studied in more detail.

Results in transfected fibroblasts unequivocally show that hypertonic stress can activate BGT1 transport function in the absence of changes in BGT1 protein abundance. Direct visualization of the EGFP-BGT protein (Figs. 1 and 6) suggests that in transfected fibroblasts, the upregulation of BGT1 transport during hypertonic stress is due primarily to redistribution of intracellular BGT1 protein from cytoplasm to plasma membrane rather than synthesis of additional BGT1 protein. This provides strong support for the possibility that a redistribution mechanism may also operate in normal kidney cells during the initial phase of hypertonic adaptation. Translocation of endogenous BGT1 protein in MDCK cells has been suggested by previous studies (3). Direct studies of the time course of redistribution in transfected MDCK cells (Figs. 8 and 9) showed that EGFP-BGT appeared in the plasma membrane within 2-3 h after the onset of hypertonic stress. Overexpression, due to transfection, provides a plentiful supply of EGFP-BGT protein under isotonic conditions without the need for synthesis de novo. Under these conditions, the EGFP-BGT was detected at the cell surface relatively quickly when the cells were transferred to hypertonic medium, consistent with a redistribution mechanism.

Hypertonic upregulation of BGT1 transport is dependent on de novo RNA and protein synthesis, as shown by blockade of the upregulation by actinomycin D and cycloheximide in kidney (3), bone (11), and endothelial (40) cells. A proper understanding of how this dependence on RNA and protein synthesis can be reconciled with the lack of an increase in EGFP-BGT protein abundance, reported here, will require additional investigation. One possibility is that insertion of the BGT1 protein into the plasma membrane requires synthesis of accessory proteins, such as certain SNARE proteins involved in membrane docking and fusion. Alternatively, BGT1 protein may simply be unstable under hypertonic conditions. In this case, an increased production of BGT1 protein would be required for maintaining the adaptation established initially by redistribution. Either explanation is consistent with blockade of the overall adaptive mechanism by nonselective inhibitors of RNA and protein synthesis. However, blockade of the redistribution by cycloheximide, even when the supply of EGFP-BGT protein is already plentiful (Fig. 10), strongly supports the notion that accessory proteins are required for the membrane insertion step. Until adequate amounts of these proteins are made available through de novo synthesis, the intracellular EGFP-BGT cannot gain access to the plasma membrane.


    DISCLOSURES
 
This work was supported in part by grants from the National Kidney Foundation of Indiana (SAK), the American Heart Association, by a Showalter Foundation Award (SC), and by National Institutes of Health. This work was presented in part in abstract form at the American Society of Nephrology annual meeting in 2001 (J Am Soc Nephrol 12: 50A, 2001).


    ACKNOWLEDGMENTS
 
We thank Dr. H. M. Kwon, University of Maryland, for providing the BGT1 cDNA and antibodies and for helpful discussions and Dr. J. Marrs, Indiana University Medical Center, for providing E-cadherin antibodies.


    FOOTNOTES
 

Address for reprint requests and other correspondence: S. A. Kempson, Medical Sciences 451, 635 Barnhill Drive, Indianapolis, IN 46202-5120 (E-mail: skempson{at}iupui.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
1. Ahn J, Mundigl O, Muth TR, Rudnick G, and Caplan MJ. Polarized expression of GABA transporters in MDCK cells and cultured hippocampal neurons. J Biol Chem 271: 6917-6924, 1996.[Abstract/Free Full Text]

2. Atta MG, Dahl SC, Kwon HM, and Handler J. Tyrosine kinase inhibitors and immunosuppressants perturb the myoinositol but not the betaine cotransporter in isotonic and hypertonic MDCK cells. Kidney Int 55: 956-962, 1999.[Web of Science][Medline]

3. Basham JC, Chabrerie A, and Kempson SA. Hypertonic activation of the renal betaine/GABA transporter is microtubule dependent. Kidney Int 59: 2182-2191, 2001.[Web of Science][Medline]

4. Bianchi AA and Baneyx F. Hyperosmotic shock induces the sigma32 and sigmaE stress regulons of Escherichia coli. Mol Microbiol 34: 1029-1038, 1999.[Web of Science][Medline]

5. Bitoun M and Tappaz M. Gene expression of taurine transporter and taurine biosynthetic enzymes in brain of rats with acute or chronic hyperosmotic plasma. A comparative study. Brain Res Mol Brain Res 77: 10-18, 2000.[Medline]

6. Blazer-Yost BL, Butterworth M, Hartman AD, Parker GE, Faletti GE, Els WJ, and Rhodes SJ. Characterization and imaging of A6 epithelial cell clones expressing fluorescently labeled ENaC subunits. Am J Physiol Cell Physiol 281: C624-C632, 2001.[Abstract/Free Full Text]

7. Bricker JL, Chu S, and Kempson SA. Disruption of F-actin stimulates hypertonic activation of the BGT1 transporter in MDCK cells. Am J Physiol Renal Physiol 284: F930-F937, 2003.[Abstract/Free Full Text]

8. Burg MB, Kwon HM, and Kultz D. Osmotic regulation of gene expression. FASEB J 10: 1598-1606, 1996.[Abstract]

9. Capasso JM, Rivard CJ, and Berl T. Long-term adaptation of renal cells to hypertonicity: role of MAP kinases and Na-KATPase. Am J Physiol Renal Physiol 280: F768-F776, 2001.[Abstract/Free Full Text]

10. Chen JG, Strawbridge AB, and Kempson SA. Microtubule disruption stimulates system A transport in cultured vascular smooth muscle cells. Am J Physiol Cell Physiol 268: C1512-C1519, 1995.[Abstract/Free Full Text]

11. De Angelis E, Petronini PG, Borghetti P, Borghetti AF, and Wheeler KP. Induction of betaine-g-aminobutyric acid transport activity in porcine chondrocytes exposed to hypertonicity. J Physiol 518: 187-194, 1999.[Abstract/Free Full Text]

12. Franchi-Gazzola R, Visigalli R, Dall'Asta V, Sala R, Woo SK, Kwon HM, Gazzola GC, and Bussolati O. Amino acid depletion activates TonEBP and sodium-coupled inositol transport. Am J Physiol Cell Physiol 280: C1465-C1474, 2001.[Abstract/Free Full Text]

13. Garay-Arroyo A, Colmenero-Flores JM, Garciarrubio A, and Covarrubias AA. Highly hydrophilic proteins in prokaryotes and eukaryotes are common during conditions of water deficit. J Biol Chem 275: 5668-5674, 2000.[Abstract/Free Full Text]

14. Garduno J, Elenes S, Cebada J, Becerra E, and Garcia U. Expression and functional characterization of GABA transporters in crayfish neurosecretory cells. J Neurosci 22: 9176-9184, 2002.[Abstract/Free Full Text]

15. Gonda T, Maouyo D, Rees SE, and Montrose MH. Regulation of intracellular pH gradients by identified Na/H exchanger isoforms and a short chain fatty acid. Am J Physiol Gastrointest Liver Physiol 276: G259-G270, 1999.[Abstract/Free Full Text]

16. Gustafson CE, Katsura T, McKee M, Bouley R, Casanova JE, and Brown D. Recycling of AQP2 occurs though a temperature and bafilomycin-sensitive trans-Golgi-associated compartment. Am J Physiol Renal Physiol 278: F317-F326, 2000.[Abstract/Free Full Text]

17. Hernando N, Forgo J, Biber J, and Murer H. PTH-induced downregulation of the type IIa Na/Pi-cotransporter is independent of known endocytic motifs. J Am Soc Nephrol 11: 1961-1968, 2000.[Abstract/Free Full Text]

18. Hwang DY and Ismail-Beigi F. Stimulation of GLUT-1 glucose transporter expression in response to hyperosmolarity. Am J Physiol Cell Physiol 281: C1365-C1372, 2001.[Abstract/Free Full Text]

19. Janecki AJ, Janecki M, Akhter S, and Donowitz M. Basic fibroblast growth factor stimulates surface expression and activity of Na+/H+ exchanger NHE3 via mechanism involving phosphatidylinositol 3-kinase. J Biol Chem 275: 8133-8142, 2000.[Abstract/Free Full Text]

20. Janecki AJ, Janecki M, Akhter S, and Donowitz M. Quantitation of plasma membrane expression of a fusion protein of Na/H exchanger NHE3 and green fluorescent protein (GFP) in living PS120 fibroblasts. J Histochem Cytochem 48: 1479-1492, 2000.[Abstract/Free Full Text]

21. Johnston JA, Ward CL, and Kopito RR. Aggresomes: a cellular response to misfolded proteins. J Cell Biol 143: 1883-1898, 1998.[Abstract/Free Full Text]

22. Kaneko T, Takenaka M, Okabe M, Yoshimura Y, Yamauchi A, Horio M, Kwon HM, Handler JS, and Imai E. Osmolarity in renal medulla of transgenic mice regulates transcription via 5'-flanking region of canine BGT1 gene. Am J Physiol Renal Physiol 272: F610-F616, 1997.[Abstract/Free Full Text]

23. Kempson SA. Differential activation of system A and betaine/GABA transport in MDCK cell membranes by hypertonic stress. Biochim Biophys Acta 1372: 117-123, 1998.[Medline]

24. Kempson SA, Lotscher M, Kaissling B, Biber J, Murer H, and Levi M. Parathyroid hormone action on phosphate transporter mRNA and protein in rat renal proximal tubules. Am J Physiol Renal Fluid Electrolyte Physiol 268: F784-F791, 1995.[Abstract/Free Full Text]

25. Keusch I, Traebert M, Lotscher M, Kaissling B, Murer H, and Biber J. Parathyroid hormone and dietary phosphate provoke a lysosomal routing of the proximal tubular Na/Pi-cotransporter type II. Kidney Int 54: 1224-1232, 1998.[Web of Science][Medline]

26. Kultz D and Burg MB. Intracellular signaling in response to osmotic stress. Contrib Nephrol 123: 94-109, 1998.[Web of Science][Medline]

27. Kwon HM, Itoh T, Rim JS, and Handler JS. The MAP kinase cascade is not essential for transcriptional stimulation of osmolyte transporter genes. Biochem Biophys Res Commun 213: 975-979, 1995.[Web of Science][Medline]

28. Loffing-Cueni D, Loffing J, Shaw C, Taplin AM, Govindan M, Stanton CR, and Stanton BA. Trafficking of GFP-tagged DF508-CFTR to the plasma membrane in a polarized epithelial cell line. Am J Physiol Cell Physiol 281: C1889-C1897, 2001.[Abstract/Free Full Text]

29. Maouyo M, Chu S, and Montrose MH. pH heterogeneity at intracellular and extracellular plasma membrane sites in HT29-C1 cell monolayers. Am J Physiol Cell Physiol 278: C973-C981, 2000.[Abstract/Free Full Text]

30. Matskevitch I, Wagner CA, Stegen C, Broer S, Noll B, Risler T, Kwon HM, Handler JS, Waldegger S, Busch A, and Lang F. Functional characterization of the betaine/GABA transporter BGT-1 expressed in Xenopus oocytes. J Biol Chem 274: 16709-16716, 1999.[Abstract/Free Full Text]

31. Miyai A, Yamauchi A, Moriyama T, Kaneko T, Takenaka M, Sugiura T, Kitamura H, Ando A, Tohyama M, Shimada S, Imai E, and Kamada T. Expression of betaine transporter mRNA: its unique localization and rapid regulation in rat kidney. Kidney Int 50: 819-827, 1996.[Web of Science][Medline]

32. Miyakawa H, Woo SK, Chen CP, Dahl SC, Handler JS, and Kwon HM. Cis- and trans-acting factors regulating transcription of the BGT1 gene in response to hypertonicity. Am J Physiol Renal Physiol 274: F753-F761, 1998.[Abstract/Free Full Text]

33. Miyakawa H, Woo SK, Dahl SC, Handler JS, and Kwon HM. Tonicity-responsive enhancer binding protein, a Rel-like protein that stimulates transcription in response to hypertonicity. Proc Natl Acad Sci USA 96: 2538-2542, 1999.[Abstract/Free Full Text]

34. Nahm O, Woo SK, Handler J, and Kwon HM. Involvement of multiple kinase pathways in stimulation of gene transcription by hypertonicity. Am J Physiol Cell Physiol 282: C49-C58, 2002.[Abstract/Free Full Text]

35. Nakanishi T, Turner RJ, and Burg MB. Osmoregulation of betaine transport in mammalian renal medullary cells. Am J Physiol Renal Fluid Electrolyte Physiol 258: F1061-F1067, 1990.[Abstract/Free Full Text]

36. Pahlman AK, Granath K, Ansell R, Hohmann S, and Adler L. The yeast glycerol 3-phosphatases Gpp1p and Gpp2p are required for glycerol biosynthesis and differentially involved in the cellular responses to osmotic, anaerobic, and oxidative stress. J Biol Chem 276: 3555-3563, 2001.[Abstract/Free Full Text]

37. Palacios S, Lalioti V, Martinez-Arca S, Chattopadhyay S, and Sandoval IV. Recycling of the insulin-sensitive glucose transporter GLUT4. J Biol Chem 276: 3371-3383, 2001.[Abstract/Free Full Text]

38. Perego C, Bulbarelli A, Longhi R, Caimi M, Villa A, Caplan MJ, and Pietrini G. Sorting of two polytopic proteins, the GABA and betaine transporters, in polarized epithelial cells. J Biol Chem 272: 6584-6592, 1997.[Abstract/Free Full Text]

39. Perego C, Vanoni C, Villa A, Longhi R, Kaech SM, Frohli E, Hajnal A, Kim SK, and Pietrini G. PDZ-mediated interactions retain the epithelial GABA transporter on the basolateral surface of polarized epithelial cells. EMBO J 18: 2384-2393, 1999.[Web of Science][Medline]

40. Petronini PG, Alfieri RR, Losio MN, Caccamo AE, Cavazzoni A, Bonelli MA, Borghetti AF, and Wheeler KP. Induction of BGT-1 and amino acid system A transport activities in endothelial cells exposed to hyperosmolarity. Am J Physiol Regul Integr Comp Physiol 279: R1580-R1589, 2000.[Abstract/Free Full Text]

41. Powell K, Campbell LC, Tavare JM, Leader DP, Wakefield JA, and Gould GW. Trafficking of Glut4-green fluorescent protein chimaeras in 3T3-L1 adipocytes suggests distinct internalization mechanisms regulating cell surface Glut4 levels. Biochem J 344: 535-543, 1999.[Medline]

42. Quick MW, Corey JL, Davidson N, and Lester HA. Second messengers, trafficking-related proteins, and amino acid residues that contribute to the functional regulation of the rat brain GABA transporter GAT1. J Neurosci 17: 2967-2979, 1997.[Abstract/Free Full Text]

43. Reznikoff CA, Brankow DW, and Heidelberger C. Establishment and characterization of a cloned line of C3H mouse embryo cells sensitive to postconfluence inhibition of division. Cancer Res 33: 3231-3238, 1973.[Abstract/Free Full Text]

44. Ruiz-Tachiquin ME, Sanchez-Lemus E, Soria-Jasso LE, Arias-Montano JA, and Ortega A. Gamma-aminobutyric acid transporter (BGT-1) expressed in human astrocytoma U373 MG cells: pharmacological and molecular characterization and phorbol ester-induced inhibition. J Neurosci Res 69: 125-132, 2002.[Web of Science][Medline]

45. Sheikh-Hamad D, Di Mari J, Suki WN, Safirstein R, Watts BA, and Rouse D. p38 kinase activity is essential for osmotic induction of mRNAs for HSP70 and transporter for organic solute betaine in Madin-Darby canine kidney cells. J Biol Chem 273: 1832-1837, 1998.[Abstract/Free Full Text]

46. Sitte HH, Singer EA, and Scholze P. Bi-directional transport of GABA in human embryonic kidney (HEK-293) cells stably expressing the rat GABA transporter GAT-1. Br J Pharmacol 135: 93-102, 2002.[Web of Science][Medline]

47. Takanaga H, Ohtsuki S, Hosoya K, and Terasaki T. GAT2/BGT-1 as a system responsible for the transport of {gamma}-aminobutyric acid at the mouse blood-brain barrier. J Cereb Blood Flow Metab 21: 1232-1239, 2001.[Web of Science][Medline]

48. Uchida S, Yamauchi A, Preston AS, Kwon HM, and Handler JS. Medium tonicity regulates expression of the Na+ and Cl-dependent betaine transporter in MDCK cells by increasing transcription of the transporter gene. J Clin Invest 91: 1604-1607, 1993.[Web of Science][Medline]

49. Warntges S, Grone HJ, Capasso G, and Lang F. Cell volume regulatory mechanisms in progression of renal disease. J Nephrol 14: 319-326, 2001.[Web of Science][Medline]

50. Woo SK, Dahl SC, Handler JS, and Kwon HM. Bidirectional regulation of tonicity-responsive enhancer binding protein in response to changes in tonicity. Am J Physiol Renal Physiol 278: F1006-F1012, 2000.[Abstract/Free Full Text]

51. Yamauchi A, Kwon HM, Uchida S, Preston AS, and Handler J. Myo-inositol and betaine transporters regulated by tonicity are basolateral in MDCK cells. Am J Physiol Renal Fluid Electrolyte Physiol 261: F197-F202, 1991.[Abstract/Free Full Text]

52. Yamauchi A, Uchida S, Kwon HM, Preston AS, Robey RB, Garcia-Perez A, Burg MB, and Handler JS. Cloning of a Na+- and Cl--dependent betaine transporter that is regulated by hypertonicity. J Biol Chem 267: 649-652, 1992.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
S. A. Kempson, J. M. Edwards, A. Osborn, and M. Sturek
Acute inhibition of the betaine transporter by ATP and adenosine in renal MDCK cells
Am J Physiol Renal Physiol, July 1, 2008; 295(1): F108 - F117.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. A. Kempson, J. M. Edwards, and M. Sturek
Inhibition of the renal betaine transporter by calcium ions
Am J Physiol Renal Physiol, August 1, 2006; 291(2): F305 - F313.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
J. Xu, R. T. Worrell, H. C. Li, S. L. Barone, S. Petrovic, H. Amlal, and M. Soleimani
Chloride/Bicarbonate Exchanger SLC26A7 Is Localized in Endosomes in Medullary Collecting Duct Cells and Is Targeted to the Basolateral Membrane in Hypertonicity and Potassium Depletion
J. Am. Soc. Nephrol., April 1, 2006; 17(4): 956 - 967.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/5/C1091    most recent
00021.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kempson, S. A.
Right arrow Articles by Montrose, M. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kempson, S. A.
Right arrow Articles by Montrose, M. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the American Physiological Society.