Am J Physiol Cell Physiol AJP: Gastrointestinal and Liver Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 284: C1176-C1184, 2003. First published January 8, 2003; doi:10.1152/ajpcell.00339.2002
0363-6143/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/5/C1176    most recent
00339.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (12)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gillis, T. E.
Right arrow Articles by Tibbits, G. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gillis, T. E.
Right arrow Articles by Tibbits, G. F.
Vol. 284, Issue 5, C1176-C1184, May 2003

Sequence mutations in teleost cardiac troponin C that are permissive of high Ca2+ affinity of site II

Todd E. Gillis1,2, Chris D. Moyes3, and Glen F. Tibbits2,4

1 Department of Biological Sciences and 2 Cardiac Membrane Research Lab, Simon Fraser University, Burnaby, British Columbia V5A 1S6; 3 Department of Biology, Queens University, Kingston, Ontario K7L 3N6; and 4 Cardiovascular Sciences, British Columbia Research Institute for Children's and Women's Health, Vancouver, British Columbia, Canada V5Z 4H4


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Cardiac myofibrils isolated from trout heart have been demonstrated to have a higher sensitivity for Ca2+ than mammalian cardiac myofibrils. Using cardiac troponin C (cTnC) cloned from trout and mammalian hearts, we have previously demonstrated that this comparatively high Ca2+ sensitivity is due, in part, to trout cTnC (ScTnC) having twice the Ca2+ affinity of mammalian cTnC (McTnC) over a broad range of temperatures. The amino acid sequence of ScTnC is 92% identical to McTnC. To determine the residues responsible for the high Ca2+ affinity, the function of a number of ScTnC and McTnC mutants was characterized by monitoring an intrinsic fluorescent reporter that monitors Ca2+ binding to site II (F27W). The removal of the COOH terminus (amino acids 90-161) from ScTnC and McTnC maintained the difference in Ca2+ affinity between the truncated cTnC isoforms (ScNTnC and McNTnC). The replacement of Gln29 and Asp30 in ScNTnC with the corresponding residues from McNTnC, Leu and Gly, respectively, reduced Ca2+ affinity to that of McNTnC. These results demonstrate that Gln29 and Asp30 in ScTnC are required for the high Ca2+ affinity of site II.

myocyte contractility; Antarctic icefish; salmonid


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

MUSCLE CONTRACTION IS INITIATED when membrane depolarization leads to an increase in cytosolic Ca2+. The binding of Ca2+ to the low-affinity sites of troponin C (TnC) initiates a conformational change in the protein that is transmitted through the other components of the thin filament, allowing cross-bridge cycling between actin and myosin. Many of the characteristic responses of the contractile apparatus can be attributed to the Ca2+ binding properties of TnC. The differences between cardiac and skeletal myofibrils are due, in part, to the structural divergence in the TnC isoforms. While both fast skeletal muscle TnC (sTnC) and cardiac TnC (cTnC) are highly conserved within mammals and between mammals and the chicken, TnC from lower vertebrates exhibits less identity. Thus establishing the links between TnC structure and myofibrillar function should provide insight into both physiological responsiveness and evolutionary origins of contractile regulation.

TnC consists of two globular domains connected by an alpha -helical linker. Both the NH2- and COOH-terminal domains contain two EF-hand Ca2+-binding sites. The COOH-terminal domain possesses two high-affinity sites (III and IV) that are always bound with either Ca2+ or Mg2+. These sites are considered to be structural sites, helping to anchor TnC into the troponin complex. The two isoforms of TnC that exist in vertebrate striated muscle differ in the number of active Ca2+-binding sites in the NH2-terminal domain. In the isoform of TnC found in fast skeletal muscle (sTnC), both sites I and II are functional, low-affinity Ca2+-binding sites. In cTnC, which is expressed in both cardiac and slow skeletal muscle, site I is rendered nonfunctional by amino acid substitutions that disrupt its ability to form the pentagonal bipyramid necessary to coordinate Ca2+. In both isoforms, Ca2+ binding to the NH2-terminal site(s) is responsible for triggering contraction (30, 31). NMR structural studies have demonstrated that the Ca2+-induced conformational change is greater in sTnC than in cTnC (35).

Many studies have attempted to assess the impact of the structural differences in TnC isoforms on the functional properties of striated muscle. Ca2+ affinity is very sensitive to pH in cardiac muscle but much less so in skeletal muscle. Studies using transgenic mice (24) and TnC replacement in skinned fibers (7, 25) have demonstrated that TnC isoforms influence the pH sensitivity of striated muscle. Cardiac muscle demonstrates important differences in the length-tension relationship, the basis of the Starling relationship, that have been attributed, at least in part, to cTnC (2, 13), though there is also compelling evidence to the contrary (22, 26). Differences in temperature dependence of cardiac and skeletal muscle contractility can also be attributed, in part, to the isoform of TnC that they contain. The Ca2+ affinity of skeletal myofilaments is relatively insensitive to temperature (11, 36), whereas cardiac muscle becomes desensitized to Ca2+ at low temperatures (5, 6, 14, 16, 37). Replacement of native cTnC in skinned cardiac muscle with sTnC attenuates this desensitizing effect of temperature (15). This loss of Ca2+ sensitivity at low temperature has been attributed to a reduction in Ca2+ affinity of cTnC site II (10).

The impact of temperature on myocardial Ca2+ sensitivity is particularly important in cold-blooded animals, such as fish, that experience low and fluctuating environmental temperatures. Functional comparison of cardiac myofibrils from mammals and rainbow trout suggests that trout cardiac muscle has a higher inherent Ca2+ affinity (6). It is thought that this higher affinity facilitates cardiac function at the low temperatures (0-20°C) normally experienced by this fish (6). We have demonstrated that the high Ca2+ sensitivity of trout myofibrils is due, in part, to the differences in the affinity of mammalian and trout cTnC for Ca2+ (10). Although the amino acid sequence of trout cTnC (ScTnC) is 91% identical to mammalian cTnC (McTnC) (27), and site II is completely conserved, ScTnC has 2.3-fold higher Ca2+ affinity than McTnC at 21°C (10). This difference in affinity was maintained when McTnC and ScTnC Ca2+ binding were compared at 7 and 37°C and over a range of pH values. The comparatively higher Ca2+ affinity of ScTnC would allow for force generation to be initiated at a lower intracellular [Ca2+] in the trout myocyte.

The purpose of the present study was to identify the residues responsible for interspecies differences in Ca2+ affinity of site II in cTnC. Although all known mammalian cTnC amino acid sequences exhibit 100% identity, there are differences between fish and mammals and within fish species. We created mutants to compare the impact of differences between salmonid (ScTnC) and McTnC. We also exploited naturally occurring differences between trout and Antarctic icefish (40). Ca2+ binding to site II was measured by titrating the F27W cTnC mutants with Ca2+ while measuring fluorescence. These results demonstrate that there is no difference in the Ca2+ affinity of ScTnC and icefish cTnC (IFcTnC), despite nine amino acid differences. The differences in Ca2+ affinity between mammals and fish can be attributed to amino acid substitutions in the NH2-terminal domain, because the removal of the COOH terminus (amino acids 90-161) through the creation of cNTnC mutants maintained the difference in Ca2+ affinity. Gln29 and Asp30 were also demonstrated as being required for the higher Ca2+ affinity of ScNTnC.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Construction of the IFcTnC F27W mutant. IFcTnC cDNA cloned into PCR2.1-TOPO was first subcloned into the pGex expression vector. To accomplish this, we engineered BamHI and EcoRI restriction sites onto the 5'- and 3'-ends, respectively, of the IFcTnC cDNA, using Accurase DNA polymerase (DNmp, Farnborough Hants, UK). The sequences of the 5' sense oligonucleotide primers used were as follows: BamHI, TCAGGATCCATCGAAGGTCGTATGAACGACATCTACAAAGCA; EcoRI, GAGTTCATGAAAGGAGTAGAATAAGAATTCGCA. After PCR, the product was purified by gel electrophoresis and use of the QIAquick gel extraction kit (Qiagen, Mississauga, ON, Canada) and then digested with BamHI and EcoRI (Pharmacia Biotech, Baie d'Urfé, QC, Canada). pGex plasmid was similarly digested and then ligated with the cassette using T4 DNA ligase (GIBCO BRL, Gaithersburg, MD), and the sequence of the insert was confirmed by sequencing at the Nucleic Acid/Protein Service Unit, University of British Columbia (UBC; Vancouver, BC, Canada) using AmpliTaq dye terminator cycle sequencing.

To substitute Trp for Phe at residue 27, we used the parental plasmid (pGex) containing the wild-type IFcTnC gene insert as a template for the extension of sense and antisense oligonucleotide primers containing a tryptophan point mutation as described in Gillis et al. (10). The sequence of the 5' sense oligonucleotide primer was GCCGCCTTTGACATCTGGGTACCAGATGCCGAG. A cassette containing the mutation was made from the mutated plasmid by using the restriction enzymes BamHI and StyI (New England Biolabs, Mississauga, ON, Canada) and was ligated into the similarly digested parental plasmid containing the wild-type IFcTnC gene. The nucleotide sequence of the newly mutated insert was confirmed by sequencing. From this point on, IFcTnC will refer to F27W IFcTnC.

Construction of McNTnC and ScNTnC F27W mutants. To construct McNTnC and ScNTnC F27W mutants, we introduced a stop codon into McTnC and ScTnC cDNA after the Ser codon at residue 89 using the QuickChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). Both of these gene constructs had been previously mutated to contain the F27W mutation and then cloned into the pGex expression plasmid from Pharmacia Biotech as described in Gillis et al. (10). These existing parental cDNA inserts were used as templates for the extension of sense and antisense oligonucleotide primers containing the stop codon TAA. The sequences of the 5' sense oligonucleotide primers were as follows: ScTnC, GGACGACAGCTAAGGGAAAACAGAGG; McTnC, GGTTCGGTGTATGAAAGATGACAGCTAAGGAAAAAC. Cassettes containing the mutation were then made using the restriction enzymes StyI and BsmI (New England Biolabs). Full-length F27W ScTnC and McTnC cDNA constructs subcloned into the pGex vector were similarly digested, and the cassette and plasmid were then purified as described above and ligated. The nucleotide sequences of the two newly mutated inserts were confirmed by sequencing. From this point on, McNTnC will refer to F27W McNTnC and ScNTnC will refer to F27W ScNTnC.

Construction of Q29L/D30G ScNTnC, Q29L ScNTnC, D30G ScNTnC, L29Q/G30D McNTnC, and D2N/L29Q/G30D McNTnC F27W mutants. The cDNA constructs in the pGex plasmid created to synthesize ScNTnC and McNTnC were used as templates for the extension of sense and antisense oligonucleotide primers containing codons to manipulate the residues at positions 29 and 30 using the QuickChange site-directed mutagenesis kit. The sequences of the 5' sense oligonucleotide primers used were as follows: Q29L/D30G ScNTnC, GCCTTTGACATCTGGATCCTGGGGGCGGAGGACGGC; Q29L ScNTnC, GCCTTTGACATCTGGATCCTGGATGCGGAGGACGGC; D30G ScNTnC, GCCTTTGACATCTGGATCCAGGGGGCGGAGGACGGC; L29Q/G30D McNTnC, GCCTTCGACATCTGGGTGCAGGATGCAGAGGATGGCTGC. Cassettes containing the mutations were made using SmaI (GIBCO BRL) and BsmI and were then ligated into the parental plasmids that had been similarly digested. The nucleotide sequences of the inserts were confirmed by sequencing. Once the sequence of L29Q/G30D McNTnC was confirmed, it was used as a template for the extension of sense and antisense oligonucleotide primers to make the D2N/L29Q/G30D McNTnC mutant. The sequence of the 5' sense oligonucleotide primer used to replace the Asp at residue 2 with an Asn was CCATCGAAGGTCGTATGAATGACATCTATAAGGCGGC. A cassette containing the mutation was made using BsmI and BamHI and was then ligated into the parental plasmid that had been similarly digested. The nucleotide sequence of the insert was confirmed by sequencing.

Expression and purification of cTnC mutants. The pGex plasmids containing the ScNTnC, McNTnC, IFcTnC, Q29L/D30G ScNTnC, Q29L ScNTnC, D30G ScNTnC, L29Q/G30D McNTnC, and D2N/L29Q/G30D McNTnC inserts were transformed into the Escherichia coli strain BL21 for protein expression. The cTnC mutants were expressed as glutathione S-transferase fusion proteins that were then digested and purified as described previously (10). The identities of all cTnC mutants were confirmed by NH2-terminal microsequencing and amino acid analysis completed at the Nucleic Acid/Protein Service Unit, UBC. The purities of the isolated proteins as well as their atomic masses were confirmed by matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry completed at the UBC Mass Spectrometry Center. Collectively, these tests confirmed the identity of all cTnC mutants.

Solutions used in fluorescence studies. The solution used to measure fluorescence at 21°C, pH 7.0, was identical to that described in Gillis et al. (10) (in mM: 1.0 EGTA, 0.03 CaCl2, 112.0 KCl, and 50 MOPS). A miniature Ca2+ electrode, made according to Baudet et al. (3), was used to confirm the purity and apparent Ca2+ affinity constant (K'Ca) of the EGTA used in the solution under the experimental conditions. This electrode was also used to test the initial pCa of the solution and the change in pCa during Ca2+ titration. This electrode was calibrated by using Ca2+ standards (Orion Research, Boston, MA) and was sensitive to a pCa of 8.0. The EGTA had a calculated purity of 95.6% and a K'Ca of 2.99 × 106 M-1. It should be noted that Mg2+ was not included in the reaction buffers despite its physiological presence. The solution composition was carefully considered for simplicity of interpretation of the in vitro experiments as well as accuracy of pCa in the titrations, which were determined as described above.

Fluorescence studies. The fluorescence studies were carried out as previously described (10) using a Photon Technology International (PTI) model C-30 spectrofluorometer (London, ON, Canada) attached to a NesLab (Portsmouth, NJ) water bath to maintain the cuvette at 21.0 ± 0.1°C. Fluorescence was measured during Ca2+ titration of the cTnC mutants by using an excitation wavelength of 276 nm and an emission wavelength of 330 nm. The slit widths for both the excitation and fluorescence light pathways were adjusted to setting 4 on the PTI spectrofluorometer. The relative fluorescence was calculated as the ratio of the fluorescence of the protein and an internal rhodamine standard. The relative fluorescence was calculated as the ratio of the fluorescence of the protein and an internal rhodamine standard. Before the beginning of fluorescence measurements, the current gain setting of each photomultiplier tube (PMT) of the spectrofluorometer was adjusted so that the relative fluorescence of the Ca2+-saturated cTnC mutants was equal to unity for each mutant.

Data manipulation and statistical analysis. The Ca2+-dependent component of the fluorescence measurements from each titration was determined by subtracting the fluorescence at basal [Ca2+] from all measurements and then expressing the resultant values as percentages of the maximum fluorescence. Each data set was fitted by using the Hill equation with Origin 6.0. (Microcal Software, Northhampton, MA) as previously described (10). The chi 2, which was used as a goodness-of-fit index of the Hill equation to our data, ranged from 0.0017 ± 0.0006 (D30G ScNTnC) to 0.0003 ± 0.00008 (IFcTnC). The effect of the mutations on the K1/2 values ([Ca2+] at half-maximal fluorescence) determined by the Hill equation curve fitting were analyzed statistically using a one-way repeated measures ANOVA followed by Bonferroni post hoc tests using the statistical software package SigmaStat. The values reported for K1/2 are expressed as means ± SE in pCa units. Two means were considered to be significantly different when the P value was <0.05.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Ca2+ affinity of IFcTnC at 21°C, pH 7.0. Because of its location in the cTnC molecule, the fluorescent reporter monitors Ca2+ binding to site II. The K1/2 values were used as a measure of the Ca2+ binding characteristics of site II. Visual comparison of the titration curves of IFcTnC and full-length ScTnC reveals that these curves are superimposable and are shifted to the left of McTnC (Fig. 1A). The K1/2 of IFcTnC is not significantly different from that previously reported for full-length ScTnC (10) and is 2.4 times less than that of McTnC under the same conditions (Table 1). These results indicate that site II of IFcTnC has Ca2+ binding abilities similar to those of ScTnC.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 1.   Comparison of the Ca2+ titration curves of salmonid cardiac troponin C (ScTnC), mammalian cardiac troponin C (McTnC), icefish cardiac troponin C (IFcTnC), ScTnC NH2-terminal domain (ScNTnC), and McTnC NH2-terminal domain (McNTnC) at 21°C, pH 7.0. Data are normalized with respect to the maximal fluorescence of each Ca2+ titration and presented as means ± SE. The curves generated by fitting the data with the Hill equation have been added for comparison with the data points. A: titration of fluorescence of ScTnC (n = 9), McTnC (n = 10), and IFcTnC (n = 8). B: titration of fluorescence of ScNTnC (n = 6), 1-89 McNTnC (n = 6). In A, there is no difference between the K1/2 values (pCa values at half-maximal fluorescence) of the curves for ScTnC and IFcTnC, whereas the K1/2 of the curve for McTnC is significantly different from those of both ScTnC and IFcTnC. Data for ScTnC and McTnC are from Gillis et al. (9). In B, the K1/2 of the curve for ScNTnC is significantly different from that for McNTnC.


                              
View this table:
[in this window]
[in a new window]
 
Table 1.   K1/2 of Ca2+ binding to McNTnC, ScNTnC, Q29L/D30G ScNTnC, Q29L ScNTnC, D30G ScNTnC, L29Q/G30D McNTnC, D2N/L29Q/G30D McNTnC, IFcTnC, McTnC, and ScTnC at 21.0°C, pH 7.0 

Comparison of the Ca2+ affinities of ScNTnC and McNTnC at 21°C, pH 7.0. Comparison of the Ca2+ titration curves of ScNTnC and McNTnC reveals that the curve for ScNTnC is shifted to the left of McNTnC, indicating that less Ca2+ is required to saturate site II of ScNTnC (Fig. 1B). The K1/2 of ScNTnC is ~0.30 pCa units greater than that of McNTnC, demonstrating that it has a higher Ca2+ affinity (Table 1). The removal of the COOH-terminal domain caused the K1/2 values of both ScNTnC and McNTnC to be ~0.44 pCa units higher at 21°C, pH 7.0, than the respective full-length isoform (Table 1).

Ca2+ affinities of Q29L/D30G ScNTnC, Q29L ScNTnC, D30G ScNTnC, L29Q/G30D McNTnC, and D2N/L29Q/G30D McNTnC at 21°C, pH 7.0. The replacement of Gln29 and Asp30 in ScNTnC with Leu and Gly, respectively, caused site II of Q29L/D30G ScNTnC to have Ca2+ binding characteristics similar to those of McNTnC. The titration curves of Q29L/D30G ScNTnC and McNTnC are superimposable (Fig. 2A), and there were no differences in the K1/2 values of the two proteins (Table 1). The Hill coefficient is typically used to describe the cooperativity of Ca2+ binding to a single molecule with multiple binding sites (sTnC) or of Ca2+-activated tension in a functioning myofibril. However, this study determined that in the in vitro Ca2+ binding of cTnC, which has a single activation site, cooperativity is highly unlikely and is reflected in the fact the Hill coefficients were approximately unity for all cTnCs. In these experiments, the Hill coefficient is used only as a parameter of curve fitting, and a physiological interpretation of these relatively small differences has been avoided. The Hill coefficients for the Ca2+ binding curves of McNTnC and Q29L/D30G ScNTnC do not differ, reflecting the similarities in the shape of the Ca2+ binding curves (Table 2).


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 2.   Comparison of the Ca2+ titration curves of ScNTnC, McNTnC, Q29L/D30G ScNTnC, D30G ScNTnC, and L29Q/G30D McNTnC at 21°C, pH 7.0. Data are normalized with respect to the maximal fluorescence of each Ca2+ titration and presented as means ± SE. The curves generated by fitting the data with the Hill equation have been added for comparison with the data points. A: titration of fluorescence of ScNTnC (n = 6), 1-89 McNTnC (n = 6), and Q29L/D30G ScNTnC (n = 7). B: titration of fluorescence of ScNTnC, 1-89 McNTnC, and D30G ScNTnC (n = 8). C: titration of fluorescence of ScNTnC, 1-89 McNTnC, and L29Q/G30D McNTnC (n = 7). D: titration of fluorescence of ScNTnC, 1-89 McNTnC, and D2N/L29Q/G30D McNTnC (n = 8). In A, the K1/2 of the curve for ScNTnC is significantly different from those for Q29D/L30G ScNTnC and McNTnC, and there is no difference between the K1/2 values of Q29L/D30G ScNTnC and McNTnC. In B, the K1/2 of the curve for D30G ScNTnC is significantly different from those of ScNTnC and McNTnC. In C, the K1/2 of the curve for L29Q/G30D McNTnC is significantly different from those for ScNTnC and McNTnC. In D, the K1/2 of the curve for D2N/L29Q/G30D McNTnC is significantly different from those for ScNTnC and McNTnC.


                              
View this table:
[in this window]
[in a new window]
 
Table 2.   Hill coefficients of Ca2+ binding to McNTnC, ScNTnC, Q29L/D30G ScNTnC, Q29L ScNTnC, D30G ScNTnC, L29Q/G30D McNTnC, D2N/L29Q/G30D McNTnC, IFcTnC, McTnC, and ScTnC at 21.0°C, pH 7.0 

Replacement of Gln with Leu at residue 29 in ScNTnC (Q29L ScNTnC) decreased K1/2 by 0.42 pCa units to 5.64 ± 0.31, a value significantly lower than the K1/2 values of both ScNTnC and McNTnC (Table 1). The mutant D30G ScNTnC exhibited a decrease in the K1/2 of 0.12 pCa units compared with ScNTnC. The K1/2 of D30G ScNTnC, however, was significantly higher than that of McNTnC (Table 1). Comparison of the titration curve of D30G ScNTnC with those of ScNTnC and McNTnC reveals that at low [Ca2+] (pCa 8 to 7.5) this curve is shifted to the left of ScNTnC, whereas at higher concentrations the curve shifts to the right of ScNTnC to become more like McNTnC (Fig. 2B). It should be noted that site II of D30G ScNTnC never fully saturated with Ca2+, because fluorescence continued to gradually increase at [Ca2+] greater than pCa 3.5. The fluorescence at pCa 3.5, however, was arbitrarily taken as maximum for fitting the data with the Hill equation. The difference in the shape of the Ca2+ binding curves of ScNTnC and D30G ScNTnC is reflected in the Hill coefficients with that for ScNTnC being greater, indicating a steeper slope (Table 2).

The replacement of Leu29 and Gly30 in McNTnC with Gln and Asp, respectively, decreased the K1/2 by 0.09 pCa units (Table 1). The Ca2+ titration curve of the mutant protein, L29Q/G30D McNTnC, was shifted to the right of the Ca2+ titration curves for both McNTnC and ScNTnC (Fig. 2C). The replacement of Asp with Asn at position 2 in L29Q/G30D McNTnC, with the creation of D2N/L29Q/G30D McNTnC, decreased the K1/2 by 0.16 pCa units relative to L29Q/G30D McNTnC (Table 1).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Heart rate is determined by many factors, but with each contraction cycle, Ca2+ binds and releases from TnC. If the Ca2+ affinity of TnC is too high, the rate of relaxation will be limited. Thus the cTnC-Ca2+ on- and off-rate constants must be compatible with cardiac performance. Despite the difference of nearly three orders of magnitude in heart rate across birds and mammals, there is very little variation in cTnC primary sequence. Within mammals and between mammals and the chicken, cTnC variation does not seem to be an important determinant of interspecies differences in myocardial contractility. When cTnC structure is compared more widely across vertebrates, a greater degree of variability is seen. Among the differences between fish and mammals and within fishes (40), it is not clear which structural variants have functional consequences.

Of the 13 sequence differences between McTnC and ScTnC, 5 occur in the NH2-terminal domain (40). To determine the residues responsible for the higher Ca2+ affinity of ScTnC, we focused on this region of the protein. Previous studies have established that sequence manipulations within the NH2-terminal domain can have significant effect on the ability of TnC to bind Ca2+ (12, 31). Examination of the cTnC isoform cloned from another fish, the Antarctic icefish, reveals that there are nine differences in sequence between icefish cTnC and ScTnC. However, of the five sequence differences between ScTnC and McTnC in the NH2-terminal domain, three also occur between icefish cTnC and McTnC. These are Asn2, Gln29, and Asp30 (Fig. 3) (40). In McTnC, the residues at these positions are Asp, Leu, and Gly, respectively (Fig. 3). The titration curves of IFcTnC and ScTnC are superimposable, and the K1/2 values of these curves are similar, demonstrating that the differences in sequence between IFcTnC and ScTnC do not appear to affect Ca2+ affinity. IFcTnC also contains Asn2, Gln29, and Asp30, suggesting that one or a combination of these amino acids is responsible for the high Ca2+ affinity of ScTnC and IFcTnC.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 3.   Comparison of the amino acid sequences of human/bovine/porcine (H-B-P) cTnC, salmonid (Oncorhynchus mykiss) cTnC (27), icefish (Chaenocephalus aceratus) cTnC (40), and African clawed frog (Xenopus laevis) cTnC (41). Regions of identity between H-B-P cTnC and the sequences of salmon, icefish, and frog cTnC are denoted by commas. Ca2+-binding sites I-IV are based on analogous regions in the Herzberg-Moult-James (HMJ) model (17) for sTnC. Secondary structures are reported for comparison in the context of the HMJ model. Helices A-H are denoted by tilde (~) and coordinating residues by x, y, z, -y, -x, and -z.

To confirm that sequence differences in the NH2-terminal domain of ScTnC are responsible for its higher Ca2+ affinity, we removed the COOH terminus from both ScTnC and McTnC, creating cNTnC mutants. cNTnC mutants have been used in previous studies to examine the structure and Ca2+ activation of the NH2-terminal domain (20, 34, 35). Spyracopoulos et al. (35) have demonstrated that the Ca2+-saturated NMR solution structure of McNTnC is similar to that of the Ca2+-saturated NH2 domain of the full-length mutant (C35S/C84S) chicken cTnC (33). In the present study, ScNTnC and McNTnC had a higher Ca2+ affinity than the respective full-length isoforms. The fact that this difference in affinity was similar for both McNTnC and ScNTnC suggests that any alteration in the ability of site II to bind Ca2+ caused by removal of the COOH-terminal domain was similar for both isoforms.

The difference in affinity between ScNTnC and McNTnC is consistent with that between the full-length ScTnC and McTnC (10) (Table 1). These data demonstrate that the removal of the COOH terminus of ScTnC and McTnC maintains the difference in affinity between isoforms while removing 8 of the 13 differences in amino acid sequence (Fig. 3). This result corroborates the IFcTnC data that suggested that NH2-terminal domain amino substitutions are responsible for the differences in Ca2+ affinity.

To identify the specific residues responsible for the high Ca2+ affinity of ScTnC, we next focused on Gln29 and Asp30 because these nonconservative substitutions occur in series in a region of the protein, site I, that while unable to bind Ca2+ directly has significant influence on the Ca2+ binding characteristics of cTnC (12, 31). Replacement of Gln29 and Asp30 with the corresponding residues from McTnC, Leu and Gly, caused the new construct, Q29L/D30G ScNTnC, to behave almost identically to McNTnC. The K1/2 of the mutant was not different from that of McNTnC, and the Ca2+ titration curves are virtually superimposed. Together, these results demonstrate that Gln29 and/or Asp30 is required for the higher affinity of ScNTnC.

The Ca2+ affinities of Q29L ScNTnC and D30G ScNTnC were measured to determine whether both Gln29 and Asp30 are necessary for the high Ca2+ affinity of ScNTnC. Both mutants demonstrated lower Ca2+ affinity than did ScNTnC. The replacement of Asp with Gly appears to make the Ca2+ affinity of the mutant intermediate between ScNTnC and McNTnC. The inability of D30G ScNTnC to become saturated at high [Ca2+], however, suggests that the protein, as a result of this mutation, has lost some functional integrity. We have previously observed a similar loss of functionality when the ability of ScTnC to bind Ca2+ was measured at 37°C (10). Because 37°C is well above the physiological temperature of the protein and lethal to the trout, this result was interpreted as a loss of thermal stability (10).

The specific mechanism by which the presence of Gln and Asp at residues 29 and 30, respectively, increases the affinity of site II in ScTnC is not known; however, we suggest that it is due to an allosteric effect on the ability of site II to bind Ca2+. Additionally, through interpretation of 3JHNHalpha coupling constants and data from 15N relaxation measurements obtained from NMR studies of apo- and Ca2+-saturated McNTnC, Spyracopoulos et al. (35) have suggested that sites I and II are structurally linked. It is not unreasonable, therefore, to propose that the manipulation of the sequence in this area of the protein could allosterically affect the ability of site II to bind Ca2+. The replacement of a hydrophobic residue (Leu) with Gln and the addition of a negative charge through the insertion of Asp are likely to have an effect on protein tertiary structure, consistent with NMR solution observations (4). Additionally, titration of 15N-labeled ScNTnC while monitoring two-dimensional 1H,15N-heteronuclear single quantum correlation NMR spectra has demonstrated that site I behaves differently in ScNTnC than in McNTnC as it continues to remain responsive to Ca2+ following the saturation of site II (9). Together, these results demonstrate that site I in ScNTnC differs both structurally and functionally from McNTnC.

To determine whether only Gln29 and Asp30 are responsible for the high Ca2+ affinity of ScNTnC, we mutated the sequence of McNTnC to insert these residues at positions 29 and 30 in place of Leu and Gly, respectively. The Ca2+ affinity of this new protein was significantly less than that of both ScTnC and McTnC. This result suggests that one or more residues in combination with Gln29 and Asp30 is/are responsible for the high Ca2+ affinity of ScTnC. The three remaining possibilities are Asn2, Asp14, and Val28, which are in place of Asp, Glu, and Ile, respectively, in McNTnC. The D14E and V28I substitutions are fairly conservative. Additionally, IFcTnC, which has the same Ca2+ affinity as ScTnC, also contains Asn at position 2 (Fig. 3). The sequence of cTnC cloned from the frog, Xenopus laevis, another ectothermic species, contains Asp at position 2 as in McTnC (41) (Fig. 3). This suggests that the presence of Asn at residue 2 may be unique only to cTnC cloned from fish and is not a common genotype of ectothermic hearts. To determine whether Asn2 is required, in addition to Gln29 and Asp30, for the high Ca2+ affinity of ScNTnC, we replaced the Asp2 in L29Q/G30D McNTnC with an Asn. The Ca2+ affinity of the resultant mutant was lower than that of L29Q/G30D McNTnC. This suggests that either Asn2 is not involved in the high Ca2+ affinity of site II in ScTnC or that other residues in addition to Asn2, Gln29, and Asp30 are required. This result also demonstrates that the manipulation of the amino acid sequence far outside of site II affects Ca2+ affinity. This finding is supported by earlier work by Gulati et al. (12), who demonstrated that the NH2-terminal alpha -helical overhang of cTnC, where residue 2 is located, plays a role in regulating the Ca2+ binding characteristics of site II in cTnC.

Fluorescent probes engineered into TnC through Phe to Trp mutation in site I have been used previously to study the Ca2+ binding dynamics of this molecule (8, 19, 21, 27, 29, 32, 38). We have demonstrated the effectiveness of Trp at residue 27 in reporting Ca2+ binding to site II in McTnC and ScTnC without significantly affecting the alpha -helical content of the protein, which reflects the general structure of the molecule, using far UV circular dichroism spectra (27). Additionally, the K1/2 values of Ca2+ binding to the F27W cNTnC mutants and full-length IFcTnC in the present study are within the range previously reported for that of Ca2+-triggered tension generation in cardiac myocytes under similar conditions (16, 18, 23, 24, 28, 39). We therefore maintain that the F27W mutation effectively reports on the Ca2+-induced conformational response of the cTnC isoforms without significantly altering the functional characteristics of the proteins.

We do not feel that the absence of Mg2+ confounds the results, because Allen et al. (1) demonstrated that Mg2+ (1-8 mM) had no effect on the relationship between [Ca2+] and activated force in rat ventricular skinned fibers or on the relationship between pCa and ATPase activity in skinned cardiac cells. These results therefore indicate that Mg2+ has no measurable influence on the ability of Ca2+ to activate cTnC.

In summary, this study has demonstrated that it is the sequence differences between ScTnC and McTnC in the NH2-terminal domain that are responsible for the high Ca2+ affinity of ScTnC. Additionally, Gln29 and Asp30 were demonstrated as being required for the comparatively high Ca2+ affinity of ScTnC. Because the replacements of these two residues into McNTnC did not increase its Ca2+ affinity, it is clear that other residues in addition to Gln29 and Asp30 are required. The affinity of L29Q/G30D McNTnC was not increased through the replacement of Asp at residue 2 with an Asn, illustrating that other residues in place of, or in addition to, Asn2, along with Gln29 and Asp30, are required for the high Ca2+ affinity of ScTnC. The identification of these residues represents the focus of future experiments because they represent logical targets for pharmacological intervention to increase the Ca2+ affinity of McTnC to enhance the Ca2+ sensitivity of cardiac tissue. Such an agent would be useful in end-stage heart failure, allowing for increased inotropism and improved stroke volume.


    ACKNOWLEDGEMENTS

We thank Dr. J. S. Ballantyne for the use of the spectrofluorometer and C. R. Marshall for molecular biology assistance.


    FOOTNOTES

This work is supported by operating grants from the Heart and Stroke Foundation of British Columbia and Yukon and from the Natural Sciences and Engineering Research Council of Canada to G. F. Tibbits and by a Doctoral Fellowship from the Heart and Stroke Foundation of Canada to T. E. Gillis.

Address for reprint requests and other correspondence: G. F. Tibbits, Cardiac Membrane Research Lab, Simon Fraser Univ., 8888 Univ. Drive, Burnaby, BC, Canada V5A 1S6 (E-mail: tibbits{at}sfu.ca).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

First published January 8, 2003;10.1152/ajpcell.00339.2002

Received 23 July 2002; accepted in final form 11 December 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Allen, K, Xu YY, and Kerrick WG. Ca2+ measurements in skinned cardiac fibers: effects of Mg2+ on Ca2+ activation of force and fiber ATPase. J Appl Physiol 88: 180-185, 2000[Abstract/Free Full Text].

2.   Babu, A, Sonnenblick E, and Gulati J. Molecular basis for the influence of muscle length on myocardial performance. Science 240: 74-76, 1988[Abstract/Free Full Text].

3.   Baudet, S, Hove-Madsen L, and Bers DM. How to make and use Ca2+-specific mini- and microelectrodes. Methods Cell Biol 40: 93-113, 1994[Web of Science][Medline].

4.   Blumenschein, TMA, Gillis TE, Tibbits GF, and Sykes BD. Effect of temperature on trout cardiac troponin C structure. Biophys J 82: 387a, 2002.

5.   Brandt, PW, and Hibberd MG. Proceedings: Effect of temperature on the pCa-tension relation of skinned ventricular muscle of the cat. J Physiol 258: 76P-77P, 1976[Medline].

6.   Churcott, CS, Moyes CD, Bressler BH, Baldwin KM, and Tibbits GF. Temperature and pH effects on Ca2+ sensitivity of cardiac myofibrils: a comparison of trout with mammals. Am J Physiol Regul Integr Comp Physiol 267: R62-R70, 1994[Abstract/Free Full Text].

7.   Ding, XL, Akella AB, and Gulati J. Contributions of troponin I and troponin C to the acidic pH-induced depression of contractile Ca2+ sensitivity in cardiotrabeculae. Biochemistry 34: 2309-2316, 1995[Medline].

8.   Foguel, D, Suarez MC, Barbosa C, Rodrigues JJ, Jr, Sorenson MM, Smillie LB, and Silva JL. Mimicry of the Ca2+-induced conformational state of troponin C by low temperature under pressure. Proc Natl Acad Sci USA 93: 10642-10646, 1996[Abstract/Free Full Text].

9.   Gillis, TE, Blumenschein TMA, Sykes BD, and Tibbits GF. Site I binds Ca2+ in trout cardiac troponin C. Biophys J 82: 387a, 2002.

10.   Gillis, TE, Marshall CR, Xue XH, Borgford TJ, and Tibbits GF. Ca2+ binding to cardiac troponin C: effects of temperature and pH on mammalian and salmonid isoforms. Am J Physiol Regul Integr Comp Physiol 279: R1707-R1715, 2000[Abstract/Free Full Text].

11.   Goldman, YE, McCray JA, and Ranatunga KW. Transient tension changes initiated uninitiated by laser temperature jumps in rabbit psoas muscle fibres. J Physiol 392: 71-95, 1987[Abstract/Free Full Text].

12.   Gulati, J, Babu A, and Su H. Functional delineation of the Ca2+-deficient EF-hand in cardiac muscle, with genetically engineered cardiac-skeletal chimeric troponin C. J Biol Chem 267: 25073-25077, 1992[Abstract/Free Full Text].

13.   Gulati, J, Sonnenblick E, and Babu A. The role of troponin C in the length dependence of Ca2+-sensitive force of mammalian skeletal and cardiac muscles. J Physiol 441: 305-324, 1991[Abstract/Free Full Text].

14.   Harrison, SM, and Bers DM. Influence of temperature on the Ca2+ sensitivity of the myofilaments of skinned ventricular muscle from the rabbit. J Gen Physiol 93: 411-428, 1989[Abstract/Free Full Text].

15.   Harrison, SM, and Bers DM. Modification of temperature dependence of myofilament Ca sensitivity by troponin C replacement. Am J Physiol Cell Physiol 258: C282-C288, 1990[Abstract/Free Full Text].

16.   Harrison, SM, and Bers DM. Temperature dependence of myofilament Ca sensitivity of rat, guinea pig, and frog ventricular muscle. Am J Physiol Cell Physiol 258: C274-C281, 1990[Abstract/Free Full Text].

17.   Herzberg, O, Moult J, and James MN. A model for the Ca2+-induced conformational transition of troponin C. A trigger for muscle contraction. J Biol Chem 261: 2638-2644, 1986[Abstract/Free Full Text].

18.   Komukai, K, Ishikawa T, and Kurihara S. Effects of acidosis on Ca2+ sensitivity of contractile elements in intact ferret myocardium. Am J Physiol Heart Circ Physiol 274: H147-H154, 1998[Abstract/Free Full Text].

19.   Li, MX, Chandra M, Pearlstone JR, Racher KI, Trigo-Gonzalez G, Borgford T, Kay CM, and Smillie LB. Properties of isolated recombinant N and C domains of chicken troponin C. Biochemistry 33: 917-925, 1994[Medline].

20.   Li, MX, Gagne SM, Spyracopoulos L, Kloks CP, Audette G, Chandra M, Solaro RJ, Smillie LB, and Sykes BD. NMR studies of Ca2+ binding to the regulatory domains of cardiac and E41A skeletal muscle troponin C reveal the importance of site I to energetics of the induced structural changes. Biochemistry 36: 12519-12525, 1997[Medline].

21.   Li, MX, Gagne SM, Tsuda S, Kay CM, Smillie LB, and Sykes BD. Ca2+ binding to the regulatory N-domain of skeletal muscle troponin C occurs in a stepwise manner. Biochemistry 34: 8330-8340, 1995[Medline].

22.   McDonald, KS, Field LJ, Parmacek MS, Soonpaa M, Leiden JM, and Moss RL. Length dependence of Ca2+ sensitivity of tension in mouse cardiac myocytes expressing skeletal troponin C. J Physiol 483: 131-139, 1995[Abstract/Free Full Text].

23.   Metzger, JM. Effects of troponin C isoforms on pH sensitivity of contraction in mammalian fast and slow skeletal muscle fibres. J Physiol 492: 163-172, 1996[Abstract/Free Full Text].

24.   Metzger, JM, Parmacek MS, Barr E, Pasyk K, Lin WI, Cochrane KL, Field LJ, and Leiden JM. Skeletal troponin C reduces contractile sensitivity to acidosis in cardiac myocytes from transgenic mice. Proc Natl Acad Sci USA 90: 9036-9040, 1993[Abstract/Free Full Text].

25.   Morimoto, S, Harada K, and Ohtsuki I. Roles of troponin isoforms in pH dependence of contraction in rabbit fast and slow skeletal and cardiac muscles. J Biochem (Tokyo) 126: 121-129, 1999[Abstract/Free Full Text].

26.   Moss, RL, Nwoye LO, and Greaser ML. Substitution of cardiac troponin C into rabbit muscle does not alter the length dependence of Ca2+ sensitivity of tension. J Physiol 440: 273-289, 1991[Abstract/Free Full Text].

27.   Moyes, CD, Borgford T, LeBlanc L, and Tibbits GF. Cloning and expression of salmon cardiac troponin C: titration of the low-affinity Ca2+-binding site using a tryptophan mutant. Biochemistry 35: 11756-11762, 1996[Medline].

28.   Palmer, S, and Kentish JC. The role of troponin C in modulating the Ca2+ sensitivity of mammalian skinned cardiac and skeletal muscle fibres. J Physiol 480: 45-60, 1994[Abstract/Free Full Text].

29.   Pearlstone, JR, Borgford T, Chandra M, Oikawa K, Kay CM, Herzberg O, Moult J, Herklotz A, Reinach FC, and Smillie LB. Construction and characterization of a spectral probe mutant of troponin C: application to analyses of mutants with increased Ca2+ affinity. Biochemistry 31: 6545-6553, 1992[Medline].

30.   Putkey, JA, Liu W, and Sweeney HL. Function of the N-terminal Ca2+-binding sites in cardiac/slow troponin C assessed in fast skeletal muscle fibres. J Biol Chem 266: 14881-14884, 1991[Abstract/Free Full Text].

31.   Putkey, JA, Sweeney HL, and Campbell ST. Site-directed mutation of the trigger Ca2+-binding sites in cardiac troponin C. J Biol Chem 264: 12370-12378, 1989[Abstract/Free Full Text].

32.   Rao, VG, Akella AB, Su H, and Gulati J. Molecular mobility of the Ca2+-deficient EF-hand of cardiac troponin C as revealed by fluorescence polarization of genetically inserted tryptophan. Biochemistry 34: 562-568, 1995[Medline].

33.   Sia, SK, Li MX, Spyracopoulos L, Gagne SM, Liu W, Putkey JA, and Sykes BD. Structure of cardiac muscle troponin C unexpectedly reveals a closed regulatory domain. J Biol Chem 272: 18216-18221, 1997[Abstract/Free Full Text].

34.   Spyracopoulos, L, Gagne SM, Li MX, and Sykes BD. Dynamics and thermodynamics of the regulatory domain of human cardiac troponin C in the apo- and Ca2+-saturated states. Biochemistry 37: 18032-18044, 1998[Medline].

35.   Spyracopoulos, L, Li MX, Sia SK, Gagne SM, Chandra M, Solaro RJ, and Sykes BD. Ca2+-induced structural transition in the regulatory domain of human cardiac troponin C. Biochemistry 36: 12138-12146, 1997[Medline].

36.   Stephenson, DG, and Williams DA. Ca2+-activated force responses in fast- and slow-twitch skinned. J Physiol 317: 281-302, 1981[Abstract/Free Full Text].

37.   Sweitzer, NK, and Moss RL. The effect of altered temperature on Ca2+-sensitive force in permeabilized myocardium and skeletal muscle. Evidence for force dependence of thin filament activation. J Gen Physiol 96: 1221-1245, 1990[Abstract/Free Full Text].

38.   Trigo-Gonzalez, G, Racher K, Burtnick L, and Borgford T. A comparative spectroscopic study of tryptophan probes engineered into high- and low-affinity domains of recombinant chicken troponin C. Biochemistry 31: 7009-7015, 1992[Medline].

39.   Wattanapermpool, J, Reiser PJ, and Solaro RJ. Troponin I isoforms and differential effects of acidic pH on soleus and cardiac myofilaments. Am J Physiol Cell Physiol 268: C323-C330, 1995[Abstract/Free Full Text].

40.   Yang, H, Velema J, Hedrick MS, Tibbits GF, and Moyes CD. Evolutionary and physiological variation in cardiac troponin C in relation to thermal strategies of fish. Physiol Biochem Zool 73: 841-849, 2000[Web of Science][Medline].

41.   Yuasa, HJ, Cox JA, and Takagi T. Diversity of the troponin C genes during chordate evolution. J Biochem (Tokyo) 123: 1180-1190, 1998[Abstract/Free Full Text].


Am J Physiol Cell Physiol 284(5):C1176-C1184
0363-6143/03 $5.00 Copyright © 2003 the American Physiological Society



This article has been cited by other articles:


Home page
Physiol. GenomicsHome page
B. Liang, F. Chung, Y. Qu, D. Pavlov, T. E. Gillis, S. B. Tikunova, J. P. Davis, and G. F. Tibbits
Familial hypertrophic cardiomyopathy-related cardiac troponin C mutation L29Q affects Ca2+ binding and myofilament contractility
Physiol Genomics, April 1, 2008; 33(2): 257 - 266.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
J. P. Davis and S. B. Tikunova
Ca2+ exchange with troponin C and cardiac muscle dynamics
Cardiovasc Res, March 1, 2008; 77(4): 619 - 626.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
T. E. Gillis, C. R. Marshall, and G. F. Tibbits
Functional and evolutionary relationships of troponin C
Physiol Genomics, December 19, 2007; 32(1): 16 - 27.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
K. L. Kreutziger, T. E. Gillis, J. P. Davis, S. B. Tikunova, and M. Regnier
Influence of enhanced troponin C Ca2+-binding affinity on cooperative thin filament activation in rabbit skeletal muscle
J. Physiol., August 15, 2007; 583(1): 337 - 350.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
T. E. Gillis, B. Liang, F. Chung, and G. F. Tibbits
Increasing mammalian cardiomyocyte contractility with residues identified in trout troponin C
Physiol Genomics, June 16, 2005; 22(1): 1 - 7.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/5/C1176    most recent
00339.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (12)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gillis, T. E.
Right arrow Articles by Tibbits, G. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gillis, T. E.
Right arrow Articles by Tibbits, G. F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online