Am J Physiol Cell Physiol Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 285: C161-C170, 2003. First published March 19, 2003; doi:10.1152/ajpcell.00416.2002
0363-6143/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/1/C161    most recent
00416.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (21)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Boland, L. M.
Right arrow Articles by O'Grady, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boland, L. M.
Right arrow Articles by O'Grady, S. M.

MEMBRANE TRANSPORTERS, ION CHANNELS, AND PUMPS

Functional properties of a brain-specific NH2-terminally spliced modulator of Kv4 channels

Linda M. Boland,1 Min Jiang,2 So Yeong Lee,3,4 Scott C. Fahrenkrug,4 Mark T. Harnett,1 and Scott M. O'Grady3,4

1Department of Neuroscience, University of Minnesota, Minneapolis, Minnesota 55455; 2Department of Physiology, Virginia Commonwealth University, Richmond, Virginia 23298; and Departments of 3Physiology and 4Animal Science, University of Minnesota, St. Paul, Minnesota

Submitted 9 September 2002 ; accepted in final form 17 March 2003


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Kv4/K channel-interacting protein (KChIP) potassium channels are a major class of rapidly inactivating K channels in brain and heart. Considering the importance of alternative splicing to the quantitative features of KChIP gating modulation, a previously uncharacterized splice form of KChIP1 was functionally characterized. The KChIP1b splice variant differs from the previously characterized KChIP1a splice form by the inclusion of a novel amino-terminal region that is encoded by an alternative exon that is conserved in mouse, rat, and human genes. The expression of KChIP1b mRNA was high in brain but undetectable in heart or liver by RT-PCR. In cerebellar tissue, KChIP1b and KChIP1a transcripts were expressed at nearly equal levels. Coexpression of KChIP1b or KChIP1a with Kv4.2 channels in oocytes slowed K current decay and destabilized open-inactivated channel gating. Like other KChIP subunits, KChIP1b increased Kv4.2 current amplitude and KChIP1b also shifted Kv4.2 conductance-voltage curves by —10 mV. The development of Kv4.2 channel inactivation accessed from closed gating states was faster with KChIP1b coexpression. Deletion of the novel amino-terminal region in KChIP1b selectively altered the subunit's modulation of Kv4.2 closed inactivation gating. The role of the KChIP1b NH2-terminal region was further confirmed by direct comparison of the properties of the NH2-terminal deletion mutant and the KChIP1a subunit, which is encoded by a transcript that lacks the novel exon. The features of KChIP1b modulation of Kv4 channels are likely to be conserved in mammals and demonstrate a role for the KChIP1 NH2-terminal region in the regulation of closed inactivation gating.

inactivation; gating; mutagenesis; K channel-interacting protein; exon


VOLTAGE-GATED ION CHANNELS are comprised of pore-forming, transmembrane {alpha}-subunits that coassociate with one or more modulatory subunits. A family of cytoplasmic K channel interacting proteins known as KChIPs was found to coassociate with transient voltage-gated potassium channels of the Kv4 (Shal) gene family. The KChIP subunits associate with the amino-terminal region of Kv4 {alpha}-subunits, enhance Kv4 channel expression, and alter inactivation gating by complex mechanisms (2, 4, 6, 16, 25). All KChIP subunits are members of the neuronal calcium sensor family of proteins and possess a conserved "core" region with EF-hand domains, which suggests a role for cytoplasmic calcium in the regulation of Kv4 channel function (2, 8). The amino-terminal regions of KChIPs are variable and may contribute to functional differences. However, the structural basis for the complex modulatory functions of KChIP proteins is largely unexplored.

KChIP proteins coimmunoprecipitate and coimmunolocalize with Kv4 {alpha}-subunits in brain and heart tissue (2). KChIPs are, therefore, important and perhaps essential subunits of native Kv4 channels that comprise a major class of transient, A-type K channels in the nervous system (5, 28, 32, 33, 35), and contribute to the transient outward K current (Ito) in heart (12, 13, 20, 36). The biophysical properties of Kv4 channels are important for their special functions in excitable cells. Kv4 channels activate in the subthreshold range of depolarization and undergo rapid inactivation at membrane potentials close to the action potential firing threshold. Inactivation from closed gating states (3, 18, 19) causes the inhibition of K channel activity without the requirement for channel opening. This important property distinguishes neuronal Kv4 channels from other types of inactivating K channels and gives them a unique role of regulating signal amplification in the postsynaptic somatodendritic compartments where they localize (21, 34, 35). Rapid inactivation of K channels with subthreshold excitatory postsynaptic potential (EPSPs) contributes to the regulation of repetitive firing (10) and may truncate fast glutamatergic synaptic transmission, allowing prolonged inhibitory synaptic transmission at dendrodendritic synapses in the olfactory bulb (31). Furthermore, the rapid inactivation of dendritic Kv4 channels with subthreshold EPSPs may prevent action potential backpropagation, resulting in dendritic spike amplification sufficient for the induction of synaptic plasticity by associative mechanisms (14, 23, 24). In heart, the rapid inactivation of Kv4 channels is responsible for the initial phase of repolarization and contributes to the magnitude of the cardiac action potential (12, 20, 26). KChIP subunit modulation of the stability of Kv4 channel inactivated gating states (2, 4, 6) is therefore critical for the functional roles of K channels in brain and heart.

In addition to the modulation of intrinsic channel gating mechanisms, KChIP subunits may also contribute to the regulation of Kv4 channel gating by cytoplasmic messengers (15). Evidence suggests that KChIPs may influence native Kv4 protein trafficking or stability because coexpression of KChIPs with Kv4 subunits results in enhanced current magnitude in oocytes or mammalian cells (2, 4, 6, 11, 25) and KChIP2-deficient mice lack the ventricular Ito current (22).

Amino-terminal splice-variants of the four known KChIP genes appear to have distinct differences in the quantitative features of gating modulation, suggesting that the NH2-terminal region of KChIP proteins is a critical determinant in modulating Kv4 channel function. The identification and functional description of new Kv4 modulatory subunits is important for our understanding of the diversity of regulation of rapidly inactivating K channels in neurons and cardiac muscle.

In this article, we describe the cloning, tissue distribution, and functional analysis of a novel KChIP1 isoform (KChIP1b). Expression of KChIP1b, as well as a previously described KChIP1 splice-form (KChIP1a) in brain and heart muscle, was characterized by semiquantitative RT-PCR. The functional properties of KChIP1b and an NH2-terminal deletion mutant were studied by coexpression with Kv4.2 in Xenopus oocytes. These KChIP isoforms have distinct functional influences on K channel inactivation gating, which is at least partly regulated by the KChIP NH2-terminal region. Conservation of the exon that encodes for KChIP1b suggests the NH2 terminus of KChIP proteins may be important to K channel function in all mammals.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cloning of KChIP1b cDNA. A DNA fragment encoding an NH2-terminal splice variant of rat KChIP1 was amplified by standard reverse transcription-PCR protocols from total RNA of rat brain (Clontech, Palo Alto, CA). Primers were designed based on the sequence of human brain KChIP1 (2). The forward PCR primer (5'-CCGGAATTCATGGGGGCCGTCATG-3') and the reverse primer (5'-CGGGGTACCTTACATGACATTTTGAAACAGC-3') contained EcoR1 and Kpn1 restriction sites, respectively, at the 5'- or 3'-ends. A single PCR product was obtained by using an annealing temperature of 57°C (45 s) and an extension temperature of 72°C (1 min) for 30 cycles. After digestion with EcoR1 and KpnI, the PCR product was subcloned into the expression vector pAlterMax (Promega, Madison, WI). Four independent clones were isolated, sequenced (ABI 310, Perkin Elmer), and determined to be identical. Sequence fragment assembly and multiple alignments were done using Vector NTI Suite v. 7.0 (Informax, Bethesda, MD). The subcloned PCR fragment differed from a published KChIP1 sequence for human brain (Ref. 2; GenBank accession no. NM_014592 [GenBank] ) and represents a splice form, which we named KChIP1b (GenBank/EMBL accession no. AY142709 [GenBank] ).

Bioinformatic analysis. The full-length KChIP1b sequence, as well as the 33-nucleotide region comprising the alternatively retained exon, were compared with sequences in GenBank and at ENSEMBL using the BLASTN and BLASTX algorithms (1). Mouse, human, and rat KChIP1 genes were identified by BLASTN using the ENSEMBL genome browser and analyzed by the splice-site prediction algorithm NNSSP (29).

Construction of KChIP1b NH2-terminal deletion mutant. The rKChIP1b {Delta}21–31 mutant was constructed using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) with primers designed to loop out the nucleotides encoding for amino acid residues 21–31 from the rKChIP1b template DNA. The forward primer was 5'-(CAAAGGCGACCCTCTAAAGACA)-{Delta}-(AGATCGAG)-3', and the reverse primer was -5'-(CTCGATCT)-{Delta}-(TGTCTTTAGAGGGTCGCCTTTG)-3' where the sequences flanking the deleted residues ({Delta}) are indicated by parentheses. Thermocycling parameters consisted of denaturing at 95°C (30 s), annealing at 60°C (50 s), and extension at 68°C (16 min) for 18 cycles. Deletion mutagenesis was confirmed by DNA sequencing. For comparison, a rat KChIP1a clone without the NH2-terminal insert (accession no. AY082658 [GenBank] ; a kind gift from K. Takimoto, Pittsburg, PA) was sequenced and functionally tested.

Expression of Kv4 channels in oocytes. Plasmids containing the cDNAs encoding for Kv4.2 and KChIP subunits were linearized and capped RNAs were synthesized in vitro using Ambion (Austin, TX) MessageMachine RNA polymerase kits. RNA was purified by use of the RNAid kit (Bio 101, Vista, CA) and stored at —80°C in diethyl pyrocarbonate (DEPC)-treated water. Transcription reaction products were checked for size by agarose gel electrophoresis, and RNA concentrations were determined by spectrophotometry using the equation: 1 A260 = 40 µg/ml RNA.

Oocytes were harvested from Xenopus laevis (Xenopus I, Dexter, MI), previously injected by the supplier with human chorionic gonadotropin. Female frogs were anesthetized by immersion in 0.2% 3-aminobenzoic acid ethyl ester (Sigma Chemical), and ovarian lobes were surgically removed. Oocytes were released by gentle agitation for 1–1.5 h in 1 mg/ml collagenase D (Boehringer-Mannheim) or 15 min in 0.15 mg/ml collagenase 1A (Sigma-Aldrich) dissolved in a Ca2+-free OR-2 solution containing (in mM) 96 NaCl, 2 KCl, 1 MgCl2, 5 HEPES, pH 7.4 with NaOH. Subsequently, oocytes were extensively washed with Ca2+-free OR-2, and stage V and VI oocytes were injected the same day or the following day with 50 nl of RNA dissolved in DEPC-treated water (5 ng Kv4.2 ± 5–31 ng KChIP). Oocytes were maintained at 17–18°C in a frog Ringer's solution of (in mM) 96 NaCl, 1 KCl, 1 CaCl2, 2 MgCl2, 10 HEPES, and 2 Na-pyruvate, pH 7.4 with NaOH, with 50 U/ml penicillin G and 50 µg/ml streptomycin. Electrophysiological recordings began at 2 days postinjection.

Electrophysiology. Kv4 potassium currents were recorded from oocytes with a two-electrode voltage clamp using a Geneclamp 500B amplifier (Axon Instruments, Foster City, CA). Voltage-measuring and current-passing electrodes were filled with 3 M KCl and had resistances between 0.3 and 1.0 M{Omega}. Currents were sampled at 5–10 kHz and filtered at 1–2 kHz. All recordings were done at room temperature (about 22°C). Oocytes were clamped at —90 or —100 mV and voltage protocols to study channel gating were applied, as described in RESULTS. Oocytes were perfused continuously with an external solution containing (in mM) 96 NaCl, 2 KCl, 2 CaCl2, 1 MgCl2, 10 HEPES, pH 7.4 with NaOH. Data were recorded on Pentium computers equipped with Digidata 1320A (Axon Instruments) analog-to-digital hardware. Axon's Clampex acquisition and Clampfit analysis software (version 8) were used. Leak subtraction used P/-4 or P/-6 pulses from a holding potential of —90 or —100 mV. Data were also transferred to Microsoft Excel and Microcal Origin v. 6.0 (Northhampton, MA) for additional analysis, curve-fitting, and the production of figures. Exponential fitting was done using a Levenberg-Marquardt searching algorithm with a sum of squared errors (in Clampfit) or a {chi}-square (in Origin) minimization method. In fitting the data to exponential functions, we compared mathematical models incorporating up to five exponential functions. The best model was determined from an F-statistic, using a confidence level of 0.999. When two models could not be discriminated by this statistical test, we compared the correlation coefficient for each model and selected the model that showed an improvement in the correlation to the data. Statistical analysis of the fitted parameters from the complete data sets used one-way ANOVA with the Scheffé method of posthoc analysis. Differences were determined to be statistically significant if P < 0.01. All data are expressed as means ± SE.

Tissue distribution of KChIP isoforms by RT-PCR. Freshly dissected brain, heart, and liver tissues were pooled from four adult rats, and total RNA was extracted using TRIzol reagent (GIBCO BRL). RNA (0.2–4 µg) from each tissue was reverse-transcribed using random hexamer primers and the Superscript II reverse transcription kit (GIBCO BRL). The complete set of primers used in this study is shown in Table 1. Primers for KChIP2 were designed to detect a common region for KChIP2a (accession no. AF269283 [GenBank] ) and KChIP2b (AF269284 [GenBank] ). Primers for KChIP3 were designed to detect a conserved region (AB043892 [GenBank] ). Detection of the KChIP1b transcript in the different tissue sources was done using cycle conditions of 94°C for 4 min, followed by 94°C for 45 s, annealing temperature in degrees Celsius (see Table 1) for 45 s, and 72°C for 1 min for 30 cycles. To discriminate the two KChIP1 splice forms in RNA samples from brain, we used a set of nonspecific (pan-) KChIP1 primers (see Table 1) and ran the RT-PCR products on a 12% polyacrylamide gel. PCR conditions were denaturated at 94°C for 2 min, followed by 94°C for 20 s, annealing at 62°C for 20 s, and extension at 72°C for 2 min for 20 cycles. To quantify the relative amounts of the KChIP1a and 1b transcripts in a tissue sample, we used an RNA dilution series and quantified the band intensities using Image J software from NIH. RNA integrity and gel loading were verified by RT-PCR using primers for rat GAPDH, designed according to Horikoshi and Sakakibara (17). PCR products for all KChIPs were gel-purified using the QIAquick gel extraction kit or QIAEX II (Qiagen), ligated into pGEM-T plasmid (Promega), and sequenced to confirm PCR product identity.


View this table:
[in this window]
[in a new window]
 
Table 1. Primers for RT-PCR reactions

 


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We isolated a novel rat KChIP1b cDNA that encodes a protein of 227 amino acids and possesses putative EF-hand motifs common to all previously identified KChIP proteins. The new cDNA for KChIP1b also contains an NH2-terminal myristoylation sequence common to only the KChIP1 subfamily of KChIP proteins. Several putative phosphorylation sites were also identified using the software NetPhos Predictor. The specific functions of these regions have not been fully elucidated but suggest that Kv4/KChIP function may be regulated by intracellular calcium, protein kinases, and phosphatases, among other possible modulatory agents.

An amino acid alignment (Fig. 1A) of rat brain KChIP1b with rat brain KChIP1a shows that KChIP1b possesses a novel 11-residue NH2-terminal region, not present in the previously isolated shorter form of KChIP1. Query of the EST (Expressed Sequence Tag) database at NCBI using the 33-bp exon revealed a mouse transcript spliced in a manner identical to rat KChIP1b. To determine the degree to which this exon is conserved in mammals, the KChIP1 gene from mouse (chromosome 11; gene identifier ENSMUSG-00000040574), human (chromosome 5; ENSG00000164431), and rat (chromosome 10; RNOR01500851) was compared (Fig. 1B). The sequence surrounding this exon is nearly identical in these three species, with splice-acceptor and splice-donor sequences consistent with known vertebrate consensus splice junctions (7). A neural network-based splice-site prediction algorithm (NNSSP) was used to assess the degree to which mouse and rat splice junctions identified for the novel exon, as well as previously described exons, conform to a training set of eukaryotic splice sites (29). For the novel exon, the sequences surrounding the predicted splice-donor and splice-acceptor sites conform to the training set with 89 and 99% likelihood, respectively. The splice-donor score for the novel exon is close to that for all previously described exons and substantially exceeds that for exon 4, which possesses only 26% likelihood. The splice-acceptor score for the novel exon is similar to the other exons but exceeds the scores for exons 6 and 7 (71 and 88%, respectively). Recently, two other laboratories independently identified the longer KChIP1b isoform containing a 33-bp NH2-terminal insert sequence identical to the sequence shown in the present study (mouse: AY050525 [GenBank] and rat: AY082657 [GenBank] ). The novel exon is absent in the shorter KChIP1a isoform, a transcript originally identified in human brain (Ref. 2; NM_014592 [GenBank] ) and subsequently identified in rat (AY082658 [GenBank] ) and mouse (AY050526 [GenBank] ).



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 1. Cloning of rat K channel-interacting proteins (KChIP1b). A: alignment of the deduced amino acid sequences of the rat KChIP1b clone, with rat KChIP1a (AY082658 [GenBank] ). The amino-terminal region unique to rat KChIP1b is distinguished by dashes in the rat KChIP1a sequence. Numbers at left refer to the first amino acid residue in each line. Conserved EF-hand motifs (EF-1, 2, 3, or 4) are indicated above the sequence. The conserved KChIP1 amino-terminal myristoylation sequence (MGA) is indicated in bold. B: alignment of the genomic sequence surrounding the alternative exon that comprises the novel region of KChIP1b. Intron sequences are noted in small letters, exon sequence in capital letters. See MATERIALS AND METHODS for details on bioinformatics analysis.

 

To determine the relative abundance of the KChIP1a and KChIP1b mRNAs, brain and heart tissue were analyzed by semiquantitative RT-PCR with 20 cycles (see MATERIALS AND METHODS) (Fig. 2). In addition to size determination, the PCR products were purified from the gel and sequenced to confirm their identity. The results indicate that KChIP1b is a prominent KChIP1 isoform in the brain and that the relative ratio for KChIP1b/KChIP1a is ~1.0 for RNA isolated from adult rat cerebellum (Fig. 2c). Thus the relative abundance of the two transcripts remains similar despite the change in initial RNA concentration, and the quantitation of signal intensity is within the linear concentration range. We did not detect KChIP1 transcripts in cardiac ventricle despite the concentration-dependent detection of GAPDH transcripts in the same RNA samples, confirming RNA integrity (Fig. 2B).



View larger version (44K):
[in this window]
[in a new window]
 
Fig. 2. Analysis of KChIP1a and KChIP1b transcripts. Semiquantitative RT-PCR of total RNAs (2.0, 1.0, 0.5, or 0.25 µg) extracted from adult rat (A) cerebellum or (B) cardiac ventricle using nonspecific KChIP1 primers with products separated by 12% PAGE. The last lane contains a DNA size ladder (LAD; 200–500 bp are shown). PCR products were sequenced and identified as KChIP1b (upper band) and KChIP1a (lower band). C: results of densitometric analysis of KChIP1a and KChIP1b bands in cerebellum; bands were imaged and the intensity scale was measured as a function of distance from the gel origin, in the migration range of the 200- to 300-bp markers. Data points represent the average of 3 determinations. D: relative signal intensity for each band was normalized to the maximum signal for KChIP1b at 2.0 µg of RNA.

 

To determine the distribution of KChIP1b in native tissue, reverse transcription PCR was used on RNA isolated from different rat tissue sources, using a PCR primer pair designed to detect the novel NH2-terminal region specific to KChIP1b. KChIP1b was detected in all four brain regions tested (cerebellum, hippocampus, striatum, and cerebral cortex) but was not detected in liver, ventricle, or atria despite the presence of a strong GAPDH signal in these RNA samples (Fig. 3). The KChIP2 primers were designed to amplify a region common to KChIP2a and 2b, and we resolved only the single predicted band. Expression of KChIP2 was detected in all brain tissues tested and also ventricle and atrium, but the signal appeared to be lower in liver. KChIP3 was also identified in all tissues tested, although the signal in liver was weak. The PCR products were purified from the gel and sequenced to confirm their identity. The KChIP1b-specific primers resolved a single PCR product, and direct sequencing of the gel-purified product confirmed that it was KChIP1b.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 3. Identification of KChIP1b transcripts in rat tissues. cDNAs were obtained by reverse transcription of total RNAs extracted from adult rat tissues: liver (LV), ventricle (VN), atrium (AT), cerebellum (CB), hippocampus (HC), striatum (ST), and cerebral cortex (CX). PCR primers used for identification of KChIP1b, KChIP2, KChIP3, or GAPDH (an internal control for RNA integrity and gel loading) are listed in Table 1. Amplified products were separated on agarose gels and visualized by ethidium bromide staining. The last lane of each gel contains a DNA size ladder (LAD; {varphi}X174 DNA/HaeIII) with the 603-bp (upper band) and 310-bp (lower band) fragments shown.

 

We tested the modulatory function of rKChIP1b by coexpression with rat Kv4.2 in Xenopus oocytes (Fig.4A). Injection of oocytes with Kv4.2 RNA alone results in fast inactivating A-type K currents. The current magnitude, however, was small in both oocytes (Fig. 4B) and transfected mammalian cells (data not shown). However, heterologous A-type K current magnitude in the oocytes was enhanced three- to sixfold by coexpression with KChIP1b. To examine the role of the novel KChIP1b NH2 terminus in the modulatory functions of KChIP1b, we tested a deletion mutant, KChIP1b{Delta}21–31 (hereafter, KChIP1b{Delta}N or 1b{Delta}N). We observed a similar three- to sixfold increase in the magnitude of the Kv4.2 current upon coexpression with KChIP1b{Delta}N, as well as the KChIP1a subunit, which was studied for comparison. These results suggest that KChIP1b and KChIP1a produce comparable effects on the enhancement of Kv4 current amplitude and that the novel NH2-terminal region of KChIP1b was not essential for this function. We did not explore the mechanism of current enhancement by any of the KChIP subunits.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 4. KChIP1b functional expression in Xenopus oocytes. Transient K currents were recorded using a 2-microelectrode voltage clamp after injection of oocytes with RNA encoding for rKv4.2 plus rKChIP1b (A) or rKv4.2 alone (B). The currents in A and B are shown on the same scale. For clarity, only the currents elicited by test potentials from —40 to +40 in 20-mV increments are shown. The inset in B compares the modulation of Kv4.2 inactivation kinetics by KChIP1b (arrow). Currents at +40 mV were normalized to peak values; only the first 200 ms of a 1-s pulse are shown to emphasize the early kinetic changes. Current decay at +40 mV was fitted by the sum of 3 exponential functions (see MATERIALS AND METHODS). Time constants of inactivation (C) and the relative (normalized) amplitudes of each time constant (D) are plotted for Kv4.2 alone (n = 15), Kv4.2 + KChIP1b (n = 20), Kv4.2 + KChIP1b{Delta}N (n = 22), and Kv4.2 + KChIP1a (n = 8).

 

Kv4.2 inactivation, elicited by depolarizations that open the channels, was slowed by coexpression with wild-type KChIP1b (Fig. 4B, inset), as expected for a member of this family of modulatory subunits. We examined macroscopic inactivation kinetics using a series of test potentials in oocytes expressing the homomeric Kv4.2 or heteromeric Kv4.2/KChIP1b channels. To measure the quantitative aspects of this modulation, the decaying K current during a pulse of 1-s duration from —90 to +40 mV was fitted to a mathematical model that used a sum of three exponential terms. The fast time constant of current decay (term 1, {tau}1) represents largely the gating transitions from open conducting states to open inactivated states. However, the slower components represent a complex contribution of gating transitions from open inactivated to closed inactivated states, as well as other gating transitions (3, 19). For each construct tested, the fitted exponential time constants for the fast, intermediate, and slow components were compared (Fig. 4C). Each of the fitted terms that describe Kv4.2 current decay during a long test depolarization was modestly slowed by KChIP1b, KChIP1b{Delta}N, or KChIP1a. Deletion of the novel NH2-terminal region of KChIP1b retained the subunit's modulation of Kv4.2 current decay, and the quantitative features of the modulation were not significantly different from the modulation induced by wild-type KChIP1b or KChIP1a. To quantify the relative contribution of the three time constants to the decaying currents, we also assessed the amplitude of the current fitted by each exponential term (Fig. 4D). Coexpression of KChIP1b with Kv4.2 reduced the relative amplitude of the fast component of current decay ({tau}1) while enhancing the relative amplitude of the intermediate and slow components of decay ({tau}2 and {tau}3). The analysis shows that KChIP1b{Delta}N and KChIP1a followed this same trend and that there were no systematic differences that were impacted by the presence or absence of the novel NH2-terminal region of KChIP1b. Although it is not possible to directly assign the fitted time constants to individual gating transitions, the lack of significant changes in the fast time constant of decay ({tau}1) in KChIP1b-modulated currents compared with KChIP1b{Delta}N or KChIP1a indicates that the novel 11-amino acid region in the KChIP1b NH2 terminus does not regulate the equilibrium between open to open-inactivated transitions.

Although early inactivation transitions after Kv4.2 channel opening reflect transitions to open inactivated gating states, prolonged membrane depolarization maximizes occupancy of closed inactivated states (3, 19). To examine more directly the entry of Kv4.2 channels into closed inactivated states, we used a modified two-pulse protocol with a variable duration, —50 mV conditioning potential that elicited <10% of the maximal Kv4.2 conductance (Fig. 6A). The development of closed-state inactivation (Fig. 5A) occurred with a time constant of 596 ± 49.9 ms (n = 10) for Kv4.2 channels and was significantly accelerated by almost fourfold upon coexpression with KChIP1b ({tau} = 169 ± 14.8 ms, n = 8). Coexpression of Kv4.2 channels with the mutant KChIP1b{Delta}N resulted in currents with an intermediate rate of closed-state inactivation ({tau} = 333 ± 23.3 ms, n = 17), which was significantly different from both Kv4.2 alone and the wild-type KChIP1b-modulated channels. KChIP1a, which naturally lacks the region deleted in KChIP1b{Delta}N, modulated closed-state inactivation with no significant quantitative differences from the deletion mutant (243 ± 22.0 ms, n = 8). These results suggest that the unique NH2-terminal region of the KChIP1b protein may contribute to the rate of access of inactivated states from preopen, closed gating states.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 6. KChIP1b modulation of the voltage dependence of Kv4.2 channel conductance. A: normalized conductance-voltage (G-V) relationships for Kv4.2 ({blacksquare}, means ± SE; n = 14), Kv4.2 plus wild-type KChIP1b (+1b, {circ}; n = 14), and Kv4.2 plus KChIP1b{Delta}N (+1b{Delta}N, {triangleup}; n = 12). Conductances were normalized using a Goldman-Hodgkin-Katz formulation according to Clay (7) with EK = —100 mV. G-V data were fit to first-order Boltzmann functions (solid curves). The G-V curve for Kv4.2 alone was fit with V1/2 = —16 mV and k = 11.7. The G-V curve for the wild-type KChIP1b-modulated channels was fit with V1/2 = —28 mV and k = 9.5, and the data for the mutant KChIP1b{Delta}N-modulated channels was fit with V1/2 = —25 mV and k = 7.7. B: time course of current activation was assessed by a single exponential function fit to the rising phase of the K current elicited at different test potentials. Values are means ± SE; n = 11–13 cells each for Kv4.2 alone ({square}), Kv4.2 plus wild-type KChIP1b ({circ}), and Kv4.2 plus KChIP1b{Delta}N ({triangleup}).

 


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 5. KChIP1b modulation of Kv4.2 inactivation and recovery. A: rate of entry into closed inactivated states was assessed using a variable duration prepulse to —50 mV (inset). The data sets are fitted with single exponential functions of the form y = e x/{tau} (solid lines). The fitted time constants are as follows: {tau} = 596 ms for Kv4.2 channels ({blacksquare}, n = 10) and {tau} = 169 ms for currents generated upon coexpression of Kv4.2 with wild-type KChIP1b (+1b; {circ}; n = 8). The development of inactivation from closed states for Kv4.2 coexpressed with the KChIP1b NH2-terminal deletion mutant had a time constant of 333 ms (+1b{Delta}N; {triangleup}; n = 17) and for KChIP1a-modulated currents, {tau} = 237 ms ({bullet}; n = 8). B: recovery from inactivation was determined using a standard 2-pulse protocol, as shown in the inset. For Kv4.2 channels (n = 11), the data set is fit with a single exponential function of the form y = 1 — ex/{tau} with {tau} = 297 ms (solid line). For the coexpression of Kv4.2 plus KChIP1b (n = 12), the recovery data set is shown fitted by a single exponential function with {tau} = 114 ms. For the coexpression of Kv4.2 plus mutant KChIP1b{Delta}N (n = 14), the recovery data set is shown fitted by a single exponential function with {tau} = 110 ms, which is the same as that for the KChIP1a-modulated currents (n = 8). C: recovery from closed-state inactivation was assessed using a modified 2-pulse protocol, as shown in the inset. A 7-s-long pulse to —50 mV was used to maximize occupancy of preopen, closed inactivated states. For Kv4.2 channels (n = 8), the recovery data set is fit with a single exponential function with {tau} = 712 ms. For the coexpression of Kv4.2 plus KChIP1b (n = 5), the recovery data set is shown fitted by a single exponential function with {tau} = 538 ms. Recovery was incomplete, and the fitted functions cap the maximum recovery at 78% for Kv4.2 alone and 74% for Kv4.2/KChIP1b channels. For the coexpression of Kv4.2 plus mutant KChIP1b{Delta}N (n = 9), the time dependence of recovery is shown fitted by a single exponential function with {tau} = 214 ms (90% recovery). KChIP1a-modulated currents recovered from closed-state inactivation with {tau} = 338 ms (84% recovery). Note: in this figure, some data are a representative subset of the complete data set noted in the text but with a larger sample size. This is due to the use of different conditioning pulse intervals ({Delta}t) in some of the experiments.

 

Recovery from inactivation was about 2.5-fold faster for KChIP1b-regulated currents than for Kv4.2 alone (Fig. 5B). This was first measured using a standard two-pulse protocol with a holding and interpulse potential of —90 mV and two-step depolarizations to +40 mV, separated by a variable interpulse interval. The fraction of the maximum (pulse 1) current recovered in response to the second pulse is a measure of the time-dependent recovery of K channel availability. During the 1-s-long pulse to +40 mV, the Kv4.2 current decays to almost zero, maximizing the occupancy of inactivated states accessed through transitions from both open and closed gating states. Both KChIP1b ({tau} = 140 ± 12.4 ms, n = 12) and KChIP1b{Delta}N ({tau} = 110 ± 7.57 ms, n = 14) produced a modest, but significant (ANOVA, P < 0.01), enhancement in the rate of recovery from inactivation measured for Kv4.2 channels alone ({tau} = 297 ± 24.8 ms, n = 11). Using this protocol, differences in the modulation by wild-type or mutant KChIP1b were not significant. Likewise, KChIP1a modulation of the rate of recovery from inactivation ({tau} = 110 ± 8.15 ms, n = 8) was not different from that measured for KChIP1b{Delta}N or wild-type KChIP1b.

To measure more directly the kinetics of recovery from closed-state inactivation, we used a long (7 s) conditioning pulse to —50 mV to allow accumulation of the channels in closed inactivated states, followed by a variable duration recovery pulse (Fig. 5C). It has been shown previously that during prolonged depolarizations, Kv4.2 channels, studied as naked {alpha}-subunit tetramers, largely accumulate in closed inactivated state(s), from which they directly recover, bypassing the open state (3). Recovery from closed-state inactivation occurred with a time constant of 664 ± 58.8 ms for Kv4.2 channels expressed alone (n = 11). At least 20% of the current elicited in the first pulse could not be recovered in the second pulse using this protocol. Coexpression with KChIP1b did not significantly alter the rate of Kv4.2 channel recovery from closed-state inactivation ({tau} = 458 ± 29.2 ms, n = 6) or the maximum recoverable current. However, deletion of the novel NH2 terminus of KChIP1b accelerated both the rate of recovery ({tau} = 242 ± 19.8 ms, n = 9) and increased the maximum recoverable current to 90% of the current elicited in the first pulse (Fig. 5C). We further tested that the deletion of the NH2 terminus was critical to this change and found that the KChIP1a subunit enhanced the rate of recovery and magnitude of current recovered from closed-state inactivation ({tau} = 312 ± 30.3 ms, n = 8), results that were not significantly different from those for KChIP1b{Delta}N.

Kv4.2/KChIP1b conductance-voltage curves showed a modest but statistically significant leftward shift compared with Kv4.2 alone (Fig. 6A; P < 0.01). The voltage dependence of activation gating was determined by measuring the peak, macroscropic K current elicited by a family of step depolarizations. Current values were converted to conductances and normalized according to a Goldman-Hodgkin-Katz formulation that avoids the presumption that the current-voltage relationship for Kv4 channels is linearly related to the driving force, VmEK, as explained by Clay (9). For comparison, we also performed the analysis with the assumption of linearity and found the same modest voltage shift induced by KChIP1b coexpression, but with quantitative differences in the values for the fitted parameters, V1/2 and the slope k (not shown). Steady-state activation of Kv4.2 channels was thus shifted by ~10 mV in the hyperpolarizing direction upon coexpression with wild-type KChIP1b or mutant KChIP1b{Delta}N (Fig. 6A). We also measured the kinetics of the rising phase of the activated current following P/-4 or P/-6 subtraction of the capacitative transients elicited by the step depolarization. We found no significant differences in the time constants of activation for Kv4.2, Kv4.2/KChIP1b, or Kv4.2/KChIP1b{Delta}N currents for any of the voltages for which measurements could be obtained (Fig. 6B).


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The physiological properties of brain and heart A-type K+ channels are modulated by a structurally related family of cytoplasmic, Kv4-interacting proteins known as KChIPs. We report the cloning and functional analysis of a brain-specific KChIP1 isoform that possesses a unique amino-terminal region, not present in related KChIP proteins. KChIP1b modulates Kv4.2 channel inactivation gating and current magnitude (Figs. 4 and 5) and thus displays functional properties common to other KChIP subunits. The identification of KChIP1b and the determination of this splice form's modulatory properties further illustrates the structural diversity of the regulatory subunits of A-type K+ channels.

KChIP1b modulation of Kv4.2 inactivation kinetics can be explained by changes in the stability of open-state inactivation. Simultaneously, we found that Kv4.2 closed-state inactivation was accelerated by KChIP1b coexpression. Our results are thus in general agreement with those recently reported for KChIP1a modulation of Kv4 channel inactivation gating (6) and suggest opposing effects of KChIP1 subunits on the mechanisms that regulate inactivation from conducting and nonconducting states of the channel.

The magnitude of modulation by KChIP1b or KChIP1a of the rate of recovery from inactivation for Kv4.2 channels (~2.5-fold faster; Fig. 5B) is smaller than first reported (2) for either hKChIP1a regulation of rKv4.2 channels expressed in Chinese hamster ovarian (CHO) cells (approximately fivefold faster) or hKChIP1a regulation of hKv4.3 channels expressed in oocytes (approximately ninefold faster). Our results, however, are closer to those recently reported for the KChIP1a isoform, which induced a 2.5- to 4-fold acceleration of recovery from inactivation for Kv4.3 and Kv4.1 channels (respectively) studied in oocytes (6). For comparison, we also measured the rate of recovery from inactivation for Kv4.2 channels modulated by coexpression of the related rat KChIP2. Compared with our results from the coexpression of rKv4.2 plus rKChIP1b, the KChIP2 subunit had a stronger effect on the recovery from inactivation with a fitted {tau}recovery of 16 ms (data not shown), ~13-fold faster than for Kv4.2 channels alone and 7-fold faster than for KChIP1-modulated channels. This suggests that quantitative differences in the modulation of inactivation gating by the different KChIP isoforms may depend on structural differences in the KChIP proteins, including differences in amino-terminal splicing. This hypothesis is also supported by recent evidence that a unique NH2-terminal region of the KChIP4a subunit (residues 2–44) controls the modulation of Kv4 channel inactivation gating (16).

We found that deletion of the novel NH2 terminus of KChIP1b alters only the subunit's modulation of the rate of entry into and recovery from closed inactivated gating states, which are likely to become populated during subthreshold depolarizations. In the absence of additional, significant differences in the modulatory properties of KChIP1b and KCHIP1b{Delta}N, we conclude that the alternatively spliced NH2-terminal region contributes to the regulation of closed inactivated gating transitions. This study thus identifies a new role for the variable NH2-terminal region of KChIP proteins and provides another example (16) that the structural diversity in this region is important in the regulation of the specific gating properties of Kv4 channels. Because closed inactivation gating regulates dendritic signal amplification and synaptic plasticity in the nervous system and cardiac action potential amplitude (see Introduction), identifying the structures that regulate the stability of these inactivated gating states is important to our understanding of the function of Kv4 channels in brain and heart.

KChIP1b induces a modest leftward shift in the Kv4.2 conductance-voltage relationship (Fig. 6). Unlike the reproducible effects of KChIPs on inactivation gating of Kv4 channels, the reported effects of KChIPs on activation gating are more variable. It was first shown that KChIP1, 2 or 3 shift Kv4.2 activation gating by —30 to —40 mV in whole cell recordings from transfected CHO cells, but not in oocytes (2). These large changes in steady-state activation have not been confirmed. Other studies suggest that KChIP2 introduces a +9-mV shift in Kv4 channel activation gating in mammalian cells (4), whereas KChIP1a is reported to shift by —21 mV the voltage dependence of activation gating of Kv4.2 channels studied in oocytes (25). In contrast, Beck and colleagues (6) recently reported that the same KChIP1a does not significantly alter the activation gating of Kv4.1 or Kv4.3 channels expressed in oocytes. Additional studies of activation gating, including the study of gating currents, are needed to clarify the role of KChIP subunits in the modulation of channel activation.

Our tissue expression studies support the idea that KChIP1b is brain specific, whereas the KChIP2 and 3 genes are less restricted in their expression (Fig. 3). The related KChIP1a has been identified by RT-PCR, Northern blot, or RNAse protection assay in human heart (27), but not in rat (Fig. 2B and Refs. 2 and 27), mouse (27), or canine (30) heart. KChIP2 has been detected in brain and heart from human, rat, mouse, and dog (Fig. 3 and Refs. 2, 27, and 30). KChIP3 was detected in brain tissue from all species tested (Fig. 3 and Refs. 2, 27, and 30), as well as in human and rat heart (Fig. 3 and Refs. 2 and 27). The conservation of the KChIP1b-specific exon and flanking sequences in rodent and human KChIP1 genes (Fig. 1B) suggests a role for the KChIP1b isoform in mammalian Kv4 channel function. Although the precise tissue distribution in mouse and human remains to be determined, the rat KChIP1b isoform appears to be a brain-specific modulator of Kv4 channel function.

The functions of native A-type K channels are critically dependent on activation voltage dependence, mechanisms, and rates of inactivation and time-dependent recovery from inactivation. Kv4 channels and partner subunits such as KChIPs may comprise the A-type current in somatodendritic compartments and Ito in cardiac myocytes. KChIPs may, therefore, be candidate genes for disorders of cellular excitability and may be subject to altered regulation in disease, aging, or different physiological states. The ability of KChIPs to fine-tune the gating processes of the pore-forming Kv4 subunits suggests that KChIPs are potentially important therapeutic targets for drugs designed to treat neuronal or cardiac excitability disorders. The structural bases of the KChIP modulation of Kv4.2 channel gating remain to be fully elucidated; our data suggest a role for the alternatively spliced amino-terminal region in the modulation of closed inactivated gating transitions.


    ACKNOWLEDGMENTS
 
We thank Gea-Ny Tseng and Anthony Varghese for helpful discussions and Kate Ihle and Marlise Luskin for technical assistance. We thank Dirk Isbrandt for the gift of KChIP2 cDNA and Koichi Takimoto for the gift of KChIP1a cDNA and helpful discussion.

This work was supported by National Institute of Neurological Disorders and Stroke Grant NS-34379 (to L. M. Boland) and the Minnesota Medical Foundation (to L. M. Boland).


    FOOTNOTES
 

Address for reprint requests and other correspondence: L. M. Boland, Dept. of Neuroscience, Univ. of Minnesota, 6–145 Jackson Hall, Minneapolis, MN 55455 (E-mail: bolan007{at}umn.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
1. Altschul SF, Gish W, Miller W, Myers EW, and Lipman DJ. Basic local alignment search tool. J Mol Biol 215: 403–410, 1990.[Web of Science][Medline]

2. An WF, Bowlby MR, Betty M, Cao J, Ling HP, Mendoza G, Hinson JW, Mattsson KI, Strassle BW, Trimmer JS, and Rhodes KJ. Modulation of A-type potassium channels by a family of calcium sensors. Nature 403: 553–556, 2000.[Medline]

3. Bähring R, Boland LM, Varghese A, Gebauer M, and Pongs O. Kinetic analysis of open- and closed-state inactivation transitions in human Kv4.2 A-type potassium channels. J Physiol 535: 65–81, 2001.[Abstract/Free Full Text]

4. Bähring R, Dannenberg J, Peters HC, Leicher T, Pongs O, and Isbrandt D. Conserved Kv4 N-terminal domain critical for effects of Kv channel-interacting protein 2.2 on channel expression and gating. J Biol Chem 276: 23888–23894, 2001.[Abstract/Free Full Text]

5. Baldwin TJ, Tsaur ML, Lopez GA, Jan YN, and Jan LY. Characterization of a mammalian cDNA for an inactivating voltage-sensitive K+ channel. Neuron 7: 471–483, 1991.[Web of Science][Medline]

6. Beck EJ, Bowlby M, An WF, Rhodes KJ, and Covarrubias M. Remodelling inactivation gating of Kv4 channels by KChIP1, a small-molecular-weight calcium-binding protein. J Physiol 538: 691–706, 2002.[Abstract/Free Full Text]

7. Breathnach R and Chambon P. Organization and expression of eucaryotic split genes coding for proteins. Annu Rev Biochem 50: 349–383, 1981.[Web of Science][Medline]

8. Burgoyne RD and Weiss JL. The neuronal calcium sensor family of Ca2+-binding proteins. Biochem J 353: 1–12, 2001.[Web of Science][Medline]

9. Clay JR. Determining K+ channel activation curves from K+ channel currents. Eur Biophys J J.29: 555–557, 2000.[Web of Science][Medline]

10. Connor JA and Stevens CF. Voltage clamp studies of a transient outward membrane current in gastropod neural somata. J Physiol 215: 21–30, 1971.

11. Decher N, Uyguner O, Scherer CR, Karaman B, Yuksel-Apak M, Busch AE, Steinmeyer K, and Wollnik B. hKChIP2 is a functional modifier of hKv4.3 potassium channels. Cloning and expression of a short hKChIP2 splice variant. Cardiovasc Res 52: 255–264, 2001.[Abstract/Free Full Text]

12. Dixon JE, Shi W, Wang HS, McDonald C, Yu H, Wymore RS, Cohen IS, and MacKinnon D. Role of the Kv4.2 K+ channel in ventricular muscle. A molecular correlate for the transient outward current. Circ Res 79: 659–668.

13. Guo W, Li H, London B, and Nerbonne JM. Functional consequences of elimination of Ito,f and Ito,s: early after depolarizations, atrioventricular block, and ventricular arrhythmias in mice lacking Kv1.4 and expressing a dominant-negative Kv4 {alpha} subunit. Circ Res 87: 73–79, 2000.[Abstract/Free Full Text]

14. Hoffman DA, Magee JC, Colbert CM, and Johnston D. K+ channel regulation of signal propagation in dendrites of hippocampal pyramidal neurons. Nature 387: 869–875, 1997.[Medline]

15. Holmqvist MH, Cao J, Knoppers MH, Jurman ME, Distefano PS, Rhodes KJ, Xie Y, and An WF. Kinetic modulation of Kv4-mediated A-current by arachidonic acid is dependent on potassium channel interacting proteins. J Neurosci 21: 4154–4161, 2001.[Abstract/Free Full Text]

16. Holmqvist MH, Cao J, Hernandez-Pineda R, Jacobson MD, Carroll KI, Sung MA, Betty M, Ge P, Gilbride KJ, Brown ME, Jurman ME, Lawson D, Silos-Santiago I, Xie Y, Covarrubias M, Rhodes KJ, Distefano PS, and An WF. Elimination of fast inactivation in Kv4 A-type potassium channels by an auxiliary subunit domain. Proc Natl Acad Sci USA 99: 1035–1040, 2002.[Abstract/Free Full Text]

17. Horikoshi T and Sakakibara M. Quantification of relative mRNA expression in the rat brain using simple RT-PCR and ethidium bromide staining. J Neurosci Methods 99: 4–51, 2000.

18. Jerng HH and Covarrubias M. K+ channel inactivation mediated by the concerted action of the cytoplasmic N- and C-terminal domains. Biophys J 72: 163–174, 1997.[Web of Science][Medline]

19. Jerng HH, Shahidullah M, and Covarrubias M. Inactivation gating of Kv4 potassium channels: molecular interactions involving the inner vestibule of the pore. J Gen Physiol 113: 641–660, 1999.[Abstract/Free Full Text]

20. Johns DC, Nuss HB, and Marban E. Suppression of neuronal and cardiac transient outward currents by viral gene transfer of dominant-negative Kv4.2 constructs. J Biol Chem 272: 31598–31603, 1997.[Abstract/Free Full Text]

21. Johnston D, Hoffman DA, Magee JC, Poolos NP, Watanabe S, Colbert CM, and Migliore M. Dendritic potassium channels in hippocampal pyramidal neurons. J Physiol 525: 75–81, 2000.[Abstract/Free Full Text]

22. Kuo HC, Cheng CF, Clark RB, Lin JJ, Lin JL, Hoshijima M, Nguyen-Tran VT, Gu Y, Ikeda Y, Chu PH, Ross J, Giles WR, and Chien KR. A defect in the Kv channel-interacting protein 2 (KChIP2) gene leads to a complete loss of Ito and confers susceptibility to ventricular tachycardia. Cell 107: 801–813, 2001.[Web of Science][Medline]

23. Magee JC and Johnston D. A synaptically controlled, associative signal for Hebbian plasticity in hippocampal neurons. Science 275: 209–213, 1997.[Abstract/Free Full Text]

24. Migliore M, Hoffman DA, Magee JC, and Johnston D. Role of an A-type K+ conductance in the back-propagation of action potentials in the dendrites of hippocampal pyramidal neurons. J Comput Neurosci 7: 5–15, 1999.[Web of Science][Medline]

25. Nakamura TY, Nandi S, Pountney DJ, Artman M, Rudy B, and Coetzee WA. Different effects of the Ca2+-binding protein, KChIP1, on two Kv4 subfamily members, Kv4.1 and Kv4.2. FEBS Lett 499: 205–209, 2001.[Web of Science][Medline]

26. Nerbonne JM. Molecular basis of functional voltage-gated K+ channel diversity in the mammalian myocardium. J Physiol 525: 285–298, 2000.[Abstract/Free Full Text]

27. Ohya S, Morohashi Y, Muraki K, Tomita T, Watanabe M, Iwatsubo T, and Imaizumi Y. Molecular cloning and expression of the novel splice variants of K+ channel-interacting protein 2. Biochem Biophys Res Commun 282: 96–102, 2001.[Web of Science][Medline]

28. Pak MD, Baker K, Covarrubias M, Butler A, Ratcliffe A, and Salkoff L. mShal, a subfamily of A-type K+ channel cloned from mammalian brain. Proc Natl Acad Sci USA 88: 4386–4390, 1991.[Abstract/Free Full Text]

29. Reese MG, Eeckman FH, Kulp D, and Haussler D. Improved splice site detection in Genie. J Comput Biol 4: 311–323, 1997.[Web of Science][Medline]

30. Rosati B, Pan Z, Lype S, Wang HS, Cohen I, Dixon JE, and McKinnon D. Regulation of KChIP2 potassium channel {beta} subunit gene expression underlies the gradient of transient outward current in canine and human ventricle.. J Physiol 533: 119–125, 2001.[Abstract/Free Full Text]

31. Schoppa NE and Westbrook GL. Regulation of synaptic timing in the olfactory bulb by an A-type potassium current. Nat Neurosci 2: 1106–1113, 1999.[Web of Science][Medline]

32. Serôdio P, Vega-Saenz DM, and Rudy B. Cloning of a novel component of A-type K+ channels operating at subthreshold potentials with unique expression in heart and brain. J Neurophysiol 75: 2174–2179, 1996.[Abstract/Free Full Text]

33. Serôdio P and Rudy B. Differential expression of Kv4 K+ channel subunits mediating subthreshold transient K+ (A-type) currents in rat brain. J Neurophysiol 79: 1081–1091, 1998.[Abstract/Free Full Text]

34. Sheng M, Tsaur ML, Jan YN, and Jan LY. Subcellular segregation of two distinct A-type K+ channel proteins in rat central neurons. Neuron 9: 271–284, 1992.[Web of Science][Medline]

35. Song WJ, Tkatch T, Baranauskas G, Ichinohe N, Kitai S, and Surmeier DJ. Somatodendritic depolarization-activated potassium currents in rat neostriatal cholinergic interneurons are predominantly of the A type and attributable to coexpression of Kv42 and Kv41 subunits. J Neurosci 18: 3124–3137, 1998.[Abstract/Free Full Text]

36. Yeola S and Snyders DJ. Electrophysiological and pharmacological correspondence between Kv4.2 current and rat cardiac transient outward current. Cardiovasc Res 33: 540–547, 1997.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
L. M. Boland, M. M. Drzewiecki, G. Timoney, and E. Casey
Inhibitory effects of polyunsaturated fatty acids on Kv4/KChIP potassium channels
Am J Physiol Cell Physiol, May 1, 2009; 296(5): C1003 - C1014.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
G. J. Tompkins-MacDonald, W. J. Gallin, O. Sakarya, B. Degnan, S. P. Leys, and L. M. Boland
Expression of a poriferan potassium channel: insights into the evolution of ion channels in metazoans
J. Exp. Biol., March 15, 2009; 212(6): 761 - 767.
[Abstract] [Full Text] [PDF]


Home page
Learn. Mem.Home page
J. C. Alexander, C. M. McDermott, T. Tunur, V. Rands, C. Stelly, D. Karhson, M. R. Bowlby, W. F. An, J. D. Sweatt, and L. A. Schrader
The role of calsenilin/DREAM/KChIP3 in contextual fear conditioning
Learn. Mem., February 17, 2009; 16(3): 167 - 177.
[Abstract] [Full Text] [PDF]


Home page
J R Soc InterfaceHome page
J. R Clay, D. Paydarfar, and D. B Forger
A simple modification of the Hodgkin and Huxley equations explains type 3 excitability in squid giant axons
J R Soc Interface, December 6, 2008; 5(29): 1421 - 1428.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
J. Maffie and B. Rudy
Weighing the evidence for a ternary protein complex mediating A-type K+ currents in neurons
J. Physiol., December 1, 2008; 586(23): 5609 - 5623.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
H. Vacher, D. P. Mohapatra, and J. S. Trimmer
Localization and Targeting of Voltage-Dependent Ion Channels in Mammalian Central Neurons
Physiol Rev, October 1, 2008; 88(4): 1407 - 1447.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
G. C. L. Bett and R. L. Rasmusson
Modification of K+ channel-drug interactions by ancillary subunits
J. Physiol., February 15, 2008; 586(4): 929 - 950.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
D. Van Hoorick, A. Raes, and D. J. Snyders
The aromatic cluster in KCHIP1b affects Kv4 inactivation gating
J. Physiol., September 15, 2007; 583(3): 959 - 969.
[Abstract] [Full Text] [PDF]


Home page
NeuroscientistHome page
Y. Li, S. Y. Um, and T. V. Mcdonald
Voltage-Gated Potassium Channels: Regulation by Accessory Subunits
Neuroscientist, June 1, 2006; 12(3): 199 - 210.
[Abstract] [PDF]


Home page
J. Physiol.Home page
K. Ono, T. Toyono, E. Honda, and K. Inenaga
Transient outward K+ currents in rat dissociated subfornical organ neurones and angiotensin II effects
J. Physiol., November 1, 2005; 568(3): 979 - 991.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
H. H Jerng, K. Kunjilwar, and P. J Pfaffinger
Multiprotein assembly of Kv4.2, KChIP3 and DPP10 produces ternary channel complexes with ISA-like properties
J. Physiol., November 1, 2005; 568(3): 767 - 788.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
K. J. Rhodes, K. I. Carroll, M. A. Sung, L. C. Doliveira, M. M. Monaghan, S. L. Burke, B. W. Strassle, L. Buchwalder, M. Menegola, J. Cao, et al.
KChIPs and Kv4 {alpha} Subunits as Integral Components of A-Type Potassium Channels in Mammalian Brain
J. Neurosci., September 8, 2004; 24(36): 7903 - 7915.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/1/C161    most recent
00416.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (21)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Boland, L. M.
Right arrow Articles by O'Grady, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boland, L. M.
Right arrow Articles by O'Grady, S. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the American Physiological Society.