|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
and tumor necrosis factor-
on
gene expression in human endothelial cells
1 Pharmaceutics Division, College of Pharmacy, University of Texas at Austin, Austin 78712; and 2 US Army Institute of Surgical Research and Clinical Investigation, Brook Army Medical Center, San Antonio, Texas 78234
| |
ABSTRACT |
|---|
|
|
|---|
Interleukin-1
(IL-1
) and tumor necrosis factor-
(TNF-
) are two major
cytokines that rise to relatively high levels during systemic
inflammation, and the endothelial cell (EC) response to these cytokines
may explain some of the dysfunction that occurs. To better understand
the cytokine-induced responses of EC at the gene expression level,
human umbilical vein EC were exposed to IL-1
or TNF-
for various
times and subjected to cDNA microarray analyses to study alterations in
their mRNA expression. Of ~4,000 genes on the microarray, expression
levels of 33 and 58 genes appeared to be affected by treatment with
IL-1
and TNF-
, respectively; 25 of these genes responded to both
treatments. These results suggest that the effects of IL-1
and
TNF-
on EC are redundant and that it may be necessary to suppress
both cytokines simultaneously to ameliorate the systemic response.
recombinant cytokines; microarray analysis; human cells; vascular system
| |
INTRODUCTION |
|---|
|
|
|---|
ENDOTHELIAL CELLS (EC) lining all blood vessels appear to play an important role during systemic inflammatory responses because of their unique position and immediate exposure to inflammatory mediators. They are known to respond to various stimuli, in part by changing the gene expression for cytokines, adhesion molecules, procoagulation factors, and other proteins. Endothelial dysfunction in systemic inflammation may result in disseminated intravascular coagulation and vascular leakage (12, 16, 23), which may lead to development of multiple organ failure and death. The present information on the response of EC to inflammatory stimuli remains limited. A comprehensive understanding of the response of EC to inflammatory mediators may lead to new means for developing drugs for intervention. The recent modest success in reducing mortality in sepsis with activated protein C, which directly effects the EC and its function in coagulopathy, points to its role in the systemic inflammatory response (14).
We previously examined the response of human umbilical vein EC (HUVEC)
to gram-negative bacterial lipopolysaccharide (LPS) and found that many
genes involving various cellular functions were activated at different
times (26). In this study, we explored the response of
HUVEC to the proinflammatory mediators interleukin (IL)-1
(IL-1
)
and tumor necrosis factor-
(TNF-
), which are secreted by
monocytes and macrophages during systemic inflammatory reactions after
infection, inflammation, and tissue damage (18, 25). Their
plasma levels correlate significantly with the severity of septic shock
and multiple organ failure (2, 3, 11), and they share many
biological effects and have been implicated in several acute and
chronic pathological states. However, attempts to blunt the systemic
inflammatory response by blocking the effects of IL-1
or TNF-
with receptor agonists or antibodies in severe sepsis have not been
successful in reducing overall mortality rate (5, 20).
Possible reasons for the ineffectiveness of these trials may include
the following: 1) The biological functions of IL-1
and
TNF-
overlap and can complement each other (8). Blocking only one mediator may not effectively reduce the overall inflammatory responses. 2) IL-1
and TNF-
produce
effects at an early stage of inflammation, and the use of their
inhibitory reagents at a later stage may not reverse the more damaging
events initiated by them. 3) IL-1
and TNF-
may not
represent the best targets for intervention in systemic inflammatory
response. Other mediators initiated by them with as yet unknown
functions may be better targets.
Therefore, to better understand the EC response to inflammation, we
used primary HUVEC with cDNA microarrays containing ~4,000 known
human genes to compare the effects of IL-1
and TNF-
on the
alterations of gene expression in EC. About 1% of all genes tested
showed significant alterations in mRNA expression levels after
stimulation of IL-1
or TNF-
in EC during a 24-h period. Many of
the affected genes appeared in both treatments.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
EC and treatments. EC from two to four human umbilical veins were harvested by collagenase treatment (133 mg/ml; Roche Molecular Biochemicals, Indianapolis IN), pooled, and seeded in 0.2% gelatin-coated tissue culture flasks in medium 199 containing EC growth supplement (50 µg/ml; Collaborative Biomedical Products, Bedford, MA), penicillin (100 U/ml), streptomycin (100 µg/ml), amphotericin B (0.25 µg/ml; Life Technologies, Gaithersburg, MD), and 20% fetal calf serum (Hyclone). The cells were cultured at 37°C in 95% air-5% CO2.
Primary cultured HUVEC were seeded 1:1 onto gelatin-coated six-well tissue culture plates and, on confluence, were treated with TNF-
(10 ng/ml; Research Diagnostics, Flanders, NJ) or IL-1
(10 U/ml; Roche
Molecular Biochemicals) for 1, 4, 7, 12, or 24 h before harvest of
total cellular RNA and supernatants. Control cells were treated with
the same medium without stimuli for 12 h. Cells in each treatment
condition were incubated in duplicate, and each was analyzed with a
microarray; cells treated with IL-1
for 12 and 24 h were
incubated singularly.
In a nuclear factor
B (NF-
B) inhibition experiment, cells were
pretreated with the NF-
B inhibitory peptide SN50 or the inactive
control peptide SN50M (Calbiochem, La Jolla, CA) at 50 µM for 1 h before the addition of a stimulus [LPS (50 ng/ml), IL-1
(10 U/ml), or TNF-
(10 ng/ml)] for another 4 h. The parallel positive controls were subjected to the same medium for 1 h
without a pretreatment peptide and then exposed to one of the three
stimuli for 4 h. A negative control (without pretreatment or
stimulus) was incubated for 5 h. By the end of treatments, cell
culture supernatants were collected for measurement of secreted
monocyte chemoattractant protein type 1 (MCP-1) and IL-8.
RNA isolation, cDNA production, microarray hybridization, and image acquisition. RNA isolation, cDNA production, microarray hybridization, and image acquisition were carried out as described elsewhere (26). Briefly, total RNA was isolated from cells with TriReagent (Molecular Research Center, Cincinnati, OH) according to the manufacturer's instructions. Then 2 µg of total RNA were reverse transcribed into radiolabeled cDNA with [33P]dATP (10 mCi/mmol; Amersham/Phamacia, Arlington Heights, IL). Microarrays containing ~4,000 known human genes (GeneFilters GF211 Release I, Research Genetics) were hybridized with the labeled cDNA according to the manufacturer's protocol. The hybridized microarrays were then exposed to a phosphorimaging screen (Packard Instruments, Meridian, CT). After appropriate exposure, high-resolution images were obtained by scanning phosphorimaging screen with a Cyclone scanner (Packard Instruments). The resulting images were analyzed with Pathways 3.0 software (Research Genetics).
Data analysis. Data analysis was performed as previously described (26). Briefly, the intensity of each clone on the microarray was quantitatively analyzed and normalized. Then a statistical analysis, Chen's test (4), was used to determine whether the expression ratio (ratio of treated to unexposed cells) of any gene deviated outside the 99.9% confidence interval for chance-observed magnitudes. The limits of this interval were taken as the screening threshold to identify genes with likely-altered expression.
Expression ratios of these presumably up- or downregulated genes were also used in clustering analysis with Cluster and Treeview programs (Michael Eisen, Stanford University, genome-WWW.stanford.edu). These programs allow genes with similar expression patterns to be grouped together and displayed in colors representing induction and suppression.Real-time RT-PCR.
Real-time PCRs were performed with 1 µg of total RNA from the same
samples used for microarray using a LightCycler thermal cycler (Idaho
Technology, Salt Lake City, UT) as previously described (26). Briefly, total RNA was reverse transcribed to cDNA
with Superscript II reverse transcriptase and poly(dT) priming (Life Technologies), and 1 µl of cDNA solution was amplified with a primer
set for each gene listed below. The amplification reaction was stopped
at the exponential range, and all the resultant PCR products were
displayed with gel electrophoresis on 2% agarose containing 1:10,000
SYBR gold nucleic acid stain (Molecular Probes, Portland, OR). The
gene-specific primers and the size of the PCR products were as follows:
sense and antisense for
-actin (131 bp),
CCTCCAGCATGAAAGTCTCTGC (sense) and AGTGTTCAAGTCTTCGGAGTTTGG (antisense) for MCP-1 (313 bp), ATGACTTCCAAGCTGGCCGTGGCT (sense) and TCTCAGCCCTCTTCAAAAACTTCTC (antisense) for IL-8 (289 bp),
CAAACCGAAGTCATAGCCACACTC (sense) and TCTCCTAAGCGATGCTCAAACAC
(antisense) for GRO1 (251 bp), and acaaatcagacggcagcactg (sense) and
GGCACCTCTTTTTCATAAGGGG (antisense) for plasminogen activator inhibitor
type 1 (PAI-1, 169 bp).
ELISA.
Cell culture supernatants were collected at the end of treatment and
stored at
20°C until analyzed by ELISA for IL-1
, MCP-1, and IL-8
(R & D Systems, Minneapolis, MN). Samples were assayed according to the
manufacturer's instructions. The detection sensitivity is 1 pg/ml for
IL-1
and 5 pg/ml for MCP-1 and IL-8 in cell culture media. Data were
analyzed with the Tamhane T2 test using SPSS software.
| |
RESULTS |
|---|
|
|
|---|
Assessment of the reproducibility of the microarrays.
To assess the reproducibility of the results obtained from these cDNA
microarrays, duplicate samples labeled and hybridized on two
microarrays from the same treatment were compared (Fig. 1A). The normalized
intensities of any clone from duplicate samples have a ratio
approaching 1. The two parallel lines in Fig. 1 were the screening
thresholds as described in Data analysis. Only clones falling above or below the lines were considered to have different expression between samples. Five clones (0.1% of all clones) showed expression difference between the same duplicate samples, i.e., the
expected false rate. Comparison between a single control replicate and
a single 4-h TNF-
-treated sample replicate resulted in more gene
expression changes at greater deviations (Fig. 1B). For
actual sample screening, microarray duplicate means were plotted on the axes when duplicates were available.
|
Identification of differentially expressed genes induced by
IL-1
.
To examine the EC response to IL-1
at the level of gene expression,
confluent HUVEC cultured in six-well tissue culture plates were given
fresh medium with or without 10 U/ml recombinant human IL-1
and
incubated for various times. At the end of treatment, total RNA was
isolated and subjected to cDNA microarray analysis. A total of 33 genes
with expression ratios beyond screening thresholds at 99.9% confidence
limits during 24 h of stimulation were identified as responsive to
IL-1
in EC. These genes are clustered in Fig. 2 on the basis of the similarity of their
expression patterns with Cluster and Treeview programs.
|
, but most of them recovered to
control levels within 24 h. The other 22 genes were affected at
later times and had different induction or repression patterns. Some of
these genes displayed a short temporal expression disturbance; the
others apparently remained changed for
24 h. According to fold
changes, the most upregulated genes are the CXC-type chemokine IL-8 and the CC-type chemokine MCP-1, which induce extravasation of neutrophiles and mononuclear cells, respectively. These two proinflammatory chemokines were upregulated as early as 1 h and sustained for up
to 24 h. Only two genes (PRKAR2B and HMGIY) appeared suppressed in
EC by IL-1
treatment. Expression of some genes known to be involved
in the response of EC in inflammation provides a measure of confidence
of this screening technique.
|
Gene expression profiling of TNF-
-affected genes.
To examine the endothelial response to TNF-
, the same experimental
procedure was performed using TNF-
(10 ng/ml) in place of IL-1
.
Microarray analysis identified 58 genes with mRNA expression ratios
(ratio of exposed to unexposed samples) that changed beyond screening
thresholds in human EC after TNF-
stimulation. They were clustered
together with the genes identified from the IL-1
experiment and
displayed in Fig. 2. The number of these identified genes at different
times is shown in Fig. 3. At 1 and 4 h, fewer genes were affected
by TNF-
than by IL-1
. Only five genes (9% of 58 genes) were
upregulated within 1 h of treatment. Most genes affected by
TNF-
were identified at 7 and 24 h. Nine genes (15% of 58 genes) appeared downregulated over a 24-h period.
experiment. A section of the images from scanned cDNA microarrays containing the spot for MCP-1 is shown in Fig.
4. Comparison of the results from both
experiments shows a common group of 25 genes apparently affected by
both cytokines. They account for 75% and 43% of all the identified
genes in IL-1
and TNF-
treatments, respectively. The time pattern
of expression of many of these genes was similar with both agents. They
belong to different functional groups, such as chemokine (e.g., IL-8
and MCP-1), extracellular matrix related (e.g., PAI-1 and matrix
metalloproteinase type 10), inflammation (e.g., NK4, HLA-C, and B2M),
signal transduction (e.g., ARHB, TRAF1, PRKAR2B, and CAV1), and
metabolism (e.g., SAT, EXT1, NNMT, and PTGS2). Thirty-three genes
affected only by TNF-
and eight by IL-1
in EC. Some of the
TNF-
-specific genes were ADD3, SCYA14, ALDH1, PRG1, PSME1, PSME2,
PSMD9, GARS, SARS, SUI1, TSFM, TNFRSF11B, JUN, and TGFB1I1. The
IL-1
-specific genes included HMGIY, GRO1, ZFP36, PAI2, CD47, KDR,
PLCB3, and FOSL1. The changes in expression were independently verified
with real-time PCRs and gel electrophoresis for some of these genes (Fig. 5). In general, microarray and PCR
methods gave similar results.
|
|
could induce IL-1
production in HUVEC,
cell culture supernatants from the TNF-
experiment were subjected to
ELISA. IL-1
was not detectable, indicating that the response of EC
to TNF-
was not likely the result of induction of IL-1
(data not shown).
Effect of NF-
B inhibition on MCP-1 and IL-8 secretion induced by
IL-1
and TNF-
.
In an earlier study, it was shown that induction of MCP-1 and IL-8 by
LPS is exclusively through the NF-
B pathway (26). To
determine whether they are also NF-
B dependent, the NF-
B inhibitory peptide SN50 and the inactive control peptide SN50M were
given to the cells before the cytokine treatments. LPS was used as a
positive control on the effectiveness of the peptides. SN50 did not
inhibit IL-1
- or TNF-
-induced MCP-1 and IL-8 secretion by
blocking the translocation of NF-
B but was effective in blocking LPS
stimulation of their production (Fig. 6).
|
| |
DISCUSSION |
|---|
|
|
|---|
During inflammation, presumably protective responses may be
inappropriately overexpressed, potentially resulting in morbidity and
sometimes mortality. The proinflammatory cytokines TNF-
and IL-1
are potent cytokines with dramatic effects on many cells. By utilizing
cDNA microarray techniques that allow parallel, high-throughput screening of altered gene expression, the identification of
cytokine-affected genes becomes possible. The present study
investigated the effects of TNF-
and IL-1
on regulation of gene
expression in EC among ~4,000 genes.
TNF-
and IL-1
are the products of genes with little homology and
bind to different cell surface receptors. However, activation of their
receptors leads to the induction or suppression of a similar set of
genes in HUVEC, including genes for chemokines, cell adhesion
molecules, procoagulants, metalloproteinases, proteasomes, and the
major histocompatibility complex. The receptors for TNF-
and
IL-1
employ similar signaling pathways that involve
mitogen-activated protein (MAP) kinase cascades (6, 7,
15). Eder (9) proposed a model in which MAP kinase
kinase kinases connect the TNF-
and IL-1
signaling pathways. A
common result of this MAP kinase kinase kinase-primed pathway is the
activation of certain transcription factors, such as NF-
B and
activating protein 1 (AP-1), a heterodimer of c-jun and
c-fos. In this study, a significant overlapping of the
affected genes by both cytokines was noticed (25 of 33, or 75%, with
IL-1
treatment; 25 of 58, or 43%, with TNF-
treatment). Some of
these genes have been well known for their roles in inflammation, such
as PAI-1, vascular cell adhesion molecule type 1 (VCAM-1), IL-8, MCP-1,
endothelin-1, matrix metalloproteinase type 10,
2-microglobulin, TNF receptor-associated factor-1, and prostaglandin-endoperoxide synthase-2. Others, including natural killer
cell transcript-4, diubiquitin, butyrate response factor-1, and
caveolin-1, have unclear functions with respect to inflammatory responses.
Comparison of the gene expression profile of HUVEC in response to LPS
from our earlier study (26) with the results reported here
shows that 15 genes are unique to LPS, 30 to TNF-
, and 6 to IL-1
alone. However, 18 of these 25 genes are stimulated in common (Fig.
7). This finding is supported by the
evidence that NF-
B is also the major transcription factor in
LPS-induced gene transcription regulation in HUVEC. Furthermore, the
intracellular domain of the transmembrane protein toll-like receptor-4,
which is responsible for LPS binding and signal transduction, is very similar to that of IL-1
(1). Therefore, it is not
surprising to find that the group of genes identified in HUVEC in
response to IL-1
and LPS is very redundant. Because IL-1
was not
detectable in culture media from TNF-
- or LPS-stimulated HUVEC with
ELISA and TNF-
protein production is not induced by IL-1
or LPS
alone in HUVEC (13, 22), the differential expression
patterns induced by these stimuli appeared to be caused by an
individual stimulus, not by a combination of two or more stimuli.
|
Even though TNF-
and IL-1
exhibited similar patterns of gene
expression, they do not share identical signaling pathways and
functions. Each of them was able to stimulate a unique set of genes in
HUVEC. For example, TNF-
upregulated the expression of several
members of the proteasome family, such as PSME1, PSME2, PSMD9, and
PSMA6, whereas IL-1
upregulated only PSMA6. Proteasomes are involved
in IL-1
-induced MCP-1 production in HUVEC (21). The upregulated proteasome subunits may also imply involvement of an
antigen-presenting pathway in the host's defense against pathogen
invasion. The kinetics and extent of the altered gene expression by
TNF-
and IL-1
were not exactly the same. VCAM-1 appeared to be
stimulated by TNF-
for a longer time than IL-1
. Suppression of
PRKAR2B expression occurred earlier and for a shorter time with TNF-
than with IL-1
treatment.
The similarity of gene expression regulation by LPS, TNF-
, and
IL-1
does not mean that a gene affected by all three stimuli is
always controlled by the same signaling pathway or transcription factor. TNF-
and IL-1
are able to activate NF-
B and AP-1 in EC. However, alteration of LPS-induced gene expression is mainly through NF-
B, as evidenced in our earlier study, in which
pretreatment with an NF-
B translocation inhibitory peptide abolished
most of the transcriptional regulation by LPS. In addition,
transfection of an LPS receptor, toll-like receptor-4, construct into
cells resulted in activation of NF-
B, but not AP-1
(10). Using MCP-1 and IL-8 as the model genes, we examined
whether a gene is mainly regulated by the same transcription factor
activated by different stimuli. MCP-1 is one of the genes most affected
by LPS, TNF-
, and IL-1
in HUVEC and has been known to be under
the regulation of transcription factors including NF-
B, AP-1, and
sequence-specific transcription factor-1 (17, 24).
Inhibition of NF-
B translocation greatly suppressed LPS-induced
MCP-1 and IL-8 secretion but had no effect on their induction by
TNF-
and IL-1
(Fig. 6). This implies that AP-1 and
sequence-specific transcription factor-1 may be more potent in some
HUVEC responses to these two cytokines.
Results similar to these have been reported for 4 h of TNF-
stimulation of HUVEC by Murakami et al. (19) utilizing
Affymetrix chips interrogating 35,000 genes. They reported some of the
most upregulated genes, and many of them were also found in this study, including TNF receptor-associated factor-1, IL-8, MCP-1,
fractalkine, E-selectin, VCAM-1, GRO, and spermidine/spermine
N1-acetyltransferase.
Taken together, the highly redundant transcriptional effects by proinflammatory agents may point to a partial explanation for the failure of clinical trials attempting to block any single cytokine or LPS in patients succumbing to sepsis and systemic inflammation. The effects of removing one syndrome-causing agent may be compensated by others with similar functions. Thus an agent that interferes with a transcription factor or a step in an involved signaling pathway might prove more efficacious.
| |
ACKNOWLEDGEMENTS |
|---|
We are deeply indebted to Dr. George M. Vaughan for critical reading of the manuscript and many helpful suggestions in the treatment of data analysis.
| |
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: P. D. Bowman, US Army Institute of Surgical Research, 3400 Rawley E. Chambers Ave., Bldg. 3611, Fort Sam Houston, TX 78234-6315 (E-mail: phillip.bowman{at}amedd.army.mil).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
First published January 29, 2003;10.1152/ajpcell.00243.2002
Received 28 May 2002; accepted in final form 26 January 2003.
| |
REFERENCES |
|---|
|
|
|---|
1.
Bowie, A,
and
O'Neill LA.
The interleukin-1 receptor/Toll-like receptor superfamily: signal generators for pro-inflammatory interleukins and microbial products.
J Leukoc Biol
67:
508-514,
2000[Abstract].
2.
Calandra, T,
Baumgartner JD,
Grau GE,
Wu MM,
Lambert PH,
Schellekens J,
Verhoef J,
and
Glauser MP.
Prognostic values of tumor necrosis factor/cachectin, interleukin-1, interferon-
, and interferon-
in the serum of patients with septic shock.
J Infect Dis
161:
982-987,
1990[Web of Science][Medline].
3.
Cannon, JG,
Tompkins RG,
Gelfand JA,
Michie HR,
Stanford GG,
van der Meer JW,
Endres S,
Lonnemann G,
Corsetti J,
Chernow B,
Circulating interleukin-1 and tumor necrosis factor in septic shock and experimental endotoxin fever.
J Infect Dis
161:
79-84,
1990[Web of Science][Medline].
4.
Chen, Y,
Dougherty ER,
and
Bittner ML.
Ratio-based decisions and the quantitative analysis of cDNA microarray images.
J Biomed Optics
2:
364-374,
1997.
5.
Clark, MA,
Plank LD,
Connolly AB,
Streat SJ,
Hill AA,
Gupta R,
Monk DN,
Shenkin A,
and
Hill GL.
Effect of a chimeric antibody to tumor necrosis factor-
on cytokine and physiologic responses in patients with severe sepsis
a randomized, clinical trial.
Crit Care Med
26:
1650-1659,
1998[Web of Science][Medline].
6.
Darnay, BG,
and
Aggarwal BB.
Signal transduction by tumour necrosis factor and tumour necrosis factor-related ligands and their receptors.
Ann Rheum Dis
58 Suppl 1:
I2-I13,
1999[Medline].
7.
Dinarello, CA.
Proinflammatory cytokines.
Chest
118:
503-508,
2000[Web of Science][Medline].
8.
Dinarello, CA,
Gelfand JA,
and
Wolff SM.
Anticytokine strategies in the treatment of the systemic inflammatory response syndrome.
JAMA
269:
1829-1835,
1993
9.
Eder, J.
Tumour necrosis factor-
and interleukin 1 signalling: do MAPKK kinases connect it all?
Trends Pharmacol Sci
18:
319-322,
1997[Medline].
10.
Frantz, S,
Kobzik L,
Kim YD,
Fukazawa R,
Medzhitov R,
Lee RT,
and
Kelly RA.
Toll4 (TLR4) expression in cardiac myocytes in normal and failing myocardium.
J Clin Invest
104:
271-280,
1999[Web of Science][Medline].
11.
Gardlund, B,
Sjolin J,
Nilsson A,
Roll M,
Wickerts CJ,
and
Wretlind B.
Plasma levels of cytokines in primary septic shock in humans: correlation with disease severity.
J Infect Dis
172:
296-301,
1995[Web of Science][Medline].
12.
Groneck, P,
Gotze-Speer B,
Oppermann M,
Eiffert H,
and
Speer CP.
Association of pulmonary inflammation and increased microvascular permeability during the development of bronchopulmonary dysplasia: a sequential analysis of inflammatory mediators in respiratory fluids of high-risk preterm neonates.
Pediatrics
93:
712-718,
1994
13.
Imaizumi, T,
Itaya H,
Fujita K,
Kudoh D,
Kudoh S,
Mori K,
Fujimoto K,
Matsumiya T,
Yoshida H,
and
Satoh K.
Expression of tumor necrosis factor-
in cultured human endothelial cells stimulated with lipopolysaccharide or interleukin-1
.
Arterioscler Thromb Vasc Biol
20:
410-415,
2000
14.
Joyce, DE,
Gelbert L,
Ciaccia A,
DeHoff B,
and
Grinnell BW.
Gene expression profile of antithrombotic protein C defines new mechanisms modulating inflammation and apoptosis.
J Biol Chem
276:
11199-11203,
2001
15.
Ledgerwood, EC,
Pober JS,
and
Bradley JR.
Recent advances in the molecular basis of TNF signal transduction.
Lab Invest
79:
1041-1050,
1999[Web of Science][Medline].
16.
Levi, M,
ten Cate H,
van der Poll T,
and
van Deventer SJ.
Pathogenesis of disseminated intravascular coagulation in sepsis.
JAMA
270:
975-979,
1993
17.
Martin, T,
Cardarelli PM,
Parry GC,
Felts KA,
and
Cobb RR.
Cytokine induction of monocyte chemoattractant protein-1 gene expression in human endothelial cells depends on the cooperative action of NF-
B and AP-1.
Eur J Immunol
27:
1091-1097,
1997[Web of Science][Medline].
18.
Munoz, C,
Carlet J,
Fitting C,
Misset B,
Bleriot JP,
and
Cavaillon JM.
Dysregulation of in vitro cytokine production by monocytes during sepsis.
J Clin Invest
88:
1747-1754,
1991[Web of Science][Medline].
19.
Murakami, T,
Mataki C,
Nagao C,
Umetani M,
Wada Y,
Ishii M,
Tsutsumi S,
Kohro T,
Saiura A,
Aburatani H,
Hamakubo T,
and
Kodama T.
The gene expression profile of human umbilical vein endothelial cells stimulated by tumor necrosis factor-
using DNA microarray analysis.
J Atheroscler Thromb
7:
39-44,
2000[Medline].
20.
Opal, SM,
Fisher CJ, Jr,
Dhainaut JF,
Vincent JL,
Brase R,
Lowry SF,
Sadoff JC,
Slotman GJ,
Levy H,
Balk RA,
Shelly MP,
Pribble JP,
LaBrecque JF,
Lookabaugh J,
Donovan H,
Dubin H,
Baughman R,
Norman J,
DeMaria E,
Matzel K,
Abraham E,
and
Seneff M.
Confirmatory interleukin-1 receptor antagonist trial in severe sepsis: a phase III, randomized, double-blind, placebo-controlled, multicenter trial.
Crit Care Med
25:
1115-1124,
1997[Web of Science][Medline].
21.
Parry, GC,
Martin T,
Felts KA,
and
Cobb RR.
IL-1
-induced monocyte chemoattractant protein-1 gene expression in endothelial cells is blocked by proteasome inhibitors.
Arterioscler Thromb Vasc Biol
18:
934-940,
1998
22.
Ranta, V,
Orpana A,
Carpen O,
Turpeinen U,
Ylikorkala O,
and
Viinikka L.
Human vascular endothelial cells produce tumor necrosis factor-
in response to proinflammatory cytokine stimulation.
Crit Care Med
27:
2184-2187,
1999[Web of Science][Medline].
23.
Thijs, LG,
de Boer JP,
de Groot MC,
and
Hack CE.
Coagulation disorders in septic shock.
Intensive Care Med
19:
S8-S15,
1993[Medline].
24.
Ueda, A,
Okuda K,
Ohno S,
Shirai A,
Igarashi T,
Matsunaga K,
Fukushima J,
Kawamoto S,
Ishigatsubo Y,
and
Okubo T.
NF-
B and Sp1 regulate transcription of the human monocyte chemoattractant protein-1 gene.
J Immunol
153:
2052-2063,
1994[Abstract].
25.
Xing, Z,
Jordana M,
Kirpalani H,
Driscoll KE,
Schall TJ,
and
Gauldie J.
Cytokine expression by neutrophils and macrophages in vivo: endotoxin induces tumor necrosis factor-
, macrophage inflammatory protein-2, interleukin-1
, and interleukin-6 but not RANTES or transforming growth factor-
1 mRNA expression in acute lung inflammation.
Am J Respir Cell Mol Biol
10:
148-153,
1994[Abstract]. [Corrigenda. Am J Respir Cell Mol Biol 10: Mar 1994, p. 346.]
26.
Zhao, B,
Bowden RA,
Stavchansky SA,
and
Bowman PD.
Human endothelial cell response to gram-negative lipopolysaccharide assessed with cDNA microarrays.
Am J Physiol Cell Physiol
281:
C1587-C1595,
2001
This article has been cited by other articles:
![]() |
J. M. Kuldo, J. Westra, S. A. Asgeirsdottir, R. J. Kok, K. Oosterhuis, M. G. Rots, J. P. Schouten, P. C. Limburg, and G. Molema Differential effects of NF-{kappa}B and p38 MAPK inhibitors and combinations thereof on TNF-{alpha}- and IL-1{beta}-induced proinflammatory status of endothelial cells in vitro Am J Physiol Cell Physiol, November 1, 2005; 289(5): C1229 - C1239. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Akerstrom, A. Steensberg, P. Keller, C. Keller, M. Penkowa, and B. K. Pedersen Exercise induces interleukin-8 expression in human skeletal muscle J. Physiol., March 1, 2005; 563(2): 507 - 516. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Krappmann, E. Wegener, Y. Sunami, M. Esen, A. Thiel, B. Mordmuller, and C. Scheidereit The I{kappa}B Kinase Complex and NF-{kappa}B Act as Master Regulators of Lipopolysaccharide-Induced Gene Expression and Control Subordinate Activation of AP-1 Mol. Cell. Biol., July 15, 2004; 24(14): 6488 - 6500. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Luyendyk, W. B. Mattes, L. D. Burgoon, T. R. Zacharewski, J. F. Maddox, G. N. Cosma, P. E. Ganey, and R. A. Roth Gene Expression Analysis Points to Hemostasis in Livers of Rats Cotreated with Lipopolysaccharide and Ranitidine Toxicol. Sci., July 1, 2004; 80(1): 203 - 213. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Mayer, M. Bilban, V. Kurtev, F. Gruber, O. Wagner, B. R. Binder, and R. de Martin Deciphering Regulatory Patterns of Inflammatory Gene Expression From Interleukin-1--Stimulated Human Endothelial Cells Arterioscler Thromb Vasc Biol, July 1, 2004; 24(7): 1192 - 1198. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Viemann, M. Goebeler, S. Schmid, K. Klimmek, C. Sorg, S. Ludwig, and J. Roth Transcriptional profiling of IKK2/NF-{kappa}B-- and p38 MAP kinasedependent gene expression in TNF-{alpha}--stimulated primary human endothelial cells Blood, May 1, 2004; 103(9): 3365 - 3373. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |