Am J Physiol Cell Physiol Information on EB 2010
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 284: C1525-C1530, 2003; doi:10.1152/ajpcell.00480.2002
0363-6143/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (51)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Arredondo, M.
Right arrow Articles by Núñez, M. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Arredondo, M.
Right arrow Articles by Núñez, M. T.
Vol. 284, Issue 6, C1525-C1530, June 2003

DMT1, a physiologically relevant apical Cu1+ transporter of intestinal cells

Miguel Arredondo1,3, Patricia Muñoz1,2, Casilda V. Mura2, and Marco T. Núñez1,2

1 Departamento de Biología, Facultad de Ciencias, 2 Millennium Institute for Advanced Studies in Cell Biology and Biotechnology, and 3 Instituto de Nutrición y Tecnología de los Alimentos, Universidad de Chile, Santiago, Chile


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Despite important advances in the understanding of copper secretion and excretion, the molecular components of intestinal copper absorption remain a mystery. DMT1, also known as Nramp2 and DCT1, is the transporter responsible for intestinal iron uptake. Electrophysiological evidence suggests that DMT1 can also be a copper transporter. Thus we examined the potential role of DMT1 as a copper transporter in intestinal Caco-2 cells. Treatment of cells with a DMT1 antisense oligonucleotide resulted in 80 and 48% inhibition of iron and copper uptake, respectively. Cells incorporated considerable amounts of copper as Cu1+, whereas Cu2+ transport was about 10-fold lower. Cu1+ inhibited apical Fe2+ transport. Fe2+, but not Fe3+, effectively inhibited Cu1+ uptake. The iron content of the cells influenced both copper and iron uptake. Cells with low iron content transported fourfold more iron and threefold more copper than cells with high iron content. These results demonstrate that DMT1 is a physiologically relevant Cu1+ transporter in intestinal cells, indicating that intestinal absorption of copper and iron are intertwined.

Nramp2; iron; copper; absorption; metals; antisense


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

INTESTINAL IRON ABSORPTION includes two transport processes: the apical uptake process, which involves the reduction of Fe3+ to Fe2+ by DcytB and the inward transport of Fe2+, and the transfer step, which involves the exotransport of Fe2+ by basolateral membrane ferroportin 1 (also called Ireg1 and MTP1) and its oxidation to Fe3+ by hephestin or ceruloplasmin (reviewed in Ref. 32). The transporter DMT1 (also called DCT1 and Nramp2) mediates the uptake phase of intestinal iron absorption. Cloned and electrophysiologically characterized in the oocyte expression system, DMT1 is a 12-transmembrane segment, 561-amino acid residue protein widely expressed and preferentially found in intestine, kidney, and certain areas of the brain (12; reviewed in Ref. 10). In the intestine, DMT1 transports Fe2+ from the lumen of the intestine into the duodenal epithelial cells. The G185R mutation in DMT1 causes defective iron uptake from the lumen of the intestine in the microcytic (mk) mouse (8). The same mutation accounts for the phenotype of the Belgrade (b) rat (7), characterized by deficient intestinal iron absorption and transferrin-bound iron uptake (11, 21). DMT1 is negatively regulated by HFE, the protein whose mutation produces the hereditary hemochromatosis phenotype (1). HFE-/- mice manifest marked body iron overload, whereas HFE-/- mice interbred with mk mice do not (18). This evidence indicates that DMT1 is the principal, if not the only, transporter of ferrous iron from the intestinal lumen into the enterocyte.

DMT1 transports iron by a process coupled to the cotransport of one H+. Hence, the transport of iron generates a positive inward current (12, 26, 29). The finding that DMT1-expressing oocytes also generate positive inward currents when exposed to Zn2+, Cd2+, Mn2+, Cu2+, Fe2+, Co2+, Ni2+, and Pb2+ raised the possibility that these cations could also be transported by DMT1. Because 100 µM ascorbate was present in the assay medium used in these experiments, copper was most probably in the Cu1+ state, as predicted from the standard reduction potentials for the Cu2+/Cu1+ and ascorbate/dehydroascorbate pairs (19).

DMT1 involvement in the transport of Cd2+ and Mn2+ has been documented. Cd2+ competes for iron transport in Madin-Darby canine kidney cells (23) and Caco-2 cells (6, 28). Moreover, in Caco-2 cells, iron supplementation reduces Cd2+ uptake (28), and Cd2+ and Fe2+ uptake show similar pH dependence (6). The relationship between Fe2+ and Mn2+ uptake was characterized in DMT1-transfected HEK-293T cells. Mn2+ inhibits 59Fe2+ uptake, whereas Fe2+ inhibits 54Mn2+ uptake. Moreover, Mn2+ uptake is severely diminished when the cells express DMT1 with the mk mutation (4, 9). In contrast, 65Zn2+ uptake into Caco-2 cells is not affected by cell iron status or by dissipation of the membrane potential, and it is not dependent on an acidic extracellular pH (29). Moreover, in the oocyte expression system, Zn2+ elicits an inward proton flow that is not accompanied by actual metal transport (26). Thus the case for DMT1-mediated Zn2+ transport seems unlikely.

The individual steps of intestinal copper absorption are largely unknown. Early research on intestinal copper absorption using whole animals described an uptake phase not dependent on the ATP status of the cell and a transfer step that is both energy dependent and rate limiting for its overall absorption (17). The major plasma membrane copper transporter identified so far is hCTR1, which is homologous to crt1 of yeast (5, 35). hCTR1 is a distinct candidate for intestinal copper uptake (14, 15). The potential of DMT1 to mediate intestinal uptake not only of Fe2+ but also of other cations makes it possible to predict the existence of intestinal absorptive mechanisms common for two or more cations. In this work, we tested the hypothesis that DMT1 is a physiologically relevant copper transporter. The findings reported here are germane for the understanding of the basic mechanisms of intestinal copper absorption and their interplay with intestinal iron absorption. They are also relevant for the establishment of strategies to prevent excessive iron and copper intestinal absorption in pathologies such as hereditary hemochromatosis.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Reagents. Dulbecco's modified Eagle's medium (DMEM), fetal bovine serum (FBS), and Lipofectamine were purchased from GIBCO Life Technologies (Grand Island, NY). Nitrilotriacetate, disodium salt (NTA), bathocuproine disulfonate, disodium salt (bathocuproine), buffers, and salts were from Sigma (St. Louis, MO). 59Fe, in the FeCl3 form, was from New England Nuclear (Boston, MA). 64Cu, in the CuCl2 form, was purchased from Comisión Chilena de Energía Nuclear (Santiago, Chile). Culture plastic ware and Transwell bicameral inserts were from Corning-Costar (Cambridge, MA). Antisense oligonucleotides, synthesized as phosphothioate derivatives, were purchase from Integrated DNA Technologies (www.idtdna.com).

Cell line. Caco-2 cells (no. HTB37; American Type Culture Collection, Rockville, MD) were cultured in DMEM supplemented with 10% FBS. In culture, Caco-2 cells acquire a small intestine phenotype (24). They express high levels of GLUT5, a glucose transporter found in the brush border of fetal and adult small intestine (20). Moreover, they express transferrin receptors in the basolateral membrane and the DMT1 transporter in the apical membrane, and they have an active IRE/IRP (iron-responsive element/iron regulatory protein) system that regulates apical iron uptake and transepithelial iron transport as a function of intracellular iron levels (2, 16, 30).

Cell transfections with antisense oligonucleotides to DMT1. Selection of antisense sequences was done following the strategy of Tu et al. (33), which disrupts splicing by targeting intronic sequences carrying the GGGA motif. Selected sequences encompassed introns 6-8. From a total of eight antisenses tested, the effect of antisenses MA1 (CCTTTGACCCTCCCATTCCTGCTC), TN2 (CACTCTCTTCCCAACAGCTCTCC), and TN3 (ATATATACTCTTCCCCGGTTCAG) are reported here.

Caco-2 cells grown for 10 days in 0.33-cm2 polycarbonate cell culture inserts (Transwell, Corning-Costar) were transfected with 10 µg/ml antisense oligonucleotides in the presence of Lipofectamine following the instructions of the manufacturer (GIBCO Life Sciences). The DNA/Lipofectamine mixture was renewed every 24 h of incubation for 3 days, after which uptake experiments were performed. DMT1 protein expression was checked by Western immunodetection as described previously (1).

Copper and iron uptake and transport by Caco-2 cells. Caco-2 cells were seeded and grown for 12 days in 0.33-cm2 polycarbonate cell culture inserts (Corning-Costar) in DMEM supplemented with 10% FBS. The cells were washed with saline [in mM: 50 3-(N-morpholino)propanesulfonic acid-Na, 94 NaCl, 7.4 KCl, 0.74 MgCl2, and 1.5 CaCl2, pH 6.7] and incubated at 37°C in saline supplemented with 5 µM 59Fe as either the 59Fe-ascorbate complex (1:50 mol/mol) or the Fe-NTA complex (1:2.2 mol/mol) or with 5 µM 64Cu as the 64Cu-histidine complex (1:10 mol/mol) (3) in the apical medium. The uptake was stopped by washing the inserts three times with ice-cold saline supplemented with 1 mM EDTA. In previous experiments, we ascertained that this treatment effectively removed the radioactivity loosely bound to cells. A cell extract was prepared by adding 50 µl of lysis buffer (10 mM HEPES, pH 7.5, 3 mM MgCl2, 40 mM KCl, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, 0.5 µg/ml aprotinin, 0.7 µg/ml pepstatin A, 5% glycerol, 1 mM dithiothreitol, and 0.5% Triton X-100). The mixture was incubated for 15 min on ice and sedimented for 10 min at 10,000 g. The supernatant was evaluated for protein and for 59Fe or 64Cu radioactivity.

Competition studies between iron and copper uptake were performed with cells grown in polycarbonate cell culture inserts (Corning-Costar). When the effect of copper on iron uptake was tested, the apical chamber contained 5 µM 59Fe as the 59Fe-ascorbate complex (1:50 mol/mol) plus 0.5-150 µM 64Cu as a 64Cu-histidine complex (1:10 mol/mol). When the effect of iron on copper uptake was tested, the apical chamber contained 5 µM 64Cu-histidine with or without 250 µM ascorbate, plus 0.5-150 µM Fe3+ as either FeCl3-NTA (1:2.2 mol/mol) or freshly prepared FeSO4.

Statistical analysis. Variables were tested in triplicate, and the experiments were repeated at least twice. Variability among experiments was <20%. One-way ANOVA was used to test differences in mean values, and Bonferroni's post hoc test was used for comparisons (GraphPad InStat). Differences were considered significant if P < 0.05.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Antisense oligonucleotides against DMT1 inhibited iron and copper transport. To demonstrate the possible mediation of DMT1 on copper transport, we determined iron and copper apical uptake in Caco-2 cells transfected with DMT1 antisense oligonucleotides. Figure 1A shows 59Fe apical uptake in the absence or presence of DMT1 antisense oligonucleotides. Treatment of cells with antisense MA1 produced 80% inhibition in 59Fe uptake compared with control cells. Significant inhibition was also produced by antisense TN2, whereas antisense TN3 produced a nonsignificant inhibition. Similarly, antisense oligonucleotides MA1 and TN2 produced significant inhibitions of 64Cu uptake, whereas TN3 did not (Fig. 1B). MA1 produced 47% inhibition in 64Cu uptake. Besides TN3, other three antisense sequences did not produce inhibition of iron uptake (data not shown). We considered these antisenses negative controls for antisenses MA1 and TN2.


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 1.   Iron and copper uptake by Caco-2 cells in the presence of DMT1 antisense oligonucleotides. Caco-2 cells grown in polycarbonate cell culture inserts were transfected with DMT1 antisense oligonucleotides as described in EXPERIMENTAL PROCEDURES. The day of the experiment, the cells were incubated from the apical side with 5 µM 59Fe-ascorbate or 5 µM 64Cu-histidine plus ascorbate. A: kinetics of apical 59Fe uptake. B: kinetics of apical 64Cu uptake. Statistical analysis of uptake rates: **P < 0.001; *P < 0.05; ns (nonsignificant) indicates P > 0.05. C: cell extracts from either control cells or cells treated with MA1 were subjected to Western immunodetection of DMT1 by using a polyclonal antibody raised against the COOH-terminal segment of DMT1, IRE-isoform. A band of 66,000 Daltons (66 kDa) was observed. To control for gel load, the membranes were acid-stripped after the detection of DMT1 and reblotted with anti-actin.

Iron and copper transport inhibition induced by MA1 antisense treatment correlated with decreased DMT1 protein expression (Fig. 1C).

Iron and copper uptake competition. The ability of one cation to inhibit the uptake of another cation has been used as a criterion for transport by a unique carrier (4, 6, 9, 28). To assess iron competition for copper transport, we evaluated the effect of iron on 64Cu uptake by Caco-2 cells. Preliminary experiments indicated that copper uptake depended on the presence of ascorbate in the medium, so experiments were designed to elucidate both the role of iron and of ascorbate on copper transport. Figure 2A shows that the presence of ascorbate was necessary to obtain significant apical 64Cu uptake, providing an insight into the oxidation state of the transported copper. In fact, the requirement for ascorbate is a strong indication that in Caco-2 cells, copper is transported in the reduced (Cu1+) state. In the presence of ascorbate, iron added as either FeSO4 (i.e., in a pure Fe2+ form) or Fe-NTA (i.e., in a Fe2+ form achieved after the reaction of Fe3+ with ascorbate) inhibited 64Cu uptake.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 2.   Iron and copper uptake competition studies. A: Caco-2 cells grown in bicameral inserts were incubated from the apical side with 5 µM 64Cu-histidine with or without 250 µM ascorbate (AA) and with the Fe species indicated. NTA, nitriloacetate disodium salt. B: cells were incubated from the apical side with 5 µM 59Fe, 250 µM ascorbate, and increasing concentrations (0.5-250 µM) of Cu2+ as a Cu-histidine (Cu-His) complex.

To evaluate copper competition for iron transport, we studied 5 µM 59Fe-ascorbate uptake in the presence of varied concentrations of copper (range: 0.1 to 150 µM) (Fig. 2B). Iron uptake decreased when extracellular copper increased. Fifty percent inhibition of iron uptake was achieved at 7.1 µM Cu, that is at a Cu:Fe ratio of 1.4. Inhibition increased to 79.2 and 92.5% when the ratio increased to 10 and 100, respectively. Thus, in the presence of ascorbate, copper inhibited the absorption of iron and vice versa.

The oxidation state of transported copper is relevant to understand its transport process. Accordingly, further experiments were designed to assess the redox state of transported copper under the assay conditions used here. As shown in Fig. 3A, Cu(II)-histidine plus ascorbate formed a complex with bathocuproine with absorption at 480 nm. Given that bathocuproine is a specific Cu1+ chelator (27), it is apparent that ascorbate reduced Cu2+ present in the Cu-histidine complex to Cu1+. We further explored the reduction of copper under the different conditions tested in Fig. 2A. Ascorbate reduced Cu(II)-histidine in the absence and the presence of equimolar concentrations of Fe3+, whereas no reduction of copper was observed with Fe3+ alone (Fig. 3B). Interestingly, equimolar concentrations of Fe2+, in the absence of ascorbate, afforded a considerable reduction of Cu(II)-histidine, as observed by the increase in 480-nm absorbance. The experiments shown in Figs. 2 and 3 strongly indicate that Cu1+ is the prevalent transported species and that Fe2+ inhibits this transport.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 3.   Cu1+ is formed in the presence of either ascorbate or Fe2+. A: 10 µM Cu2+, as the Cu-histidine complex was reacted with 1 mM bathocuproine in the absence or the presence of 500 µM ascorbate. The formation of a Cu1+-bathocuproine complex presented a strong absorbance (Abs.) that peaked at 480 nm. B: the Cu-histidine complex was reacted with bathocuproine, and the formation of Cu1+ was followed by absorbance at 480 nm. In all conditions, 1 mM bathocuproine was present. Cu-H, 10 µM Cu(II)-histidine; Cu-H + Asc, 10 µM Cu(II)-histidine + 500 µM ascorbate; Fe(III), 10 µM Fe-NTA; Fe(III) + Asc, 10 µM Fe-NTA + 500 µM ascorbate; Cu-H + Fe(III), 10 µM Cu(II)-histidine + 10 µM Fe-NTA; Cu-H + F(III) + Asc, 10 µM Cu(II)-histidine + 10 µM Fe-NTA + 500 µM ascorbate; Cu-H + Fe(II), 10 µM Cu(II)-histidine + 10 µM Fe2SO4. Values are means ± SD of 4 determinations.

59Fe and 64Cu uptake in Caco-2 cells as a function of intracellular iron levels. DMT1 is the main, if not the only, Fe2+ apical transporter of intestinal cells. Because DMT1 expression is regulated by cell iron levels (1), we evaluated copper transport in cells with varied levels of iron. As previously reported (30), 59Fe uptake in Caco-2 cells inversely correlated with intracellular iron concentration (Fig. 4A). The apical 59Fe uptake rate of Caco-2 cells was 44.24 ± 2.92 pmol · mg protein-1 · h-1 in cells preconditioned in 0.5 µM Fe and 12.17 ± 1.09 pmol · mg protein-1 · h-1 in cells preconditioned in 20 µM Fe. 64Cu uptake responded similarly to cellular iron concentrations (Fig. 4B). The rate of 64Cu uptake was 20.81 ± 2.86 pmol · mg protein-1 · h-1 in cells preconditioned in 0.5 µM Fe and 7.75 ± 0.98 pmol · mg protein-1 · h-1 in cells preconditioned in 20 µM Fe. The fact that both iron and copper uptake are dependent on the intracellular iron concentration is in line with the possibility that a common transporter transports both metals.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 4.   Apical 59Fe and 64Cu uptake by Caco-2 cells. Caco-2 cells grown in bicameral inserts were conditioned with varied extracellular iron concentrations. Cells were then incubated from the apical side with either 5 µM 59Fe (A) or 5 µM 64Cu (B) in the presence of 250 µM ascorbate. A: kinetics of apical 59Fe uptake. B: kinetics of apical 64Cu uptake.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

DMT1 is the Fe2+ transporter responsible for apical iron uptake by intestinal cells. In this work we investigated the possibility that copper could also be transported by DMT1, based on the observation that, as with iron, copper induces an inward positive current in oocytes expressing the transporter (12, 26). Though the requirement for DMT1 to undertake apical iron absorption and to maintain body iron homeostasis is evident (10, 18, 25), a putative role for DMT1 in intestinal copper absorption is uncertain.

The MA1 antisense oligonucleotide inhibited iron and copper uptake by 80 and 47%, respectively. These data demonstrate two important aspects of copper and iron intestinal absorption: DMT1 is the main iron transporter in intestinal cells, and at least 50% of copper transport is mediated by DMT1. Transport competition experiments indicated that copper inhibited iron uptake and vice versa. Significant copper uptake was observed only when copper was in the Cu1+ state, i.e., in the presence of ascorbate. This observation agrees with previous observations indicating that Cu1+ inhibits Fe2+, but not Fe3+, uptake by perfused mouse intestine (13), and it strongly supports the idea that Cu1+ is the species transported by DMT1 in apical Caco-2 copper uptake. The possibility that copper inhibition arises from competition for DcytB is unlikely because competition was observed under reducing conditions (50 µM ascorbate), where Fe2+, or Cu1+, should be directly transported by DMT1. The subject is more complex when there is a mixture of Fe2+ and Cu2+, or Fe3+ and Cu1+. Because of crossed redox reactions, a mixture of Fe2+, Fe3+, Cu1+, and Cu2+ should be present. The relative proportion of each species should be predicted by the reduction potential of the Fe3+/Fe2+ and Cu2+/Cu1+ pairs. Nevertheless, there is still the possibility that iron and copper could be competing for hephestin and thus affect crossed inhibition of the transfer phase, which could result in secondary inhibition of the uptake phase.

Our observation that iron uptake was inversely correlated with cell iron content confirms earlier studies in Caco-2 cells (30) and isolated intestine (22). Likewise, we found that copper uptake was inversely related to cell iron content, in agreement with recent reports describing increased copper uptake in deferrioxamine-treated cells (34) and decreased DMT1 protein and mRNA expression in Caco-2 cells cultured in high copper (31). Zerounian and Linder (34) also found that copper depletion induced an increase in iron uptake. Thus an intimate relationship exists between intestinal copper and iron homeostasis. Although the molecular mechanisms that connect copper and iron uptake are unknown at present, our data are in line with the idea that DMT1 is a common link.

In summary, the results presented indicate that DMT1 is a physiologically relevant Cu1+ transporter and that intestinal absorption of copper and iron are intertwined.


    ACKNOWLEDGEMENTS

We thank Dr. Cecilia Hidalgo for thoughtful comments.


    FOOTNOTES

This work was supported by Fondo Nacional de Ciencia y Tecnología Grants 2990116 and 1010657 and Millennium Institute for Advanced Studies in Cell Biology and Biotechnology Grant P99-031F.

Address for reprint requests and other correspondence: M. T. Núñez, Departamento de Biología, Facultad de Ciencias, Universidad de Chile, Casilla 653, Santiago, Chile (E-mail: mnunez{at}uchile.cl).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

10.1152/ajpcell.00480.2002

Received 16 October 2002; accepted in final form 3 January 2003.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1.   Arredondo, M, Muñoz P, Mura C, and Núñez MT. HFE inhibits apical iron uptake by intestinal epithelial (Caco-2) cells. FASEB J 15: 1276-1278, 2001[Free Full Text].

2.   Arredondo, M, Orellana A, Gárate MA, and Núñez MT. Intracellular iron regulates iron absorption and IRP activity in intestinal epithelial (Caco-2) cells. Am J Physiol Gastrointest Liver Physiol 273: G275-G280, 1997[Abstract/Free Full Text].

3.   Arredondo, M, Uauy R, and Gonzalez M. Regulation of copper uptake and transport in intestinal cell monolayers by acute and chronic copper exposure. Biochim Biophys Acta 1474: 169-176, 2000[Medline].

4.   Conrad, ME, Umbreit JN, Moore EG, Hainsworth LN, Porubcin M, Simovich MJ, Nakada MT, Dolan K, and Garrick MD. Separate pathways for cellular uptake of ferric and ferrous iron. Am J Physiol Gastrointest Liver Physiol 279: G767-G774, 2000[Abstract/Free Full Text].

5.   Dancis, A, Haile D, Yuan DS, and Klausner RD. The Saccharomyces cerevisiae transport protein (ctr1p). Biochemical characterization, regulation by copper, and physiological role in copper uptake. J Biol Chem 269: 25660-25667, 1994[Abstract/Free Full Text].

6.   Elisma, F, and Jumarie C. Evidence for cadmium uptake through Nramp2: metal speciation studies with Caco-2 cells. Biochem Biophys Res Commun 285: 662-668, 2001[Web of Science][Medline].

7.   Fleming, MD, Romano MA, Su MA, Garrick LM, Garrick MD, and Andrews NC. Nramp2 is mutated in the anemic Belgrade (b) rat: evidence of a role for Nramp2 in endosomal iron transport. Proc Natl Acad Sci USA 95: 1148-1153, 1998[Abstract/Free Full Text].

8.   Fleming, MD, Trenor CI, Su MA, Foernzler D, Beier DR, Dietrich WF, and Andrews NC. Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene. Nat Genet 16: 383-386, 1997[Web of Science][Medline].

9.   Garrick, MD, and Dolan KG. An expression system for a transporter of iron and other metals. In: Ultrastructure and Molecular Biology Protocols for Oxidants and Antioxidants. Methods in Molecular Biology, edited by Armstrong D.. Totowa, NJ: Humana, 2002, vol. 196, p. 149-156.

10.   Garrick, MD, Dolan KG, Horbinski C, Ghio AJ, Higgins D, Porubcin M, Moore EG, Hainsworth LN, Umbreit JN, Conrad ME, Feng L, Lis A, Roth JA, Singleton S, and Garrick LM. DMT1: a mammalian transporter for multiple metals. BioMetals 16: 41-54, 2003[Web of Science][Medline].

11.   Garrick, MD, Gniecko K, Liu Y, Cohan DS, and Garrick LM. Transferrin and the transferrin cycle in Belgrade rat reticulocytes. J Biol Chem 268: 14867-14874, 1993[Abstract/Free Full Text].

12.   Gunshin, H, Mackenzie B, Berger UV, Gunshin Y, Romero MF, Boron WF, Nussberger S, Gollan JL, and Hediger MA. Cloning and characterization of a proton-coupled mammalian metal ion transporter. Nature 388: 482-488, 1997[Medline].

13.   Iturri, S, and Núñez MT. Effect of copper, cadmium, mercury, manganese and lead on Fe2+ and Fe3+ absorption in perfused mouse intestine. Digestion 59: 671-675, 1998[Web of Science][Medline].

14.   Lee, J, Prohaska JR, Dagenais SL, Glover TW, and Thiele DJ. Isolation of a murine copper transporter gene, tissue specific expression and functional complementation of a yeast copper transport mutant. Gene 254: 87-96, 2000[Web of Science][Medline].

15.   Lee, J, Prohaska J, and Thiele D. Essential role for mammalian copper transporter Ctr1 in copper homeostasis and embryonic development. Proc Natl Acad Sci USA 98: 6842-6847, 2001[Abstract/Free Full Text].

16.   Leibold, EA, and Munro HN. Cytoplasmic protein binds in vitro to a highly conserved sequence in the untranslated region of ferritin heavy-and-light-subunit mRNAs. Proc Natl Acad Sci USA 85: 2171-2175, 1998.

17.   Linder, MC, and Hazegh-Azam M. Copper biochemistry and molecular biology. Am J Clin Nutr 63: 797S-811S, 1996[Abstract/Free Full Text].

18.   Levy, JE, Montross LK, and Andrews NC. Genes that modify the hemochromatosis phenotype in mice. J Clin Invest 105: 1209-1216, 2000[Web of Science][Medline].

19.   Mahler, HR, and Cordes EH. Biological Chemistry. New York: Harper and Row, 1961, p. 207.

20.   Mahraoui, L, Ruosset M, Dussaulx E, Darmoul A, Zweibaun A, and Brot-Laroche E. Expression and localization of GLUT-5 in Caco-2 cells, human small intestine, and colon. Am J Physiol Gastrointest Liver Physiol 263: G312-G318, 1992[Abstract/Free Full Text].

21.   Oates, PS, and Morgan EH. Defective iron uptake by the duodenum of Belgrade rats fed diets of different iron contents. Am J Physiol Gastrointest Liver Physiol 270: G826-G832, 1996[Abstract/Free Full Text].

22.   Oates, PS, Trinder D, and Morgan EH. Gastrointestinal function, divalent metal transporter-1 expression and intestinal iron absorption. Pflügers Arch 440: 496-502, 2000[Web of Science][Medline].

23.   Olivi, L, Sisk J, and Bressler J. Involvement of DMT1 in uptake of Cd in MDCK cells: role of protein kinase C. Am J Physiol Cell Physiol 281: C793-C800, 2001[Abstract/Free Full Text].

24.   Peterson, MD, and Mooseker MS. An in vitro model for the analysis of intestinal brush-border assembly. I. Ultrastructural analysis of cell-contact induced brush border assembly in Caco-2 cells. J Cell Sci 105: 445-460, 1993[Abstract].

25.   Rolfs, A, and Hediger M. Metal ion transporter in mammals: structure, function and pathological implications. J Physiol 518: 1-12, 1999[Abstract/Free Full Text].

26.   Sacher, A, Cohen A, and Nelson N. Properties of the mammalian and yeast metal-ion transporters DCT1 and Smf1p expressed in Xenopus laevis oocytes. J Exp Biol 204: 1053-1061, 2001[Abstract].

27.   Sayre, LM, and Multhaup G. Alzheimer's precursor protein and the use of bathocuproine for determining reduction of copper(II). Science 274: 1933-1934, 1996[Web of Science][Medline].

28.   Tallkvist, J, Bowlus CL, and Lönnerdal B. DMT1 gene expression and cadmium absorption in human absorptive enterocytes. Toxicol Lett 122: 171-177, 2001[Web of Science][Medline].

29.   Tandy, S, Williams M, Leggett A, Lopez-Jimenez M, Dedes M, Ramesh B, Srai SK, and Sharp P. Nramp2 expression is associated with pH-dependent iron uptake across the apical membrane of human intestinal Caco-2 cells. J Biol Chem 275: 1023-1029, 2000[Abstract/Free Full Text].

30.   Tapia, V, Arredondo M, and Núñez MT. Regulation of Fe absorption by cultured intestinal (Caco-2) cell monolayers with varied Fe status. Am J Physiol Gastrointest Liver Physiol 271: G443-G447, 1996[Abstract/Free Full Text].

31.   Tennant, J, Stansfield M, Yamaji S, Srai SK, and Sharp P. Effect of copper on the expression of metal transporters in human intestinal Caco-2 cells. FEBS Lett 527: 239-244, 2002[Web of Science][Medline].

32.   Trinder, D, Fox C, Vautier G, and Olynyk JK. Molecular pathogenesis of iron overload. Gut 51: 290-295, 2002[Abstract/Free Full Text].

33.   Tu, GC, Cao QN, Zhou F, and Israel Y. Tetranucleotide GGGA motif in primary RNA transcripts. Novel target site for antisense design. J Biol Chem 273: 25125-25131, 1998[Abstract/Free Full Text].

34.   Zerounian, NR, and Linder MC. Effects of copper and ceruloplasmin on iron transport in the Caco-2 cell intestinal model. J Nutr Biochem 13: 138-148, 2002[Web of Science][Medline].

35.   Zhou, B, and Gitschier J. hCTR1: a human gene for copper uptake identified by complementation in yeast. Proc Natl Acad Sci USA 94: 7481-7486, 1997[Abstract/Free Full Text].


Am J Physiol Cell Physiol 284(6):C1525-C1530
0363-6143/03 $5.00 Copyright © 2003 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
J. F. Collins, P. Hua, Y. Lu, and P. N. Ranganathan
Alternative splicing of the Menkes copper Atpase (Atp7a) transcript in the rat intestinal epithelium
Am J Physiol Gastrointest Liver Physiol, October 1, 2009; 297(4): G695 - G707.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. H. Kaplan and S. Lutsenko
Copper Transport in Mammalian Cells: Special Care for a Metal with Special Needs
J. Biol. Chem., September 18, 2009; 284(38): 25461 - 25465.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
S. L. Hansen, N. Trakooljul, H.-C. Liu, A. J. Moeser, and J. W. Spears
Iron Transporters Are Differentially Regulated by Dietary Iron, and Modifications Are Associated with Changes in Manganese Metabolism in Young Pigs
J. Nutr., August 1, 2009; 139(8): 1474 - 1479.
[Abstract] [Full Text] [PDF]


Home page
J DAIRY SCIHome page
S. L. Hansen and J. W. Spears
Bioaccessibility of iron from soil is increased by silage fermentation
J Dairy Sci, June 1, 2009; 92(6): 2896 - 2905.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
M. Domellof, O. Hernell, S. A Abrams, Z. Chen, and B. Lonnerdal
Iron supplementation does not affect copper and zinc absorption in breastfed infants
Am. J. Clinical Nutrition, January 1, 2009; 89(1): 185 - 190.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
M. Gonzalez, A. Reyes-Jara, M. Suazo, W. J Jo, and C. Vulpe
Expression of copper-related genes in response to copper load
Am. J. Clinical Nutrition, September 1, 2008; 88(3): 830S - 834S.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
B. Lonnerdal
Intestinal regulation of copper homeostasis: a developmental perspective
Am. J. Clinical Nutrition, September 1, 2008; 88(3): 846S - 850S.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
M. Moriya, Y.-H. Ho, A. Grana, L. Nguyen, A. Alvarez, R. Jamil, M. L. Ackland, A. Michalczyk, P. Hamer, D. Ramos, et al.
Copper is taken up efficiently from albumin and {alpha}2-macroglobulin by cultured human cells by more than one mechanism
Am J Physiol Cell Physiol, September 1, 2008; 295(3): C708 - C721.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
C. D. San Martin, C. Garri, F. Pizarro, T. Walter, E. C. Theil, and M. T. Nunez
Caco-2 Intestinal Epithelial Cells Absorb Soybean Ferritin by {micro}2 (AP2)-Dependent Endocytosis
J. Nutr., April 1, 2008; 138(4): 659 - 666.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
S. Lutsenko, N. L. Barnes, M. Y. Bartee, and O. Y. Dmitriev
Function and Regulation of Human Copper-Transporting ATPases
Physiol Rev, July 1, 2007; 87(3): 1011 - 1046.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
L. Nyasae, R. Bustos, L. Braiterman, B. Eipper, and A. Hubbard
Dynamics of endogenous ATP7A (Menkes protein) in intestinal epithelial cells: copper-dependent redistribution between two intracellular sites
Am J Physiol Gastrointest Liver Physiol, April 1, 2007; 292(4): G1181 - G1194.
[Abstract] [Full Text] [PDF]


Home page
Hum Exp ToxicolHome page
J. P Bressler, L. Olivi, J. H. Cheong, Y. Kim, A. Maerten, and D. Bannon
Metal transporters in intestine and brain: their involvement in metal-associated neurotoxicities
Human and Experimental Toxicology, March 1, 2007; 26(3): 221 - 229.
[Abstract] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
M. Moriya and M. C. Linder
Vesicular transport and apotransferrin in intestinal iron absorption, as shown in the Caco-2 cell model
Am J Physiol Gastrointest Liver Physiol, February 1, 2006; 290(2): G301 - G309.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
W.S. Chong, P.C. Kwan, L.Y. Chan, P.Y. Chiu, T.K. Cheung, and T.K. Lau
Expression of divalent metal transporter 1 (DMT1) isoforms in first trimester human placenta and embryonic tissues
Hum. Reprod., December 1, 2005; 20(12): 3532 - 3538.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
J. F. Collins, C. A. Franck, K. V. Kowdley, and F. K. Ghishan
Identification of differentially expressed genes in response to dietary iron deprivation in rat duodenum
Am J Physiol Gastrointest Liver Physiol, May 1, 2005; 288(5): G964 - G971.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. F. Eisses, Y. Chi, and J. H. Kaplan
Stable Plasma Membrane Levels of hCTR1 Mediate Cellular Copper Uptake
J. Biol. Chem., March 11, 2005; 280(10): 9635 - 9639.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
M. Arredondo, V. Cambiazo, L. Tapia, M. Gonzalez-Aguero, M. T. Nunez, R. Uauy, and M. Gonzalez
Copper overload affects copper and iron metabolism in Hep-G2 cells
Am J Physiol Gastrointest Liver Physiol, July 1, 2004; 287(1): G27 - G32.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (51)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Arredondo, M.
Right arrow Articles by Núñez, M. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Arredondo, M.
Right arrow Articles by Núñez, M. T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the American Physiological Society.