|
|
||||||||
MEMBRANE TRANSPORTERS, ION CHANNELS, AND PUMPS
1Department of Neuroscience, University of Minnesota, Minneapolis, Minnesota 55455; 2Department of Physiology, Virginia Commonwealth University, Richmond, Virginia 23298; and Departments of 3Physiology and 4Animal Science, University of Minnesota, St. Paul, Minnesota
Submitted 9 September 2002 ; accepted in final form 17 March 2003
| ABSTRACT |
|---|
|
|
|---|
inactivation; gating; mutagenesis; K channel-interacting protein; exon
-subunits that coassociate with one or more modulatory
subunits. A family of cytoplasmic K channel interacting proteins known as
KChIPs was found to coassociate with transient voltage-gated potassium
channels of the Kv4 (Shal) gene family. The KChIP subunits associate
with the amino-terminal region of Kv4
-subunits, enhance Kv4 channel
expression, and alter inactivation gating by complex mechanisms
(2,
4,
6,
16,
25). All KChIP subunits are
members of the neuronal calcium sensor family of proteins and possess a
conserved "core" region with EF-hand domains, which suggests a
role for cytoplasmic calcium in the regulation of Kv4 channel function
(2,
8). The amino-terminal regions
of KChIPs are variable and may contribute to functional differences. However,
the structural basis for the complex modulatory functions of KChIP proteins is
largely unexplored.
KChIP proteins coimmunoprecipitate and coimmunolocalize with Kv4
-subunits in brain and heart tissue
(2). KChIPs are, therefore,
important and perhaps essential subunits of native Kv4 channels that comprise
a major class of transient, A-type K channels in the nervous system
(5,
28,
32,
33,
35), and contribute to the
transient outward K current (Ito) in heart
(12,
13,
20,
36). The biophysical
properties of Kv4 channels are important for their special functions in
excitable cells. Kv4 channels activate in the subthreshold range of
depolarization and undergo rapid inactivation at membrane potentials close to
the action potential firing threshold. Inactivation from closed gating states
(3,
18,
19) causes the inhibition of K
channel activity without the requirement for channel opening. This important
property distinguishes neuronal Kv4 channels from other types of inactivating
K channels and gives them a unique role of regulating signal amplification in
the postsynaptic somatodendritic compartments where they localize
(21,
34,
35). Rapid inactivation of K
channels with subthreshold excitatory postsynaptic potential (EPSPs)
contributes to the regulation of repetitive firing
(10) and may truncate fast
glutamatergic synaptic transmission, allowing prolonged inhibitory synaptic
transmission at dendrodendritic synapses in the olfactory bulb
(31). Furthermore, the rapid
inactivation of dendritic Kv4 channels with subthreshold EPSPs may prevent
action potential backpropagation, resulting in dendritic spike amplification
sufficient for the induction of synaptic plasticity by associative mechanisms
(14,
23,
24). In heart, the rapid
inactivation of Kv4 channels is responsible for the initial phase of
repolarization and contributes to the magnitude of the cardiac action
potential (12,
20,
26). KChIP subunit modulation
of the stability of Kv4 channel inactivated gating states
(2,
4,
6) is therefore critical for
the functional roles of K channels in brain and heart.
In addition to the modulation of intrinsic channel gating mechanisms, KChIP subunits may also contribute to the regulation of Kv4 channel gating by cytoplasmic messengers (15). Evidence suggests that KChIPs may influence native Kv4 protein trafficking or stability because coexpression of KChIPs with Kv4 subunits results in enhanced current magnitude in oocytes or mammalian cells (2, 4, 6, 11, 25) and KChIP2-deficient mice lack the ventricular Ito current (22).
Amino-terminal splice-variants of the four known KChIP genes appear to have distinct differences in the quantitative features of gating modulation, suggesting that the NH2-terminal region of KChIP proteins is a critical determinant in modulating Kv4 channel function. The identification and functional description of new Kv4 modulatory subunits is important for our understanding of the diversity of regulation of rapidly inactivating K channels in neurons and cardiac muscle.
In this article, we describe the cloning, tissue distribution, and functional analysis of a novel KChIP1 isoform (KChIP1b). Expression of KChIP1b, as well as a previously described KChIP1 splice-form (KChIP1a) in brain and heart muscle, was characterized by semiquantitative RT-PCR. The functional properties of KChIP1b and an NH2-terminal deletion mutant were studied by coexpression with Kv4.2 in Xenopus oocytes. These KChIP isoforms have distinct functional influences on K channel inactivation gating, which is at least partly regulated by the KChIP NH2-terminal region. Conservation of the exon that encodes for KChIP1b suggests the NH2 terminus of KChIP proteins may be important to K channel function in all mammals.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Bioinformatic analysis. The full-length KChIP1b sequence, as well as the 33-nucleotide region comprising the alternatively retained exon, were compared with sequences in GenBank and at ENSEMBL using the BLASTN and BLASTX algorithms (1). Mouse, human, and rat KChIP1 genes were identified by BLASTN using the ENSEMBL genome browser and analyzed by the splice-site prediction algorithm NNSSP (29).
Construction of KChIP1b NH2-terminal
deletion mutant. The rKChIP1b
2131 mutant was constructed
using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA)
with primers designed to loop out the nucleotides encoding for amino acid
residues 2131 from the rKChIP1b template DNA. The forward primer was
5'-(CAAAGGCGACCCTCTAAAGACA)-
-(AGATCGAG)-3', and the reverse
primer was -5'-(CTCGATCT)-
-(TGTCTTTAGAGGGTCGCCTTTG)-3'
where the sequences flanking the deleted residues (
) are indicated by
parentheses. Thermocycling parameters consisted of denaturing at 95°C (30
s), annealing at 60°C (50 s), and extension at 68°C (16 min) for 18
cycles. Deletion mutagenesis was confirmed by DNA sequencing. For comparison,
a rat KChIP1a clone without the NH2-terminal insert (accession no.
AY082658
[GenBank]
; a kind gift from K. Takimoto, Pittsburg, PA) was sequenced and
functionally tested.
Expression of Kv4 channels in oocytes. Plasmids containing the cDNAs encoding for Kv4.2 and KChIP subunits were linearized and capped RNAs were synthesized in vitro using Ambion (Austin, TX) MessageMachine RNA polymerase kits. RNA was purified by use of the RNAid kit (Bio 101, Vista, CA) and stored at 80°C in diethyl pyrocarbonate (DEPC)-treated water. Transcription reaction products were checked for size by agarose gel electrophoresis, and RNA concentrations were determined by spectrophotometry using the equation: 1 A260 = 40 µg/ml RNA.
Oocytes were harvested from Xenopus laevis (Xenopus I, Dexter, MI), previously injected by the supplier with human chorionic gonadotropin. Female frogs were anesthetized by immersion in 0.2% 3-aminobenzoic acid ethyl ester (Sigma Chemical), and ovarian lobes were surgically removed. Oocytes were released by gentle agitation for 11.5 h in 1 mg/ml collagenase D (Boehringer-Mannheim) or 15 min in 0.15 mg/ml collagenase 1A (Sigma-Aldrich) dissolved in a Ca2+-free OR-2 solution containing (in mM) 96 NaCl, 2 KCl, 1 MgCl2, 5 HEPES, pH 7.4 with NaOH. Subsequently, oocytes were extensively washed with Ca2+-free OR-2, and stage V and VI oocytes were injected the same day or the following day with 50 nl of RNA dissolved in DEPC-treated water (5 ng Kv4.2 ± 531 ng KChIP). Oocytes were maintained at 1718°C in a frog Ringer's solution of (in mM) 96 NaCl, 1 KCl, 1 CaCl2, 2 MgCl2, 10 HEPES, and 2 Na-pyruvate, pH 7.4 with NaOH, with 50 U/ml penicillin G and 50 µg/ml streptomycin. Electrophysiological recordings began at 2 days postinjection.
Electrophysiology. Kv4 potassium currents were recorded from
oocytes with a two-electrode voltage clamp using a Geneclamp 500B amplifier
(Axon Instruments, Foster City, CA). Voltage-measuring and current-passing
electrodes were filled with 3 M KCl and had resistances between 0.3 and 1.0
M
. Currents were sampled at 510 kHz and filtered at 12
kHz. All recordings were done at room temperature (about 22°C). Oocytes
were clamped at 90 or 100 mV and voltage protocols to study
channel gating were applied, as described in RESULTS. Oocytes were
perfused continuously with an external solution containing (in mM) 96 NaCl, 2
KCl, 2 CaCl2, 1 MgCl2, 10 HEPES, pH 7.4 with NaOH. Data
were recorded on Pentium computers equipped with Digidata 1320A (Axon
Instruments) analog-to-digital hardware. Axon's Clampex acquisition and
Clampfit analysis software (version 8) were used. Leak subtraction used P/-4
or P/-6 pulses from a holding potential of 90 or 100 mV. Data
were also transferred to Microsoft Excel and Microcal Origin v. 6.0
(Northhampton, MA) for additional analysis, curve-fitting, and the production
of figures. Exponential fitting was done using a Levenberg-Marquardt searching
algorithm with a sum of squared errors (in Clampfit) or a
-square (in
Origin) minimization method. In fitting the data to exponential functions, we
compared mathematical models incorporating up to five exponential functions.
The best model was determined from an F-statistic, using a confidence
level of 0.999. When two models could not be discriminated by this statistical
test, we compared the correlation coefficient for each model and selected the
model that showed an improvement in the correlation to the data. Statistical
analysis of the fitted parameters from the complete data sets used one-way
ANOVA with the Scheffé method of posthoc analysis. Differences were
determined to be statistically significant if P < 0.01. All data
are expressed as means ± SE.
Tissue distribution of KChIP isoforms by RT-PCR. Freshly dissected brain, heart, and liver tissues were pooled from four adult rats, and total RNA was extracted using TRIzol reagent (GIBCO BRL). RNA (0.24 µg) from each tissue was reverse-transcribed using random hexamer primers and the Superscript II reverse transcription kit (GIBCO BRL). The complete set of primers used in this study is shown in Table 1. Primers for KChIP2 were designed to detect a common region for KChIP2a (accession no. AF269283 [GenBank] ) and KChIP2b (AF269284 [GenBank] ). Primers for KChIP3 were designed to detect a conserved region (AB043892 [GenBank] ). Detection of the KChIP1b transcript in the different tissue sources was done using cycle conditions of 94°C for 4 min, followed by 94°C for 45 s, annealing temperature in degrees Celsius (see Table 1) for 45 s, and 72°C for 1 min for 30 cycles. To discriminate the two KChIP1 splice forms in RNA samples from brain, we used a set of nonspecific (pan-) KChIP1 primers (see Table 1) and ran the RT-PCR products on a 12% polyacrylamide gel. PCR conditions were denaturated at 94°C for 2 min, followed by 94°C for 20 s, annealing at 62°C for 20 s, and extension at 72°C for 2 min for 20 cycles. To quantify the relative amounts of the KChIP1a and 1b transcripts in a tissue sample, we used an RNA dilution series and quantified the band intensities using Image J software from NIH. RNA integrity and gel loading were verified by RT-PCR using primers for rat GAPDH, designed according to Horikoshi and Sakakibara (17). PCR products for all KChIPs were gel-purified using the QIAquick gel extraction kit or QIAEX II (Qiagen), ligated into pGEM-T plasmid (Promega), and sequenced to confirm PCR product identity.
|
| RESULTS |
|---|
|
|
|---|
An amino acid alignment (Fig. 1A) of rat brain KChIP1b with rat brain KChIP1a shows that KChIP1b possesses a novel 11-residue NH2-terminal region, not present in the previously isolated shorter form of KChIP1. Query of the EST (Expressed Sequence Tag) database at NCBI using the 33-bp exon revealed a mouse transcript spliced in a manner identical to rat KChIP1b. To determine the degree to which this exon is conserved in mammals, the KChIP1 gene from mouse (chromosome 11; gene identifier ENSMUSG-00000040574), human (chromosome 5; ENSG00000164431), and rat (chromosome 10; RNOR01500851) was compared (Fig. 1B). The sequence surrounding this exon is nearly identical in these three species, with splice-acceptor and splice-donor sequences consistent with known vertebrate consensus splice junctions (7). A neural network-based splice-site prediction algorithm (NNSSP) was used to assess the degree to which mouse and rat splice junctions identified for the novel exon, as well as previously described exons, conform to a training set of eukaryotic splice sites (29). For the novel exon, the sequences surrounding the predicted splice-donor and splice-acceptor sites conform to the training set with 89 and 99% likelihood, respectively. The splice-donor score for the novel exon is close to that for all previously described exons and substantially exceeds that for exon 4, which possesses only 26% likelihood. The splice-acceptor score for the novel exon is similar to the other exons but exceeds the scores for exons 6 and 7 (71 and 88%, respectively). Recently, two other laboratories independently identified the longer KChIP1b isoform containing a 33-bp NH2-terminal insert sequence identical to the sequence shown in the present study (mouse: AY050525 [GenBank] and rat: AY082657 [GenBank] ). The novel exon is absent in the shorter KChIP1a isoform, a transcript originally identified in human brain (Ref. 2; NM_014592 [GenBank] ) and subsequently identified in rat (AY082658 [GenBank] ) and mouse (AY050526 [GenBank] ).
|
To determine the relative abundance of the KChIP1a and KChIP1b mRNAs, brain
and heart tissue were analyzed by semiquantitative RT-PCR with 20 cycles (see
MATERIALS AND METHODS) (Fig.
2). In addition to size determination, the PCR products were
purified from the gel and sequenced to confirm their identity. The results
indicate that KChIP1b is a prominent KChIP1 isoform in the brain and that the
relative ratio for KChIP1b/KChIP1a is
1.0 for RNA isolated from adult rat
cerebellum (Fig. 2c).
Thus the relative abundance of the two transcripts remains similar despite the
change in initial RNA concentration, and the quantitation of signal intensity
is within the linear concentration range. We did not detect KChIP1 transcripts
in cardiac ventricle despite the concentration-dependent detection of GAPDH
transcripts in the same RNA samples, confirming RNA integrity
(Fig. 2B).
|
To determine the distribution of KChIP1b in native tissue, reverse transcription PCR was used on RNA isolated from different rat tissue sources, using a PCR primer pair designed to detect the novel NH2-terminal region specific to KChIP1b. KChIP1b was detected in all four brain regions tested (cerebellum, hippocampus, striatum, and cerebral cortex) but was not detected in liver, ventricle, or atria despite the presence of a strong GAPDH signal in these RNA samples (Fig. 3). The KChIP2 primers were designed to amplify a region common to KChIP2a and 2b, and we resolved only the single predicted band. Expression of KChIP2 was detected in all brain tissues tested and also ventricle and atrium, but the signal appeared to be lower in liver. KChIP3 was also identified in all tissues tested, although the signal in liver was weak. The PCR products were purified from the gel and sequenced to confirm their identity. The KChIP1b-specific primers resolved a single PCR product, and direct sequencing of the gel-purified product confirmed that it was KChIP1b.
|
We tested the modulatory function of rKChIP1b by coexpression with rat
Kv4.2 in Xenopus oocytes
(Fig.4A). Injection of
oocytes with Kv4.2 RNA alone results in fast inactivating A-type K currents.
The current magnitude, however, was small in both oocytes
(Fig. 4B) and
transfected mammalian cells (data not shown). However, heterologous A-type K
current magnitude in the oocytes was enhanced three- to sixfold by
coexpression with KChIP1b. To examine the role of the novel KChIP1b
NH2 terminus in the modulatory functions of KChIP1b, we tested a
deletion mutant, KChIP1b
2131 (hereafter, KChIP1b
N or
1b
N). We observed a similar three- to sixfold increase in the magnitude
of the Kv4.2 current upon coexpression with KChIP1b
N, as well as the
KChIP1a subunit, which was studied for comparison. These results suggest that
KChIP1b and KChIP1a produce comparable effects on the enhancement of Kv4
current amplitude and that the novel NH2-terminal region of KChIP1b
was not essential for this function. We did not explore the mechanism of
current enhancement by any of the KChIP subunits.
|
Kv4.2 inactivation, elicited by depolarizations that open the channels, was
slowed by coexpression with wild-type KChIP1b
(Fig. 4B,
inset), as expected for a member of this family of modulatory
subunits. We examined macroscopic inactivation kinetics using a series of test
potentials in oocytes expressing the homomeric Kv4.2 or heteromeric
Kv4.2/KChIP1b channels. To measure the quantitative aspects of this
modulation, the decaying K current during a pulse of 1-s duration from
90 to +40 mV was fitted to a mathematical model that used a sum of
three exponential terms. The fast time constant of current decay (term 1,
1) represents largely the gating transitions from open
conducting states to open inactivated states. However, the slower components
represent a complex contribution of gating transitions from open inactivated
to closed inactivated states, as well as other gating transitions
(3,
19). For each construct
tested, the fitted exponential time constants for the fast, intermediate, and
slow components were compared (Fig.
4C). Each of the fitted terms that describe Kv4.2 current
decay during a long test depolarization was modestly slowed by KChIP1b,
KChIP1b
N, or KChIP1a. Deletion of the novel NH2-terminal
region of KChIP1b retained the subunit's modulation of Kv4.2 current decay,
and the quantitative features of the modulation were not significantly
different from the modulation induced by wild-type KChIP1b or KChIP1a. To
quantify the relative contribution of the three time constants to the decaying
currents, we also assessed the amplitude of the current fitted by each
exponential term (Fig.
4D). Coexpression of KChIP1b with Kv4.2 reduced the
relative amplitude of the fast component of current decay (
1)
while enhancing the relative amplitude of the intermediate and slow components
of decay (
2 and
3). The analysis shows that
KChIP1b
N and KChIP1a followed this same trend and that there were no
systematic differences that were impacted by the presence or absence of the
novel NH2-terminal region of KChIP1b. Although it is not possible
to directly assign the fitted time constants to individual gating transitions,
the lack of significant changes in the fast time constant of decay
(
1) in KChIP1b-modulated currents compared with
KChIP1b
N or KChIP1a indicates that the novel 11-amino acid region in
the KChIP1b NH2 terminus does not regulate the equilibrium between open to
open-inactivated transitions.
Although early inactivation transitions after Kv4.2 channel opening reflect
transitions to open inactivated gating states, prolonged membrane
depolarization maximizes occupancy of closed inactivated states
(3,
19). To examine more directly
the entry of Kv4.2 channels into closed inactivated states, we used a modified
two-pulse protocol with a variable duration, 50 mV conditioning
potential that elicited <10% of the maximal Kv4.2 conductance
(Fig. 6A). The
development of closed-state inactivation
(Fig. 5A) occurred
with a time constant of 596 ± 49.9 ms (n = 10) for Kv4.2
channels and was significantly accelerated by almost fourfold upon
coexpression with KChIP1b (
= 169 ± 14.8 ms, n = 8).
Coexpression of Kv4.2 channels with the mutant KChIP1b
N resulted in
currents with an intermediate rate of closed-state inactivation (
= 333
± 23.3 ms, n = 17), which was significantly different from
both Kv4.2 alone and the wild-type KChIP1b-modulated channels. KChIP1a, which
naturally lacks the region deleted in KChIP1b
N, modulated closed-state
inactivation with no significant quantitative differences from the deletion
mutant (243 ± 22.0 ms, n = 8). These results suggest that the
unique NH2-terminal region of the KChIP1b protein may contribute to
the rate of access of inactivated states from preopen, closed gating
states.
|
|
Recovery from inactivation was about 2.5-fold faster for KChIP1b-regulated
currents than for Kv4.2 alone (Fig.
5B). This was first measured using a standard two-pulse
protocol with a holding and interpulse potential of 90 mV and two-step
depolarizations to +40 mV, separated by a variable interpulse interval. The
fraction of the maximum (pulse 1) current recovered in response to
the second pulse is a measure of the time-dependent recovery of K channel
availability. During the 1-s-long pulse to +40 mV, the Kv4.2 current decays to
almost zero, maximizing the occupancy of inactivated states accessed through
transitions from both open and closed gating states. Both KChIP1b (
= 140
± 12.4 ms, n = 12) and KChIP1b
N (
= 110 ±
7.57 ms, n = 14) produced a modest, but significant (ANOVA,
P < 0.01), enhancement in the rate of recovery from inactivation
measured for Kv4.2 channels alone (
= 297 ± 24.8 ms, n =
11). Using this protocol, differences in the modulation by wild-type or mutant
KChIP1b were not significant. Likewise, KChIP1a modulation of the rate of
recovery from inactivation (
= 110 ± 8.15 ms, n = 8) was
not different from that measured for KChIP1b
N or wild-type KChIP1b.
To measure more directly the kinetics of recovery from closed-state
inactivation, we used a long (7 s) conditioning pulse to 50 mV to allow
accumulation of the channels in closed inactivated states, followed by a
variable duration recovery pulse (Fig.
5C). It has been shown previously that during prolonged
depolarizations, Kv4.2 channels, studied as naked
-subunit tetramers,
largely accumulate in closed inactivated state(s), from which they directly
recover, bypassing the open state
(3). Recovery from closed-state
inactivation occurred with a time constant of 664 ± 58.8 ms for Kv4.2
channels expressed alone (n = 11). At least 20% of the current
elicited in the first pulse could not be recovered in the second pulse using
this protocol. Coexpression with KChIP1b did not significantly alter the rate
of Kv4.2 channel recovery from closed-state inactivation (
= 458 ±
29.2 ms, n = 6) or the maximum recoverable current. However, deletion
of the novel NH2 terminus of KChIP1b accelerated both the rate of
recovery (
= 242 ± 19.8 ms, n = 9) and increased the
maximum recoverable current to 90% of the current elicited in the first pulse
(Fig. 5C). We further
tested that the deletion of the NH2 terminus was critical to this
change and found that the KChIP1a subunit enhanced the rate of recovery and
magnitude of current recovered from closed-state inactivation (
= 312
± 30.3 ms, n = 8), results that were not significantly
different from those for KChIP1b
N.
Kv4.2/KChIP1b conductance-voltage curves showed a modest but statistically
significant leftward shift compared with Kv4.2 alone
(Fig. 6A; P
< 0.01). The voltage dependence of activation gating was determined by
measuring the peak, macroscropic K current elicited by a family of step
depolarizations. Current values were converted to conductances and normalized
according to a Goldman-Hodgkin-Katz formulation that avoids the presumption
that the current-voltage relationship for Kv4 channels is linearly related to
the driving force, Vm EK, as
explained by Clay (9). For
comparison, we also performed the analysis with the assumption of linearity
and found the same modest voltage shift induced by KChIP1b coexpression, but
with quantitative differences in the values for the fitted parameters,
V
and the slope k (not shown). Steady-state
activation of Kv4.2 channels was thus shifted by
10 mV in the
hyperpolarizing direction upon coexpression with wild-type KChIP1b or mutant
KChIP1b
N (Fig.
6A). We also measured the kinetics of the rising phase of
the activated current following P/-4 or P/-6 subtraction of the capacitative
transients elicited by the step depolarization. We found no significant
differences in the time constants of activation for Kv4.2, Kv4.2/KChIP1b, or
Kv4.2/KChIP1b
N currents for any of the voltages for which measurements
could be obtained (Fig.
6B).
| DISCUSSION |
|---|
|
|
|---|
KChIP1b modulation of Kv4.2 inactivation kinetics can be explained by changes in the stability of open-state inactivation. Simultaneously, we found that Kv4.2 closed-state inactivation was accelerated by KChIP1b coexpression. Our results are thus in general agreement with those recently reported for KChIP1a modulation of Kv4 channel inactivation gating (6) and suggest opposing effects of KChIP1 subunits on the mechanisms that regulate inactivation from conducting and nonconducting states of the channel.
The magnitude of modulation by KChIP1b or KChIP1a of the rate of recovery
from inactivation for Kv4.2 channels (
2.5-fold faster;
Fig. 5B) is smaller
than first reported (2) for
either hKChIP1a regulation of rKv4.2 channels expressed in Chinese hamster
ovarian (CHO) cells (approximately fivefold faster) or hKChIP1a regulation of
hKv4.3 channels expressed in oocytes (approximately ninefold faster). Our
results, however, are closer to those recently reported for the KChIP1a
isoform, which induced a 2.5- to 4-fold acceleration of recovery from
inactivation for Kv4.3 and Kv4.1 channels (respectively) studied in oocytes
(6). For comparison, we also
measured the rate of recovery from inactivation for Kv4.2 channels modulated
by coexpression of the related rat KChIP2. Compared with our results from the
coexpression of rKv4.2 plus rKChIP1b, the KChIP2 subunit had a stronger effect
on the recovery from inactivation with a fitted
recovery of 16
ms (data not shown),
13-fold faster than for Kv4.2 channels alone and
7-fold faster than for KChIP1-modulated channels. This suggests that
quantitative differences in the modulation of inactivation gating by the
different KChIP isoforms may depend on structural differences in the KChIP
proteins, including differences in amino-terminal splicing. This hypothesis is
also supported by recent evidence that a unique NH2-terminal region
of the KChIP4a subunit (residues 244) controls the modulation of Kv4
channel inactivation gating
(16).
We found that deletion of the novel NH2 terminus of KChIP1b
alters only the subunit's modulation of the rate of entry into and recovery
from closed inactivated gating states, which are likely to become populated
during subthreshold depolarizations. In the absence of additional, significant
differences in the modulatory properties of KChIP1b and KCHIP1b
N, we
conclude that the alternatively spliced NH2-terminal region
contributes to the regulation of closed inactivated gating transitions. This
study thus identifies a new role for the variable NH2-terminal
region of KChIP proteins and provides another example
(16) that the structural
diversity in this region is important in the regulation of the specific gating
properties of Kv4 channels. Because closed inactivation gating regulates
dendritic signal amplification and synaptic plasticity in the nervous system
and cardiac action potential amplitude (see Introduction), identifying the
structures that regulate the stability of these inactivated gating states is
important to our understanding of the function of Kv4 channels in brain and
heart.
KChIP1b induces a modest leftward shift in the Kv4.2 conductance-voltage relationship (Fig. 6). Unlike the reproducible effects of KChIPs on inactivation gating of Kv4 channels, the reported effects of KChIPs on activation gating are more variable. It was first shown that KChIP1, 2 or 3 shift Kv4.2 activation gating by 30 to 40 mV in whole cell recordings from transfected CHO cells, but not in oocytes (2). These large changes in steady-state activation have not been confirmed. Other studies suggest that KChIP2 introduces a +9-mV shift in Kv4 channel activation gating in mammalian cells (4), whereas KChIP1a is reported to shift by 21 mV the voltage dependence of activation gating of Kv4.2 channels studied in oocytes (25). In contrast, Beck and colleagues (6) recently reported that the same KChIP1a does not significantly alter the activation gating of Kv4.1 or Kv4.3 channels expressed in oocytes. Additional studies of activation gating, including the study of gating currents, are needed to clarify the role of KChIP subunits in the modulation of channel activation.
Our tissue expression studies support the idea that KChIP1b is brain specific, whereas the KChIP2 and 3 genes are less restricted in their expression (Fig. 3). The related KChIP1a has been identified by RT-PCR, Northern blot, or RNAse protection assay in human heart (27), but not in rat (Fig. 2B and Refs. 2 and 27), mouse (27), or canine (30) heart. KChIP2 has been detected in brain and heart from human, rat, mouse, and dog (Fig. 3 and Refs. 2, 27, and 30). KChIP3 was detected in brain tissue from all species tested (Fig. 3 and Refs. 2, 27, and 30), as well as in human and rat heart (Fig. 3 and Refs. 2 and 27). The conservation of the KChIP1b-specific exon and flanking sequences in rodent and human KChIP1 genes (Fig. 1B) suggests a role for the KChIP1b isoform in mammalian Kv4 channel function. Although the precise tissue distribution in mouse and human remains to be determined, the rat KChIP1b isoform appears to be a brain-specific modulator of Kv4 channel function.
The functions of native A-type K channels are critically dependent on activation voltage dependence, mechanisms, and rates of inactivation and time-dependent recovery from inactivation. Kv4 channels and partner subunits such as KChIPs may comprise the A-type current in somatodendritic compartments and Ito in cardiac myocytes. KChIPs may, therefore, be candidate genes for disorders of cellular excitability and may be subject to altered regulation in disease, aging, or different physiological states. The ability of KChIPs to fine-tune the gating processes of the pore-forming Kv4 subunits suggests that KChIPs are potentially important therapeutic targets for drugs designed to treat neuronal or cardiac excitability disorders. The structural bases of the KChIP modulation of Kv4.2 channel gating remain to be fully elucidated; our data suggest a role for the alternatively spliced amino-terminal region in the modulation of closed inactivated gating transitions.
| ACKNOWLEDGMENTS |
|---|
This work was supported by National Institute of Neurological Disorders and Stroke Grant NS-34379 (to L. M. Boland) and the Minnesota Medical Foundation (to L. M. Boland).
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
2. An WF, Bowlby MR, Betty M, Cao J, Ling HP, Mendoza G, Hinson JW, Mattsson KI, Strassle BW, Trimmer JS, and Rhodes KJ. Modulation of A-type potassium channels by a family of calcium sensors. Nature 403: 553556, 2000.[Medline]
3. Bähring R,
Boland LM, Varghese A, Gebauer M, and Pongs O. Kinetic analysis of open-
and closed-state inactivation transitions in human Kv4.2 A-type potassium
channels. J Physiol 535:
6581, 2001.
4. Bähring R,
Dannenberg J, Peters HC, Leicher T, Pongs O, and Isbrandt D. Conserved Kv4
N-terminal domain critical for effects of Kv channel-interacting protein 2.2
on channel expression and gating. J Biol Chem
276: 2388823894,
2001.
5. Baldwin TJ, Tsaur ML, Lopez GA, Jan YN, and Jan LY. Characterization of a mammalian cDNA for an inactivating voltage-sensitive K+ channel. Neuron 7: 471483, 1991.[Web of Science][Medline]
6. Beck EJ, Bowlby
M, An WF, Rhodes KJ, and Covarrubias M. Remodelling inactivation gating of
Kv4 channels by KChIP1, a small-molecular-weight calcium-binding protein.
J Physiol 538:
691706, 2002.
7. Breathnach R and Chambon P. Organization and expression of eucaryotic split genes coding for proteins. Annu Rev Biochem 50: 349383, 1981.[Web of Science][Medline]
8. Burgoyne RD and Weiss JL. The neuronal calcium sensor family of Ca2+-binding proteins. Biochem J 353: 112, 2001.[Web of Science][Medline]
9. Clay JR. Determining K+ channel activation curves from K+ channel currents. Eur Biophys J J.29: 555557, 2000.[Web of Science][Medline]
10. Connor JA and Stevens CF. Voltage clamp studies of a transient outward membrane current in gastropod neural somata. J Physiol 215: 2130, 1971.
11. Decher N,
Uyguner O, Scherer CR, Karaman B, Yuksel-Apak M, Busch AE, Steinmeyer K, and
Wollnik B. hKChIP2 is a functional modifier of hKv4.3 potassium channels.
Cloning and expression of a short hKChIP2 splice variant.
Cardiovasc Res 52:
255264, 2001.
12. Dixon JE, Shi W, Wang HS, McDonald C, Yu H, Wymore RS, Cohen IS, and MacKinnon D. Role of the Kv4.2 K+ channel in ventricular muscle. A molecular correlate for the transient outward current. Circ Res 79: 659668.
13. Guo W, Li H,
London B, and Nerbonne JM. Functional consequences of elimination of
Ito,f and Ito,s: early after depolarizations,
atrioventricular block, and ventricular arrhythmias in mice lacking Kv1.4 and
expressing a dominant-negative Kv4
subunit. Circ
Res 87:
7379, 2000.
14. Hoffman DA, Magee JC, Colbert CM, and Johnston D. K+ channel regulation of signal propagation in dendrites of hippocampal pyramidal neurons. Nature 387: 869875, 1997.[Medline]
15. Holmqvist MH,
Cao J, Knoppers MH, Jurman ME, Distefano PS, Rhodes KJ, Xie Y, and An WF.
Kinetic modulation of Kv4-mediated A-current by arachidonic acid is dependent
on potassium channel interacting proteins. J Neurosci
21: 41544161,
2001.
16. Holmqvist MH,
Cao J, Hernandez-Pineda R, Jacobson MD, Carroll KI, Sung MA, Betty M, Ge P,
Gilbride KJ, Brown ME, Jurman ME, Lawson D, Silos-Santiago I, Xie Y,
Covarrubias M, Rhodes KJ, Distefano PS, and An WF. Elimination of fast
inactivation in Kv4 A-type potassium channels by an auxiliary subunit domain.
Proc Natl Acad Sci USA 99:
10351040, 2002.
17. Horikoshi T and Sakakibara M. Quantification of relative mRNA expression in the rat brain using simple RT-PCR and ethidium bromide staining. J Neurosci Methods 99: 451, 2000.
18. Jerng HH and Covarrubias M. K+ channel inactivation mediated by the concerted action of the cytoplasmic N- and C-terminal domains. Biophys J 72: 163174, 1997.[Web of Science][Medline]
19. Jerng HH,
Shahidullah M, and Covarrubias M. Inactivation gating of Kv4 potassium
channels: molecular interactions involving the inner vestibule of the pore.
J Gen Physiol 113:
641660, 1999.
20. Johns DC, Nuss
HB, and Marban E. Suppression of neuronal and cardiac transient outward
currents by viral gene transfer of dominant-negative Kv4.2 constructs.
J Biol Chem 272:
3159831603, 1997.
21. Johnston D,
Hoffman DA, Magee JC, Poolos NP, Watanabe S, Colbert CM, and Migliore M.
Dendritic potassium channels in hippocampal pyramidal neurons. J
Physiol 525:
7581, 2000.
22. Kuo HC, Cheng CF, Clark RB, Lin JJ, Lin JL, Hoshijima M, Nguyen-Tran VT, Gu Y, Ikeda Y, Chu PH, Ross J, Giles WR, and Chien KR. A defect in the Kv channel-interacting protein 2 (KChIP2) gene leads to a complete loss of Ito and confers susceptibility to ventricular tachycardia. Cell 107: 801813, 2001.[Web of Science][Medline]
23. Magee JC and
Johnston D. A synaptically controlled, associative signal for Hebbian
plasticity in hippocampal neurons. Science
275: 209213,
1997.
24. Migliore M, Hoffman DA, Magee JC, and Johnston D. Role of an A-type K+ conductance in the back-propagation of action potentials in the dendrites of hippocampal pyramidal neurons. J Comput Neurosci 7: 515, 1999.[Web of Science][Medline]
25. Nakamura TY, Nandi S, Pountney DJ, Artman M, Rudy B, and Coetzee WA. Different effects of the Ca2+-binding protein, KChIP1, on two Kv4 subfamily members, Kv4.1 and Kv4.2. FEBS Lett 499: 205209, 2001.[Web of Science][Medline]
26. Nerbonne JM. Molecular basis of functional voltage-gated
K+ channel diversity in the mammalian myocardium. J
Physiol 525:
285298, 2000.
27. Ohya S, Morohashi Y, Muraki K, Tomita T, Watanabe M, Iwatsubo T, and Imaizumi Y. Molecular cloning and expression of the novel splice variants of K+ channel-interacting protein 2. Biochem Biophys Res Commun 282: 96102, 2001.[Web of Science][Medline]
28. Pak MD, Baker
K, Covarrubias M, Butler A, Ratcliffe A, and Salkoff L. mShal, a
subfamily of A-type K+ channel cloned from mammalian brain.
Proc Natl Acad Sci USA 88:
43864390, 1991.
29. Reese MG, Eeckman FH, Kulp D, and Haussler D. Improved splice site detection in Genie. J Comput Biol 4: 311323, 1997.[Web of Science][Medline]
30. Rosati B, Pan
Z, Lype S, Wang HS, Cohen I, Dixon JE, and McKinnon D. Regulation of
KChIP2 potassium channel
subunit gene expression underlies the gradient
of transient outward current in canine and human ventricle.. J
Physiol 533:
119125, 2001.
31. Schoppa NE and Westbrook GL. Regulation of synaptic timing in the olfactory bulb by an A-type potassium current. Nat Neurosci 2: 11061113, 1999.[Web of Science][Medline]
32. Serôdio P, Vega-Saenz DM, and Rudy B. Cloning of a novel
component of A-type K+ channels operating at subthreshold
potentials with unique expression in heart and brain. J
Neurophysiol 75:
21742179, 1996.
33. Serôdio P and Rudy B. Differential expression of Kv4 K+ channel subunits
mediating subthreshold transient K+ (A-type) currents in rat brain.
J Neurophysiol 79:
10811091, 1998.
34. Sheng M, Tsaur ML, Jan YN, and Jan LY. Subcellular segregation of two distinct A-type K+ channel proteins in rat central neurons. Neuron 9: 271284, 1992.[Web of Science][Medline]
35. Song WJ, Tkatch
T, Baranauskas G, Ichinohe N, Kitai S, and Surmeier DJ. Somatodendritic
depolarization-activated potassium currents in rat neostriatal cholinergic
interneurons are predominantly of the A type and attributable to coexpression
of Kv42 and Kv41 subunits. J Neurosci
18: 31243137,
1998.
36. Yeola S and
Snyders DJ. Electrophysiological and pharmacological correspondence
between Kv4.2 current and rat cardiac transient outward current.
Cardiovasc Res 33:
540547, 1997.
This article has been cited by other articles:
![]() |
L. M. Boland, M. M. Drzewiecki, G. Timoney, and E. Casey Inhibitory effects of polyunsaturated fatty acids on Kv4/KChIP potassium channels Am J Physiol Cell Physiol, May 1, 2009; 296(5): C1003 - C1014. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Tompkins-MacDonald, W. J. Gallin, O. Sakarya, B. Degnan, S. P. Leys, and L. M. Boland Expression of a poriferan potassium channel: insights into the evolution of ion channels in metazoans J. Exp. Biol., March 15, 2009; 212(6): 761 - 767. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Alexander, C. M. McDermott, T. Tunur, V. Rands, C. Stelly, D. Karhson, M. R. Bowlby, W. F. An, J. D. Sweatt, and L. A. Schrader The role of calsenilin/DREAM/KChIP3 in contextual fear conditioning Learn. Mem., February 17, 2009; 16(3): 167 - 177. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R Clay, D. Paydarfar, and D. B Forger A simple modification of the Hodgkin and Huxley equations explains type 3 excitability in squid giant axons J R Soc Interface, December 6, 2008; 5(29): 1421 - 1428. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Maffie and B. Rudy Weighing the evidence for a ternary protein complex mediating A-type K+ currents in neurons J. Physiol., December 1, 2008; 586(23): 5609 - 5623. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Vacher, D. P. Mohapatra, and J. S. Trimmer Localization and Targeting of Voltage-Dependent Ion Channels in Mammalian Central Neurons Physiol Rev, October 1, 2008; 88(4): 1407 - 1447. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. C. L. Bett and R. L. Rasmusson Modification of K+ channel-drug interactions by ancillary subunits J. Physiol., February 15, 2008; 586(4): 929 - 950. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Van Hoorick, A. Raes, and D. J. Snyders The aromatic cluster in KCHIP1b affects Kv4 inactivation gating J. Physiol., September 15, 2007; 583(3): 959 - 969. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, S. Y. Um, and T. V. Mcdonald Voltage-Gated Potassium Channels: Regulation by Accessory Subunits Neuroscientist, June 1, 2006; 12(3): 199 - 210. [Abstract] [PDF] |
||||
![]() |
K. Ono, T. Toyono, E. Honda, and K. Inenaga Transient outward K+ currents in rat dissociated subfornical organ neurones and angiotensin II effects J. Physiol., November 1, 2005; 568(3): 979 - 991. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. H Jerng, K. Kunjilwar, and P. J Pfaffinger Multiprotein assembly of Kv4.2, KChIP3 and DPP10 produces ternary channel complexes with ISA-like properties J. Physiol., November 1, 2005; 568(3): 767 - 788. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Rhodes, K. I. Carroll, M. A. Sung, L. C. Doliveira, M. M. Monaghan, S. L. Burke, B. W. Strassle, L. Buchwalder, M. Menegola, J. Cao, et al. KChIPs and Kv4 {alpha} Subunits as Integral Components of A-Type Potassium Channels in Mammalian Brain J. Neurosci., September 8, 2004; 24(36): 7903 - 7915. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |