|
|
||||||||
1 Departamento de Biología, Facultad de Ciencias, 2 Millennium Institute for Advanced Studies in Cell Biology and Biotechnology, and 3 Instituto de Nutrición y Tecnología de los Alimentos, Universidad de Chile, Santiago, Chile
| |
ABSTRACT |
|---|
|
|
|---|
Despite important advances in the understanding of copper secretion and excretion, the molecular components of intestinal copper absorption remain a mystery. DMT1, also known as Nramp2 and DCT1, is the transporter responsible for intestinal iron uptake. Electrophysiological evidence suggests that DMT1 can also be a copper transporter. Thus we examined the potential role of DMT1 as a copper transporter in intestinal Caco-2 cells. Treatment of cells with a DMT1 antisense oligonucleotide resulted in 80 and 48% inhibition of iron and copper uptake, respectively. Cells incorporated considerable amounts of copper as Cu1+, whereas Cu2+ transport was about 10-fold lower. Cu1+ inhibited apical Fe2+ transport. Fe2+, but not Fe3+, effectively inhibited Cu1+ uptake. The iron content of the cells influenced both copper and iron uptake. Cells with low iron content transported fourfold more iron and threefold more copper than cells with high iron content. These results demonstrate that DMT1 is a physiologically relevant Cu1+ transporter in intestinal cells, indicating that intestinal absorption of copper and iron are intertwined.
Nramp2; iron; copper; absorption; metals; antisense
| |
INTRODUCTION |
|---|
|
|
|---|
INTESTINAL IRON
ABSORPTION includes two transport processes: the apical uptake
process, which involves the reduction of Fe3+ to
Fe2+ by DcytB and the inward transport of Fe2+,
and the transfer step, which involves the exotransport of
Fe2+ by basolateral membrane ferroportin 1 (also called
Ireg1 and MTP1) and its oxidation to Fe3+ by hephestin or
ceruloplasmin (reviewed in Ref. 32). The
transporter DMT1 (also called DCT1 and Nramp2) mediates the uptake
phase of intestinal iron absorption. Cloned and electrophysiologically characterized in the oocyte expression system, DMT1 is a
12-transmembrane segment, 561-amino acid residue protein widely
expressed and preferentially found in intestine, kidney, and certain
areas of the brain (12; reviewed in Ref. 10). In the
intestine, DMT1 transports Fe2+ from the lumen of the
intestine into the duodenal epithelial cells. The G185R mutation in
DMT1 causes defective iron uptake from the lumen of the intestine in
the microcytic (mk) mouse (8). The same
mutation accounts for the phenotype of the Belgrade (b) rat
(7), characterized by deficient intestinal iron absorption and transferrin-bound iron uptake (11, 21). DMT1 is
negatively regulated by HFE, the protein whose mutation produces the
hereditary hemochromatosis phenotype (1).
HFE
/
mice manifest marked body iron
overload, whereas HFE
/
mice interbred with
mk mice do not (18). This evidence indicates that DMT1 is the principal, if not the only, transporter of ferrous iron from the intestinal lumen into the enterocyte.
DMT1 transports iron by a process coupled to the cotransport of one H+. Hence, the transport of iron generates a positive inward current (12, 26, 29). The finding that DMT1-expressing oocytes also generate positive inward currents when exposed to Zn2+, Cd2+, Mn2+, Cu2+, Fe2+, Co2+, Ni2+, and Pb2+ raised the possibility that these cations could also be transported by DMT1. Because 100 µM ascorbate was present in the assay medium used in these experiments, copper was most probably in the Cu1+ state, as predicted from the standard reduction potentials for the Cu2+/Cu1+ and ascorbate/dehydroascorbate pairs (19).
DMT1 involvement in the transport of Cd2+ and Mn2+ has been documented. Cd2+ competes for iron transport in Madin-Darby canine kidney cells (23) and Caco-2 cells (6, 28). Moreover, in Caco-2 cells, iron supplementation reduces Cd2+ uptake (28), and Cd2+ and Fe2+ uptake show similar pH dependence (6). The relationship between Fe2+ and Mn2+ uptake was characterized in DMT1-transfected HEK-293T cells. Mn2+ inhibits 59Fe2+ uptake, whereas Fe2+ inhibits 54Mn2+ uptake. Moreover, Mn2+ uptake is severely diminished when the cells express DMT1 with the mk mutation (4, 9). In contrast, 65Zn2+ uptake into Caco-2 cells is not affected by cell iron status or by dissipation of the membrane potential, and it is not dependent on an acidic extracellular pH (29). Moreover, in the oocyte expression system, Zn2+ elicits an inward proton flow that is not accompanied by actual metal transport (26). Thus the case for DMT1-mediated Zn2+ transport seems unlikely.
The individual steps of intestinal copper absorption are largely unknown. Early research on intestinal copper absorption using whole animals described an uptake phase not dependent on the ATP status of the cell and a transfer step that is both energy dependent and rate limiting for its overall absorption (17). The major plasma membrane copper transporter identified so far is hCTR1, which is homologous to crt1 of yeast (5, 35). hCTR1 is a distinct candidate for intestinal copper uptake (14, 15). The potential of DMT1 to mediate intestinal uptake not only of Fe2+ but also of other cations makes it possible to predict the existence of intestinal absorptive mechanisms common for two or more cations. In this work, we tested the hypothesis that DMT1 is a physiologically relevant copper transporter. The findings reported here are germane for the understanding of the basic mechanisms of intestinal copper absorption and their interplay with intestinal iron absorption. They are also relevant for the establishment of strategies to prevent excessive iron and copper intestinal absorption in pathologies such as hereditary hemochromatosis.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Reagents. Dulbecco's modified Eagle's medium (DMEM), fetal bovine serum (FBS), and Lipofectamine were purchased from GIBCO Life Technologies (Grand Island, NY). Nitrilotriacetate, disodium salt (NTA), bathocuproine disulfonate, disodium salt (bathocuproine), buffers, and salts were from Sigma (St. Louis, MO). 59Fe, in the FeCl3 form, was from New England Nuclear (Boston, MA). 64Cu, in the CuCl2 form, was purchased from Comisión Chilena de Energía Nuclear (Santiago, Chile). Culture plastic ware and Transwell bicameral inserts were from Corning-Costar (Cambridge, MA). Antisense oligonucleotides, synthesized as phosphothioate derivatives, were purchase from Integrated DNA Technologies (www.idtdna.com).
Cell line. Caco-2 cells (no. HTB37; American Type Culture Collection, Rockville, MD) were cultured in DMEM supplemented with 10% FBS. In culture, Caco-2 cells acquire a small intestine phenotype (24). They express high levels of GLUT5, a glucose transporter found in the brush border of fetal and adult small intestine (20). Moreover, they express transferrin receptors in the basolateral membrane and the DMT1 transporter in the apical membrane, and they have an active IRE/IRP (iron-responsive element/iron regulatory protein) system that regulates apical iron uptake and transepithelial iron transport as a function of intracellular iron levels (2, 16, 30).
Cell transfections with antisense oligonucleotides to DMT1. Selection of antisense sequences was done following the strategy of Tu et al. (33), which disrupts splicing by targeting intronic sequences carrying the GGGA motif. Selected sequences encompassed introns 6-8. From a total of eight antisenses tested, the effect of antisenses MA1 (CCTTTGACCCTCCCATTCCTGCTC), TN2 (CACTCTCTTCCCAACAGCTCTCC), and TN3 (ATATATACTCTTCCCCGGTTCAG) are reported here.
Caco-2 cells grown for 10 days in 0.33-cm2 polycarbonate cell culture inserts (Transwell, Corning-Costar) were transfected with 10 µg/ml antisense oligonucleotides in the presence of Lipofectamine following the instructions of the manufacturer (GIBCO Life Sciences). The DNA/Lipofectamine mixture was renewed every 24 h of incubation for 3 days, after which uptake experiments were performed. DMT1 protein expression was checked by Western immunodetection as described previously (1).Copper and iron uptake and transport by Caco-2 cells. Caco-2 cells were seeded and grown for 12 days in 0.33-cm2 polycarbonate cell culture inserts (Corning-Costar) in DMEM supplemented with 10% FBS. The cells were washed with saline [in mM: 50 3-(N-morpholino)propanesulfonic acid-Na, 94 NaCl, 7.4 KCl, 0.74 MgCl2, and 1.5 CaCl2, pH 6.7] and incubated at 37°C in saline supplemented with 5 µM 59Fe as either the 59Fe-ascorbate complex (1:50 mol/mol) or the Fe-NTA complex (1:2.2 mol/mol) or with 5 µM 64Cu as the 64Cu-histidine complex (1:10 mol/mol) (3) in the apical medium. The uptake was stopped by washing the inserts three times with ice-cold saline supplemented with 1 mM EDTA. In previous experiments, we ascertained that this treatment effectively removed the radioactivity loosely bound to cells. A cell extract was prepared by adding 50 µl of lysis buffer (10 mM HEPES, pH 7.5, 3 mM MgCl2, 40 mM KCl, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, 0.5 µg/ml aprotinin, 0.7 µg/ml pepstatin A, 5% glycerol, 1 mM dithiothreitol, and 0.5% Triton X-100). The mixture was incubated for 15 min on ice and sedimented for 10 min at 10,000 g. The supernatant was evaluated for protein and for 59Fe or 64Cu radioactivity.
Competition studies between iron and copper uptake were performed with cells grown in polycarbonate cell culture inserts (Corning-Costar). When the effect of copper on iron uptake was tested, the apical chamber contained 5 µM 59Fe as the 59Fe-ascorbate complex (1:50 mol/mol) plus 0.5-150 µM 64Cu as a 64Cu-histidine complex (1:10 mol/mol). When the effect of iron on copper uptake was tested, the apical chamber contained 5 µM 64Cu-histidine with or without 250 µM ascorbate, plus 0.5-150 µM Fe3+ as either FeCl3-NTA (1:2.2 mol/mol) or freshly prepared FeSO4.Statistical analysis. Variables were tested in triplicate, and the experiments were repeated at least twice. Variability among experiments was <20%. One-way ANOVA was used to test differences in mean values, and Bonferroni's post hoc test was used for comparisons (GraphPad InStat). Differences were considered significant if P < 0.05.
| |
RESULTS |
|---|
|
|
|---|
Antisense oligonucleotides against DMT1 inhibited iron and copper
transport.
To demonstrate the possible mediation of DMT1 on copper transport, we
determined iron and copper apical uptake in Caco-2 cells transfected
with DMT1 antisense oligonucleotides. Figure
1A shows 59Fe
apical uptake in the absence or presence of DMT1 antisense oligonucleotides. Treatment of cells with antisense MA1 produced 80%
inhibition in 59Fe uptake compared with control cells.
Significant inhibition was also produced by antisense TN2, whereas
antisense TN3 produced a nonsignificant inhibition. Similarly,
antisense oligonucleotides MA1 and TN2 produced significant inhibitions
of 64Cu uptake, whereas TN3 did not (Fig. 1B).
MA1 produced 47% inhibition in 64Cu uptake. Besides TN3,
other three antisense sequences did not produce inhibition of iron
uptake (data not shown). We considered these antisenses negative
controls for antisenses MA1 and TN2.
|
Iron and copper uptake competition.
The ability of one cation to inhibit the uptake of another cation has
been used as a criterion for transport by a unique carrier (4, 6,
9, 28). To assess iron competition for copper transport, we
evaluated the effect of iron on 64Cu uptake by Caco-2
cells. Preliminary experiments indicated that copper uptake depended on
the presence of ascorbate in the medium, so experiments were designed
to elucidate both the role of iron and of ascorbate on copper
transport. Figure 2A shows
that the presence of ascorbate was necessary to obtain significant
apical 64Cu uptake, providing an insight into the oxidation
state of the transported copper. In fact, the requirement for ascorbate
is a strong indication that in Caco-2 cells, copper is transported in
the reduced (Cu1+) state. In the presence of ascorbate,
iron added as either FeSO4 (i.e., in a pure
Fe2+ form) or Fe-NTA (i.e., in a Fe2+ form
achieved after the reaction of Fe3+ with ascorbate)
inhibited 64Cu uptake.
|
|
59Fe and 64Cu uptake in Caco-2 cells as a
function of intracellular iron levels.
DMT1 is the main, if not the only, Fe2+ apical transporter
of intestinal cells. Because DMT1 expression is regulated by cell iron
levels (1), we evaluated copper transport in cells with varied levels of iron. As previously reported (30),
59Fe uptake in Caco-2 cells inversely correlated with
intracellular iron concentration (Fig.
4A). The apical
59Fe uptake rate of Caco-2 cells was 44.24 ± 2.92 pmol · mg
protein
1 · h
1 in
cells preconditioned in 0.5 µM Fe and 12.17 ± 1.09 pmol · mg
protein
1 · h
1 in
cells preconditioned in 20 µM Fe. 64Cu uptake responded
similarly to cellular iron concentrations (Fig. 4B). The
rate of 64Cu uptake was 20.81 ± 2.86 pmol · mg
protein
1 · h
1 in
cells preconditioned in 0.5 µM Fe and 7.75 ± 0.98 pmol · mg protein
1 · h
1 in
cells preconditioned in 20 µM Fe. The fact that both iron and copper
uptake are dependent on the intracellular iron concentration is in line
with the possibility that a common transporter transports both metals.
|
| |
DISCUSSION |
|---|
|
|
|---|
DMT1 is the Fe2+ transporter responsible for apical iron uptake by intestinal cells. In this work we investigated the possibility that copper could also be transported by DMT1, based on the observation that, as with iron, copper induces an inward positive current in oocytes expressing the transporter (12, 26). Though the requirement for DMT1 to undertake apical iron absorption and to maintain body iron homeostasis is evident (10, 18, 25), a putative role for DMT1 in intestinal copper absorption is uncertain.
The MA1 antisense oligonucleotide inhibited iron and copper uptake by 80 and 47%, respectively. These data demonstrate two important aspects of copper and iron intestinal absorption: DMT1 is the main iron transporter in intestinal cells, and at least 50% of copper transport is mediated by DMT1. Transport competition experiments indicated that copper inhibited iron uptake and vice versa. Significant copper uptake was observed only when copper was in the Cu1+ state, i.e., in the presence of ascorbate. This observation agrees with previous observations indicating that Cu1+ inhibits Fe2+, but not Fe3+, uptake by perfused mouse intestine (13), and it strongly supports the idea that Cu1+ is the species transported by DMT1 in apical Caco-2 copper uptake. The possibility that copper inhibition arises from competition for DcytB is unlikely because competition was observed under reducing conditions (50 µM ascorbate), where Fe2+, or Cu1+, should be directly transported by DMT1. The subject is more complex when there is a mixture of Fe2+ and Cu2+, or Fe3+ and Cu1+. Because of crossed redox reactions, a mixture of Fe2+, Fe3+, Cu1+, and Cu2+ should be present. The relative proportion of each species should be predicted by the reduction potential of the Fe3+/Fe2+ and Cu2+/Cu1+ pairs. Nevertheless, there is still the possibility that iron and copper could be competing for hephestin and thus affect crossed inhibition of the transfer phase, which could result in secondary inhibition of the uptake phase.
Our observation that iron uptake was inversely correlated with cell iron content confirms earlier studies in Caco-2 cells (30) and isolated intestine (22). Likewise, we found that copper uptake was inversely related to cell iron content, in agreement with recent reports describing increased copper uptake in deferrioxamine-treated cells (34) and decreased DMT1 protein and mRNA expression in Caco-2 cells cultured in high copper (31). Zerounian and Linder (34) also found that copper depletion induced an increase in iron uptake. Thus an intimate relationship exists between intestinal copper and iron homeostasis. Although the molecular mechanisms that connect copper and iron uptake are unknown at present, our data are in line with the idea that DMT1 is a common link.
In summary, the results presented indicate that DMT1 is a physiologically relevant Cu1+ transporter and that intestinal absorption of copper and iron are intertwined.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. Cecilia Hidalgo for thoughtful comments.
| |
FOOTNOTES |
|---|
This work was supported by Fondo Nacional de Ciencia y Tecnología Grants 2990116 and 1010657 and Millennium Institute for Advanced Studies in Cell Biology and Biotechnology Grant P99-031F.
Address for reprint requests and other correspondence: M. T. Núñez, Departamento de Biología, Facultad de Ciencias, Universidad de Chile, Casilla 653, Santiago, Chile (E-mail: mnunez{at}uchile.cl).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
10.1152/ajpcell.00480.2002
Received 16 October 2002; accepted in final form 3 January 2003.
| |
REFERENCES |
|---|
|
|
|---|
1.
Arredondo, M,
Muñoz P,
Mura C,
and
Núñez MT.
HFE inhibits apical iron uptake by intestinal epithelial (Caco-2) cells.
FASEB J
15:
1276-1278,
2001
2.
Arredondo, M,
Orellana A,
Gárate MA,
and
Núñez MT.
Intracellular iron regulates iron absorption and IRP activity in intestinal epithelial (Caco-2) cells.
Am J Physiol Gastrointest Liver Physiol
273:
G275-G280,
1997
3.
Arredondo, M,
Uauy R,
and
Gonzalez M.
Regulation of copper uptake and transport in intestinal cell monolayers by acute and chronic copper exposure.
Biochim Biophys Acta
1474:
169-176,
2000[Medline].
4.
Conrad, ME,
Umbreit JN,
Moore EG,
Hainsworth LN,
Porubcin M,
Simovich MJ,
Nakada MT,
Dolan K,
and
Garrick MD.
Separate pathways for cellular uptake of ferric and ferrous iron.
Am J Physiol Gastrointest Liver Physiol
279:
G767-G774,
2000
5.
Dancis, A,
Haile D,
Yuan DS,
and
Klausner RD.
The Saccharomyces cerevisiae transport protein (ctr1p). Biochemical characterization, regulation by copper, and physiological role in copper uptake.
J Biol Chem
269:
25660-25667,
1994
6.
Elisma, F,
and
Jumarie C.
Evidence for cadmium uptake through Nramp2: metal speciation studies with Caco-2 cells.
Biochem Biophys Res Commun
285:
662-668,
2001[Web of Science][Medline].
7.
Fleming, MD,
Romano MA,
Su MA,
Garrick LM,
Garrick MD,
and
Andrews NC.
Nramp2 is mutated in the anemic Belgrade (b) rat: evidence of a role for Nramp2 in endosomal iron transport.
Proc Natl Acad Sci USA
95:
1148-1153,
1998
8.
Fleming, MD,
Trenor CI,
Su MA,
Foernzler D,
Beier DR,
Dietrich WF,
and
Andrews NC.
Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene.
Nat Genet
16:
383-386,
1997[Web of Science][Medline].
9.
Garrick, MD,
and
Dolan KG.
An expression system for a transporter of iron and other metals.
In: Ultrastructure and Molecular Biology Protocols for Oxidants and Antioxidants. Methods in Molecular Biology, edited by Armstrong D.. Totowa, NJ: Humana, 2002, vol. 196, p. 149-156.
10.
Garrick, MD,
Dolan KG,
Horbinski C,
Ghio AJ,
Higgins D,
Porubcin M,
Moore EG,
Hainsworth LN,
Umbreit JN,
Conrad ME,
Feng L,
Lis A,
Roth JA,
Singleton S,
and
Garrick LM.
DMT1: a mammalian transporter for multiple metals.
BioMetals
16:
41-54,
2003[Web of Science][Medline].
11.
Garrick, MD,
Gniecko K,
Liu Y,
Cohan DS,
and
Garrick LM.
Transferrin and the transferrin cycle in Belgrade rat reticulocytes.
J Biol Chem
268:
14867-14874,
1993
12.
Gunshin, H,
Mackenzie B,
Berger UV,
Gunshin Y,
Romero MF,
Boron WF,
Nussberger S,
Gollan JL,
and
Hediger MA.
Cloning and characterization of a proton-coupled mammalian metal ion transporter.
Nature
388:
482-488,
1997[Medline].
13.
Iturri, S,
and
Núñez MT.
Effect of copper, cadmium, mercury, manganese and lead on Fe2+ and Fe3+ absorption in perfused mouse intestine.
Digestion
59:
671-675,
1998[Web of Science][Medline].
14.
Lee, J,
Prohaska JR,
Dagenais SL,
Glover TW,
and
Thiele DJ.
Isolation of a murine copper transporter gene, tissue specific expression and functional complementation of a yeast copper transport mutant.
Gene
254:
87-96,
2000[Web of Science][Medline].
15.
Lee, J,
Prohaska J,
and
Thiele D.
Essential role for mammalian copper transporter Ctr1 in copper homeostasis and embryonic development.
Proc Natl Acad Sci USA
98:
6842-6847,
2001
16.
Leibold, EA,
and
Munro HN.
Cytoplasmic protein binds in vitro to a highly conserved sequence in the untranslated region of ferritin heavy-and-light-subunit mRNAs.
Proc Natl Acad Sci USA
85:
2171-2175,
1998.
17.
Linder, MC,
and
Hazegh-Azam M.
Copper biochemistry and molecular biology.
Am J Clin Nutr
63:
797S-811S,
1996
18.
Levy, JE,
Montross LK,
and
Andrews NC.
Genes that modify the hemochromatosis phenotype in mice.
J Clin Invest
105:
1209-1216,
2000[Web of Science][Medline].
19.
Mahler, HR,
and
Cordes EH.
Biological Chemistry. New York: Harper and Row, 1961, p. 207.
20.
Mahraoui, L,
Ruosset M,
Dussaulx E,
Darmoul A,
Zweibaun A,
and
Brot-Laroche E.
Expression and localization of GLUT-5 in Caco-2 cells, human small intestine, and colon.
Am J Physiol Gastrointest Liver Physiol
263:
G312-G318,
1992
21.
Oates, PS,
and
Morgan EH.
Defective iron uptake by the duodenum of Belgrade rats fed diets of different iron contents.
Am J Physiol Gastrointest Liver Physiol
270:
G826-G832,
1996
22.
Oates, PS,
Trinder D,
and
Morgan EH.
Gastrointestinal function, divalent metal transporter-1 expression and intestinal iron absorption.
Pflügers Arch
440:
496-502,
2000[Web of Science][Medline].
23.
Olivi, L,
Sisk J,
and
Bressler J.
Involvement of DMT1 in uptake of Cd in MDCK cells: role of protein kinase C.
Am J Physiol Cell Physiol
281:
C793-C800,
2001
24.
Peterson, MD,
and
Mooseker MS.
An in vitro model for the analysis of intestinal brush-border assembly. I. Ultrastructural analysis of cell-contact induced brush border assembly in Caco-2 cells.
J Cell Sci
105:
445-460,
1993[Abstract].
25.
Rolfs, A,
and
Hediger M.
Metal ion transporter in mammals: structure, function and pathological implications.
J Physiol
518:
1-12,
1999
26.
Sacher, A,
Cohen A,
and
Nelson N.
Properties of the mammalian and yeast metal-ion transporters DCT1 and Smf1p expressed in Xenopus laevis oocytes.
J Exp Biol
204:
1053-1061,
2001[Abstract].
27.
Sayre, LM,
and
Multhaup G.
Alzheimer's precursor protein and the use of bathocuproine for determining reduction of copper(II).
Science
274:
1933-1934,
1996[Web of Science][Medline].
28.
Tallkvist, J,
Bowlus CL,
and
Lönnerdal B.
DMT1 gene expression and cadmium absorption in human absorptive enterocytes.
Toxicol Lett
122:
171-177,
2001[Web of Science][Medline].
29.
Tandy, S,
Williams M,
Leggett A,
Lopez-Jimenez M,
Dedes M,
Ramesh B,
Srai SK,
and
Sharp P.
Nramp2 expression is associated with pH-dependent iron uptake across the apical membrane of human intestinal Caco-2 cells.
J Biol Chem
275:
1023-1029,
2000
30.
Tapia, V,
Arredondo M,
and
Núñez MT.
Regulation of Fe absorption by cultured intestinal (Caco-2) cell monolayers with varied Fe status.
Am J Physiol Gastrointest Liver Physiol
271:
G443-G447,
1996
31.
Tennant, J,
Stansfield M,
Yamaji S,
Srai SK,
and
Sharp P.
Effect of copper on the expression of metal transporters in human intestinal Caco-2 cells.
FEBS Lett
527:
239-244,
2002[Web of Science][Medline].
32.
Trinder, D,
Fox C,
Vautier G,
and
Olynyk JK.
Molecular pathogenesis of iron overload.
Gut
51:
290-295,
2002
33.
Tu, GC,
Cao QN,
Zhou F,
and
Israel Y.
Tetranucleotide GGGA motif in primary RNA transcripts. Novel target site for antisense design.
J Biol Chem
273:
25125-25131,
1998
34.
Zerounian, NR,
and
Linder MC.
Effects of copper and ceruloplasmin on iron transport in the Caco-2 cell intestinal model.
J Nutr Biochem
13:
138-148,
2002[Web of Science][Medline].
35.
Zhou, B,
and
Gitschier J.
hCTR1: a human gene for copper uptake identified by complementation in yeast.
Proc Natl Acad Sci USA
94:
7481-7486,
1997
This article has been cited by other articles:
![]() |
J. F. Collins, P. Hua, Y. Lu, and P. N. Ranganathan Alternative splicing of the Menkes copper Atpase (Atp7a) transcript in the rat intestinal epithelium Am J Physiol Gastrointest Liver Physiol, October 1, 2009; 297(4): G695 - G707. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Kaplan and S. Lutsenko Copper Transport in Mammalian Cells: Special Care for a Metal with Special Needs J. Biol. Chem., September 18, 2009; 284(38): 25461 - 25465. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Hansen, N. Trakooljul, H.-C. Liu, A. J. Moeser, and J. W. Spears Iron Transporters Are Differentially Regulated by Dietary Iron, and Modifications Are Associated with Changes in Manganese Metabolism in Young Pigs J. Nutr., August 1, 2009; 139(8): 1474 - 1479. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Hansen and J. W. Spears Bioaccessibility of iron from soil is increased by silage fermentation J Dairy Sci, June 1, 2009; 92(6): 2896 - 2905. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Domellof, O. Hernell, S. A Abrams, Z. Chen, and B. Lonnerdal Iron supplementation does not affect copper and zinc absorption in breastfed infants Am. J. Clinical Nutrition, January 1, 2009; 89(1): 185 - 190. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gonzalez, A. Reyes-Jara, M. Suazo, W. J Jo, and C. Vulpe Expression of copper-related genes in response to copper load Am. J. Clinical Nutrition, September 1, 2008; 88(3): 830S - 834S. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Lonnerdal Intestinal regulation of copper homeostasis: a developmental perspective Am. J. Clinical Nutrition, September 1, 2008; 88(3): 846S - 850S. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Moriya, Y.-H. Ho, A. Grana, L. Nguyen, A. Alvarez, R. Jamil, M. L. Ackland, A. Michalczyk, P. Hamer, D. Ramos, et al. Copper is taken up efficiently from albumin and {alpha}2-macroglobulin by cultured human cells by more than one mechanism Am J Physiol Cell Physiol, September 1, 2008; 295(3): C708 - C721. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. San Martin, C. Garri, F. Pizarro, T. Walter, E. C. Theil, and M. T. Nunez Caco-2 Intestinal Epithelial Cells Absorb Soybean Ferritin by {micro}2 (AP2)-Dependent Endocytosis J. Nutr., April 1, 2008; 138(4): 659 - 666. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lutsenko, N. L. Barnes, M. Y. Bartee, and O. Y. Dmitriev Function and Regulation of Human Copper-Transporting ATPases Physiol Rev, July 1, 2007; 87(3): 1011 - 1046. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Nyasae, R. Bustos, L. Braiterman, B. Eipper, and A. Hubbard Dynamics of endogenous ATP7A (Menkes protein) in intestinal epithelial cells: copper-dependent redistribution between two intracellular sites Am J Physiol Gastrointest Liver Physiol, April 1, 2007; 292(4): G1181 - G1194. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P Bressler, L. Olivi, J. H. Cheong, Y. Kim, A. Maerten, and D. Bannon Metal transporters in intestine and brain: their involvement in metal-associated neurotoxicities Human and Experimental Toxicology, March 1, 2007; 26(3): 221 - 229. [Abstract] [PDF] |
||||
![]() |
M. Moriya and M. C. Linder Vesicular transport and apotransferrin in intestinal iron absorption, as shown in the Caco-2 cell model Am J Physiol Gastrointest Liver Physiol, February 1, 2006; 290(2): G301 - G309. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.S. Chong, P.C. Kwan, L.Y. Chan, P.Y. Chiu, T.K. Cheung, and T.K. Lau Expression of divalent metal transporter 1 (DMT1) isoforms in first trimester human placenta and embryonic tissues Hum. Reprod., December 1, 2005; 20(12): 3532 - 3538. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Collins, C. A. Franck, K. V. Kowdley, and F. K. Ghishan Identification of differentially expressed genes in response to dietary iron deprivation in rat duodenum Am J Physiol Gastrointest Liver Physiol, May 1, 2005; 288(5): G964 - G971. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Eisses, Y. Chi, and J. H. Kaplan Stable Plasma Membrane Levels of hCTR1 Mediate Cellular Copper Uptake J. Biol. Chem., March 11, 2005; 280(10): 9635 - 9639. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Arredondo, V. Cambiazo, L. Tapia, M. Gonzalez-Aguero, M. T. Nunez, R. Uauy, and M. Gonzalez Copper overload affects copper and iron metabolism in Hep-G2 cells Am J Physiol Gastrointest Liver Physiol, July 1, 2004; 287(1): G27 - G32. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |