|
|
||||||||
MUSCLE CELL BIOLOGY AND CELL MOTILITY
1University of California, Irvine, California 92697-4560; and 2University of Colorado, Boulder, Colorado 80304
Submitted 4 February 2003 ; accepted in final form 22 May 2003
| ABSTRACT |
|---|
|
|
|---|
140-160%
increase (P < 0.0001) in IGF-I pre-mRNA (a transcriptional
marker). IGF-I mRNA expression also increased by
90% (P <
0.0001), and it was correlated (R = 0.93; P < 0.0001)
with the pre-mRNA increases. The three longest IGF-I exon 1 promoters induced
reporter gene expression in proliferating C2C12 and L6E9
myoblasts. In differentiated L6E9 myotubes, promoter activity increased
approximately two- to threefold over myoblasts. Overexpression of calcineurin
and MyoD increased the activity of the -852/+192 promoter in
C2C12 myotubes by
5- and
18-fold,
respectively. However, FO did not induce these exogenous promoter fragments.
Nevertheless, the present findings are consistent with the hypothesis that the
IGF-I gene is transcriptionally regulated during muscle hypertrophy in vivo as
evidenced by the induction of the endogenous IGF-I pre-mRNA during plantaris
FO. The exon 1 promoter region of the IGF-I gene is sufficient to direct
inducible expression in vitro; however, an in vivo response to FO may require
elements outside the -852/+346 region of the exon 1 IGF-I promoter or features
inherent to the endogenous IGF-I gene. muscle fiber; hypertrophy; functional overload; transcription factor; myogenic regulatory factor; pre-messenger ribonucleic acid; myotube
The human and rat IGF-I genes (Fig. 1A) consist of six exons, with distinct promoter regions regulating transcription initiation for both exons 1 and 2 (17). Exons 1 and/or 2 encode untranslated alternate leader sequences, whereas exons 3 and 4 encode the mature peptide domains A, B, C, and D. Exon 4 also encodes a small portion of an extension (E) domain that serves as a signaling peptide, whereas exons 5 and 6 each encode alternate E domains (35). Circulating IGF-I in adult rats is primarily synthesized in the liver, with hepatic transcription initiated by both exon 1 and 2 promoters (30). In contrast, local IGF-I transcription appears to be regulated by the exon 1 promoter in most other tissues, including skeletal muscle (17, 30).
|
The structure of the proximal exon 1 promoter
(Fig. 1) reveals the complexity
of the rat IGF-I gene, which lacks typical promoter regulatory elements such
as TATA boxes, CCAAT boxes, and GC-rich regions
(17,
34). Adding further to this
complexity, previous in vitro studies have identified two major and two minor
exon 1 transcription start sites (TSS) in the
0.36-kb promoter region
located within exon 1 (34).
TSS 3 was identified as the primary TSS in several types of nonmuscle cells in
vitro, because deletion of this site caused an
1.5- to 9-fold decrease in
promoter activity (34).
Moreover, ribonuclease protection assays indicate that TSS 3 also appears to
be the main TSS in skeletal muscle
(17).
Given the absence of any previous information showing that transcription controls the elevated IGF-I mRNA and protein during muscle overload, the first aim of the present study was to test the hypothesis that IGF-I induction during muscle overload is transcriptionally regulated. We hypothesized that muscle IGF-I pre-mRNA (the primary product of transcription) levels would increase in 7-day FO rat plantaris muscles, because this time point (7 days) was previously reported as the peak elevation for muscle IGF-I mRNA and protein (6). The second aim was to characterize the promoter region(s) regulating transcription of IGF-I in skeletal muscle. To achieve this aim, we investigated the activity of different-length exon 1 promoter fragments in muscle cells both in vitro and in vivo with reporter gene assay technology.
| METHODS |
|---|
|
|
|---|
121 ± 10 g body wt; n = 3-10
rats/group) by surgical ablation of the gastrocnemius and soleus muscles
(10). The nonoperated right
plantaris served as the control (Con). IGF-I exon 1 promoter activity was
tested by injection of promoter-reporter plasmids into the FO and Con
plantaris muscles with a 29-gauge needle attached to a 0.5-ml insulin syringe.
Plasmids were injected in Con and FO plantaris immediately before the FO
ablation surgery. For the Con plantaris, a skin incision was made to access
the plantaris muscle. Plasmid mixtures consisted of the rat IGF-I exon 1 test
promoter (molar equivalent to 10 µg of -852/+346 IGF-I pGL3 promoter
construct) and a fixed amount (3.29 µg) of the human skeletal
-actin
reference promoter construct (HSA2000-pRL) in 20 µl of sterile
phosphate-buffered saline (PBS). To further enhance plasmid uptake after
injection, the plantaris was electroporated (4 pulses at 200 V/cm, 50 ms each,
1 Hz, followed by 4 identical pulses in reverse polarity) with two gold-plated
electrodes set 4 mm apart and placed on the injection site
(23). After 7 days of FO, rats
were euthanized with pentobarbital sodium (100 mg/kg) and plantaris muscles
were dissected, trimmed of excessive connective tissue, quick frozen, and
stored at -80°C until analysis. All procedures involving rats were
approved by the University's internal review board.
Plasmid constructs. The initial IGF-I promoter sequence (see
Fig. 1B) was a gift
from Dr. Peter Rotwein (Oregon Health Sciences University, Portland, OR) and
consisted of the rat exon 1 IGF-I promoter encompassing -852 to +346 bp [+1 is
the first TSS as identified by Adamo et al.
(3)]. This promoter sequence
was linked to a firefly luciferase (FLuc) reporter gene in the pGL3 basic
vector (Promega) with standard cloning techniques. Deletion fragments of the
5' and/or 3' ends were produced from this longest fragment by
using high-fidelity PCR to generate specific promoter fragments that were
subcloned into the pGL3 basic plasmid at unique restriction enzyme sites in
the multicloning site upstream of the FLuc reporter gene
(Fig. 1B). In
addition, a 5.5-kb IGF-I minigene
(11) [obtained from Dr. Martin
Adamo (University of Texas Health Science Center, San Antonio) and courtesy of
Dr. William Lowe (Northwestern University Medical School, Chicago, IL)]
containing 412 bp of the region upstream from TSS 1 and exons 1 and 2 and a
portion of exon 3 plus introns 1 and 2 inserted into pGL3 also was
investigated (Fig.
1A). The -852/+346 bp, -852/+192 bp, -250/+192 bp,
-250/+64 bp, and minigene IGF-I promoter pGL3 constructs were individually
tested in a series of separate experiments. For in vivo experiments, a
coinjected reference promoter consisted of the human skeletal
-actin
promoter (a kind gift from Dr. Steven Swoap, Williams College, Williamstown,
MA) extending from -2000 to +250 bp relative to the TSS
(26) and linked to the
Renilla luciferase (RLuc) reporter gene in the pRL vector (Promega).
The IGF-I promoter activity in Con and FO plantaris was expressed relative to
the activity of a promoterless pGL3 basic plasmid.
In vivo reporter expression assays. Each plantaris was homogenized in 1.5 ml of ice-cold passive lysis buffer (Promega) supplemented with protease inhibitors [0.2 mM 4-(2-aminoethyl)-benzenesulfonyl fluoride, 5 µg/ml aprotinin, and 5 µg/ml leupeptin] made in nuclease-free deionized water. A 250-µl aliquot of this homogenate was immediately mixed with 750 µl of TRI-LS reagent (Molecular Research Center) and stored at -80°C for RNA extraction. The remaining homogenate was centrifuged at 10,000 g for 10 min at 4°C. The supernatant was decanted and used to measure reporter gene activity with the Promega Dual Luciferase Assay kit, which is designed for detection of both FLuc and RLuc activities from a single sample. Five microliters of supernatant was used in the assay to measure light output integrated over 10 s with a luminometer (Analytical Luminescence) and expressed as relative light units (RLUs). Background activity was determined from noninjected normal muscle extracts and was subtracted from the activity of plasmid-injected muscles.
Pre-mRNA and mRNA analyses. Total RNA was extracted from 250 µl
of total muscle homogenate with TRI-LS reagent according to the supplied
procedure (Molecular Research Center). The RNA pellet was suspended in
nuclease-free water and treated with DNase I according to the supplier's
(Invitrogen) recommendation to remove any genomic DNA contamination. After
DNase I treatment, RNA concentration was determined by ultraviolet light (UV)
absorbance at 260 nm. One microgram of RNA was reverse transcribed in twenty
microliters of total volume with Superscript II (Invitrogen) and a primer mix
consisting of oligo(dT) (100 ng/µl) and random decamers (200 ng/µl)
according to the supplier's (Invitrogen) recommendation. PCR amplification to
detect IGF-I pre-mRNA used 1 µl of cDNA amplified for 30 cycles. Two
separate sets of IGF-I pre-mRNA PCR primers
55 kb apart were designed to
distinguish between transcripts either near transcription initiation
(exon/intron 1 primers) or as elongation proceeded (exon/intron 3 primers).
Primers designated as I1 produced a 363-bp PCR product with the following
primers: a forward primer based on exon 1 sequence, TGCGCAATCGAAATAAAGTCCTCA,
and a reverse primer complementary to the sequence from intron 1 of the IGF-I
gene, AGCTCCCACAGAACCGCACATT. Primers designated as I3 produced a 295-bp PCR
product with the following primers: a forward primer based on exon 3 sequence,
ACAGACGGGCATTGTGGATGA, and a reverse primer complementary to sequence from
intron 3 of the IGF-I gene, TTGGAAGGGTGGACCCATAAGC. Furthermore, additional
primers were designed to evaluate initiation at TSS 2 and TSS 3 as identified
by Adamo et al. (1). For TSS 2,
the forward primer was TGTTCCCCCAGCTGTTTCCTGTCT and resided between TSS 2 and
TSS 3 on exon 1, with the reverse primer complementary to the sequence from
exon 3, CACTCATCCACAATGCCCGTCTGT, to produce a 539-bp PCR product. In
combination with this same exon 3 reverse primer, another exon 1 forward
primer distal to TSS 3, GCCTGCGCAATCGAAATAAAGTCC, was used to detect a 417-bp
mRNA transcript from combined TSS 2 and TSS 3.
PCR reactions to determine IGF-I mRNA used 0.1 µl of cDNA amplified for 25 cycles to produce a 202-bp product with the following primers: a forward primer derived from exon 3 sequence, GCATTGTGGATGAGTGTTGC, and a reverse primer complementary to exon 5 sequence, GGCTCCTCCTACATTCTGTA. The PCR reaction mixture consisted of 1x PCR buffer, 0.5 µl of 10 mM dNTP, 0.75 µl of 50 mM MgCl2, 3 µl of 5' + 3' IGF-I primers at 5 pmol/µl, 0.15 µl of Biolase DNA polymerase (Bioline), and water to a final volume of 25 µl. Amplification was performed by using a Stratagene thermocycler with an initial denaturization step of 3 min at 96°C followed by 25 or 30 cycles of 1 min at 96°C, 45 s at 58°C, and 45 s at 72°C. The final elongation step was 3 min at 72°C. All samples were run in duplicate, and PCR products were separated on 2% agarose gels and stained with ethidium bromide. Pictures were taken in UV conditions with Polaroid 55 film, negatives were scanned (Molecular Dynamics densitometer), and band intensity was measured by volume integration with Image Quant 5.0 software (Molecular Dynamics). All PCR primers were designed with sequence data from rat GenBank accession no. NW044015, with the IGF-I gene located between positions 1,109,034 and 1,183,518.
Myoblast cell culture: cell culture and transfections. Mouse C2C12 myoblasts and rat L6E9 myoblasts were obtained from American Type Culture Collection (Rockville, MD). Primary mouse muscle fibroblasts were isolated from adult mouse skeletal muscle with standard techniques. Briefly, adult C57 male mice were killed by cervical dislocation and the thigh and calf muscles were isolated, minced, and placed in ice-cold Dulbecco's modified Eagle's medium (DMEM; GIBCO). The muscle fragments were digested with 0.01% trypsin and 0.5% collagenase type IV for 3 x 10 min. The fragments were triturated by pipetting up and down 20-30 times and then filtered through a 40-µm mesh (Becton Dickinson). The resulting suspension was centrifuged for 5 min at 500 g, and the pellet was resuspended in fresh growth medium consisting of DMEM plus 10% fetal bovine serum (FBS; Hyclone) and preplated on uncoated 10-cm dishes for 30 min at 37°C. These cells, which were enriched for fibroblasts, were grown to near confluence and then passaged two or three times to allow fibroblasts to proliferate. At this stage >99% of the cells were nonmyogenic as determined by staining for the muscle-specific intermediate filament protein desmin (data not shown).
Transfections for all three cell types were carried out under identical
conditions. An aliquot of cells was thawed, grown to
80% confluence, and
then passaged (1/4 for C2C12 cells, 1/3 for L6E9 cells,
and 1/2.5 for fibroblasts) onto 0.5% gelatin-coated 24-well tissue culture
plates. The following day (
80% confluence) the cells were transfected
with Lipofectamine 2000 reagent (Invitrogen) per the manufacturer's
instructions. Briefly, 2.0 µl of Lipofectamine 2000 and 0.8 µg of total
DNA per well were diluted in 50 µl each of DMEM without
penicillin-streptomycin, allowed to complex for 20 min, and added to the
wells. In addition to the IGF-I promoter constructs, other cultures were
transfected with an embryonic myosin heavy chain (MHC) promoter-reporter
construct as a positive control. The following day,
C2C12 and L6E9 myoblasts and 1-day transfected primary
fibroblasts were harvested by removing the medium, rinsing with PBS, and
scraping them into 100 µl of 1x passive lysis buffer (Promega). At
this point, C2C12 and L6E9 myoblasts were placed in
differentiation medium consisting of DMEM plus 1% horse serum (GIBCO),
differentiated for 2 days, and harvested as described for myoblasts. For
cotransfections, equal amounts of IGF-I promoter construct plasmid DNA and
constructs overexpressing specific signaling molecules or transcription
factors were added to the cells. The following genes were used for
cotransfections, and overexpression was driven by a cytomegalovirus (CMV)
promoter unless noted otherwise: MyoD, which was driven by the RSV promoter;
serum response factor (SRF); myocyte enhancer factor-2C (MEF-2C); a
constitutively active nuclear form of the nuclear factor-activator of T cells
(NF-AT) of transcription 3 gene (NFAT3); GATA-4; MEKK1; constitutively active
calcineurin; focal adhesion kinase (FAK); and FAK-related nonkinase (FRNK), a
dominant-negative inhibitor of FAK activity. These constructs were described
previously (8). The FAK and
FRNK constructs were kindly provided by Dr. David Schlaepfer (Scripps Research
Institute, San Diego, CA); the MEKK1 was purchased from Stratagene; all others
were kindly provided by Dr. Eric Olson (University of Texas-Dallas
Southwestern Medical Center). All cell culture experiments were replicated
three or four times in quadruplicate wells. Ten microliters of cell homogenate
was used to assay for FLuc activity with the Promega luciferase kit. In all
experiments, a promoterless pGL3 basic construct was also transfected into an
equal amount of wells and all IGF-I luciferase values were normalized to pGL3
basic luciferase values to generate the fold difference between the IGF-I
promoter-containing constructs and the promoterless pGL3 basic construct. To
control for potential effects of the cotransfection, such as promoter
interference, a CMV-
-galactosidase promoter-reporter plasmid construct
also was cotransfected with the IGF-I promoter construct. These control
experiments found no adverse effects of CMV-
-galactosidase
cotransfection on the IGF-I promoter activity, which was approximately one- to
twofold and approximately fivefold above the promoterless pGL3 in myoblasts
and myotubes, respectively, and thus essentially identical to the IGF-I
promoter-only transfection condition (see
Fig. 4).
|
Statistical analysis. IGF-I pre-mRNA and mRNA levels were each
compared between Con and FO groups by paired t-tests. In addition,
the percent increases of FO plantaris from Con plantaris were calculated with
the respective mean Con value and compared by a paired t-test. The
fold activation of the IGF-I promoter (i.e., FLuc activity) and the ratio of
IGF-I to
-actin (i.e., FLuc:RLuc activities) were calculated relative
to the mean values from the promoterless (basic) pGL3 experiment and compared
among the different IGF-I promoter-reporter construct experiments with ANOVA
and Fisher's post hoc test. For cell culture, the fold activity of the IGF-I
promoter constructs relative to promoterless pGL3 were compared by ANOVA and
Fisher's post hoc test. P < 0.05 was considered significant. Data
are reported as means ± SE. Statistical analyses were performed with
Stat-view (SPSS) or Prism3 (GraphPad) software.
| RESULTS |
|---|
|
|
|---|
0.05) increase in mean plantaris
muscle wet weight (mean increase 32 ± 9%) in all experiments. FO in
plantaris was associated with
140% (I1 primers) to
160% (I3 primers)
increases (P < 0.0001) in IGF-I pre-mRNA expression and an
90% increase (P < 0.0001) in IGF-I mRNA expression as
determined by semiquantitative RT-PCR (Fig.
2A). The increase in IGF-I pre-mRNA (I3 primers) was
significantly greater than the increase in IGF-I mRNA (P = 0.0003).
Moreover, the relationship between pre-mRNA (I3 primers) and mRNA across the
Con and FO groups was highly correlated (R = 0.93, P <
0.0001; Fig. 2B),
indicating that increased IGF-I mRNA expression resulted from increased
pre-mRNA production rather than an increase in its stability. The similar
increases and significant correlation (R = 0.83, P <
0.0001) between IGF-I pre-mRNA detected by the I1 and I3 PCR primers indicate
that the increase in pre-mRNA in FO plantaris is due to transcription
initiation rather than elongation. Thus the induction of IGF-I mRNA in
response to FO is consistent with a transcriptional regulation. With regard to
which TSS of exon 1 is active in muscle and responsive to FO, RT-PCR analysis
with primers differentiating between TSS 2 and TSS 3 showed that TSS 3 is
15-20 times more active than TSS 2. Both TSS 2 and TSS 3 mRNA products
increased in FO plantaris (data not shown).
|
Promoter activity in cultured myocytes and muscle fibroblasts. The
shortest IGF-I promoter construct (-250/+64), which lacked the major TSS 3,
was not significantly different from the promoterless pGL3 in
C2C12 and L6E9 myoblasts and myotubes
(Fig. 3, A and
B). However, the three longer IGF-I promoter constructs
all showed significantly greater (P < 0.0001) activity than the
promoterless pGL3 plasmid in myoblasts and myotubes. The activities of these
three longer promoter constructs were approximately one- to threefold greater
than the promoterless pGL3 in mouse C2C12 cells
(Fig. 3A) and
approximately twofold greater in rat L6E9 myoblasts
(Fig. 3B). Although
IGF-I promoter activity was not significantly different between
C2C12 myoblasts and myotubes, in L6E9 cells IGF-I
promoter activity was approximately four- to sixfold above promoterless pGL3
in L6E9 myotubes compared with approximately twofold greater in myoblasts
(Fig. 3B). In
comparison, the embryonic MHC promoter activities relative to promoterless
pGL3 were
50- and 230-fold higher in proliferating myoblasts and
525- and
2,180-fold higher in differentiated myotubes in L6E9 and
C2C12 cultures, respectively.
|
Because the identity of IGF-I-expressing cells in skeletal muscle has not
been definitively established, we also examined IGF-I promoter activity in
muscle-derived fibroblasts. In fibroblasts derived from mouse skeletal
muscles, promoter activity over promoterless pGL3 at 1 day after transfection
was higher only for the -250/+192 IGF-I construct
(Fig. 3C). However, at
3 days after transfection, promoter activity was approximately two- to
fourfold higher (P
0.005) than promoterless pGL3 for the
-852/+346, -250/+192, and minigene constructs
(Fig. 3C).
We also tested whether the activity of the -852/+192 IGF-I promoter
construct in myotubes could be further induced by cotransfection with
overexpression constructs containing a variety of transcription factors and
signaling molecules associated with muscle growth and differentiation. None of
the cotransfected constructs had an effect on IGF-I promoter activity in L6E9
myotubes (Fig. 4B).
However, cotransfection of C2C12 myotubes with either
the myogenic regulatory factor MyoD or a constitutively active form of the
calcium signaling phosphatase calcineurin resulted in
5- and
18-fold
(P < 0.0001) increases in -852/+192 IGF-I promoter construct,
respectively (Fig.
4A). These data demonstrate that in
C2C12 myotubes, IGF-I promoter activity can be further
augmented by overexpression of factors associated with muscle growth and
differentiation.
In vivo promoter activity of FO plantaris. Across all experiments
in both the Con and FO groups, the FLuc reporter of IGF-I promoter activity
was very low relative to promoterless (basic) pGL3
(Fig. 5A). The lowest
promoter activity was generally observed for the shortest construct
(-192/+64), which lacked the major TSS 3, suggesting that this site is a major
TSS for skeletal muscle in vivo. Only the IGF-I minigene showed higher
(P = 0.01) basal FLuc activity than basic (promoterless) pGL3
(Fig. 5A). When
expressed relative to the coinjected
-actin promoter activity, the
IGF-I promoter activities of both the IGF-I minigene and the longest exon 1
fragment, -852/+346, were greater than the basic pGL3
(Fig. 5B). Moreover,
the ratio of IGF-I to
-actin promoter activities was similar between FO
and Con muscles for each of the constructs tested
(Fig. 5B). Thus,
although the reporter activities of the two longer IGF-I promoter fragments
were above a promoterless pGL3, their activity was not induced further in
response to FO.
|
| DISCUSSION |
|---|
|
|
|---|
140-160% increase in the
IGF-I pre-mRNA, which is the initial RNA product of gene transcription.
Moreover, the increase in pre-mRNA detected by I1 primers strongly indicates
that FO induced transcription initiation of the IGF-I gene. Prior studies
confirmed that hepatic IGF-I pre-mRNA levels reflect transcriptional activity,
as evidenced by a positive correlation between pre-mRNA levels with data
quantified from nuclear run-on assays during fasting conditions
(19), development
(20), and growth hormone
treatment (12). In the present
study, the strong positive correlation (R = 0.93, P <
0.0001) between the levels of IGF-I pre-mRNA and mRNA in Con and FO muscles
demonstrates that the alterations in IGF-I pre-mRNA and mRNA levels are
tightly linked. In this regard, the present results confirm that the increase
in local IGF-I protein expression in overloaded skeletal muscle occurs, at
least in part, by inducing transcription of IGF-I. Given that MGF is produced
by alternative splicing of the pre-mRNA, an increase in IGF-I transcription
also provides more substrate for MGF-I production, further indicating that
IGF-I transcription is essential for expression of this local stretch-induced
growth factor. Therefore, the results of the present study indicate that IGF-I
gene transcription is a key mechanism for increasing these two IGF-I protein
isoforms in overloaded muscles.
Very little information is available concerning the regulatory elements
controlling IGF-I gene expression in skeletal muscle or other tissues in vivo.
Previous attempts to identify the regulatory features of the rat IGF-I gene
promoter regions revealed the uniqueness and complexity of its structure. Two
promoter regions have been identified, each of which precedes/includes exon 1
and 2 (1). Initiation of
transcription at these distinct promoter regions gives rise to IGF-I mRNAs
with alternate untranslated leader sequences. The exon 1 promoter controls
expression in liver and in many other tissues that produce IGF-I, including
skeletal and cardiac muscle
(30). IGF-I expression
controlled by exon 2 promoter activity occurs in relatively fewer types of
tissue, but this promoter is particularly active in liver and kidney
(30). The exon 1 promoter
includes four TSS located within
0.36 kb of exon 1
(2). TSS 3 appears to be the
major site of transcription initiation in most tissues, including rat skeletal
muscles that were analyzed by ribonuclease protection assay techniques
(17,
30). The results of the
present study are consistent with TSS 3 as the most active TSS in skeletal
muscle, with TSS 2 transcripts expressed at much lower levels. However, TSS 2
and TSS 3 showed comparable increases in response to muscle overload.
We tested the activity of four IGF-I exon 1 promoter fragments that encompassed up to 1.2 kb of the regions previously shown to modulate in vitro reporter activity in various nonmuscle cells (2). In addition, we tested an IGF-I minigene that encompassed 5.5 kb of the IGF-I gene beginning at -412 bp proximal to exon 1 and continuing through the initial portion of exon 3. To gain insight into the muscle-specific regulation of these IGF-I promoter-reporter plasmids, cell culture experiments were undertaken with myocyte cell lines derived from mice (C2C12) and rats (L6E9). In both muscle cell lines, the tested IGF-I promoter activity was highest for the three constructs that included the major TSS 3 located at approximately +135 bp downstream from TSS 1 (33). Activity of the -250/+64 construct, which included only TSS 1 and 2, exhibited reporter activity similar to the basic/promoterless pGL3 control. Thus our results are consistent with TSS 3 functioning as the major TSS for cultured myoblasts. Moreover, IGF-I promoter activity increased on differentiation in the L6E9, but not C2C12, cells (Fig. 3, A and B). However, it was surprising that promoter activity did not increase further in the C2C12 myotubes because Yoshiko et al. (37) recently reported an IGF-I-dependent regulation of differentiation in C2C12 cells. The IGF-I exon 1 promoter constructs we tested apparently do not contain the regulatory region(s) of the IGF-I promoter capable of increasing the expression of the reporter gene despite the reported presence of IGF-I mRNA in proliferating C2C12 myoblasts and the further induction of IGF-I mRNA during differentiation of C2C12 myotubes (37).
To gain insight into IGF-I promoter activity in other cell types associated with skeletal muscle, primary cultures of muscle-derived fibroblasts also were transfected with the IGF-I plasmid constructs. The IGF-I promoter activity observed in fibroblasts provides several key observations. First, it shows that nonmuscle cells might also contribute to IGF-I mRNA and protein levels measured from whole muscle homogenates. Second, the findings demonstrate that the IGF-I promoter constructs are active in cells derived from primary cultures derived from skeletal muscle despite the absence of reporter activity in the in vivo muscle transfection experiments. Third, they indicate the weakness of this promoter region in yet another in vitro cell system, perhaps because critical regulatory elements are missing that are required to induce a more robust transcriptional activity across the diverse range of cell types that have been studied to date. However, we also cannot rule out the possibility that muscle-derived fibroblasts merely do not exhibit a high level of IGF-I expression.
The relatively moderate level of reporter activity in the cell culture
experiments demonstrates that the IGF-I exon 1 promoter region is a weak
promoter compared with other inducible muscle-specific genes. For example,
Allen and coworkers showed that the MHC isoform IIa promoter activity in
C2C12 myotubes can be induced
10-20-fold by
treatment with calcium ionophores
(7) and up to 200-fold by
cotransfection of constitutively active calcineurin
(8). These same investigators
also reported that overexpression of MyoD induced an
10-fold increase in
the promoter activity of the MHC IIb isoform in C2C12
myotubes (8). The approximately
one- to sixfold increase in IGF-I promoter activity we observed in myocytes
and muscle-derived fibroblasts under various conditions is, however, generally
comparable to the activities previously reported for similar IGF-I constructs
in Chinese hamster ovary (34),
osteoblasts (31), and glial,
pituitary, and ovarian tumor cells
(34). Rotwein and colleagues
(17,
21) also reported IGF-I exon 1
promoter activities similar to that of the present study for an
IGF-I-producing human neuroblastoma cell line (SK-N-MC). However, a more
recent study by Rotwein's group
(24), as well as a study by
Wang et al. (33), reported a
more robust 16- to 70-fold IGF-I promoter activity in this same cell line. The
reason for discrepancies between their earlier and more recent results in this
neuroblastoma cell line is unclear. Nevertheless, the results across the
majority of in vitro studies using transient gene transfection techniques in
multiple cell types do not demonstrate high levels of activity for the regions
of the IGF-I exon 1 promoter studied to date, and the present results are
consistent with these observations.
Several previous in vitro studies identified putative control elements in a variety of nonmuscle cell types. Potential regulatory elements within the IGF-I exon 1 promoter region include binding sites for Sp1 (38), CCAAT/enhancer-binding protein (32), GATA (33), and response elements for prostaglandin E2 (27) and cAMP (31). In the present study, cotransfecting C2C12 myotubes with plasmid vectors that overexpress common muscle signaling molecules or transcription factors showed that IGF-I promoter activity was further induced in C2C12 myotubes by either MyoD or constitutively active calcineurin (Fig. 4A). Interestingly, MyoD and calcineurin overexpression had no effect on IGF-I promoter activity in L6E9 myotubes. Each of these molecules has been investigated for its role in muscle hypertrophy and/or phenotype plasticity (6, 28). MyoD is a member of a family of DNA-binding transcription factors called myogenic regulatory factors (MRFs) that regulate muscle-specific gene transcription (8) and can control the myogenic determination and/or differentiation of myoblasts during development (9). Inspection of the IGF-I -852/+192 exon 1 fragment indicates five regions that contain the putative consensus binding sequence (CANNTG) for MRFs known as E-boxes. The results of the present study indicate that calcineurin can also induce IGF-I gene expression in C2C12 myotubes. Calcineurin is a calcium-activated phosphatase that has been shown to mediate the effects of IGF-I signaling on hypertrophy of C2C12 (29) and L6E9 myotubes (25). Thus, in the case of C2C12 myotubes, IGF-I and calcineurin may be operating in a positive feedback loop with one another such that these factors cooperatively enhance their respective roles during myotube hypertrophy. Calcineurin affects transcriptional activity via dephosphorylation of NF-AT, which can regulate transcription by binding to NF-AT response elements in target genes (28). Indeed, sequence analyses of the IGF-I -852/+192 exon 1 fragment indicates that five putative NF-AT response elements (GGAAA) reside within this region. These observations, to our knowledge, are the first insights into which regulatory factor(s) might be involved in the induction of IGF-I gene transcription in skeletal muscle.
We also tested the activity of these exon 1 IGF-I promoters in vivo by
injecting the promoter-reporter plasmids into plantaris muscles subjected to
chronic muscle overload. Only the longest IGF-I exon I promoter (-852/+346)
and minigene constructs exhibited significant reporter activity above the
promoterless control in our experimental paradigm, which significantly induces
transcription of the endogenous IGF-I gene. The inability of these IGF-I
promoter regions to drive more robust expression in vivo was not due to low
levels of plasmid uptake, because a coinjected skeletal muscle
-actin
promoter expressing the RLuc gene showed very high activity (
400-fold
higher than background) and increased by
50% in FO plantaris. In
addition, Giger et al. (15)
used the direct gene transfer approach to study regulation of the type I MHC
promoter in overloaded skeletal muscle and reported an
100-130% increase
in the type I MHC promoter activity in FO plantaris.
One possible reason for the failure of exogenous IGF-I promoter fragments to drive measurable reporter activity is that they could lack essential regulatory element(s) required for high levels of promoter activity. These elements could be located as far as several kilobases upstream or downstream of a TSS. The likelihood that control elements exist beyond the more well-characterized exon 1 promoter regions tested in the present study is supported by the inability of a previous study to identify prostaglandin A2 regulatory elements known to repress IGF-I transcription in glioma cells (13). In that study, Bui et al. (13) concluded that the prostaglandin A2 repressive element(s) extend beyond the exon 1 promoter region between -1711 to +328. The fact that even the IGF-I minigene construct was not induced by FO in the present study provides additional information that regulation of IGF-I transcription during increased muscle loading in vivo requires an even more extensive promoter region of this gene. Alternatively, the inactivity of the exogenous IGF-I promoters in muscle after direct gene transfer might be due to the fact that naked plasmid DNA lacks chromatin structural components that could be important in the recruitment of transcriptional activators necessary to drive its transcription. The endogenous gene is a constitutive component of the chromatin, which is a highly complex structure involving multiple protein-DNA dynamic interactions (14). The remodeling of chromatin structure alters the accessibility of genomic DNA to specific activators or repressors, general transcription factors, and RNA polymerase (14). This issue could be addressed if the IGF-I promoter-reporter constructs were integrated into the chromosomes such as occurs in the generation of transgenic animals.
In summary, muscle IGF-I gene expression was induced by chronic overload as evidenced by increased IGF-I pre-mRNA in the FO plantaris. The exon 1 IGF-I promoter constructs we tested showed moderate activity in myoblasts in cell culture and were inducible by overexpression of the muscle transcription factor MyoD and the calcium signaling molecule calcineurin. However, these IGF-I promoter constructs did not initiate in vivo load-stimulated reporter gene expression in overloaded muscles despite endogenous IGF-I gene transcription. This different behavior of the IGF-I promoter in vivo vs. in vitro indicates that presently unidentified regions and/or structural features of the IGF-I gene and chromosome might be required for in vivo transcription, further illustrating the complexity and uniqueness of in vivo IGF-I gene regulation.
| DISCLOSURES |
|---|
| ACKNOWLEDGMENTS |
|---|
-actin promoter. In addition, we thank Dr. Leslie Leinwand for
assistance with the in vitro experiments. | FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
2. Adamo ML, Lanau F, Neuenschwander S, Werner H, LeRoith D, and Roberts CT Jr. Distinct promoters in the rat insulin-like growth factor-I (IGF-I) gene are active in CHO cells. Endocrinology 132: 935-937, 1993.
3. Adamo ML, Neuenschwander S, LeRoith D, and Roberts CT Jr. Structure, expression, and regulation of the IGF-I gene. Adv Exp Med Biol 343: 1-11, 1993.
4. Adams GR. Role of insulin-like growth factor-I in the regulation of skeletal muscle adaptation to increased loading. Exerc Sport Sci Rev 26: 31-60, 1998.
5. Adams GR. Autocrine/paracrine IGF-I and skeletal muscle adaptation. J Appl Physiol 93: 1159-1167, 2002.
6. Adams GR, Haddad F, and Baldwin KM. Time course of changes in markers of myogenesis in overloaded rat skeletal muscles. J Appl Physiol 87: 1705-1712, 1999.
7. Allen DL and Leinwand LA. Intracellular calcium and myosin isoform transitions. Calcineurin and calcium-calmodulin kinase pathways regulate preferential activation of the IIa myosin heavy chain promoter. J Biol Chem 277: 45323-45330, 2002.
8. Allen DL, Sartorius CA, Sycuro LK, and Leinwand LA. Different pathways regulate expression of the skeletal myosin heavy chain genes. J Biol Chem 276: 43524-43533, 2001.
9. Arnold HH and Braun T. Targeted inactivation of myogenic factor genes reveals their role during mouse myogenesis: a review. Int J Dev Biol 40: 345-353, 1996.
10. Baldwin KM, Valdez V, Herrick RE, MacIntosh AM, and Roy RR. Biochemical properties of overloaded fast-twitch skeletal muscle. J Appl Physiol 52: 467-472, 1982.
11. Benbassat C, Shoba LN, Newman M, Adamo ML, Frank SJ, and Lowe WL Jr. Growth hormone-mediated regulation of insulin-like growth factor I promoter activity in C6 glioma cells. Endocrinology 140: 3073-3081, 1999.
12. Bichell DP, Kikuchi K, and Rotwein P. Growth hormone rapidly activates insulin-like growth factor I gene transcription in vivo. Mol Endocrinol 6: 1899-1908, 1992.
13. Bui T, Kuo C, Rotwein P, and Straus DS. Prostaglandin A2 specifically represses insulin-like growth factor-I gene expression in C6 rat glioma cells. Endocrinology 138: 985-993, 1997.
14. Georgel PT. Chromatin structure of eukaryotic promoters: a changing perspective. Biochem Cell Biol 80: 295-300, 2002.
15. Giger JM,
Haddad F, Qin AX, and Baldwin KM. Functional overload increases
-MHC
promoter activity in rodent fast muscle via the proximal MCAT (
e3) site.
Am J Physiol Cell Physiol 282:
C518-C527, 2002.
16. Goldspink G, Williams P, and Simpson H. Gene expression in response to muscle stretch. Clin Orthop 403: S146-S152, 2002.
17. Hall LJ, Kajimoto Y, Bichell D, Kim SW, James PL, Counts D, Nixon LJ, Tobin G, and Rotwein P. Functional analysis of the rat insulin-like growth factor I gene and identification of an IGF-I gene promoter. DNA Cell Biol 11: 301-313, 1992.
18. Hameed M, Harridge SD, and Goldspink G. Sarcopenia and hypertrophy: a role for insulin-like growth factor-1 in aged muscle? Exerc Sport Sci Rev 30: 15-19, 2002.
19. Hayden JM, Marten NW, Burke EJ, and Straus DS. The effect of fasting on insulin-like growth factor-I nuclear transcript abundance in rat liver. Endocrinology 134: 760-768, 1994.
20. Kikuchi K, Bichell DP, and Rotwein P. Chromatin changes accompany the developmental activation of insulin-like growth factor I gene transcription. J Biol Chem 267: 21505-21511, 1992.
21. Kim SW, Lajara R, and Rotwein P. Structure and function of a human insulin-like growth factor-I gene promoter. Mol Endocrinol 5: 1964-1972, 1991.
22. McKoy G, Ashley W, Mander J, Yang SY, Williams N, Russell B, and Goldspink G. Expression of insulin growth factor-1 splice variants and structural genes in rabbit skeletal muscle induced by stretch and stimulation. J Physiol 516: 583-592, 1999.
23. Mir LM, Bureau MF, Gehl J, Rangara R, Rouy D, Caillaud JM, Delaere P, Branellec D, Schwartz B, and Scherman D. High-efficiency gene transfer into skeletal muscle mediated by electric pulses. Proc Natl Acad Sci USA 96: 4262-4267, 1999.
24. Mittanck DW, Kim SW, and Rotwein P. Essential promoter elements are located within the 5' untranslated region of human insulin-like growth factor-I exon I. Mol Cell Endocrinol 126: 153-163, 1997.
25. Musaro A, McCullagh KJ, Naya FJ, Olson EN, and Rosenthal N. IGF-1 induces skeletal myocyte hypertrophy through calcineurin in association with GATA-2 and NF-ATc1. Nature 400: 581-585, 1999.
26. Muscat GE and Kedes L. Multiple 5'-flanking regions of the human alpha-skeletal actin gene synergistically modulate muscle-specific expression. Mol Cell Biol 7: 4089-4099, 1987.
27. Pash JM, Delany AM, Adamo ML, Roberts CT Jr, LeRoith D, and Canalis E. Regulation of insulin-like growth factor I transcription by prostaglandin E2 in osteoblast cells. Endocrinology 136: 33-38, 1995.
28. Schiaffino S and Serrano A. Calcineurin signaling and neural control of skeletal muscle fiber type and size. Trends Pharmacol Sci 23: 569-575, 2002.
29. Semsarian C, Wu MJ, Ju YK, Marciniec T, Yeoh T, Allen DG, Harvey RP, and Graham RM. Skeletal muscle hypertrophy is mediated by a Ca2+-dependent calcineurin signalling pathway. Nature 400: 576-581, 1999.
30. Shemer J, Adamo ML, Roberts CT Jr, and LeRoith D. Tissue-specific transcription start site usage in the leader exons of the rat insulin-like growth factor-I gene: evidence for differential regulation in the developing kidney. Endocrinology 131: 2793-2799, 1992.
31. Thomas MJ, Umayahara Y, Shu H, Centrella M, Rotwein P, and McCarthy TL. Identification of the cAMP response element that controls transcriptional activation of the insulin-like growth factor-I gene by prostaglandin E2 in osteoblasts. J Biol Chem 271: 21835-21841, 1996.
32. Umayahara Y, Ji C, Centrella M, Rotwein P, and McCarthy TL. CCAAT/enhancer-binding protein delta activates insulin-like growth factor-I gene transcription in osteoblasts. Identification of a novel cyclic AMP signaling pathway in bone. J Biol Chem 272: 31793-31800, 1997.
33. Wang L, Wang X, and Adamo ML. Two putative GATA motifs in the proximal exon 1 promoter of the rat insulin-like growth factor I gene regulate basal promoter activity. Endocrinology 141: 1118-1126, 2000.
34. Wang X, Yang Y, and Adamo ML. Characterization of the rat insulin-like growth factor I gene promoters and identification of a minimal exon 2 promoter. Endocrinology 138: 1528-1536, 1997.
35. Yang S, Alnaqeeb M, Simpson H, and Goldspink G. Cloning and characterization of an IGF-1 isoform expressed in skeletal muscle subjected to stretch. J Muscle Res Cell Motil 17: 487-495, 1996.
36. Yang SY and Goldspink G. Different roles of the IGF-I Ec peptide (MGF) and mature IGF-I in myoblast proliferation and differentiation. FEBS Lett 522: 156-160, 2002.
37. Yoshiko Y, Hirao K, and Maeda N. Differentiation in C2C12 myoblasts depends on the expression of endogenous IGFs and not serum depletion. Am J Physiol Cell Physiol 283: C1278-C1286, 2002.
38. Zhu JL, Kaytor EN, Pao CI, Meng XP, and Phillips LS. Involvement of Sp1 in the transcriptional regulation of the rat insulin-like growth factor-1 gene. Mol Cell Endocrinol 164: 205-218, 2000.
This article has been cited by other articles:
![]() |
M. Sandri Signaling in Muscle Atrophy and Hypertrophy Physiology, June 1, 2008; 23(3): 160 - 170. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Deldicque, D. Theisen, L. Bertrand, P. Hespel, L. Hue, and M. Francaux Creatine enhances differentiation of myogenic C2C12 cells by activating both p38 and Akt/PKB pathways Am J Physiol Cell Physiol, October 1, 2007; 293(4): C1263 - C1271. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Fernandez, S. Fernandez, P. Carrero, M. Garcia-Garcia, and I. Torres-Aleman Calcineurin in Reactive Astrocytes Plays a Key Role in the Interplay between Proinflammatory and Anti-Inflammatory Signals J. Neurosci., August 15, 2007; 27(33): 8745 - 8756. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Alfieri, H. J. Evans-Anderson, and K. E. Yutzey Developmental regulation of the mouse IGF-I exon 1 promoter region by calcineurin activation of NFAT in skeletal muscle Am J Physiol Cell Physiol, May 1, 2007; 292(5): C1887 - C1894. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. McLellan, T. Kealey, and K. Langlands An E box in the exon 1 promoter regulates insulin-like growth factor-I expression in differentiating muscle cells Am J Physiol Cell Physiol, August 1, 2006; 291(2): C300 - C307. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Goldspink Mechanical Signals, IGF-I Gene Splicing, and Muscle Adaptation Physiology, August 1, 2005; 20(4): 232 - 238. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. J. Caiozzo, Y. Z. Wu, M. J. Baker, and R. Crumley Effects of Denervation on Cell Cycle Control in Laryngeal Muscle Arch Otolaryngol Head Neck Surg, September 1, 2004; 130(9): 1056 - 1068. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |