Am J Physiol Cell Physiol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 284: C870-C879, 2003; doi:10.1152/ajpcell.00322.2002
0363-6143/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (68)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Park, J. S.
Right arrow Articles by Abraham, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Park, J. S.
Right arrow Articles by Abraham, E.
Vol. 284, Issue 4, C870-C879, April 2003

Activation of gene expression in human neutrophils by high mobility group box 1 protein

Jong Sung Park1, John Arcaroli1, Ho-Kee Yum1, Huan Yang2, Haichao Wang2, Kuang-Yao Yang1, Kang-Hyeon Choe1, Derek Strassheim1, Todd M. Pitts1, Kevin J. Tracey2, and Edward Abraham1

1 Division of Pulmonary Sciences and Critical Care Medicine, University of Colorado Health Sciences Center, Denver, Colorado 80262; and 2 Laboratory of Biomedical Science, North Shore University Hospital, New York University School of Medicine, Manhasset, New York 11030


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

High mobility group box 1 (HMGB1) protein, a DNA binding protein that stabilizes nucleosomes and facilitates transcription, was recently identified as a late mediator of endotoxin lethality. High serum HMGB1 levels in patients with sepsis are associated with increased mortality, and administration of HMGB1 produces acute inflammation in animal models of lung injury and endotoxemia. Neutrophils occupy a critical role in mediating the development of endotoxemia-associated acute lung injury, but previously it was not known whether HMGB1 could influence neutrophil activation. In the present experiments, we demonstrate that HMGB1 increases the nuclear translocation of NF-kappa B and enhances the expression of proinflammatory cytokines in human neutrophils. These proinflammatory effects of HMGB1 in neutrophils appear to involve the p38 MAPK, phosphatidylinositol 3-kinase/Akt, and ERK1/2 pathways. The mechanisms of HMGB1-induced neutrophil activation are distinct from endotoxin-induced signals, because HMGB1 leads to a different profile of gene expression, pattern of cytokine expression, and kinetics of p38 activation compared with LPS. These findings indicate that HMGB1 is an effective stimulus of neutrophil activation that can contribute to development of a proinflammatory phenotype in diseases characterized by excessively high levels of HMGB1.

p38 mitogen-activated protein kinase; phosphatidylinositol 3-kinase; Akt; extracellular signal regulated kinase 1/2; nuclear factor-kappa B; inflammation


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

ACTIVATED NEUTROPHILS produce cytokines, chemokines, and other proinflammatory mediators that participate in the development of acute inflammation. For instance, neutrophils are activated during endotoxin-induced shock, sepsis, and acute lung injury (2, 4, 27, 48). Bacterial products and cytokines can initiate acute inflammatory responses in neutrophils, and these pathways have been implicated in the development of tissue injury (2). Recent data implicated high mobility group box (HMGB) chromosomal proteins as cytokine-like mediators of delayed endotoxin lethality and acute lung injury (1, 3, 41).

There are three HMGB chromosomal proteins: HMGB1 (previously HMG1), HMGB2 (previously HMG2), and HMGB3 (previously HMG4 or HMG2). HMGBs are composed of three different domains, including homologous DNA binding boxes A and B and the COOH-terminal domain (6). HMGB1 appears to have two distinct functions in cellular systems. First, it has been shown to have an intracellular role as a regulator of transcription (7) and, second, an extracellular role in which it promotes tumor metastasis (37) and inflammation (41). Monocytes/macrophages stimulated by lipopolysaccharide (LPS), tumor necrosis factor (TNF)-alpha , or interleukin (IL)-1 secrete HMGB1 (41). Addition of HMGB1 to monocytes in culture induces the release of TNF-alpha , IL-1alpha , IL-1beta , IL-1Ra, IL-6, IL-8, macrophage inflammatory protein (MIP)-1alpha , and MIP-1beta , but not IL-10 or IL-12 (3). Intratracheal administration of HMGB1 produces acute lung injury, and antibodies against HMGB1 decrease LPS-induced lung edema and neutrophil accumulation (1). Anti-HMGB1 antibodies did not significantly reduce the levels of the proinflammatory cytokines TNF-alpha , IL-1beta , or MIP-2 in LPS-induced acute lung injury, suggesting that HMGB1 occupies a more distal position in endotoxin-induced proinflammatory cascades (41). High serum HMGB1 levels accumulate in patients with sepsis, and significantly higher levels were found in lethal cases compared with survivors (41).

Although HMGB1 has been shown to activate macrophages and other cell populations, the signaling pathways involved have not been previously investigated. Here we establish that HMGB1 is an effective stimulus to neutrophil activation, primarily through the p38 MAPK pathway, leading to nuclear translocation of NF-kappa B and enhanced expression of proinflammatory cytokines.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Reagents. RPMI 1640 was obtained from Life Technologies (Gaithersburg, MD). Fetal bovine serum (FBS) and penicillin/streptomycin were purchased from Gemini Bioproducts (Calabasas, CA). LPS (from Escherichia coli O111:B4) was obtained from Sigma Chemical (St. Louis, MO). Poly(dI-dC) · poly(dI-dC) and Percoll were purchased from Amersham-Pharmacia (Piscataway, NJ). The Coomassie-Plus protein assay reagent and BCA protein assay reagent were purchased from Pierce (Rockford, IL). SB-202190, U0126, and LY-294002 were purchased from Calbiochem (La Jolla, CA). Antibodies for phospho (Ser276)-Akt, total Akt, phospho (Thr202/Tyr204)-p44/42, and total p44/42 MAPK were purchased from Cell Signaling Technology (Beverly, MA). Akt kinase assay kit, p44/42 MAPK assay kit, and p38 MAPK assay kit were purchased from Cell Signaling Technology (Beverly, MA). Recombinant HMGB1 (rHMGB1) was prepared as described previously (3, 41).

Isolation and culture of human neutrophils. Peripheral blood was obtained from healthy volunteers under a protocol approved by the University of Colorado Health Sciences Center Institutional Review Board. Neutrophils (purity >99.0%) were isolated by plasma-Percoll gradients after dextran sedimentation of erythrocytes (14). Neutrophils were resuspended in RPMI 1640 at a final concentration of 5 × 106 cells/ml and stimulated with 0-1,000 ng/ml rHMGB1 or 100 ng/ml LPS. The p38 MAPK inhibitor SB-202190 (30 µM), the MEK1/2 inhibitor U0126 (10 µM), or the phosphatidylinositol 3-kinase (PI 3-K) inhibitor LY-294002 (100 µM) was added to the neutrophil cultures for 1 h before HMGB1 or LPS stimulation. Neutrophil viability as assessed by trypan blue staining was consistently >95% after 1 h in control or LPS-stimulated cultures as well as under conditions where LY-294002 or U0126 was added to the cells for 1 h. The concentrations of kinase inhibitors have previously been used by ourselves and others (8, 32, 33, 50, 51). Specificity of these concentrations of inhibitors was verified by demonstrating that LY-294002 did not affect LPS-induced activation of SAPK/JNK or MEK1/2 and that U0126 did not alter LPS-associated SAPK/JNK activation in neutrophils. Cultures were supplemented with polymyxin B (10 µg/ml) to block any effects of contaminating endotoxin.

Gene array analysis. RNA was isolated from neutrophils using an RNeasy kit according to the manufacturer's protocol (Qiagen, Valencia, CA). Total RNA (20 µg) was converted to double-stranded cDNA (ds-cDNA) using the Superscript Choice System (Life Technologies). An oligo-dT primer containing a T7 RNA polymerase promoter (Genset, Kents Store, VA) was utilized. After second-strand synthesis, the reaction mixture was extracted with phenol-chloroform-isoamyl alcohol, and the ds-cDNA was recovered by ethanol precipitation. In vitro transcription was performed to generate biotin-labeled cRNA using a RNA transcript labeling kit (Enzo, Farmingdale, NY), and 3.3 µl of ds-cDNA template were transcribed in the presence of a mixture of biotin-labeled ribonucleotides. Biotin-labeled cRNA was purified using an RNeasy affinity column. To ensure optimal hybridization to the oligonucleotide array, we performed fragmentation of cRNA such that the fragments were between 35 and 200 bases in length by incubating the cRNA at 94°C for 35 min in fragmentation buffer. The sample was then added to a hybridization solution containing 100 mM MES, 1 M NaCl, and 20 mM EDTA in the presence of 0.01% Tween 20. The final concentration of the fragmented cRNA was 0.05 µg/µl. Hybridization was performed by incubating 200 µl of the sample. The sample was loaded on a test chip to determine the quality of mRNA by using known housekeeping genes. After passing the test chip, samples were loaded on Affymetrix GeneChip Human Genome U95Av2 (12,626 genes) chips (Affymetrix, Santa Clara, CA). Hybridization occurred at 45°C for 16 h using GeneChip Hybridization Oven 640 (Affymetrix). After hybridization, the hybridization solutions were removed, and the arrays were washed and stained with streptavidin-phycoerythrin using a GeneChipFluidics Station 400 (Affymetrix). Arrays were read at a resolution of 6 µm using an HP Gene Array Scanner (Affymetrix). Detailed protocols for data analysis of Affymetrix microarrays and extensive documentation of the sensitivity and quantitative aspects of the method have been described previously (13, 25).

Real-time quantitative RT-PCR. Total cellular RNA was isolated from human neutrophils using Trizol reagent (Life Technologies), as recommended by the manufacturer. Real-time RT-PCR was performed with specific primers and probes corresponding to the proinflammatory cytokine genes IL-1beta , IL-8, and TNF-alpha . For each mRNA detection, a fluorogenic probe and two primers for PCR (forward and reverse) were synthesized (Perkin-Elmer Life Sciences). The internal oligonucleotide probe was labeled with the fluorescent dyes carboxyfluorescein (FAM) at the 5'-end and N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA) at the 3'-end. For human IL-1beta mRNA detection, the forward and reverse primers were 5'-343CACGATGCACCTGTACGATCA363-3' and 5'-410AGACATCACCAAGCTTTTTTGCT388-3', respectively. The internal probe was 5'-(FAM)-365TGAACTGCACGCTCCGGGACTCA386-(TAMRA)-3'. The forward and reverse primers for human IL-8 were 5'-13CTGGCCGTGGCTCTCTTG31-3' and 5'-82CCTTGGCAAAACTGCACCTT63-3', respectively. The internal probe was 5'-(FAM)-33CAGCCTTCCTGATTTCTGCAGCTCTGTGT61-(TAMRA)-3'. For human TNF-alpha mRNA detection, the forward and reverse primers were 5'-251TCTTCTCGAACCCCGAGTGA272-3' and 5'-320GGAGCTGCCCCTCAGCTT303-3', respectively. The internal probe was 5'-(FAM)-273AGCCTGTAGCCCATGTTGTAGCAAACCCT301- (TAMRA)-3'. To optimize the primer sets, we performed a primer optimization experiment as described in the manufacturer's protocol. Based on primer optimization, the primer and probe concentrations for IL-1beta , IL-8, and TNF-alpha consisted of 100 nM of both primers and 200 nM for the probe, used in each reaction with 100 ng of total cellular RNA. In each experiment, ribosomal RNA control probe, forward primer, and reverse primer (Perkin-Elmer) at concentrations of 50 nM were used to normalize for the amount of RNA in each sample.

All reagents used in the one-step RT-PCR reactions were purchased from Perkin-Elmer. Each one-step RT-PCR reaction contained a total volume of 50 µl. The RT reaction was performed for 30 min at 48°C using MultiScribe reverse transcriptase at a final concentration of 0.25 U/µl. After the RT step, AmpliTaq Gold polymerase, with a final concentration of 0.025 U/µl, was activated by an increase in temperature to 95°C for 10 min, followed by 40 cycles of amplification (95°C for 15 s and 60°C for 1 min) with a Gene Amp 5700 sequence detection system (ABI Prism, Foster City, CA). The quantity of cytokine mRNA was determined from a standard curve with 10-fold dilutions of known amounts of target RNA for each primer and probe set. RNA amounts were determined using software provided with the Gene Amp 5700 sequence detection system. Quantification was determined by dividing the amount of 18S ribosomal RNA by the target amount for each cytokine sample.

Preparation of Bcl-xL and monoamine oxidase B probes. A 280-bp human monoamine oxidase B cDNA fragment was amplified by RT-PCR using the following primers: sense, 5'-GTGGGAGGCAGGACTTACAC-3'; and antisense, 5'-TCACTCGGAATCTCTCGCCC-3'. A 350-bp of human Bcl-xL cDNA fragment was amplified by RT-PCR using the following primers: sense, 5'-ATGGCAACCCATCCTGGCAC-3'; and antisense, 5'-AGCTGCGATCCGACTCACCA-3'. For human beta -actin, the following primers were used: sense, 5'-TCATGAAGTGTGACGTTGACATCCGT-3'; and antisense, 5'-CTTAGAAGCATTTGCGCTGCACGATG-3', resulting in a 285-bp band.

Single-strand cDNA synthesis and PCR were carried out using the manufacturer's protocol (Invitrogen) with SuperScript one-step RT-PCR kit. Thirty-five cycles of PCR amplification for Bcl-xL, monoamine oxidase B, and beta -actin were performed as follows: denaturation at 95°C for 30 s, annealing at 57°C for 45 s, and extension at 72°C for 1 min. The final extension was carried out for 8 min. The PCR products were characterized using 1% agarose gel electrophoresis.

Electrophoretic mobility shift assays. To obtain nuclear extracts from neutrophils, we suspended cells in lysis buffer containing 10 mM Tris · HCl (pH 7.5), 1.5 mM MgCl2, 10 mM KCl, 0.5 mM DTT, 0.5 mM PMSF, 0.1 mM Na3VO4, and 0.1% Triton X-100, and the samples were incubated on ice for 20 min. After cytoplasm was removed from the nuclei by 15 passages through a 25-gauge needle, the nuclei were collected by centrifugation at 5,000 g for 10 min at 4°C. The pellets were suspended in extraction buffer containing 20 mM Tris · HCl (pH 7.5), 1.5 mM MgCl2, 420 mM NaCl, 0.2 mM EDTA, 0.1% Triton X-100, 25% glycerol, 0.5 mM EDTA, 0.5 mM PMSF, and 0.1 mM Na3VO4. After a 30-min incubation on ice, the suspension was centrifuged at 14,000 g for 20 min at 4°C and the supernatants were collected. The protein concentration in the supernatants was determined using Coomassie Plus protein assay reagent (Pierce). Nuclear extracts (5 µg) were incubated at room temperature for 15 min in 20 µl of reaction buffer containing 10 mM Tris · HCl (pH 7.5), 1 mM MgCl2, 0.5 mM EDTA, 0.5 mM DTT, 50 mM NaCl, and 4% glycerol with 32P end-labeled, double-stranded oligonucleotide probe specific for the kappa B site, 5'-GCCATGGGGGGATCCCCG AAG TCC-3' (Geneka Biotechnology) and 1 µg of poly(dI-dC) · poly(dI-dC). In some experiments, unlabeled NF-kappa B or mutant NF-kappa B oligonucleotide (Santa Cruz Biotechnology, Santa Cruz, CA) was added to the samples at 200-fold excess before the addition of labeled probe. For supershift studies, 1 µl of anti-p65 was added to the DNA-binding reaction just before the 5-min incubation. The complexes were resolved on 5% polyacrylamide gels in Tris · HCl (pH 8.0)-borate-EDTA buffer at 10 V/cm. Dried gels were exposed with Kodak Biomax MS film (Rochester, NY) for 1-24 h at -70°C.

p38 MAPK, Akt, and ERK1/2 immunoprecipitation and kinase assays. After culture of neutrophils from the same donor with or without protein kinase inhibitors and HMGB1, neutrophils were placed in a lysis buffer containing 20 mM Tris · HCl (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 2.5 mM sodium pyrophosphate, 1 mM beta -glycerol phosphate, 1 mM Na3VO4, and 1 µg/ml leupeptin. The lysate was sonicated four times for 5 s at 4°C and centrifuged at 15,000 g for 10 min at 4°C, and the supernatant was transferred to a fresh tube. The amount of protein was measured using the Micro BCA protein assay reagent kit (Pierce), and 200 µg of lysate were incubated with a 1:50 dilution of immobilized Akt, p38, or p42/44 MAPK protein A-conjugated antibodies overnight with gentle rocking at 4°C. The mixture was centrifuged at 15,000 g for 30 s at 4°C, and the pellet was washed twice with fresh lysis buffer, followed by two washes with kinase buffer containing 25 mM Tris · HCl (pH 7.5), 5 mM beta -glycerol phosphate, 2 mM DTT, 0.1 mM Na3VO4, and 10 mM MgCl2. The pellet was resuspended in kinase buffer supplemented with 200 mM ATP and 2 µg of ATF-2 fusion protein for the p38 MAPK assay, 1 µg of GSK-3 fusion protein for the Akt assay, or Elk-1 fusion protein for the ERK1/2 assay as a substrate. The mixture was then incubated for 30 min at 30°C. The reaction was terminated with the addition of Laemmli sample buffer and boiled for 5 min. The proteins were separated by gel electrophoresis, transferred to nitrocellulose, and probed with antibodies to phospho-ATF-2 (Thr71), phospho-GSK-3alpha /beta , or phospho-Elk-1 (Ser383). Additionally, we confirmed that the same amount of protein was immunoprecipitated from each sample by establishing that similar amounts of beta -actin were present for each condition. Specific bands were visualized by an enhanced chemiluminescence detection system with subsequent exposure to X-ray film. Quantification was performed by image analysis using densitometry (ChemiDoc system; Bio-Rad, Hercules, CA).

Statistical analysis. The data are shown as means ± SE and represent information from three separate experiments. Statistical significance was determined by analysis of variance after the normality of the data was verified, followed by the Tukey-Kramer multiple comparisons test. A P value <0.05 was considered significant.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

HMGB1 and LPS induce distinct patterns of gene expression in neutrophils. The hierarchical clustering method was used to identify gene expression patterns in neutrophils stimulated by either HMGB1 or LPS for 1 h, and the results were compared with patterns obtained from experiments using unstimulated neutrophils. As shown in Fig. 1, a total of 470 genes showed at least twofold increase in expression among neutrophils cultured with either HMGB1 or LPS. Of these 470 genes, the expression of 95 genes was increased by both LPS and HMGB1. The expression of 140 genes was upregulated at least twofold by HMGB1 but not LPS, whereas the expression of 235 genes was increased by LPS but not HMGB1 (Fig. 1A).


View larger version (39K):
[in this window]
[in a new window]
 
Fig. 1.   A: hierarchical cluster images showing gene expression patterns among the 12,626 human genes examined (Affymetrix GeneChip Human Genome U95AV2 array) after neutrophil (5 × 106/ml) stimulation with high mobility group box 1 (HMGB1) protein (1 µg/ml) or LPS (100 ng/ml) for 1 h. Genes that showed >2-fold changes in control vs. HMGB1 or control vs. LPS were subjected to clustering analysis (Gene Spring 4.07 program; Silicon Genetics, Redwood City, CA) The fold changes were based on comparison with internal standards, including beta -actin. Each sample was loaded on separate chips and was run separately with its own control. These data represent the average of 2 separate experiments from the same donors. B: HMGB1 increases the expression of monoamine oxidase B and Bcl-xL mRNA in human neutrophils. Neutrophils (5 × 106 cells /ml) were treated with HMGB1 (1 µg/ml), heat-inactivated HMGB1 (1 µg/ml), or LPS (100 ng/ml) for 1 h. Levels of monoamine oxidase B and Bcl-xL mRNA were detected by RT-PCR. Heat inactivation of HMGB1 protein was performed at 95°C for 30 min. The results shown are representative of 3 experiments.

LPS signal transduction in neutrophils occurs in part through activation of ERK1/2, PI 3-K, and p38 MAPK, and pathways involving these kinases play important roles in modulating expression of inflammatory gene products (4, 20, 21, 31, 32, 33, 38, 48, 50). As expected, LPS exposure increased the expression of neutrophil genes regulated by p38 MAPK, PI 3-K, or ERK1/2 (Table 1) (5, 9, 10, 12, 18, 19, 22, 24, 30, 39, 42, 45). Increased expression of genes under the regulatory control of these kinases was also observed after exposure of neutrophils to HMGB1 (Table 1). To validate the gene array results, we used RT-PCR to confirm that expression of monoamine oxidase B and Bcl-xL was increased in neutrophils by HMGB1 but not by LPS or heat-inactivated HMGB1 (Fig. 1B).

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Increased expression of genes following exposure of neutrophils to HMGB1 or LPS

Effects of HMGB1 on proinflammatory cytokine and chemokine expression in human neutrophils. To determine the molecular basis for HMGB1-mediated neutrophil activation, we examined mRNA levels of IL-1beta , IL-8, and TNF-alpha in neutrophils cultured with LPS or HMGB1. In the gene array experiments shown in Fig. 1, the expression of IL-1beta and IL-8 was increased approximately twofold by LPS and HMGB1, and the expression of TNF-alpha was increased sevenfold by LPS and fivefold by HMGB1. Real-time RT-PCR analysis revealed induction of IL-1beta , IL-8, and TNF-alpha mRNA as early as 30 min after addition of HMGB1 to the cells. Cytokine gene expression was HMGB1 concentration dependent (Fig. 2, A-C). Maximum expression levels of IL-1beta and TNF-alpha were found in neutrophils 60 min after exposure to HMGB1 (Fig. 2, A and B), whereas maximum levels of IL-8 mRNA were present 30 min after culture with HMGB1. LPS stimulation of neutrophils produced alterations in the magnitude and timing of IL-8 and IL-1beta mRNA expression that were similar to those observed after exposure to HMGB1 (Fig. 2, A and C), whereas expression of TNF-alpha mRNA in neutrophils appeared to reach maximal levels at later time points after culture with LPS compared with HMGB1 (Fig. 2B).


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2.   Effect of HMGB1 on proinflammatory cytokine and chemokine gene expression in human neutrophils. Neutrophils (5 × 106/ml) were incubated in the presence or absence of recombinant HMGB1 (0-1,000 ng/ml) or LPS (100 ng/ml) for the indicated time (30, 60, or 240 min). Total RNA was then isolated and processed for real-time RT-PCR to determine the expression of the proinflammatory cytokines IL-1beta (A), TNF-alpha (B), and IL-8 (C). Values represent means ± SE from 3 consecutive experiments. *P < 0.05; dagger P < 0.01; and Dagger P < 0.001 vs. control.

HMGB1 induced kinase activation in human neutrophils. LPS can activate multiple signaling pathways including PI 3-K/Akt, ERK1/2, and p38 MAPK in fibroblasts, macrophages, and neutrophils (4, 20, 21, 31, 32, 33, 38, 48, 50). To determine whether HMGB1 activates similar pathways in neutrophils, we cultured human neutrophils with HMGB1 and directly examined the extent of activation of Akt, ERK1/2, and p38 MAPK. As shown in Fig. 3, HMGB1 increased the activation of p38 MAPK by approximately fourfold in neutrophils and had lesser effects on Akt and ERK1/2.


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 3.   HMGB1 activates downstream signaling pathways involving Akt, ERK1/2, and p38 MAPK in human neutrophils. Neutrophils (5 × 106/ml) were incubated for 1 h with or without the protein kinase inhibitors SB-202190 (30 µM), U0126 (10 µM), or LY-294002 (100 µM) before exposure to HMGB1 (1 µg/ml) for 60 min. Activity of Akt (A), ERK1/2 (B), and p38 MAPK (C) was determined after immunoprecipitation from cell lysates using in vitro kinase assays. Quantification of the intensity of specific bands was performed using densitometry (ChemiDoc system). Each panel is representative of 3 separate experiments.

To determine the importance of HMGB1 induced activation of pathways involving p38 MAPK, PI 3-K, or ERK1/2, we examined proinflammatory cytokine expression in neutrophils stimulated with HMGB1 in the presence of specific inhibitors of each of these kinase pathways. Preincubation of neutrophils with a specific inhibitor of p38 (SB-202190), effectively decreased HMGB1-induced activation of p38 (Fig. 3). Similarly, addition of inhibitors of PI 3-K (LY-294002) and MEK1/2 (U0126) prevented the minimal activation of Akt and ERK1/2 produced by exposure of neutrophils to HMGB1.

Inhibition of p38, MEK1/2, or PI 3-K reduced HMGB1-induced increases in IL-1beta , TNF-alpha , and IL-8 gene expression (Fig. 4, A-C). Of note, inhibition of p38 MAPK had a greater effect on HMGB1-induced cytokine expression than did blockade of MEK1/2 or PI 3-K, suggesting a relatively greater role for p38 MAPK in HMGB1-initiated inflammatory processes.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4.   Effects of inhibition of p38 MAPK, ERK1/2, or phosphatidylinositol 3-kinase (PI 3-K) on HMGB1-induced expression of IL-1beta (A), TNF-alpha (B), and IL-8 (C). Neutrophils (5 × 106/ml) were incubated with or without the protein kinase inhibitors SB-202190 (30 µM), U0126 (10 µM), or LY-294002 (100 µM) for 1 h before exposure to HMGB1 (1 µg/ml) for 60 min. Total RNA was then isolated and processed for real-time RT-PCR. Values represent means ± SE from 3 separate experiments. Dagger P < 0.001 vs. control.

HMGB1 increases nuclear translocation of NF-kappa B in human neutrophils. Stimulation of neutrophils with LPS increases nuclear translocation of NF-kappa B and NF-kappa B-dependent gene expression (26, 28, 44, 49). Figure 5A shows that HMGB1 also leads to increased nuclear translocation of NF-kappa B in human neutrophils. In these experiments, specificity of NF-kappa B binding was confirmed by demonstrating that inclusion of 200-fold molar excess of unlabeled competitor probe prevented the appearance of the specific NF-kappa B band. In contrast, no competition was observed with a NF-kappa B mutant oligonucleotide. In supershift experiments, addition of antisera to p50 decreased the intensity of the NF-kappa B band, whereas with antisera specific for the p65 subunit of NF-kappa B, generation of a slow-migrating protein-DNA complex was observed, showing that the kappa B binding proteins induced by HMGB1 included the heterodimeric p65-containing NF-kappa B complex. Amounts of p65 protein were also increased in the nucleus of neutrophils after exposure to HMGB1 (Fig. 5B).


View larger version (53K):
[in this window]
[in a new window]
 
Fig. 5.   A: HMGB1 induces NF-kappa B translocation into the nucleus of neutrophils. B: p65 NF-kappa B levels increase in the nucleus of neutrophils after HMGB1 exposure. Nuclear extracts were obtained from neutrophils (5 × 106/ml) stimulated with HMGB1 (1 µg/ml) for 1 h. WT and MT represent oligonucleotides of wild-type and mutant NF-kappa B sequences, respectively. Western blotting with an anti-p65 antibody was used to determine the level of p65 protein in the nucleus after HMGB1 stimulation (1 µg/ml) (B). The blots are representative of 3 separate experiments.

Effects of protein kinase inhibitors on HMGB1-induced NF-kappa B translocation. The p38 MAPK, ERK1/2, and PI 3-K pathways have all been shown to be involved in cytokine-or LPS-induced nuclear translocation of NF-kappa B (20, 21, 31, 32, 33, 38, 50). To examine whether HMGB1-induced NF-kappa B activation also involves p38, ERK1/2, or PI 3-K signal transduction pathways, we used specific kinase inhibitors (Fig. 6). Inhibition of signaling pathways involving p38 or ERK1/2, but not Akt, prevented HMGB1-induced nuclear translocation of NF-kappa B. Blockade of p38 MAPK had greater effects on NF-kappa B activation than did inhibition of ERK1/2. These results are consistent with those shown in Fig. 4, where inhibition of p38 had greater effects on HMGB1-induced expression of cytokines whose transcription is dependent on NF-kappa B than did blockade of ERK1/2 or Akt activation.


View larger version (62K):
[in this window]
[in a new window]
 
Fig. 6.   Inhibition of kinase pathways involving p38 MAPK, ERK1/2, or PI 3-K prevents HMGB1-induced NF-kappa B activation in human neutrophils. Neutrophils were incubated for 1 h in the presence or absence of the protein kinase inhibitors SB-202190 (30 µM), U0126 (10 µM), and LY-294002 (100 µM) before exposure to HMGB1 (1 µg/ml) for 60 min. Nuclear extracts were then prepared and used in EMSA. The blot (top) is representative of 3 separate experiments. Values for relative density (bottom) are means ± SE. ***P < 0.001 vs. control. dagger dagger P < 0.01 vs. HMGB1. #P < 0.05 vs. HMGB1.

HMGB1 induces p38 MAPK activity in a time-dependent manner. Exposure of neutrophils to LPS results in activation of p38 MAPK (31-33). As shown in Fig. 2, p38 MAPK activity was increased approximately fourfold in HMGB1-stimulated neutrophils. To determine whether HMGB1 induced a pattern of p38 activation in neutrophils that was similar to that seen after LPS stimulation, we performed kinetic experiments in HMGB1- and LPS-stimulated neutrophils (Fig. 7A). Increased activity of p38 MAPK was found at early (0-5 min) and later (30-60 min) time points after exposure of neutrophils to HMGB1. In contrast, p38 MAPK was activated only at the later time points (30 and 60 min) in LPS-stimulated neutrophils, similar to previously published data (31, 32). Only minimal alterations in levels of phosphorylated Akt and p44/42 MAPK were present at the time points examined after exposure to HMGB1 (Fig. 7B).


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 7.   A: kinetics of p38 MAPK activation by HMGB1 or LPS. Neutrophils (5 × 106/ml) were incubated with HMGB1 (1 µg/ml) or LPS (100 ng/ml) for the indicated times. After immunoprecipitation of p38 MAPK from neutrophil lysates, kinase activity (a, HMGB1; b, LPS) was determined in an in vitro assay by using ATF-2 as a substrate and anti-phosphorylated ATF-2 antibodies. OD, optical density. B: activation of Akt and p44/42 MAPK by HMGB1. Levels of phosphorylated (p) and total (t) kinases were determined by Western blot by using antibodies to phosphorylated and total Akt and p44/42 MAPK antibodies. Quantification from Aa and Ab was performed using densitometry (ChemiDoc System, Bio-Rad, Hercules, CA). The blots in B are representative of 3 separate experiments.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

HMGB1 is released in delayed manner from activated macrophages and monocytes in response to stimulation by LPS, but like other proinflammatory cytokines, HMGB1 itself induces the production of proinflammatory cytokines from macrophages (3). Although HMGB1 has been detected in human neutrophils (36), and high levels of HMGB1 occur in association with neutrophil-mediated diseases (1, 41), the role of HMGB1 in mediating neutrophil responses has not been previously described. In the present studies, we show that HMGB1 increases nuclear translocation of NF-kappa B as well as the expression of proinflammatory cytokines among human neutrophils. We also demonstrate that p38 MAPK, Akt, and ERK1/2 are involved in HMGB1-induced neutrophil activation.

In response to LPS, neutrophils demonstrate nuclear accumulation of NF-kappa B/Rel proteins, increased nuclear NF-kappa B binding activity, and enhanced expression of mRNA transcripts encoding NF-kappa B-dependent cytokines and chemokines, such as IL-1beta , TNF-alpha , and IL-8 (28, 36, 44, 49). Signaling pathways involving p38 MAPK, ERK1/2, and PI 3-K are activated in neutrophils cultured with LPS and contribute to enhanced nuclear translocation of NF-kappa B in this setting (20, 21, 31, 32, 33, 38, 50). Similar findings were found in the present studies when human neutrophils were cultured with HMGB1, suggesting that parallel mechanisms of cellular activation are induced by HMGB1 and LPS. However, differences in the kinetics of cytokine expression and kinase activation were apparent between LPS and HMGB1. For example, peak levels of TNF-alpha mRNA were present 60 min after stimulation with HMGB1 but occurred after 240 min with LPS. Similarly, activation of p38 occurred within 5 min with HMGB1 but was first seen only 30 min after culture with LPS. Additionally, gene array studies, although showing similarities in the patterns of gene expression by neutrophils cultured with HMGB1 or LPS, also demonstrated differences between the two stimuli, indicating that distinct mechanisms of neutrophil activation were initiated by HMGB1 or LPS.

The receptor for advanced glycation end products (RAGE), a multiligand member of the immunoglobulin superfamily of cell surface molecules, interacts with HMGB1 and triggers activation of key cell signaling pathways (37). Binding of HMGB1 to RAGE leads to neurite outgrowth and enhanced expression of tissue-type plasminogen activator by macrophages (16, 17, 34). In these cell populations, engagement of RAGE leads to activation of NF-kappa B through a redox-dependent pathway involving Ras (23). In addition, RAGE ligation has been shown to activate ERK1/2, p38, and SAPK/JNK kinases (17, 23, 47), as well as the small GTPases, Rac and cdc42 (17). In addition to being present on neurites and macrophages, RAGE also exists on monocytes as well as glioma, endothelial, and smooth muscle cells (11, 16, 17, 34, 37). Although RAGE has not been directly demonstrated to be present on neutrophils, the fact that synthetic human S100A12, a member of the s100/calgranulin family and a ligand for RAGE, is chemotactic for neutrophils suggests that such receptors are functional, exist on neutrophils, and are likely to interact with HMGB1 (15, 35). It is plausible that signaling through RAGE by HMGB1 can contribute to the responses observed here, but these results do not exclude the possible contribution of other receptors.

The present studies show that HMGB1 potently activates p38 and, to a lesser extent, ERK1/2 and PI 3-K in neutrophils. These kinases appear to be involved in enhancing nuclear translocation of NF-kappa B as well as in the expression of proinflammatory cytokines in HMGB1-stimulated neutrophils. As noted above, ligation of RAGE has previously been shown to result in activation of p38 and NF-kappa B in C6 rat glioma cells (37). In C6 cells, HMGB1-induced activation of NF-kappa B also was shown to be dependent on Ras, implying a role for downstream kinases, including ERK1/2, in this process. However, in neuroblastoma cells stably transfected with full-length RAGE, PI 3-K did not appear to be involved in HMGB1-induced neurite outgrowth (17), consistent with the minimal role found for the PI 3-K/Akt pathway in the present experiments.

In our studies, incubation of neutrophils with HMGB1 resulted in a fourfold increase in the activation of p38, a substantially greater increase than what was found for PI 3-K or ERK1/2. Consistent with this effect, inhibition of p38 resulted in a more profound decrease of NF-kappa B activation and expression of proinflammatory cytokines than did blockade of MEK1/2 or PI 3-K. An important role for p38 in modulating HMGB1-induced neutrophil responses is not surprising given the importance of the p38 MAPK cascade in regulating many neutrophil responses to proinflammatory stimuli, such as LPS and cytokines. Inhibition of p38 produces significant decreases among neutrophils in adhesion (33), chemotaxis (51), oxidative burst (43), synthesis of TNF-alpha and IL-8 (33, 46), secretion of secondary and tertiary granules (29), and activation of NF-kappa B (33). In addition to being directly involved in nuclear translocation of NF-kappa B (33), p38 may also enhance NF-kappa B transactivation by phosphorylating TATA-binding protein in the NF-kappa B-associated transcriptional apparatus (8). Although engagement of toll-like receptor 4 (TLR4) receptors by LPS activates p38 (46), our present results show that culture of neutrophils with HMGB1 also leads to p38 activation. This does not necessarily imply a role for TLR4 in mediating the effects of HMGB1 on neutrophil function, since ligation of RAGE by HMGB1 has been demonstrated to lead to p38 activation (37). Whether overlap exists between downstream events initiated by TLR4 and RAGE ligation, or even if cooperation between TLR4 and RAGE is involved in HMGB1 signaling, is unknown at present but is a focus of ongoing investigation.

In previous studies (1), we demonstrated that HMGB1 could initiate acute neutrophil-dependent inflammatory responses in vivo. However, it was not clear from those experiments whether HMGB1 could directly stimulate neutrophils or whether intermediate cell populations, such as macrophages, were necessary. The present studies show that HMGB1 itself can activate neutrophils to produce proinflammatory mediators, such as IL-1beta , IL-8, and TNF-alpha , that are known to have important roles in inflammation and related diseases. Because HMGB1 is released with delayed kinetics, often over a period of several hours, after exposure of cells to LPS and proinflammatory stimuli, such as TNF-alpha , it may be capable of potentiating inflammatory processes, such as sepsis or acute lung injury, that are initiated by these stimuli under in vivo conditions (3, 41). Similarly, while HMGB1 itself is an attractive therapeutic target for inflammatory conditions, the present results also suggest that therapies directed at inhibition of intracellular signaling pathways, such as p38, may also be able to attenuate the proinflammatory effects of HMGB1.


    ACKNOWLEDGEMENTS

This work was supported in part by National Heart, Lung, and Blood Institute Grants HL-62221 and 1-P01-HL-068743 (to E. Abraham).


    FOOTNOTES

Address for reprint requests and other correspondence: E. Abraham, Division of Pulmonary Sciences and Critical Care Medicine, Univ. of Colorado Health Sciences Center, Box C272, 4200 E. Ninth Ave., Denver, CO 80262 (E-mail: edward.abraham{at}uchsc.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

10.1152/ajpcell.00322.2002

Received 11 July 2002; accepted in final form 22 November 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Abraham, E, Arcaroli J, Carmody A, Wang H, and Tracey KJ. HMG-1 as a mediator of acute lung inflammation. J Immunol 165: 2950-2954, 2000[Abstract/Free Full Text].

2.   Abraham, E, Carmody A, Shenkar R, and Arcaroli J. Neutrophils as early immunologic effectors in hemorrhage- or endotoxemia-induced acute lung injury. Am J Physiol Lung Cell Mol Physiol 279: L1137-L1145, 2000[Abstract/Free Full Text].

3.   Andersson, U, Wang H, Palmblad K, Aveberger A, Bloom O, Erlandsson-Harris H, Janson A, Kokkola R, Zhang M, Yang H, and Tracey KJ. High mobility group 1 protein (HMG-1) stimulates proinflammatory cytokine synthesis in human monocytes. J Exp Med 192: 565-570, 2000[Abstract/Free Full Text].

4.   Arcaroli, J, Yum HK, Kupfner J, Park JS, Yang KY, and Abraham E. Role of p38 MAP kinase in the development of acute lung injury. Clin Immunol 101: 211-219, 2001[Web of Science][Medline].

5.   Bandeira-Melo, C, Phoofolo M, and Weller PF. Extranuclear lipid bodies, elicited by CCR3-mediated signaling pathways, are the sites of chemokine-enhanced leukotriene C4 production in eosinophils and basophils. J Biol Chem 276: 22779-22787, 2001[Abstract/Free Full Text].

6.   Bustin, M. Revised nomenclature for high mobility group (HMG) chromosomal proteins. Trends Biochem Sci 26: 152-153, 2001[Web of Science][Medline].

7.   Calogero, S, Grassi F, Aguzzi A, Voigtländer T, Ferrier P, Ferrari S, and Bianchi ME. The lack of chromosomal protein HMG1 does not disrupt cell growth, but causes lethal hypoglycaemia in newborn mice. Nat Genet 22: 276-280, 1999[Web of Science][Medline].

8.   Carter, AB, Knudtson KL, Monick MM, and Hunninghake GW. The p38 mitogen-activated protein kinase is required for NF-kappa B-dependent gene expression. The role of TATA-binding protein (TBP). J Biol Chem 274: 30858-30863, 1999[Abstract/Free Full Text].

9.   Conrad, PW, Conforti L, Kobayashi S, Beitner-Johnson D, Rust RT, Yuan Y, Kim HW, Kim RH, Seta K, and Millhorn DE. The molecular basis of O2 sensing and hypoxia tolerance in pheochromocytoma cells. Comp Biochem Physiol B Biochem Mol Biol 128: 187-204, 2001[Medline].

10.   Crespo, P, Xu N, Simonds WF, and Gutkind JS. Ras-dependent activation of MAP kinase pathway mediated by G-protein beta gamma subunits. Nature 369: 418-420, 1994[Medline].

11.   Degryse, B, Bonaldi T, Scaffidi P, Müller S, Resnati M, Sanvito F, Arrigoni G, and Bianchi ME. The High Mobility Group Boxes of the nuclear protein HMG1 induce chemotaxis and cytoskeleton reorganization in rat smooth muscle cells. J Cell Biol 152: 1197-2006, 2001[Abstract/Free Full Text].

12.   De Zutter, GS, and Davis RJ. Pro-apoptotic gene expression mediated by the p38 mitogen-activated protein kinase signal transduction pathway. Proc Natl Acad Sci USA 98: 6168-6173, 2001[Abstract/Free Full Text].

13.   Golub, TR, Slonim DK, Tamayo P, Huard C, Gaasenbeek M, Mesirov JP, Coller H, Loh ML, Downing JR, Caligiuri MA, Bloomfield CD, and Lander ES. Molecular classification of cancer: class discovery and class prediction by gene expression monitoring. Science 286: 531-537, 1999[Abstract/Free Full Text].

14.   Haslett, C, Guthrie LA, Kopaniak MM, Johnston RB, Jr, and Henson PM. Modulation of multiple neutrophil functions by preparative methods or trace concentrations of bacterial lipopolysaccharide. Am J Pathol 119: 101-110, 1985[Abstract].

15.   Hofmann, MA, Drury S, Fu C, Qu W, Taguchi A, Lu Y, Avila C, Kambham N, Bierhaus A, Nawroth P, Neurath MF, Slattery T, Beach D, McClary J, Nagashima M, Morser J, Stern DM, and Schmidt AM. RAGE mediates a novel proinflammatory axis: a central cell surface receptor for S100/calgranulin polypeptides. Cell 97: 889-901, 1999[Web of Science][Medline].

16.   Hori, O, Brett J, Slattery T, Cao R, Zhang J, Chen JX, Nagashima M, Lundh ER, Vijay S, Nitecki D, Morser J, Stern D, and Schmidt AM. The receptor for advanced glycation end products (RAGE) is a cellular binding site for amphoterin. J Biol Chem 270: 25752-25761, 1995[Abstract/Free Full Text].

17.   Huttunen, H, Fages C, and Rauvala H. Receptor for advanced glycation end products (RAGE)-mediated neutrite outgrowth and activation of NF-kappa B require the cytoplasmic domain of the receptor but different downstream signaling pathways. J Biol Chem 274: 19919-19924, 1999[Abstract/Free Full Text].

18.   Jones, A, Fujiyama C, Blanche C, Moore JW, Fuggle S, Cranston D, Bicknell R, and Harris AL. Relation of vascular endothelial growth factor production to expression and regulation of hypoxia-inducible factor-1alpha and hypoxia-inducible factor-2alpha in human bladder tumors and cell lines. Clin Cancer Res 7: 1263-1272, 2001[Abstract/Free Full Text].

19.   Kampen, GT, Stafford S, Adachi T, Jinquan T, Quan S, Grant JA, Skov PS, Poulsen LK, and Alam R. Eotaxin induces degranulation and chemotaxis of eosinophils through the activation of ERK2 and p38 mitogen-activated protein kinases. Blood 95: 1911-1917, 2000[Abstract/Free Full Text].

20.   Klein, JB, Buridi A, Coxon PY, Rane MJ, Manning T, Kettritz R, and McLeish KR. Role of extracellular signal-regulated kinase and phosphatidylinositol-3 kinase in chemoattractant and LPS delay of constitutive neutrophil apoptosis. Cell Signal 13: 335-343, 2001[Web of Science][Medline].

21.   Klein, JB, Rane MJ, Scherzer JA, Coxon PY, Kettritz R, Mathiesen JM, Buridi A, and McLeish KR. Granulocyte-macrophage colony-stimulating factor delays neutrophil constitutive apoptosis through phosphoinositide 3-kinase and extracellular signal-regulated kinase pathways. J Immunol 164: 4286-4291, 2000[Abstract/Free Full Text].

22.   Lakics, V, Medvedev AE, Okada S, and Vogel SN. Inhibition of LPS-induced cytokines by Bcl-xL in a murine macrophage cell line. J Immunol 165: 2729-2737, 2000[Abstract/Free Full Text].

23.   Lander, HL, Tauras JM, Ogiste JS, Moss RA, and Schmidt AM. Activation of the receptor for advanced glycation end products triggers a p21ras-dependent mitogen-activated protein kinase pathway regulated by oxidant stress. J Biol Chem 272: 17810-17814, 1997[Abstract/Free Full Text].

24.   Liu, Y, Honda S, Kohsaka S, and Nakajima K. Plasminogen enhances the secretion of plasminogen activator inhibitor-1 from cultured rat astrocytes. Neurosci Lett 282: 137-140, 2000[Web of Science][Medline].

25.   Lockhart, DJ, Dong H, Byrne MC, Follettie MT, Gallo MV, Chee MS, Mittmann M, Wang C, Kobayashi M, Horton H, and Brown EL. Expression monitoring by hybridization to high-density oligonucleotide arrays. Nat Biotechnol 14: 1675-1680, 1996[Web of Science][Medline].

26.   Lord, PC, Wilmoth LM, Mizel SB, and McCall CE. Expression of interleukin-1 alpha and beta genes by human blood polymorphonuclear leukocytes. J Clin Invest 87: 1312-1321, 1991[Web of Science][Medline].

27.   Martin, TR, Rubenfeld GD, Ruzinski JT, Goodman RB, Steinberg KP, Leturcq DJ, Moriarty AM, Raghu G, Baughman RP, and Hudson LD. Relationship between soluble CD14, lipopolysaccharide binding protein, and the alveolar inflammatory response in patients with acute respiratory distress syndrome. Am J Respir Crit Care Med 155: 937-944, 1997[Abstract].

28.   McDonald, PP, Bald A, and Cassatella MA. Activation of the NF-kappa B pathway by inflammatory stimuli in human neutrophils. Blood 89: 3421-3433, 1997[Abstract/Free Full Text].

29.   Mocsai, A, Jakus Z, Vantus T, Berton G, Lowell CA, and Ligeti E. Kinase pathways in chemoattractant-induced degranulation of neutrophils: the role of p38 mitogen-activated protein kinase activated by Src family kinases. J Immunol 164: 4321-4331, 2000[Abstract/Free Full Text].

30.   Murga, C, Laguinge L, Wetzker R, Cuadrado A, and Gutkind JS. Activation of Akt/protein kinase B by G protein-coupled receptors. A role for alpha  and beta gamma subunits of heterotrimeric G proteins acting through phosphatidylinositol-3-OH kinase gamma . J Biol Chem 273: 19080-19085, 1998[Abstract/Free Full Text].

31.   Nahas, N, Molski TF, Fernandez GA, and Sha'afi RI. Tyrosine phosphorylation and activation of a new mitogen-activated protein (MAP)-kinase cascade in human neutrophils stimulated with various agonists. Biochem J 15: 247-253, 1996.

32.   Nick, JA, Avdi NJ, Gerwins P, Johnson GL, and Worthen GS. Activation of a p38 mitogen-activated protein kinase in human neutrophils by lipopolysaccharide. J Immunol 156: 4867-4875, 1996[Abstract].

33.   Nick, JA, Avdi NJ, Young SK, Lehman LA, McDonald PP, Frasch SC, Billstrom MA, Henson PM, Johnson GL, and Worthen GS. Selective activation and functional significance of p38alpha mitogen-activated protein kinase lipopolysaccharide-stimulated neutrophils. J Clin Invest 103: 851-858, 1999[Web of Science][Medline].

34.   Parkkinen, J, Raulo E, Merenmies J, Nolo R, Kajander EO, Baumann M, and Rauvala H. Amphoterin, the 30-kDa protein in a family of HMG1-type polypeptides. Enhanced expression in transformed cells, leading edge localization and interactions with plasminogen activation. J Biol Chem 268: 19726-19738, 1993[Abstract/Free Full Text].

35.   Schmidt, AM, Yan SD, Yan SF, and Stern DM. The multiligand receptor RAGE as a progression factor amplifying immune and inflammatory responses. J Clin Invest 108: 949-955, 2001[Web of Science][Medline].

36.   Sobajima, J, Ozaki S, Osakada F, Uesugi H, Shirakawa H, Yoshida M, and Nakao K. Novel autoantigens of perinuclear anti-neutrophil cytoplasmic antibodies (P-ANCA) in ulcerative colitis: non-histone chromosomal proteins, HMG1 and HMG2. Clin Exp Immunol 107: 135-140, 1997[Web of Science][Medline].

37.   Taguchi, A, Blood DC, del Toro G, Canet A, Lee DC, Qu W, Tanji N, Lu Y, Lalla E, Fu C, Hofmann MA, Kislinger T, Ingram M, Lu A, Tanaka H, Hori O, Ogawa S, Stern DM, and Schmidt AM. Blockage of RAGE-amphoterin signalling suppresses tumour growth and metastasis. Nature 405: 354-360, 2000[Medline].

38.   Tilton, B, Andjelkovic M, Didichenko SA, Hemmings BA, and Thelen M. G-Protein-coupled receptors and Fc gamma -receptors mediate activation of Akt/protein kinase B in human phagocytes. J Biol Chem 272: 8096-8101, 1997.

39.   Tilton, B, Ho L, Oberlin E, Loetscher P, Baleux F, Clark-Lewis I, and Thelen M. Signal transduction by CXC chemokine receptor 4 stromal cell-derived factor 1 stimulates prolonged protein kinase B and extracellular signal-regulated kinase 2 activation in T lymphocytes. J Exp Med 192: 313-324, 2000[Abstract/Free Full Text].

40.   Wang, C, Deng L, Hong M, Akkaraju GR, Inoue J, and Chen ZJ. TAK1 is a ubiquitin-dependent kinase of MKK and IKK. Nature 412: 346-351, 2001[Medline].

41.   Wang, H, Bloom O, Zhang M, Vishnubhakat JM, Ombrellino M, Che J, Frazier A, Yang H, Ivanova S, Borovikova L, Manogue KR, Faist E, Abraham E, Andersson J, Andersson U, Molina PE, Abumrad NN, Sama A, and Tracey KJ. HMG-1 as a late mediator of endotoxin lethality in mice. Science 285: 248-251, 1999[Abstract/Free Full Text].

42.   Wang, LS, Liu HJ, Broxmeyer HE, and Lu L. Interleukin-11 enhancement of VLA-5 mediated adhesion of CD34+ cells from cord blood to fibronectin is associated with the PI-3 kinase pathway. In Vivo 14: 331-337, 2000[Web of Science][Medline].

43.   Ward, RA, Nakamura M, and McLeish KR. Priming of the neutrophil respiratory burst involves p38 mitogen-activated protein kinase-dependent exocytosis of flavocytochrome b558-containing granules. J Biol Chem 275: 367130-36719, 2000.

44.   Weinstein, SL, Sanghera JS, Lemke K, DeFranco AL, and Pelech SL. Bacterial lipopolysaccharide induces tyrosine phosphorylation and activation of mitogen-activated protein kinases in macrophages. J Biol Chem 267: 14955-14962, 1992[Abstract/Free Full Text].

45.   Yamauchi, J, Kawano T, Nagao M, Kaziro Y, and Itoh H. Gi-dependent activation of c-Jun N-terminal kinase in human embryonal kidney 293 cells. J Biol Chem 275: 7633-7640, 2000[Abstract/Free Full Text].

46.   Yang, H, Young DW, Gusovsky F, and Chow JC. Cellular events mediated by lipopolysaccharide-stimulated toll-like receptor 4. MD-2 is required for activation of mitogen-activated protein kinases and Elk-1. J Biol Chem 275: 20861-20866, 2000[Abstract/Free Full Text].

47.   Yeh, CH, Sturgis L, Haidacher J, Zhang XN, Sherwood SJ, Bjercke RJ, Juhasz O, Crow MT, Tilton RG, and Denner L. Requirement for p38 and p44/p42 mitogen-activated protein kinases in RAGE-mediated nuclear factor-kappa B transcriptional activation and cytokine secretion. Diabetes 50: 1495-1504, 2001[Abstract/Free Full Text].

48.   Yoshinari, D, Takeyoshi I, Koibuchi Y, Matsumoto K, Kawashima Y, Koyama T, Ohwada S, and Morishita Y. Effects of a dual inhibitor of tumor necrosis factor-alpha and interleukin-1 on lipopolysaccharide-induced lung injury in rats: involvement of the p38 mitogen-activated protein kinase pathway. Crit Care Med 29: 628-634, 2001[Web of Science][Medline].

49.   Yoza, BK, Hu J, and McCall CE. Protein-tyrosine kinase activation is required for lipopolysaccharide induction of interleukin 1beta and NF-kappa B activation, but not NF-kappa B nuclear translocation. J Biol Chem 271: 18306-18309, 1996[Abstract/Free Full Text].

50.   Yum, HK, Arcaroli J, Kupfner J, Shenkar R, Penninger JM, Sasaki T, Yang KY, Park JS, and Abraham E. Involvement of PI3-K in neutrophil activation and the development of acute lung injury. J Immunol 167: 6601-6608, 2001[Abstract/Free Full Text].

51.   Zu, YL, Qi J, Gilchrist A, Fernandez GA, Vazquez-Abad D, Kreutzer DL, Huan CK, and Sha'afi RI. p38 mitogen-activated protein kinase activation is required for human neutrophil function triggered by TNF-alpha or FMLP stimulation. J Immunol 160: 1982-1989, 1998[Abstract/Free Full Text].


Am J Physiol Cell Physiol 284(4):C870-C879
0363-6143/03 $5.00 Copyright © 2003 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Respir. Cell Mol. Bio.Home page
D. Tang, R. Kang, W. Xiao, H. Zhang, M. T. Lotze, H. Wang, and X. Xiao
Quercetin Prevents LPS-Induced High-Mobility Group Box 1 Release and Proinflammatory Function
Am. J. Respir. Cell Mol. Biol., December 1, 2009; 41(6): 651 - 660.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
H. S. Hreggvidsdottir, T. Ostberg, H. Wahamaa, H. Schierbeck, A.-C. Aveberger, L. Klevenvall, K. Palmblad, L. Ottosson, U. Andersson, and H. E. Harris
The alarmin HMGB1 acts in synergy with endogenous and exogenous danger signals to promote inflammation
J. Leukoc. Biol., September 1, 2009; 86(3): 655 - 662.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
T. Murakami, T. Obata, K. Kuwahara-Arai, H. Tamura, K. Hiramatsu, and I. Nagaoka
Antimicrobial cathelicidin polypeptide CAP11 suppresses the production and release of septic mediators in D-galactosamine-sensitized endotoxin shock mice
Int. Immunol., August 1, 2009; 21(8): 905 - 912.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
T. Watanabe, H. Keino, Y. Sato, A. Kudo, H. Kawakami, and A. A. Okada
High Mobility Group Box Protein-1 in Experimental Autoimmune Uveoretinitis
Invest. Ophthalmol. Vis. Sci., May 1, 2009; 50(5): 2283 - 2290.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. E. Gazzar, B. K. Yoza, X. Chen, B. A. Garcia, N. L. Young, and C. E. McCall
Chromatin-Specific Remodeling by HMGB1 and Linker Histone H1 Silences Proinflammatory Genes during Endotoxin Tolerance
Mol. Cell. Biol., April 1, 2009; 29(7): 1959 - 1971.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. B. Coffelt and A. B. Scandurro
Tumors Sound the Alarmin(s)
Cancer Res., August 15, 2008; 68(16): 6482 - 6485.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
H. Zhang, S. Tasaka, Y. Shiraishi, K. Fukunaga, W. Yamada, H. Seki, Y. Ogawa, K. Miyamoto, Y. Nakano, N. Hasegawa, et al.
Role of Soluble Receptor for Advanced Glycation End Products on Endotoxin-induced Lung Injury
Am. J. Respir. Crit. Care Med., August 15, 2008; 178(4): 356 - 362.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
A. Zicari, C. Centonze, M. Realacci, B. Buchetti, A. Pietropolli, and C. Ticconi
Estradiol 17-{beta} and Progesterone Modulate Inducible Nitric Oxide Synthase and High Mobility Group Box 1 Expression in Human Endometrium
Reproductive Sciences, July 1, 2008; 15(6): 559 - 566.
[Abstract] [PDF]


Home page
J. Leukoc. Biol.Home page
J. R. Klune, T. R. Billiar, and A. Tsung
HMGB1 preconditioning: therapeutic application for a danger signal?
J. Leukoc. Biol., March 1, 2008; 83(3): 558 - 563.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Tang, R. Kang, W. Xiao, H. Wang, S. K. Calderwood, and X. Xiao
The Anti-inflammatory Effects of Heat Shock Protein 72 Involve Inhibition of High-Mobility-Group Box 1 Release and Proinflammatory Function in Macrophages
J. Immunol., July 15, 2007; 179(2): 1236 - 1244.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
D. S. Pisetsky
The Role of Nuclear Macromolecules in Innate Immunity
Proceedings of the ATS, July 1, 2007; 4(3): 258 - 262.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. E. Ellerman, C. K. Brown, M. de Vera, H. J. Zeh, T. Billiar, A. Rubartelli, and M. T. Lotze
Masquerader: High Mobility Group Box-1 and Cancer
Clin. Cancer Res., May 15, 2007; 13(10): 2836 - 2848.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
D. Yang, Q. Chen, H. Yang, K. J. Tracey, M. Bustin, and J. J. Oppenheim
High mobility group box-1 protein induces the migration and activation of human dendritic cells and acts as an alarmin
J. Leukoc. Biol., January 1, 2007; 81(1): 59 - 66.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
E. N. Ogawa, A. Ishizaka, S. Tasaka, H. Koh, H. Ueno, F. Amaya, M. Ebina, S. Yamada, Y. Funakoshi, J. Soejima, et al.
Contribution of High-Mobility Group Box-1 to the Development of Ventilator-induced Lung Injury
Am. J. Respir. Crit. Care Med., August 15, 2006; 174(4): 400 - 407.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
M. P. Gruber, C. D. Coldren, M. D. Woolum, G. P. Cosgrove, C. Zeng, A. E. Baron, M. D. Moore, C. D. Cool, G. S. Worthen, K. K. Brown, et al.
Human Lung Project: Evaluating Variance of Gene Expression in the Human Lung
Am. J. Respir. Cell Mol. Biol., July 1, 2006; 35(1): 65 - 71.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
J.-B. Kim, J. Sig Choi, Y.-M. Yu, K. Nam, C.-S. Piao, S.-W. Kim, M.-H. Lee, P.-L. Han, J.-s. Park, and J.-K. Lee
HMGB1, a novel cytokine-like mediator linking acute neuronal death and delayed neuroinflammation in the postischemic brain.
J. Neurosci., June 14, 2006; 26(24): 6413 - 6421.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. S. Park, F. Gamboni-Robertson, Q. He, D. Svetkauskaite, J.-Y. Kim, D. Strassheim, J.-W. Sohn, S. Yamada, I. Maruyama, A. Banerjee, et al.
High mobility group box 1 protein interacts with multiple Toll-like receptors
Am J Physiol Cell Physiol, March 1, 2006; 290(3): C917 - C924.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S.-H. Kwak, S. Mitra, K. Bdeir, D. Strassheim, J. S. Park, J. Y. Kim, S. Idell, D. Cines, and E. Abraham
The kringle domain of urokinase-type plasminogen activator potentiates LPS-induced neutrophil activation through interaction with {alpha}V{beta}3 integrins
J. Leukoc. Biol., October 1, 2005; 78(4): 937 - 945.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
H. Yang, H. Wang, C. J. Czura, and K. J. Tracey
The cytokine activity of HMGB1
J. Leukoc. Biol., July 1, 2005; 78(1): 1 - 8.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. Y. Kim, J. S. Park, D. Strassheim, I. Douglas, F. Diaz del Valle, K. Asehnoune, S. Mitra, S. H. Kwak, S. Yamada, I. Maruyama, et al.
HMGB1 contributes to the development of acute lung injury after hemorrhage
Am J Physiol Lung Cell Mol Physiol, May 1, 2005; 288(5): L958 - L965.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
A. Tsung, R. Sahai, H. Tanaka, A. Nakao, M. P. Fink, M. T. Lotze, H. Yang, J. Li, K. J. Tracey, D. A. Geller, et al.
The nuclear factor HMGB1 mediates hepatic injury after murine liver ischemia-reperfusion
J. Exp. Med., April 4, 2005; 201(7): 1135 - 1143.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
G. Chen, J. Li, M. Ochani, B. Rendon-Mitchell, X. Qiang, S. Susarla, L. Ulloa, H. Yang, S. Fan, S. M. Goyert, et al.
Bacterial endotoxin stimulates macrophages to release HMGB1 partly through CD14- and TNF-dependent mechanisms
J. Leukoc. Biol., November 1, 2004; 76(5): 994 - 1001.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. S. Park, D. Svetkauskaite, Q. He, J.-Y. Kim, D. Strassheim, A. Ishizaka, and E. Abraham
Involvement of Toll-like Receptors 2 and 4 in Cellular Activation by High Mobility Group Box 1 Protein
J. Biol. Chem., February 27, 2004; 279(9): 7370 - 7377.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (68)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Park, J. S.
Right arrow Articles by Abraham, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Park, J. S.
Right arrow Articles by Abraham, E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online