Am J Physiol Cell Physiol Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 285: C959-C967, 2003. First published June 25, 2003; doi:10.1152/ajpcell.00511.2002
0363-6143/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/4/C959    most recent
00511.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (28)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chatterjee, S.
Right arrow Articles by Fisher, A. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chatterjee, S.
Right arrow Articles by Fisher, A. B.

VASCULAR BIOLOGY

Shear stress increases expression of a KATP channel in rat and bovine pulmonary vascular endothelial cells

Shampa Chatterjee,1 Abu-Bakr Al-Mehdi,1 Irena Levitan,2 Troy Stevens,3 and Aron B. Fisher1

1Institute for Environmental Medicine; and 2Institute for Medicine and Engineering, University of Pennsylvania, Medical Center, Philadelphia, Pennsylvania 19104; and 3Department of Cellular and Molecular Pharmacology, University of South Alabama, Mobile, Alabama 36688

Submitted 5 November 2002 ; accepted in final form 16 June 2003


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We have shown previously that acute ischemia leads to depolarization of pulmonary microvascular endothelial cells that is prevented with cromakalim, suggesting the presence of ATP-sensitive K+ (KATP) channels in these cells. Thus KATP channel expression and activity were evaluated in rat pulmonary microvascular endothelial cells (RPMVEC) by whole cell current measurements, dot blot (mRNA), and immunoblot (protein) for the inwardly rectifying K+ channel (KIR) 6.2 subunit and fluorescent ligand binding for the sulfonylurea receptor (SUR). Low-level expression of a KATP channel was detected in endothelial cells in routine (static) culture and led us to examine whether its expression is inducible when endothelial cells are adapted to flow. Channel expression (mRNA and both KIR6.2 and SUR proteins) and inwardly rectified membrane current by patch clamp increased significantly when RPMVEC were adapted to flow at 10 dyn/cm2 for 24 h in either a parallel plate flow chamber or an artificial capillary system. Induction of the KATP channel with flow adaptation was also observed in bovine pulmonary artery endothelial cells. Flow-adapted but not static RPMVEC showed cellular plasma membrane depolarization upon stop of flow that was inhibited by a KATP channel opener and prevented by addition of cycloheximide to the medium during the flow adaptation period. These studies indicate the induction of KATP channels by flow adaptation in pulmonary endothelium and that the expression and activity of this channel are essential for the endothelial cell membrane depolarization response with acute decrease in shear stress.

flow adaptation; KIR 6.2; sulfonylurea receptor; fluorescent glyburide; pulmonary microvascular endothelial cells


ENDOTHELIAL CELLS lining the vasculature are constantly subjected to shear stress arising from the dragging frictional force created by blood flow. Increased shear stress is known to modulate endothelial cell function by initiating a wide range of responses (9, 11, 13, 35), including activation of flow-sensitive ion channels (10, 18, 27), changes in expression of various gene products (16, 28), and cytoskeletal reorganization (13, 26). In our previous studies using an isolated perfused lung model, we showed that cessation of flow leads to an immediate (<1 s) partial depolarization of the endothelial cell membrane and is followed by generation of reactive oxygen species (ROS), increased intracellular Ca2+, and activation of endothelial nitric oxide (NO) synthase (3, 31). This response was shear dependent and independent of changes in intravascular pressure (5). Endothelial cell membrane depolarization and ROS generation with flow cessation were prevented by pretreatment with a KATP channel agonist (6, 31) and were mimicked by treating lungs with glibenclamide (glyburide) (1, 34), a KATP channel blocker. Thus we propose that a KATP channel in the lung endothelium is responsible for maintaining membrane potential with normal shear and is inactivated by loss of shear leading to depolarization. To test this hypothesis, we investigated the presence of KATP channels in rat pulmonary microvascular endothelial cells (RPMVEC). These cells were chosen as the primary model because our demonstration of membrane depolarization of the endothelium in situ was for the rat pulmonary microvasculature. Because our initial studies demonstrated only low-level expression of KATP channel proteins in RPMVEC, we postulated that their expression may be downregulated in cells cultured under static conditions and could be induced when cells are subjected to flow. Flow adaptation might more closely reproduce the properties of pulmonary endothelial cells in situ, which are expected to be adapted to shear stress associated with normal pulmonary blood flow. Thus the expression and activity of KATP channels in endothelial cells cultured under static and flow-adapted conditions was compared. Because KATP channels are formed by the association of two proteins, an inward rectifier potassium channel of the 6 family (KIR 6) and the sulfonylurea receptor (SUR), both subunits were evaluated (15). Finally, the endothelial membrane depolarization response with stop of flow was also examined in vitro in cells that were flow adapted or cultured under static conditions.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cells and culture media. Isolation and culture of RPMVEC has been described previously (32). RPMVEC were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (FBS), nonessential amino acids, and penicillin/streptomycin. Cells were maintained under static culture conditions for several passages before being subjected to flow. RPMVEC at passage 11 were used in the experiments. The endothelial phenotype of the preparation was confirmed by evaluating cellular uptake of DiI-acetylated low-density lipoprotein (DiI-Ac-LDL) and the presence of platelet endothelial cell adhesion molecule (PECAM-1). Confluent RPMVEC were incubated with DiI-Ac-LDL at a final concentration of 10 µg/ml for 1 h at 37°C, after which the cells were washed three times with fresh medium and viewed under an epifluorescence microscope at 580 nm. HeLa cells obtained from the American Type Culture Collection (ATCC) were used as a control. To evaluate expression of PECAM, cultured cells were split and incubated with anti-PECAM antibody (Centacor, Malvern, PA) or with nonimmune IgG for 3 h. Cells were washed, incubated with a 1:100 dilution of goat anti-mouse IgG conjugated with Alexa 488 (Molecular Probes, Eugene, OR), and examined with a Radiance 2000 laser scanning confocal microscope (Bio-Rad, Richmond, CA). Studies were also carried out with bovine pulmonary artery endothelial cells (BPAEC), obtained from the ATCC (Manassas, VA) and cultured as described previously (37).

Exposure of cells to shear stress. Three systems for flow adaptation of cells were used because each has specific advantages. The first was an artificial capillary system that yields sufficient cells to obtain protein lysates and RNA for immunoblotting and mRNA dot blots. The use of this commercially available apparatus (CellMax Quad Artificial Capillary Cell Culture System, Cellco, Germantown, MD) for flow-adapting endothelial cells has been described previously (36, 37). The capillaries were precoated with fibronectin (Sigma, St. Louis, MO), and cells were allowed to attach during a 24-h period. Cells were then cultured under static conditions or under shear stress at 1 dyn/cm2 for 72 h or 10 dyn/cm2 for 24 h.

A parallel plate chamber was used to adapt cells to flow on coverslips. The chamber used to adapt cells for microscopy and whole cell patch-clamp studies consisted of a steel plate (7.5 cm long, 3.7 cm wide, 0.4 cm high) with a hollow slot in the center that can be fitted on top with a glass slide and on the bottom with a coverslip containing cells to create a rectangular flow channel (0.01 cm high, 2 cm wide, and 2 cm long). Inlet and outlet ports on the steel plate were connected to a pump and a reservoir to facilitate flow of medium into the system. RPMVEC were grown to confluence on either fibronectin- or gelatin-coated glass coverslips (2 x 2 cm) and then fitted into the chamber slot. With this apparatus, cells were subjected to shear stress for 72 h at 1 dyn/cm2 or 24 h at 5 or 10 dyn/cm2. The chamber used to flow adapt cells for measurements of membrane potential in real time with fluorescent dye was designed to fit in a standard fluorometer cuvette holder and has been described previously (24). Cells on plastic coverslips (1.25 x 2.5 cm) coated with fibronectin were grown under static conditions or flow adapted at 10 dyn/cm2 for 24 h.

Electrophysiological measurements of membrane potential. Cells grown on coverslips were either subjected to flow in the parallel plate chamber or kept under static conditions. Cells were removed with 0.025% trypsin and then replated on coverslips and placed on a petri dish on the modified stage of an inverted microscope. Ion currents were measured using the whole cell patch-clamp configuration (17). Cells were continuously perfused with an external bath solution that contained 156 mM KCl, 1.5 mM CaCl2, 1 mM MgCl2, 10 mM HEPES, and 1 mM EGTA, pH 7.3. The internal pipette solution contained 145 mM KCl, 1 mM MgCl2, 10 mM HEPES, and 1 mM EGTA, pH 7.3. The holding potential was -60 mV. Current was elicited by 500-ms linear voltage ramps from -160 to +60 mV at an interpulse interval of 5 s. Currents were recorded by using an EPC9 amplifier (HEKA Electronik, Lambrecht, Germany) and accompanying acquisition and analysis software (Pulse and Pulsefit, HEKA Electronik) running on a PowerCenter 150 (Mac OS) computer. For each cell, at least 100 voltage ramps were recorded and averaged by the computer. Cells that ruptured before 100 voltage ramps were excluded from the analysis. Whole cell capacitance and series resistance were monitored throughout each recording, and cell current values were normalized to the capacitance of the cell to obtain current density. Peak current density was defined as the most negative value during the voltage ramp. An experiment was defined as all of the measurements made on a particular day, and generally three to five cells were evaluated for each condition. For each experiment, measurements were made alternately from static cultured and flow-adapted cells, and the results for each condition were averaged. Data are expressed as means ± SE and were evaluated by analysis of variance with post hoc Tukey's test for paired comparisons using SigmaStat software (Jandel Scientific, San Rafael, CA). Differences between groups were considered statistically significant at P < 0.05.

Real time fluorescence measurements of membrane potential. RPMVEC grown on fibronectin coated slides under static conditions or adapted to flow of 10 dyn/cm2 for 24 h were preincubated with the membrane potential-sensitive dye bisoxonol (50 nM) for 30 min. In some experiments, the KATP channel agonist cromakalim (30 µM) was added during the preincubation period. In other experiments, cycloheximide (10 µg/mol) was added to the perfusate medium during the flow adaptation period. Detection of bisoxonol fluorescence was at 520 nm with 490 nm excitation. Fluorescence measurements for endothelial cell membrane potential measurements during flow and with stop of flow were performed with a PTI spectrofluorometer (Photon Technology International, Bricktown, NJ) equipped with single photon counting system with excitation and emission slits at 1 and 3 nm, respectively.

RT-PCR and RNA dot blots. Total RNA was isolated from static and flow-adapted RPMVEC by using an RNEasy kit (Qiagen, Los Angeles, CA). Total RNA was also isolated from blood-free rat lung homogenates. For RT-PCR, RNA (1 µg) from flow-adapted cells was reverse transcribed into cDNA and subjected to PCR by using a GeneAmp RNA-PCR core kit (Roche, Nutley, NJ) and GeneAmp 2400 (Perkin Elmer, Boston, MA). For inwardly rectifying K+ channels (KIR) 6.1, the forward and reverse primers were TGCGCAAACCGCGCATCCGCGACC and TCAGTGGCTGACTACGCTTATCAATCAC, respectively. For KIR 6.2, the forward and reverse primers were CTACAGAGCCCAGGTACCGTACTC and GGTGCAGGTCACTAGGAGCCTGTTGGAG. The PCR program consisted of initial denaturation at 95°C for 2 min followed by 35 cycles for 45 s, annealing at 60°C for 1 min with final extension step at 72°C for 10 min. The PCR products were separated by electrophoresis on a 8% SDS-polyacrylamide gel. The primers used in these reactions should yield a PCR product of 770 bp for KIR 6.1 and 780 bp for KIR 6.2.

For RNA dot blots, total RNA was absorbed on a nylon membrane by using a dot blot microfiltration apparatus (Bio-Rad) and probed with KIR 6.2 cDNA (entire coding sequence, a gift from F. Ashcroft, Oxford, UK) labeled with 32P. The blots were serially washed with 2x SSC-1% SDS and 0.2x SSC-0.1% SDS to a final temperature of 42°C for 30 min, followed by autoradiography with overnight exposure.

Immunoblotting. Flow-adapted and static cultured RPMVEC or BPAEC were removed from the flow chamber by trypsinization. Trypsinized and pelleted cells were suspended in ice-cold buffer consisting of 145 mM NaCl, 0.1 mM MgCl2, 15 mM HEPES, 10 mM EGTA, 1 mM Na3VO4, 1% Triton X-100, and protease inhibitor cocktail (0.5 mM phenylmethylsulfonyl fluoride, 50 mg/l leupeptin, 25 mg/l aprotinin, and 25 mg/l pepstatin, all from Sigma). The cells were sonicated, and protein extracts were obtained by denaturation in boiling sample buffer. Pancreatic {beta}-cells grown in static culture and lung homogenate obtained from lungs perfused until blood free (2) were used as a control. Cell sonicate protein concentration was determined by Coomassie blue assay (Bio-Rad) by using bovine IgG as the standard, and equal amounts of experimental sample protein were loaded in the wells. After electrophoresis on 12% SDS-PAGE gel, proteins were transferred onto nitrocellulose membranes by electroblotting. After being blocked with milk, the membranes were incubated with polyclonal anti-KIR 6.2 peptide antibodies. An antibody to a COOH terminus peptide, KAKPKFSISPDSLS (KIR 6.2-C Ab) was obtained from S. Seino (Chiba University, Chiba, Japan). An antibody to a NH2 terminus peptide, EEYVLTRLAEDPAEPRYRC (KIR 6.2-N Ab), was obtained from A. Tinker (University College, London, UK). Peroxidase-conjugated goat anti-rabbit IgG (Jackson ImmunoResearch Labs, West Grove, PA) was used as the secondary antibody at 1:10,000 dilution. The signal was detected by chemiluminescence by using an ECL kit (Amersham, Piscataway, NJ). Reactivity of the antibodies was confirmed with pancreatic {beta}-cell extracts. The bands obtained were scanned using a Bio-Rad Fluor-S MultImager equipped with Quant-I software for quantitation. Data are expressed as means ± SE and evaluated by t-test using SigmaStat software.

Expression of the SUR was evaluated by cellular binding of fluorescently labeled glyburide (BODIPY-FL glyburide). A 100 mM stock of BODIPY-FL glyburide (Molecular Probes, Eugene, OR) was prepared in DMSO. For RPMVEC, cells in the parallel plate chamber were incubated for 20 min with 50 nM BODIPY-FL glyburide, washed three times, fixed on the coverslips with 4% paraformaldehyde in 0.1 M Na-cacodylate buffer, and coverslipped in Mowiol. For BPAEC, cells were removed from attachment in artificial capillaries by trypsinization, placed in petri dishes, incubated with BODIPY-FL glyburide, and processed as for RPMVEC. Fluorescence images at 480 nm were obtained by using Meta-morph imaging software (Universal Imaging, West Chester, PA) and a Nikon Optiphot microscope (Melville, NY) (4). All images were processed by using a preset scale on the Meta-morph image analysis software to facilitate quantitative comparisons.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The endothelial phenotype of RPMVEC cultured under static conditions was confirmed by uptake of the endothelial cell marker DiI-Ac-LDL and immunostaining for PECAM (Fig. 1). HeLa cells treated identically with DiI-Ac-LDL were a negative control, and nonspecific IgG was used as a control for PECAM immunoreactivity (Fig. 1).



View larger version (80K):
[in this window]
[in a new window]
 
Fig. 1. Fluorescence microscopy and phase-contrast examination of rat pulmonary microvascular endothelial cells (RPMVEC) from passage 11 cultured under static conditions. A: DiI-acetylated low-density lipoprotein (DiI-Ac-LDL) uptake. B: phase-contrast image of the same field. C: HeLa cells incubated with DiI-Ac-LDL. D: phase-contrast image of the same field. E: platelet endothelial cell adhesion molecule (PECAM)-1 expression in RPMVEC as detected by immunofluorescence using an anti-PECAM antibody. F: phase-contrast image of the same field. G: RPMVECs incubated with nonimmune rabbit IgG. H: phase-contrast image of the same field.

 

The whole cell configuration of the patch-clamp technique was used to study the function of the KATP channel in RPMVEC that were grown under static conditions or flow adapted at 1, 5, or 10 dyn/cm2. A schematic of the voltage ramp that was used and typical patch-clamp currents is shown in Fig. 2. Cells cultured under static conditions showed a low-magnitude current that was appreciably greater in cells that were adapted to flow at 10 dyn/cm2 for 24 h. The currents show an inwardly rectifying current-voltage relationship typical for KIR. The reversal potential for both static and flow-adapted cells was approximately -2 mV, as expected under symmetrical K+ conditions. The addition of glyburide (50 nM) to the external bath solution significantly blocked the inward rectifier current, indicating a KATP channel. Peak current density for cells that were flow adapted at 1 dyn/cm2 was not different from cells cultured under static conditions, but flow adaptation at 5 dyn/cm2 resulted in a significant increase with a further increase at 10 dyn/cm2 (Table 1). These cells were grown and adapted to shear on a fibronectin matrix. Cells grown on gelatin-coated coverslips also showed a significant (P < 0.05) increase in channel activity with flow adaptation at 5 dyn/cm2 for 24 h compared with static cells.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 2. Inwardly rectifying whole cell K+ currents (KIR) in rat pulmonary microvascular endothelial cells. A: the voltage protocol is shown above the experimental tracings. B: representative recordings obtained from static (no flow) cells and cells adapted to flow at a shear stress of 10 dyn/cm2 for 24 h. Addition of glyburide a KATP blocker to the bath solution of flow-adapted cells markedly diminished the current.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Mean peak current for RPMVEC cultured under static conditions or under different levels of shear stress during the flow adaptation period

 

The inward rectifier subunit of KATP channels is a member of the KIR 6 family (15). Because there is high homology between the two currently known members, KIR 6.1 and KIR 6.2, RT-PCR was used to determine which of these inward rectifier subunits is present in RPMVEC. RT-PCR showed the 780-bp band predicted for KIR 6.2 but not the predicted band (770 bp) for KIR 6.1 (Fig. 3).



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 3. RT-PCR (35 cycles) of RPMVEC cultured under static and flow-adapted conditions (10 dyn/cm2 for 24 h) using primers for KIR 6.1 and 6.2. A product of 780 bp was generated indicating the presence of message for KIR 6.2.

 

The presence of KIR 6.2 mRNA in RPMVEC was detected by RNA dot blot (Fig. 4A). The KIR message was present in static cells and was increased ~2-fold in cells adapted to shear stress at 1 dyn/cm2 and slightly more at 10 dyn/cm2. GAPDH mRNA used as a standard for loading efficiency showed similar density for all three conditions. RNA extracted from the whole lung demonstrated a signal intermediate between that for static and flow-adapted cells (not shown); this result is compatible with the observation that endothelial cells (presumably flow adapted) represent ~30% of total lung cells.



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 4. Induction of KATP channels during flow adaptation. A: representative blots of KIR 6.2 mRNA and protein content of RPMVEC cultured under static conditions or adapted to flow at 1 dyn/cm2 for 72 h (low flow) or 10 dyn/cm2 for 24 h (high flow). Total RNA was extracted, adsorbed as a dot on a nitrocellulose membrane, and hybridized with 32P-labeled KIR 6.2 cDNA. GAPDH was used as a standard for loading efficiency. Protein was analyzed by Western blot by using polyclonal antibodies to either the COOH terminus or NH2 terminus of KIR 6.2. B and C: epifluorescence images of rat pulmonary microvascular endothelial cells exposed to shear stress at 1 dyn/cm2 (B) or 10 dyn/cm2 (C) in a parallel plate chamber for varying periods and labeled with fluorescently labeled glyburide (BODIPY) glyburide (50 nM). The resulting fluorescence indicating binding of glyburide to the sulfonylurea receptor (SUR) was observed with a microscope. All images were processed on a preset scale using image analysis software as described in the text.

 

Immunoblot for KIR 6.2 protein expression (polyclonal antibodies directed against both COOH and NH2 terminus) showed a 50-kDa band consistent with that reported for the KIR 6.2 protein (15). The antibody to the COOH terminus peptide gave a relatively weak reaction with static cells but showed a significant increase in cells adapted to 1 dyn/cm2. Cells adapted to the higher shear stress were not analyzed with this antibody. The antibody to the NH2 terminus gave a more vigorous reaction; densitometric scanning of the bands revealed that immunoreactivity increased 2.2 ± 0.5-fold (n = 3) in cells exposed to 1 dyn/cm2, 2.5 ± 0.3-fold (n = 3) in cells exposed to 5 dyn/cm2, and 2.6 ± 0.5-fold (n = 3) in cells exposed to 10 dyn/cm2 (Fig. 4A). All values are statistically significant (P < 0.05) compared with cells under static culture conditions.

Expression of the SUR subunit of the KATP channel in RPMVEC was evaluated in response to shear stress of 1 dyn/cm2 for varying periods up to 72 h and 10 dyn/cm2 for periods up to 24 h. Analysis of BODIPY-FL glyburide binding demonstrated a time-dependent increase with a significantly more rapid response by cells exposed to the higher shear stress (Fig. 4, B and C). At 10 dyn/cm2 shear stress, glyburide binding reached maximum at 24 h of adaptation, whereas a similar increase in glyburide binding required 72 h of flow adaptation at 1 dyn/cm2.

Because endothelial cell membrane depolarization was observed with rat lung ischemia in situ, we studied this response in cells adapted to flow. Flow-adapted RPMVEC showed a rapid increase in bisoxonol fluorescence with stop of flow indicating plasma membrane depolarization; a return to baseline was observed with restart of flow compatible with repolarization (Fig. 5A). There was no change in bisoxonol fluorescence with stop of flow in RPMVEC that were subjected to flow for only 30 min (to load the dye) and, therefore, were not flow adapted. Cells treated with the KATP channel opener cromakalim showed no change in fluorescence upon stop of flow, providing evidence that KATP closure is required for the depolarization response. The depolarization response was studied in cells that had been treated with cycloheximide during the period of adaptation to flow. RPMVEC adapted to flow (10 dyn/cm2 for 24 h) in the presence of 10 µg/ml cycloheximide did not show the increase of bisoxonol fluorescence associated with membrane depolarization with stop of flow, indicating that this response required protein synthesis during the flow adaptation period (Fig. 5B).



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 5. Change in plasma membrane potential as measured by bisoxonol fluorescence (24). RPMVEC grown on coverslips in a parallel plate chamber were prelabeled for 30 min with 0.05 µM bisoxonol, and fluorescence was monitored at 520 nm ({lambda}ex = 490 nm). A: increase in fluorescence with stop of flow in flow-adapted RPMVEC (10 dyn/cm2 for 24 h) indicates plasma membrane depolarization. Cells pretreated with the KATP channel agonist cromakalim (30 µM) showed no change in fluorescence with stop of flow. B: membrane depolarization with flow cessation was not observed in RPMVEC grown under static conditions or in the presence of cycloheximide (CyHx, 10 µg/ml) during the flow adaptation period (10 dyn/cm2 for 24 h).

 

Induction of KATP channels by flow was also evaluated in BPAEC. Flow adaptation in these cells was demonstrated by cellular alignment in the direction of flow, as reported previously (24). Interestingly, alignment of RPMVEC did not occur with flow adaptation (not shown). BPAEC adapted to 1 dyn/cm2 for 72 h showed a significant increase in immunoreactive protein detected by KIR 6.2-C Ab and in the SUR detected by BODIPY-FL glyburide binding (Fig. 6). Adaptation to higher shear stress and electrophysiological responses was not evaluated with these cells.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 6. KATP channel expression in bovine pulmonary artery endothelial cells (BPAEC) cultured under static conditions or flow adapted to 1 dyn/cm2 for 72 h in the artificial capillary system. A: immunoblot using the antibody to the COOH-terminal peptide of protein from static cells (lane 1), flow-adapted cells (lane 2), or pancreatic {beta}-cells (lane 3). Lanes 1 and 2: 50 µg protein; lane 3: 5 µg protein. The relative position of molecular mass markers is indicated. The upper band is consistent with the molecular mass for KIR 6.2; the identity of the lower band in lane 3 is unknown. B: BODIPY-FL glyburide binding by static and flow-adapted cells. Images were processed on a preset scale using image analysis software.

 


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In our previous studies using the isolated perfused rat lung model, we determined that cessation of flow (ischemia) results in endothelial cell membrane depolarization and subsequent generation of ROS (5, 6, 31). This effect was reproduced in vitro using BPAEC but required preadaptation of the cells to shear stress (24). We also observed that treatment of lungs with glyburide, a KATP channel blocker, could induce similar effects (1, 34). Ischemic depolarization and ROS generation could be prevented by pretreatment of lungs with lemakalim or cromakalim, KATP channel agonists (6, 31). These observations suggest involvement of a KATP channel in response to flow cessation in the flow-adapted lung endothelium and led us to examine the expression of this channel in RPMVEC.

Patch-clamp studies of RPMVEC cultured under static conditions (passage 11) showed low-level expression of an inwardly rectified K+ current that was significantly increased with flow adaptation. Channel activity was sensitive to glyburide compatible with a KATP channel. Presence of the message for the KIR 6.2 pore-forming unit of the KATP channel, and absence of that for KIR 6.1, was confirmed by RT-PCR. Induction of the KIR 6.2 channel message and protein on adaptation to shear stress was demonstrated by mRNA and immunoblot analysis, whereas increased expression of SUR was shown by ligand binding. RNA and protein extracted from rat lung showed the presence of the KIR 6.2 subunit compatible with its presence in lung endothelium, although other cell types could account for some of this activity. The results suggest that the KATP channel present in pulmonary endothelial cells is downregulated when cells are cultured under static conditions and can be induced in vitro during flow adaptation. Although previous studies of endothelial cells from rat aorta and brain and rabbit aorta and pulmonary artery have identified membrane currents compatible with KATP channels (19, 20), the present results are the first demonstration in endothelial cells of the individual protein components of the KATP channel and their induction with flow adaptation.

Induction of the KATP channel components (KIR 6.2 and SUR) in cultured endothelial cells varied with the shear stress magnitude and duration. Whereas cells sheared at 5 and 10 dyn/cm2 for 24 h showed an increase in channel activity as indicated by patch-clamp studies, the change in electrical activity with adaptation to 1 dyn/cm2 for 72 h was not significant. On the other hand, there was a significant induction of protein expression at the lower level of shear stress. Because an increase in channel protein expression, as well as activity, was observed at the higher shear values of 5 and 10 dyn/cm2, it is possible that the discrepancy between the channel expression and activity at the low shear (1 dyn/cm2) arises from inadequate channel assembly. We speculate that because KATP channel activity requires a 1:1 stoichiometry of SUR and KIR 6.2 subunits, the induction of the subunits at lower shear stress does not generate the appropriate stoichiometry, resulting in a channel with lower activity. Mismatched stoichiometry has been reported to result in loss of KATP channel activity in transgenic mice (21).

Direct fluorescence studies in real time showed that flow adaptation is required for the membrane depolarization response with stop of flow and that this response can be prevented with KATP channel agonists. These results point to a role for this channel in the depolarization response with abrupt changes in shear. Abrogation of this response when cells were flow adapted in the presence of the cycloheximide, a blocker of protein synthesis, indicates that the depolarization response does not occur in the absence of increased protein expression.

Shear stress is widely accepted as a regulator of cytoskeletal organization and of cellular components such as G protein-coupled receptors, caveolae, integrins, focal adhesion kinases, and mitogen-activated receptors (11, 12, 13, 14, 16, 22, 33, 35). Our results demonstrate that shear stress also regulates KATP channel expression and activity in RPMVEC and BPAEC. Regulation likely occurs via shear stress-sensitive elements that induce gene expression because the mRNA for KIR 6.2 was increased. Shear is known to induce the transcription of some endothelial genes (23), including platelet-derived growth factor-B (PDGF-B) (29), monocyte chemotactic protein-1 (MCP-1) (30), and intercellular adhesion molecule-1 (ICAM-1) (25). Recent evidence indicates that genes regulated by shear stress respond to a shear stress response element (SSRE) defined as GAGACC (7). Our inspection of the KIR 6.2 gene (8) indicates a GAGACC sequence in the promoter region that could be the site for attachment of transcription factors. However, the mechanism for activation of the shear stress-dependent response of the KATP channel is not clear. Possibly cytoskeletal molecules such as lipid domains (caveolae or rafts), focal adhesion complexes, integrins, or the K+ channel itself might sense the change in flow, resulting in transcription factor activation.


    DISCLOSURES
 
This work was supported by National Heart, Lung, and Blood Institute Grants HL-60290 and HL-64388 and American Heart Association Scientist Development Grant 01302S4N.


    ACKNOWLEDGMENTS
 
We thank Dr. Yefim Manevich for advice concerning measurement of membrane potential with fluorescent dye, Dr. Zhihua Wei for advice regarding use of the artificial capillary chambers, and Kris DeBolt for assistance with endothelial cell culture.

Present address of Abu-Bakr Al-Mehdi: Dept. of Pharmacology, University of South Alabama, Mobile, AL.

This work has been presented in part at the Experimental Biology meetings in April 2000 (San Diego, CA), April 2001 (Orlando, FL), and April 2002 (New Orleans, LA), at the International Union of Physiological Sciences meeting in Christchurch, NZ, in August 2001 and at the American Thoracic Society meeting in Seattle, WA, on May 23, 2003.


    FOOTNOTES
 

Address for reprint requests and other correspondence: A. B. Fisher, Institute for Environmental Medicine, Univ. of Pennsylvania School of Medicine, 1 John Morgan Bldg., 3620 Hamilton Walk, Philadelphia, PA 19104-6068 (E-mail: abf{at}mail.med.upenn.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
1. Al-Mehdi AB, Shuman H, and Fisher AB. Oxidant generation with K+-induced depolarization in the isolated perfused lung. Free Radic Biol Med 23: 47-56, 1997.[Web of Science][Medline]

2. Al-Mehdi AB, Shuman H, and Fisher AB. Intracellular generation of reactive oxygen species during nonhypoxic lung ischemia. Am J Physiol Lung Cell Mol Physiol 272: L294-L300, 1997.[Abstract/Free Full Text]

3. Al-Mehdi AB, Song C, Tozawa K, and Fisher AB. Ca2+- and phosphatidylinositol 3-kinase-dependent nitric oxide generation in lung endothelial cells in situ with ischemia. J Biol Chem 275: 39807-39810, 2000.[Abstract/Free Full Text]

4. Al-Mehdi AB, Zhao G, Dodia C, Tozawa K, Costa K, Muzykantov V, Ross C, Blecha F, Dinauer M, and Fisher AB. Endothelial NADPH oxidase as the source of oxidants in lungs exposed to ischemia or high K+. Circ Res 83: 730-737, 1998.[Abstract/Free Full Text]

5. Al-Mehdi AB, Zhao G, and Fisher AB. ATP-independent membrane depolarization with ischemia in the oxygen-ventilated isolated rat lung. Am J Respir Cell Mol Biol 18: 653-661, 1998.[Abstract/Free Full Text]

6. Al-Mehdi AB, Zhao G, Tozawa K, and Fisher AB. Depolarization-associated iron release with abrupt reduction in pulmonary endothelial shear stress in situ. Antioxid Redox Signal 2: 335-345, 2000.[Medline]

7. Ando J and Kamiya A. Flow-dependent regulation of gene expression in vascular endothelial cells. Jpn Heart J 37: 19-32, 1996.[Medline]

8. Ashfield R and Ashcroft SJH. Cloning of the promoters for the {beta}-cell ATP-sensitive K-channel subunits KIR 6.2 and SUR1. Diabetes 47: 1274-1280, 1998.[Abstract]

9. Barakat AI. Responsiveness of vascular endothelium to shear stress: potential role of ion channels and cellular cytoskeleton. Int J Mol Med 4: 323-332, 1999.[Web of Science][Medline]

10. Barakat AI, Leaver EV, Pappone PA, and Davies PF. A flow-activated chloride selective membrane current in vascular endothelial cells. Circ Res 85: 820-828, 1999.[Abstract/Free Full Text]

11. Davies PF. Flow mediated endothelial mechanotransduction. Physiol Rev 75: 519-560, 1995.[Abstract/Free Full Text]

12. Davies PF, Barbee KA, Volin MV, Robotewskyj A, Chen J, Joseph L, Griem ML, Wernick MN, Jacobs E, Polacek DC, Depaola N, and Barakat AI. Spatial relationships in early signaling events of the flow-mediated endothelial mechanotransduction. Annu Rev Physiol 59: 527-549, 1997.[Web of Science][Medline]

13. Dewey CF Jr, Bussolari SR, Gimbrone MA Jr, and Davies PF. The dynamic response of the vascular endothelial cells to fluid shear stress. J Biomech Eng 103: 177-185, 1981.[Web of Science][Medline]

14. Fisher AB, Chien S, Barakat AI, and Nerem RM. Endothelial cellular response to altered shear stress. Am J Physiol Lung Cell Mol Physiol 281: L529-L533, 2001.[Abstract/Free Full Text]

15. Giblin JP, Leaney JL, and Tinker A. The molecular assembly of ATP-sensitive potassium channels. J Biol Chem 274: 22652-22659, 1999.[Abstract/Free Full Text]

16. Gudi S, Nolan JP, and Frangos JA. Modulation of GTPase activity of G proteins by fluid shear stress and phospholipid composition. Proc Natl Acad Sci USA 95: 2515-2519, 1998.[Abstract/Free Full Text]

17. Hamill OP, Marty A, Neher E, Sakmann B, and Sigworth FJ. Improved patch clamp techniques for high resolution current recording from cells and cell-free membrane patches. Pflügers Arch 391: 85-100, 1981.[Web of Science][Medline]

18. Jacobs ER, Cheliakine C, Gebremedhin D, Birks EK, Davies PF, and Harder DR. Shear activated channels in cell-attached patches of cultured bovine aortic endothelial cells. Pflügers Arch 431: 129-131, 1995.[Web of Science][Medline]

19. Janigro D, West GA, Gordon EL, and Winn HR. ATP-sensitive K+ channels in rat aorta and brain microvascular endothelial cells. Am J Physiol Cell Physiol 265: C812-C821, 1993.[Abstract/Free Full Text]

20. Katnik C and Adams DJ. An ATP-sensitive potassium conductance in rabbit arterial endothelial cells. J Physiol 485: 595-606, 1995.[Abstract/Free Full Text]

21. Koster JC, Knopp A, Flagg TP, Markova KP, Sha Q, Enkvetchakul D, Betsuyaku T, Yamada KA, and Nichols CG. Tolerance for ATP-insensitive KATP channels in transgenic mice. Circ Res 89: 1022-1029, 2001.[Abstract/Free Full Text]

22. Malek AM and Izumo S. Molecular aspects of signal transduction of shear stress in the endothelial cell. J Hypertens 12: 989-999, 1994.[Web of Science][Medline]

23. Malek AM and Izumo S. Control of endothelial gene expression by flow. J Biomech 28: 1515-1528, 1995.[Web of Science][Medline]

24. Manevich Y, Al-Mehdi AB, Muzykantov V, and Fisher AB. Oxidative burst and NO generation as the initial response to "ischemia" in flow-adapted endothelial cells. Am J Physiol Heart Circ Physiol 280: H2126-H2135, 2001.[Abstract/Free Full Text]

25. Nagel T, Resnick N, Atkinson WJ, Dewey CF Jr, and Gimbrone MA Jr. Shear stress selectively upregulates intracellular adhesion molecule-1 expression in cultured human vascular endothelial cells. J Clin Invest 94: 885-891, 1994.[Web of Science][Medline]

26. Nerem RM, Levesque MJ, and Cornhill JF. Vascular endothelial morphology as an indicator of the pattern of blood flow. J Biomech Eng 103: 172-176, 1981.[Web of Science][Medline]

27. Olesen SP, Clapham DE, and Davies PF. Haemodynamic shear stress activates a K current in vascular endothelial cells. Nature 331: 168-170, 1988.[Medline]

28. Resnick N and Gimbrone MA Jr. Hemodynamic forces are complex regulators of endothelial gene expression. FASEB J 9: 874-882, 1995.[Abstract]

29. Resnick N, Yahav H, Khachigian LM, Collins T, Anderson KR, Dewey FC, and Gimbrone MA Jr. Endothelial gene regulation by laminar shear stress. Adv Exp Med Biol 430: 155-164, 1997.[Web of Science][Medline]

30. Shyy YJ, Hsieh HJ, and Usami S, Chien S. Fluid shear stress induces a biphasic response of human monocyte chemotactic protein 1 gene expression in vascular endothelium. Proc Natl Acad Sci USA 91: 4678-4682, 1994.[Abstract/Free Full Text]

31. Song C, Al-Mehdi AB, and Fisher AB. An immediate endothelial cell signaling response to lung ischemia. Am J Physiol Lung Cell Mol Physiol 281: L993-L1000, 2001.[Abstract/Free Full Text]

32. Stevens T, Creighton J, and Thompson WJ. Control of cAMP in lung endothelial cell phenotypes. Am J Physiol Lung Cell Mol Physiol 277: L119-L126, 1999.[Abstract/Free Full Text]

33. Suvatne J, Barakat AI, and O'Donnell ME. Flow-induced expression of endothelial Na-K-Cl cotransport: dependence on K+ and Cl- channels. Am J Physiol Cell Physiol 280: C216-C227, 2001.[Abstract/Free Full Text]

34. Tozawa K, Al-Mehdi AB, Muzykantov V, and Fisher AB. In situ imaging of intracellular calcium with ischemia in lung subpleural microvascular endothelial cells. Antioxid Redox Signal 1: 145-154, 1999.[Medline]

35. Traub O and Berk BC. Laminar shear stress: mechanisms by which endothelial cells transduce an atheroprotective force. Arterioscler Thromb Vasc Biol 18: 677-685, 1998.[Abstract/Free Full Text]

36. Wei Z, Al-Mehdi AB, and Fisher AB. Signaling pathway for nitric oxide generation with simulated ischemia in flow-adapted endothelial cells. Am J Physiol Heart Circ Physiol 281: H2226-H2232, 2001.[Abstract/Free Full Text]

37. Wei Z, Costa K, Al-Mehdi AB, Dodia C, Muzykantov V, and Fisher AB. Simulated ischemia in flow-adapted endothelial cells leads to generation of reactive oxygen species and cell signaling. Circ Res 85: 682-699, 1999.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Physiol. Rev.Home page
J.-L. Balligand, O. Feron, and C. Dessy
eNOS Activation by Physical Forces: From Short-Term Regulation of Contraction to Chronic Remodeling of Cardiovascular Tissues
Physiol Rev, April 1, 2009; 89(2): 481 - 534.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
X. F. Figueroa and B. R. Duling
Dissection of two Cx37-independent conducted vasodilator mechanisms by deletion of Cx40: electrotonic versus regenerative conduction
Am J Physiol Heart Circ Physiol, November 1, 2008; 295(5): H2001 - H2007.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
P. Philip-Couderc, N. I. Tavares, A. Roatti, R. Lerch, C. Montessuit, and A. J. Baertschi
Forkhead Transcription Factors Coordinate Expression of Myocardial KATP Channel Subunits and Energy Metabolism
Circ. Res., February 1, 2008; 102(2): e20 - e35.
[Abstract] [Full Text] [PDF]


Home page
JGPHome page
J. Ledoux, A. D. Bonev, and M. T. Nelson
Ca2+-activated K+ Channels in Murine Endothelial Cells: Block by Intracellular Calcium and Magnesium
J. Gen. Physiol., January 28, 2008; 131(2): 125 - 135.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
T. Milovanova, S. Chatterjee, Y. Manevich, I. Kotelnikova, K. DeBolt, M. Madesh, J. S. Moore, and A. B. Fisher
Lung endothelial cell proliferation with decreased shear stress is mediated by reactive oxygen species
Am J Physiol Cell Physiol, January 1, 2006; 290(1): C66 - C76.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
Q. Zhang, I. Matsuzaki, S. Chatterjee, and A. B. Fisher
Activation of endothelial NADPH oxidase during normoxic lung ischemia is KATP channel dependent
Am J Physiol Lung Cell Mol Physiol, December 1, 2005; 289(6): L954 - L961.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
I. Matsuzaki, S. Chatterjee, K. DeBolt, Y. Manevich, Q. Zhang, and A. B. Fisher
Membrane depolarization and NADPH oxidase activation in aortic endothelium during ischemia reflect altered mechanotransduction
Am J Physiol Heart Circ Physiol, January 1, 2005; 288(1): H336 - H343.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
M.W. Broadhead, R.K. Kharbanda, M.J. Peters, and R.J. MacAllister
KATP Channel Activation Induces Ischemic Preconditioning of the Endothelium in Humans In Vivo
Circulation, October 12, 2004; 110(15): 2077 - 2082.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
C. M. Waters
Reactive oxygen species in mechanotransduction
Am J Physiol Lung Cell Mol Physiol, September 1, 2004; 287(3): L484 - L485.
[Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
D. K. Lieu, P. A. Pappone, and A. I. Barakat
Differential membrane potential and ion current responses to different types of shear stress in vascular endothelial cells
Am J Physiol Cell Physiol, June 1, 2004; 286(6): C1367 - C1375.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/4/C959    most recent
00511.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (28)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chatterjee, S.
Right arrow Articles by Fisher, A. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chatterjee, S.
Right arrow Articles by Fisher, A. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the American Physiological Society.