|
|
||||||||
Molecular Medicine Unit, Department of Medicine, Beth Israel, Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts 02215
| |
ABSTRACT |
|---|
|
|
|---|
Thioredoxin (Trx) is a cytosolic, redox-active protein that is secreted from many cells and has several extracellular functions. In activated lymphocytes, the pathway of secretion does not involve the Golgi apparatus. Levels of extracellular Trx are decreased by the antioxidant N-acetylcysteine. Hence, the secretion of Trx could be altered by the redox status of the cell or the protein. To study Trx mutants, we characterized the secretion of human Trx from Chinese hamster ovary cells. Secretion of human Trx is unaffected by brefeldin A, slow but efficient, and sensitive to low temperature and factors in serum. We demonstrate that N-acetylcysteine reduces the cellular level of Trx but not the proportion secreted; thus this chemical does not block the nonclassic pathway for Trx secretion. Furthermore, we find that mutations in either the active site or the dimerization site of Trx do not alter its secretion. Thus the nonclassic secretion of Trx is not dependent on the redox status of either the cell or the protein.
protein trafficking; protein secretion
| |
INTRODUCTION |
|---|
|
|
|---|
THIOREDOXIN
(Trx) is a small, redox-active, cytosolic protein found in
plants, bacteria, and eukaryotic organisms that has diverse cellular
functions (1, 27). In humans, a single gene for Trx
encodes a protein of 105 amino acids with a molecular mass of 12 kDa
that forms a compact spherical structure (13, 42, 44). Trx
is an antioxidant that helps to maintain the cytosolic redox
environment for proper protein folding and activates transcription
factors such as necrosis factor
B (NF)-
B and activator protein-1
(AP-1) (17, 23). The active site of human Trx consists of
Cys32-Gly-Pro-Cys35, and this motif is highly
conserved among various species (1). The active site
undergoes reversible oxidation-reduction, and oxidized Trx is reduced
by the NADPH-dependent flavoprotein Trx reductase (43). In
cancer cells, increased expression of Trx provides resistance against
various anticancer drugs and protection from apoptosis
(2, 4, 32).
Trx is secreted from a variety of normal and neoplastic cells of the blood, breast, colon, lung, and liver (4, 28, 30, 31, 37, 38, 40). Trx is found extracellularly despite lacking a typical, amino-terminal signal sequence that is usually present in proteins secreted via the endoplasmic reticulum (ER). Agents that disrupt secretion through the classic ER-Golgi route, such as brefeldin A (BFA) and monensin, have no effect or increase the secretion of Trx from activated lymphocytes (28). Although it is known that Trx is secreted from lymphocytes via a nonclassic pathway, this finding has not been corroborated for other cell types. The details of the secretory pathway through which Trx is exported are unknown.
Extracellular Trx performs a variety of physiological and pathophysiological functions. Trx is a powerful chemotactic factor for eosinophils as part of the defense against parasites (3, 34, 35). Trx is also a part of the early pregnancy factor necessary for establishment of the placenta (8, 9). Once secreted, Trx can potentiate the effect of cytokines such as interleukins-1 and -2 (15, 41). Furthermore, Trx on its own can stimulate growth and promote the survival of cells (15). Indeed, Trx was identified as the essential growth-promoting protein in the conditioned medium of adult T cell leukemia (ATL) cells (37, 38). The reducing activity of Trx is necessary for its mitogenic activity (14). Recent studies have shown that Trx reductase is also secreted by both normal and neoplastic cells (36). Trx reductase is therefore available to regenerate reduced Trx extracellularly.
Trx can also alter the function of lymphocytes and neutrophils
(26). Exogenous Trx protects lymphoid cells against
TNF-
- or hydrogen peroxide-mediated cytotoxicity and prevents
apoptosis caused by depletion of glutathione and
L-cysteine (18). In contrast to these
beneficial effects, elevated plasma levels of Trx can block chemotaxis
by neutrophils in response to lipopolysaccharide (25). An
elevated level of plasma Trx was found to be associated with decreased
survival in patients with acquired immune deficiency syndrome (AIDS)
and correlated with reduced chemotaxis of neutrophils (24). Chemicals that are antioxidants or that increase
glutathione could lower levels of Trx and thereby diminish its
detrimental effects on neutrophils. N-acetylcysteine (NAC)
is itself an antioxidant and also increases cellular glutathione. The
administration of NAC increased survival in patients with AIDS
(24).
Treatment with NAC was also reported to decrease the secretion of Trx by human T-cell leukemia virus I-transformed T cells (24). These findings raise the issue of whether NAC blocks the nonclassic secretory pathway or simply lowers cytosolic levels of Trx. We investigated this issue because no specific inhibitor of the nonclassic secretory pathway used by Trx is known. We also examined whether the secretion of Trx is sensitive to the redox status of the cell or Trx itself.
We investigated the heterologous secretion of human Trx from Chinese hamster ovary (CHO) cells. This approach enables the study of mutant forms of Trx without cross-reacting, endogenous human Trx. Similar to cancer cells that secrete endogenous Trx, transfected CHO cells secrete human Trx slowly but efficiently. This export is not inhibited by BFA, indicating that a nonclassic pathway is used. We characterize the secretion of Trx from CHO cells and demonstrate that its exportation does not depend on either the redox status of the cell or a functional active site in Trx.
| |
METHODS |
|---|
|
|
|---|
Reagents. Emmanuelle Wollman kindly provided the plasmid-encoding Trx (44), and David Silberstein generously provided polyclonal antibodies for Trx (3). Monoclonal antibodies against the myc epitope were purified by protein G affinity chromatography from media of MYC 1-9E10.2 cells (10). Lipofectamine 2,000, OPTI-MEM, Glutamax I, penicillin/streptomycin, fetal bovine serum, and protein A-agarose were purchased from Invitrogen. BFA was purchased from Sigma. Trans 35S-label (>70% L-methionine; >1,000 Ci/mmol) was purchased from ICN Biomedicals.
Plasmid construction. The plasmid pTrx encoding human Trx was created by amplifying Trx cDNA with the forward (encoding BamHI site and translation initiation consensus: 5'-CGGGATCCGCCACCATGGTGAAGCAGATCGAGAGCAAG-3') and reverse (encoding a stop codon and EcoRI site: 5'-CGGAATTCTTAGACTAATTCATTAATGGTGGC-3') oligonucleotides using Platinum pfx DNA polymerase (Invitrogen). The PCR product was digested, isolated, and subcloned into pcDNA3 at the BamHI and EcoRI sites. A similar method was used to create the preprolactin-myc construct by using the forward (encoding BamHI site and translation initiation consensus sequence: 5'-CGGGATCCGCCACCATGG ACAGCAAAGGTTCGTCGC-3') and reverse (encoding NotI site: 5'- ATAGTTTAGCGGCCGCGCAGTTGT TGTTGTAGATGATTCTGC-3') oligonucleotides to amplify the bovine preprolactin gene from the plasmid pT7-Bprl. The PCR product was isolated and cloned at the BamHI and NotI sites of pcDNA3 with a pre-existing myc epitope following the NotI site. The active site mutant (containing a serine instead of cysteine at residue 35) was constructed with the megaprimer method of PCR using primers T7, SP6, 5'-TAGGCCCACACCACGTGGCTGAG-3' and 5'-GCAAAATGATCAAGCCTTTCTTTC-3' and pTrx as template. The assembled PCR product was subcloned into the BamHI and EcoRI sites of pcDNA3. The dimerization mutant (containing a serine instead of cysteine at residue 73) was constructed in a similar fashion using primers T7, SP6, 5'-TTTTGACTTCACACTCTGAAGC-3', and 5'-GCATGCCAACATTCCAGTTTTTTAAG-3'. All plasmids were sequenced for verification.
Cell culture. CHO, MCF-7, and HT-29 cells were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, 100 units/ml penicillin/streptomycin, 1% nonessential amino acids, and 2 mM L-glutamine. All cells were grown in a 37°C incubator with 5% CO2.
Transient transfection. One day before transfection, CHO cells were trypsinized and counted. One million cells were transferred to 60-mm culture dishes and left overnight to form >95% confluent monolayers. Cells were transfected by using 3 µg of plasmid DNA and 15 µl of Lipofectamine 2000 for each 6-cm dish. Each of the components was resuspended in 450 µl of OPTI-MEM, incubated for 5 min at room temperature, mixed, and incubated for a further 23 min before the addition of 4 ml of OPTI-MEM. The DNA-Lipofectamine 2000 suspension was then added to the cells [prewashed twice in phosphate-buffered saline (PBS) to remove residual serum] and incubated at 37°C overnight. The next day, transfected cells were washed twice in PBS to remove residual DNA-Lipofectamine 2000 complexes before metabolic labeling.
Metabolic labeling with 35S-methionine. CHO cells were incubated in methionine-free medium (DMEM minus methionine and cysteine, 5% fetal bovine serum, 1% Glutamax I, 1% non-essential amino acids, 1× penicillin and streptomycin) for 30 min at 37°C in 5% CO2 and labeled with 100 µCi/ml 35S-methionine for 30 min. At the end of the labeling period, the cells were washed once with chase medium (DMEM, 1× penicillin and streptomycin, 1% nonessential amino acids) and incubated for the indicated amount of time. Metabolic labeling of MCF7 and HT-29 cells was performed similarly, except the cells were starved for 1 h and labeled for 1 h with 200 µCi/ml of [35S]methionine. Some cells were treated with 1 µg/ml BFA during the starvation, labeling, and chase periods.
Immunoprecipitation, SDS-PAGE, and phosphor imaging. For each dish of cells, the medium was collected and cells were lysed by the addition of 1 ml of 1× TXSWB (1% Triton X-100, 100 mM Tris · HCl, pH 8, 100 mM NaCl) in the presence of 1 mM PMSF. Both cell lysate and medium were centrifuged at 16,000 g for 15 min to remove debris, and the supernatants were transferred to fresh 1.5-ml tubes. Aliquots of cleared cell lysate and medium were saved for assays of lactate dehydrogenase (LDH) (see LDH assays). For immunoprecipitation, 200 µl of 5 × TXSWB buffer (5% Triton X-100, 500 mM Tris · HCl, pH 8, 500 mM NaCl) and 1 mM PMSF were added to the cleared medium. Either 4 µl of anti-Trx antibodies or 6 µl of anti-myc antibodies prebound to protein G beads were added per 1 ml of cell lysate or medium. The samples were mixed by inversion and incubated at 4°C for 1 h before the addition of 10 µl of a suspension of protein A-agarose beads. Samples derived from U937 and IM9 cells were precleared of endogenous antibody by overnight rotation with 10 µl of a suspension of protein A-agarose beads before immunoprecipitation. The samples were rotated at 4°C overnight, washed twice in 1× TXSWB and twice in Tris-NaCl (100 mM Tris · HCl, pH 8, 100 mM NaCl), and resuspended in 1× SDS-PAGE buffer with 500 mM 1,4-dithiothreitol (DTT). The samples were incubated at 37°C for 30 min before boiling and loaded on a 15% polyacrylamide gel. At the completion of electrophoresis, the gels were destained for 30 min, soaked in 1 M sodium salicylate for 30 min, and dried. The gels were exposed to X-ray film for viewing or a phosphor-imaging screen (Molecular Dynamics) for quantitation.
LDH assay. Assays for LDH were carried out on 5-µl samples of cell lysate and medium after the chase period to assess cell lysis. The TOX7 LDH assay kit (Sigma) was used according to the manufacturer's instructions.
| |
RESULTS |
|---|
|
|
|---|
Nonclassic secretion of endogenous Trx by human cells.
Trx is secreted from lymphoblastoid cells, fibroblasts, airway
epithelial cells, and cells derived from tumors of breast and colon
cancers (4, 28, 30, 31, 37, 38, 40). Export of Trx via a
nonclassic pathway has been demonstrated only for activated lymphocytes
(28). We assayed the secretion of Trx from a variety of
cells expressing endogenous Trx to verify that secretion is nonclassic
and to obtain a reference with which to compare secretion from
heterologous cells. From 14 to 44% of Trx is secreted from MCF-7
(breast cancer), HT-29 (colon carcinoma), U937 (histiocytic lymphoma),
and IM9 (multiple myeloma) cells (Fig.
1). To demonstrate that Trx is secreted
from these cells via a nonclassic pathway, pulse-chase assays were
repeated in the presence of BFA to block ER-Golgi transport. BFA did
not block the secretion of Trx from these cells. Assays for LDH
indicated that <3% of total cellular LDH was present in the medium
after 4 h (data not shown), verifying that the extracellular Trx
did not arise from cell lysis. Thus Trx is actively secreted from these
cells via a BFA-insensitive, nonclassic pathway.
|
Nonclassic secretion of human Trx in a heterologous cell system.
To test the role of the active site or other residues on the secretion
of Trx, we searched for a mammalian cell line that secretes Trx
nonclassically but lacks cross-reacting, endogenous Trx. We found that
CHO cells offer several advantages for these studies. First, CHO cells
do not synthesize and therefore do not secrete endogenous Trx that
could interfere with our assay for secretion. Pulse-chase analysis of
untransfected CHO cells with [35S]methionine and
subsequent immunoprecipitation with anti-Trx antibodies detected no
cross-reacting protein bands corresponding to endogenous Trx in either
the cell lysate or medium (Fig. 2A, lanes 1 and
2). Treatment of these cells
with BFA did not alter this result (Fig. 2A, lanes
3 and 4). Second, CHO cells transiently transfected with a plasmid encoding human Trx readily express an
immunoreactive 12-kDa protein in the cell (Fig. 2A,
lane 5). Third, Trx is also secreted into the medium (Fig.
2A, lane 6) in proportions comparable to those of
cells that secrete endogenous Trx (Fig. 1). Trx is secreted via a
nonclassic pathway from CHO cells because BFA did not affect this
secretion (Fig. 2A, lanes 7 and 8) in
contrast to its complete inhibition of prolactin secretion via the
ER-Golgi pathway (Fig. 2B, lanes 3 and
4). Assays for LDH showed that <5% cell lysis occurred
during the 6-h chase period (data not shown). Thus Trx is actively
exported through a nonclassic pathway in CHO cells. Overall, CHO cells
are a model system to study the export of Trx because these cells do
not contain cross-reactive 12-kDa proteins, synthesize and export
human Trx nonclassically in amounts comparable to cells that secrete
endogenous Trx, and are readily transfected in contrast to the tumor
cells in Fig. 1.
|
Kinetics of Trx secretion by transiently transfected CHO cells.
We next investigated the kinetics of Trx secretion. CHO cells
transfected with Trx were labeled with [35S]methionine
and chased at 37°C in medium lacking serum for 2, 4, 6, and 8 h.
After separation by SDS-PAGE, the protein bands were quantitated by
using a PhosphorImager, and the relative secretion for each time point
was plotted (Fig. 3). The secretion of
Trx is a slow but steady process with up to 50% being secreted into the medium after 8 h. The increase in secretion is not due to cell
lysis because an assay for LDH showed that fewer than 5% of cells
lysed even after the maximum chase time of 8 h (data not shown).
Because an adequate proportion of Trx is secreted into the medium after
6 h of chase, we chose to use this time point for subsequent
assays of Trx secretion.
|
Trx secretion is altered by temperature.
Facilitated protein secretion is generally a temperature-dependent
process. For example, secretion of proteins via the classic ER-Golgi
secretory pathway is affected by alterations in temperature (33). On the other hand, passive diffusion through a pore
is not affected by a change in temperature (21). We
investigated the temperature sensitivity of Trx secretion to gain
insight into whether it is a facilitated or passive process. CHO cells
transfected with Trx were starved, labeled at 37°C, and then
incubated in serum-free chase medium at 25, 37, and 42°C for 6 h
(Fig. 4). As expected, about 40% of Trx
synthesized in the cells is secreted after 6 h at 37°C. Lowering
the chase temperature to 25°C drastically inhibited Trx secretion. On
the other hand, the secretion of Trx increased by 15% when cells were
incubated at 42°C during the chase period. However, assays of LDH
indicated a 15% increase in cell lysis at this temperature that
accounts for much of the increase in Trx in the medium (data not
shown).
|
Trx secretion is affected by factors in serum.
Some nonclassic secretory pathways are sensitive to factors in serum.
For example, the secretion of HIV-tat and IL-1
is inversely proportional to the amount of serum in the medium (7, 29). However, the nonclassic secretion of other proteins, such as green fluorescent protein (GFP), is not affected by serum (39).
We investigated whether factors present in fetal bovine serum also alter the secretion of Trx. CHO cells transfected with the Trx plasmid
were starved, labeled with [35S]methionine, and chased in
medium containing 0, 5, 10, and 20% fetal bovine serum (Fig.
5). The proportion of secreted Trx
decreased as the concentration of serum increased. A similar inhibition of secretion by serum was observed with IM9 cells secreting endogenous Trx (data not shown). Because Trx is found in serum, it is possible that Trx in bovine serum could compete with radiolabeled human Trx for
immunoprecipitation. Therefore, we mixed lysates and media of
transfected CHO cells with 0, 5, 10, or 20% serum before
immunoprecipitation, and we found that there was no effect on the
amount of labeled human Trx recovered (data not shown). Thus factors in
serum decrease the secretion of Trx by CHO cells.
|
Secreted Trx is not associated with externalized membrane vesicles.
At least one nonclassically secreted protein, galectin-3, is secreted
via blebs in the plasma membrane that become externalized vesicles
(20). Such a mechanism could enable the posttranslational export of fully folded cytosolic proteins from the cell. We studied whether Trx, likewise, is secreted in externalized membrane vesicles via a similar pathway. CHO cells transfected with the Trx plasmid were
labeled, and the medium was collected after 4 or 6 h. By examining
the medium at two different times during the chase period, we would be
better able to detect Trx if it is in membrane vesicles. The medium was
clarified by low-speed centrifugation to remove debris and then
subjected to high-speed centrifugation sufficient to pellet any
vesicles (20). The supernatant and the pellet were
subjected to immunoprecipitation with anti-Trx antibodies. All of the
secreted Trx was in the supernatants; none of the secreted Trx was
present in the pellet (Fig. 6). These
data suggest that Trx is secreted freely into the medium and not in
membrane vesicles from CHO cells.
|
N-acetyl cysteine reduces Trx secretion by downregulating Trx
expression.
No specific inhibitor of Trx secretion is known. Recently, it was shown
that treatment with NAC resulted in the reduction of Trx secretion from
ATL-2 cells (24). NAC acts as an antioxidant, and it also
increases cellular glutathione levels. We investigated whether NAC
actually blocks the secretory pathway used by Trx or whether the
cellular level of Trx is simply decreased due to the increased
availability of other antioxidants. When NAC is added during the chase
period, no acute change in the secretion of Trx from CHO cells was
detected (Fig. 7A). We also
tested the effect of a longer treatment with NAC. CHO cells transiently
transfected with human Trx were incubated with NAC for 16 h before
assessing secretion. In these cells treated with NAC overnight, the
absolute amount of Trx secreted is diminished compared with untreated
cells (Fig. 7B). However, the level of Trx remaining in the
cells treated with NAC after 6 h also is reduced so that the
proportion of Trx secreted from cells treated with NAC is equivalent to
that from untreated cells (Fig. 7B). Thus the reduction of
Trx secretion by NAC is not due to a block in the Trx secretory pathway
but rather from reduced cytosolic levels of Trx throughout the chase period.
|
Mutations in the active or regulatory homodimerization sites of human Trx do not impair secretion. Cysteine residues play key roles in the activity of Trx. The active site of human Trx consists of two cysteine residues at positions 32 and 35 relative to the NH2 terminus. Changing either of these cysteine residues to serine renders the redox site inactive. In addition, human Trx contains cysteine at residues 62, 69, and 73. The formation of Trx homodimers that regulate the activity of the protein has been shown to depend on cysteine 73 (42).
We investigated whether the redox or regulatory status of Trx impacts its secretion. We mutated either cysteine 35 or 73 to serine to assess the effect of these disruptions on Trx secretion. Both the active site mutant (Trx C35S) and the dimerization mutant (Trx C73S) were secreted with similar efficiency to wild-type Trx (Fig. 8). Thus neither a functional redox site nor dimerization site is required for Trx secretion from CHO cells.
|
| |
DISCUSSION |
|---|
|
|
|---|
Several human cancer cells secrete endogenous Trx by a route other than the ER-Golgi pathway. Although secretion or surface expression of Trx from such tumor cell lines has been demonstrated previously, a nonclassic route of export has not been verified by using BFA for any cell type other than activated lymphocytes (28). Furthermore, this data establishes the proportion of Trx secreted in our assay as a standard for comparing the efficiency of secretion from heterologous CHO cells. Human Trx is secreted from CHO cells through a nonclassic pathway in amounts that compare favorably with tumor cells. The secretion of Trx is a slow but efficient process with up to 50% of the protein exported over 8 h. Secretion of Trx is reduced by low temperature and factors in serum. However, NAC does not affect secretion directly; rather, the antioxidant results in lower levels of Trx in the cytosol and medium. Using this heterologous system to study the secretion of Trx, we demonstrate that mutation of either the redox active site or the homodimerization site does not alter secretion of human Trx.
Trx is a cytosolic protein that is secreted selectively from several types of cells. Although the secretion of Trx from CHO cells is slow, it is specific and not simply due to diffusion or leakage out of the cell. First, low temperature reduces secretion of Trx. Second, we have expressed other cytosolic proteins by using transiently transfected CHO cells but did not observe any secretion into the medium (39). Therefore, the secretion of human Trx from these cells is not due to an artifact induced by liposome-mediated transfection. Third, assays of LDH show that cellular lysis is minimal and does not account for the significant proportion of Trx secreted. Thus human Trx is secreted actively via a nonclassic pathway from CHO cells.
It is interesting that the secretion of Trx from CHO cells is reduced with increasing serum concentration in the medium. Serum likewise inhibits the secretion of HIV tat protein (7). Recently, it has been shown that Trx is present in normal human serum (26). These observations raise the possibility that the nonclassic pathway by which Trx is secreted is inhibited by circulating Trx. Alternatively, other factors in serum block nonclassic secretion of Trx and other proteins such as HIV tat.
The redox status of the cytosol is maintained in part by the activity of Trx. Previously, it was demonstrated that the amount of Trx found in the media of cells treated with NAC is significantly decreased (24). These findings led to the suggestion that NAC blocks the secretion of Trx (24). Our investigations demonstrate that treatment with NAC does not have a direct effect on secretion. Instead, NAC decreases the level of Trx in the cytosol and thereby reduces the amount of Trx secreted. The proportion of Trx secreted, however, remains equivalent in the presence or absence of NAC. Furthermore, rendering the redox site of Trx inactive does not alter its secretion. Thus the redox status of the cell or Trx itself does not impact its secretion.
Proteins that are secreted generally contain a targeting signal to direct their export. In eukaryotic cells, signal sequences usually at the amino terminus of proteins mediate the targeting of proteins to the ER (5). Similarly, amino acid sequences direct secretion from bacteria from the sec-dependent or twin-arginine pathways. Therefore, it appears likely that a region of the Trx molecule functions as an export signal. We used the heterologous secretion of human Trx to study the effect of mutating the active site or a residue used in the formation of homodimers. Neither of these mutations significantly affected the secretion of Trx, suggesting that these biological activities are not involved in targeting. Little is known about targeting signals required for nonclassic protein secretion. The amino-terminal 96 amino acids of galectin-3 are necessary for its secretion (22), but the targeting signals for other nonclassically secreted proteins remain unknown. Our heterologous system of nonclassic secretion could facilitate studies of the export signal in human Trx.
Unlike other nonclassic pathways, the export route of Trx has not been
identified. Several other proteins, such as IL-1
, acidic and basic
fibroblast growth factor (FGF), galectins 1 and 3, and HIV-tat also
appear to be secreted via nonclassic secretory pathways (6, 7,
12, 19, 20, 29). The secretion of these proteins is not
attributable to cell lysis. On the basis of their response to
inhibitors of secretion including serum, it appears that these proteins
do not use one common pathway for nonclassic secretion. An ATP-binding
cassette protein has been implicated in the secretion of IL-1
(16), a sodium-potassium ATPase has been linked to the
secretion of bFGF (11), and membrane shedding results in
the export of galectin 3 (20). However, the export pathway
of Trx is unknown. The selective secretion of human Trx by CHO cells
indicates that a nonclassic secretory pathway is present in these cells
that is capable of recognizing human Trx as a substrate for export. The
endogenous substrates secreted by this pathway remain to be identified.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Sharmistha Ghosh for reading the manuscript and helpful discussions, Yin Chen for constructing the plasmids encoding Trx C35S and Trx C73S, Emmanuelle Wollman for providing a plasmid encoding human Trx, and David Silberstein for the generous gift of antibodies against human Trx.
| |
FOOTNOTES |
|---|
This work was supported by grant DAMD17-01-1-0150 from the United States Army.
Address for reprint requests and other correspondence: S. Chuck, Molecular Medicine Unit, Beth Israel Deaconess Medical Center, RW663, 330 Brookline Ave., Boston, MA 02215 (E-mail: schuck{at}bidmc.harvard.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
First published January 15, 2003;10.1152/ajpcell.00521.2002
Received 11 November 2002; accepted in final form 15 January 2003.
| |
REFERENCES |
|---|
|
|
|---|
1.
Arner, ES,
and
Holmgren A.
Physiological functions of thioredoxin and thioredoxin reductase.
Eur J Biochem
267:
6102-6109,
2000[Web of Science][Medline].
2.
Baker, A,
Payne CM,
Briehl MM,
and
Powis G.
Thioredoxin, a gene found overexpressed in human cancer, inhibits apoptosis in vitro and in vivo.
Cancer Res
57:
5162-5167,
1997
3.
Balcewicz-Sablinska, MK,
Wollman EE,
Gorti R,
and
Silberstein DS.
Human eosinophil cytotoxicity-enhancing factor. II. Multiple forms synthesized by U937 cells and their relationship to thioredoxin/adult T cell leukemia-derived factor.
J Immunol
147:
2170-2174,
1991[Abstract].
4.
Berggren, M,
Gallegos A,
Gasdaska JR,
Gasdaska PY,
Warneke J,
and
Powis G.
Thioredoxin and thioredoxin reductase gene expression in human tumors and cell lines, and the effects of serum stimulation and hypoxia.
Anticancer Res
16:
3459-3466,
1996[Web of Science][Medline].
5.
Blobel, G.
Intracellular protein topogenesis.
Proc Natl Acad Sci USA
77:
1496-1500,
1980
6.
Carreira, CM,
LaVallee TM,
Tarantini F,
Jackson A,
Lathrop JT,
Hampton B,
Burgess WH,
and
Maciag T.
S100A13 is involved in the regulation of fibroblast growth factor-1 and p40 synaptotagmin-1 release in vitro.
J Biol Chem
273:
22224-22231,
1998
7.
Chang, HC,
Samaniego F,
Nair BC,
Buonaguro L,
and
Ensoli B.
HIV-1 Tat protein exits from cells via a leaderless secretory pathway and binds to extracellular matrix-associated heparan sulfate proteoglycans through its basic region.
AIDS
11:
1421-1431,
1997[Web of Science][Medline].
8.
Di Trapani, G,
Orosco C,
Perkins A,
and
Clarke F.
Isolation from human placental extracts of a preparation possessing `early pregnancy factor' activity and identification of the polypeptide components.
Hum Reprod
6:
450-457,
1991
9.
Di Trapani, G,
Perkins A,
and
Clarke F.
Production and secretion of thioredoxin from transformed human trophoblast cells.
Mol Hum Reprod
4:
369-375,
1998
10.
Evan, GI,
Lewis GK,
and
Bishop JM.
Isolation of monoclonal antibodies specific for products of avian oncogene myb.
Mol Cell Biol
4:
2843-2850,
1984
11.
Florkiewicz, RZ,
Anchin J,
and
Baird A.
The inhibition of fibroblast growth factor-2 export by cardenolides implies a novel function for the catalytic subunit of Na+,K+-ATPase.
J Biol Chem
273:
544-551,
1998
12.
Florkiewicz, RZ,
Majack RA,
Buechler RD,
and
Florkiewicz E.
Quantitative export of FGF-2 occurs through an alternative, energy-dependent, non-ER/Golgi pathway.
J Cell Physiol
162:
388-399,
1995[Web of Science][Medline].
13.
Forman-Kay, JD,
Clore GM,
Wingfield PT,
and
Gronenborn AM.
High-resolution three-dimensional structure of reduced recombinant human thioredoxin in solution.
Biochemistry
30:
2685-2698,
1991[Medline].
14.
Gallegos, A,
Gasdaska JR,
Taylor CW,
Painemurrieta GD,
Goodman D,
Gasdaska PY,
Berggren M,
Briehl MM,
and
Powis G.
Transfection with human thioredoxin increases cell proliferation and a dominant-negative mutant thioredoxin reverses the transformed phenotype of human breast cancer cells.
Cancer Res
56:
5765-5770,
1996
15.
Gasdaska, JR,
Berggren M,
and
Powis G.
Cell growth stimulation by the redox protein thioredoxin occurs by a novel helper mechanism.
Cell Growth Differ
6:
1643-1650,
1995[Abstract].
16.
Hamon, Y,
Luciani MF,
Becq F,
Verrier B,
Rubartelli A,
and
Chimini G.
Interleukin-1
secretion is impaired by inhibitors of the ATP binding cassette transporter, ABC1.
Blood
90:
2911-2915,
1997
17.
Hirota, K,
Murata M,
Sachi Y,
Nakamura H,
Takeuchi J,
Mori K,
and
Yodoi J.
Distinct roles of thioredoxin in the cytoplasm and in the nucleus. A two-step mechanism of redox regulation of transcription factor NF-
B.
J Biol Chem
274:
27891-27897,
1999
18.
Iwata, S,
Hori T,
Sato N,
Hirota K,
Sasada T,
Mitsui A,
Hirakawa T,
and
Yodoi J.
Adult T cell leukemia (ATL)-derived factor/human thioredoxin prevents apoptosis of lymphoid cells induced by L-cystine and glutathione depletion: possible involvement of thiol-mediated redox regulation in apoptosis caused by pro-oxidant state.
J Immunol
158:
3108-3117,
1997[Abstract].
19.
LaVallee, TM,
Tarantini F,
Gamble S,
Carreira CM,
Jackson A,
and
Maciag T.
Synaptotagmin-1 is required for fibroblast growth factor-1 release.
J Biol Chem
273:
22217-22223,
1998
20.
Mehul, B,
and
Hughes RC.
Plasma membrane targetting, vesicular budding and release of galectin 3 from the cytoplasm of mammalian cells during secretion.
J Cell Sci
110:
1169-1178,
1997[Abstract].
21.
Melchior, F,
and
Gerace L.
Mechanisms of nuclear protein import.
Curr Opin Cell Biol
7:
310-318,
1995[Web of Science][Medline].
22.
Menon, RP,
and
Hughes RC.
Determinants in the N-terminal domains of galectin-3 for secretion by a novel pathway circumventing the endoplasmic reticulum-Golgi complex.
Eur J Biochem
264:
569-576,
1999[Web of Science][Medline].
23.
Mitsui, A,
Hirakawa T,
and
Yodoi J.
Reactive oxygen-reducing and protein-refolding activities of adult T cell leukemia-derived factor/human thioredoxin.
Biochem Biophys Res Commun
186:
1220-1226,
1992[Web of Science][Medline].
24.
Nakamura, H,
De Rosa SC,
Yodoi J,
Holmgren A,
Ghezzi P,
and
Herzenberg LA.
Chronic elevation of plasma thioredoxin: inhibition of chemotaxis and curtailment of life expectancy in AIDS.
Proc Natl Acad Sci USA
98:
2688-2693,
2001
25.
Nakamura, H,
Herzenberg LA,
Bai J,
Araya S,
Kondo N,
Nishinaka Y,
and
Yodoi J.
Circulating thioredoxin suppresses lipopolysaccharide-induced neutrophil chemotaxis.
Proc Natl Acad Sci USA
98:
15143-15148,
2001
26.
Pekkari, K,
Gurunath R,
Arner ES,
and
Holmgren A.
Truncated thioredoxin is a mitogenic cytokine for resting human peripheral blood mononuclear cells and is present in human plasma.
J Biol Chem
275:
37474-37480,
2000
27.
Powis, G,
and
Montfort WR.
Properties and biological activities of thioredoxins.
Annu Rev Pharmacol Toxicol
41:
261-295,
2001[Web of Science][Medline].
28.
Rubartelli, A,
Bajetto A,
Allavena G,
Wollman E,
and
Sitia R.
Secretion of thioredoxin by normal and neoplastic cells through a leaderless secretory pathway.
J Biol Chem
267:
24161-24164,
1992
29.
Rubartelli, A,
Cozzolino F,
Talio M,
and
Sitia R.
A novel secretory pathway for interleukin-1
, a protein lacking a signal sequence.
EMBO J
9:
1503-1510,
1990[Web of Science][Medline].
30.
Rubartelli, A,
and
Sitia R.
Interleukin 1
and thioredoxin are secreted through a novel pathway of secretion.
Biochem Soc Trans
19:
255-259,
1991[Web of Science][Medline].
31.
Sahaf, B,
Soderberg A,
Spyrou G,
Barral AM,
Pekkari K,
Holmgren A,
and
Rosen A.
Thioredoxin expression and localization in human cell lines: detection of full-length and truncated species.
Exp Cell Res
236:
181-192,
1997[Web of Science][Medline].
32.
Saitoh, M,
Nishitoh H,
Fujii M,
Takeda K,
Tobiume K,
Sawada Y,
Kawabata M,
Miyazono K,
and
Ichijo H.
Mammalian thioredoxin is a direct inhibitor of apoptosis signal-regulating kinase (ASK) 1.
EMBO J
17:
2596-2606,
1998[Web of Science][Medline].
33.
Saraste, J,
Palade GE,
and
Farquhar MG.
Temperature-sensitive steps in the transport of secretory proteins through the Golgi complex in exocrine pancreatic cells.
Proc Natl Acad Sci USA
83:
6425-6429,
1986
34.
Silberstein, DS,
Dessein AJ,
Elsas PP,
Fontaine B,
and
David JR.
Characterization of a factor from the U937 cell line that enhances the toxicity of human eosinophils to Schistosoma mansoni larvae.
J Immunol
138:
3042-3050,
1987[Abstract].
35.
Silberstein, DS,
McDonough S,
Minkoff MS,
and
Balcewicz-Sablinska MK.
Human eosinophil cytotoxicity-enhancing factor eosinophil-stimulating and dithiol reductase activities of biosynthetic (recombinant) species with COOH-terminal deletions.
J Biol Chem
268:
9138-9142,
1993
36.
Soderberg, A,
Sahaf B,
and
Rosen A.
Thioredoxin reductase, a redox-active selenoprotein, is secreted by normal and neoplastic cells: presence in human plasma.
Cancer Res
60:
2281-2289,
2000
37.
Tagaya, Y,
Maeda Y,
Mitsui A,
Kondo N,
Matsui H,
Hamuro J,
Brown N,
Arai K,
Yokota T,
Wakasugi H,
and
Yodoi J.
ATL-derived factor (ADF), an IL-2 receptor/Tac inducer homologous to thioredoxin; possible involvement of dithiol-reduction in the IL-2 receptor induction.
EMBO J
8:
757-764,
1989[Web of Science][Medline].
38.
Tagaya, Y,
Okada M,
Sugie K,
Kasahara T,
Kondo N,
Hamuro J,
Matsushima K,
Dinarello CA,
and
Yodoi J.
IL-2 receptor(p55)/Tac-inducing factor. Purification and characterization of adult T cell leukemia-derived factor.
J Immunol
140:
2614-2620,
1988[Abstract].
39.
Tanudji, M,
Hevi S,
and
Chuck SL.
Improperly folded green fluorescent protein is secreted via a non-classical pathway.
J Cell Sci
115:
3849-3857,
2002
40.
Wakasugi, H,
Wakasugi N,
Tursz T,
Tagaya Y,
and
Yodoi J.
Production of an IL-1-like factor by 3B6 EBV-infected B cells [letter].
J Immunol
142:
2569-2570,
1989[Medline].
41.
Wakasugi, N,
Tagaya Y,
Wakasugi H,
Mitsui A,
Maeda M,
Yodoi J,
and
Tursz T.
Adult T-cell leukemia-derived factor/thioredoxin, produced by both human T-lymphotropic virus type I- and Epstein-Barr virus-transformed lymphocytes, acts as an autocrine growth factor and synergizes with interleukin 1 and interleukin 2.
Proc Natl Acad Sci USA
87:
8282-8286,
1990
42.
Weichsel, A,
Gasdaska JR,
Powis G,
and
Montfort WR.
Crystal structures of reduced, oxidized, and mutated human thioredoxins: evidence for a regulatory homodimer.
Structure
4:
735-751,
1996[Medline].
43.
Williams, CH,
Arscott LD,
Muller S,
Lennon BW,
Ludwig ML,
Wang PF,
Veine DM,
Becker K,
and
Schirmer RH.
Thioredoxin reductase two modes of catalysis have evolved.
Eur J Biochem
267:
6110-6117,
2000[Web of Science][Medline].
44.
Wollman, EE,
d'Auriol L,
Rimsky L,
Shaw A,
Jacquot JP,
Wingfield P,
Graber P,
Dessarps F,
Robin P,
Galibert F,
Bertoglio J,
and
Fradelizi D.
Cloning and expression of a cDNA for human thioredoxin.
J Biol Chem
263:
15506-15512,
1988
This article has been cited by other articles:
![]() |
P. C. Schulze, J. Yoshioka, T. Takahashi, Z. He, G. L. King, and R. T. Lee Hyperglycemia Promotes Oxidative Stress through Inhibition of Thioredoxin Function by Thioredoxin-interacting Protein J. Biol. Chem., July 16, 2004; 279(29): 30369 - 30374. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. H. Watson, X. Yang, Y. E. Choi, D. P. Jones, and J. P. Kehrer Thioredoxin and Its Role in Toxicology Toxicol. Sci., March 1, 2004; 78(1): 3 - 14. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |