|
|
||||||||
1 Division of Pulmonary Sciences and Critical Care Medicine, University of Colorado Health Sciences Center, Denver, Colorado 80262; and 2 Laboratory of Biomedical Science, North Shore University Hospital, New York University School of Medicine, Manhasset, New York 11030
| |
ABSTRACT |
|---|
|
|
|---|
High
mobility group box 1 (HMGB1) protein, a DNA binding protein that
stabilizes nucleosomes and facilitates transcription, was recently
identified as a late mediator of endotoxin lethality. High serum HMGB1
levels in patients with sepsis are associated with increased mortality,
and administration of HMGB1 produces acute inflammation in animal
models of lung injury and endotoxemia. Neutrophils occupy a critical
role in mediating the development of endotoxemia-associated acute lung
injury, but previously it was not known whether HMGB1 could influence
neutrophil activation. In the present experiments, we demonstrate that
HMGB1 increases the nuclear translocation of NF-
B and enhances the
expression of proinflammatory cytokines in human neutrophils. These
proinflammatory effects of HMGB1 in neutrophils appear to involve the
p38 MAPK, phosphatidylinositol 3-kinase/Akt, and ERK1/2 pathways. The
mechanisms of HMGB1-induced neutrophil activation are distinct from
endotoxin-induced signals, because HMGB1 leads to a different profile
of gene expression, pattern of cytokine expression, and kinetics of p38
activation compared with LPS. These findings indicate that HMGB1 is an
effective stimulus of neutrophil activation that can contribute to
development of a proinflammatory phenotype in diseases characterized by
excessively high levels of HMGB1.
p38 mitogen-activated protein kinase; phosphatidylinositol
3-kinase; Akt; extracellular signal regulated kinase 1/2; nuclear
factor-
B; inflammation
| |
INTRODUCTION |
|---|
|
|
|---|
ACTIVATED NEUTROPHILS produce cytokines, chemokines, and other proinflammatory mediators that participate in the development of acute inflammation. For instance, neutrophils are activated during endotoxin-induced shock, sepsis, and acute lung injury (2, 4, 27, 48). Bacterial products and cytokines can initiate acute inflammatory responses in neutrophils, and these pathways have been implicated in the development of tissue injury (2). Recent data implicated high mobility group box (HMGB) chromosomal proteins as cytokine-like mediators of delayed endotoxin lethality and acute lung injury (1, 3, 41).
There are three HMGB chromosomal proteins: HMGB1 (previously
HMG1), HMGB2 (previously HMG2), and HMGB3 (previously HMG4 or HMG2). HMGBs are composed of three different domains, including homologous DNA binding boxes A and B and the COOH-terminal domain (6). HMGB1 appears to have two distinct functions in
cellular systems. First, it has been shown to have an intracellular
role as a regulator of transcription (7) and, second, an
extracellular role in which it promotes tumor metastasis
(37) and inflammation (41).
Monocytes/macrophages stimulated by lipopolysaccharide (LPS), tumor
necrosis factor (TNF)-
, or interleukin (IL)-1 secrete HMGB1
(41). Addition of HMGB1 to monocytes in culture induces the release of TNF-
, IL-1
, IL-1
, IL-1Ra, IL-6, IL-8,
macrophage inflammatory protein (MIP)-1
, and MIP-1
, but not IL-10
or IL-12 (3). Intratracheal administration of HMGB1
produces acute lung injury, and antibodies against HMGB1 decrease
LPS-induced lung edema and neutrophil accumulation (1).
Anti-HMGB1 antibodies did not significantly reduce the levels of the
proinflammatory cytokines TNF-
, IL-1
, or MIP-2 in LPS-induced
acute lung injury, suggesting that HMGB1 occupies a more distal
position in endotoxin-induced proinflammatory cascades
(41). High serum HMGB1 levels accumulate in patients with
sepsis, and significantly higher levels were found in lethal cases
compared with survivors (41).
Although HMGB1 has been shown to activate macrophages and other
cell populations, the signaling pathways involved have not been
previously investigated. Here we establish that HMGB1 is an effective
stimulus to neutrophil activation, primarily through the p38 MAPK
pathway, leading to nuclear translocation of NF-
B and enhanced
expression of proinflammatory cytokines.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Reagents. RPMI 1640 was obtained from Life Technologies (Gaithersburg, MD). Fetal bovine serum (FBS) and penicillin/streptomycin were purchased from Gemini Bioproducts (Calabasas, CA). LPS (from Escherichia coli O111:B4) was obtained from Sigma Chemical (St. Louis, MO). Poly(dI-dC) · poly(dI-dC) and Percoll were purchased from Amersham-Pharmacia (Piscataway, NJ). The Coomassie-Plus protein assay reagent and BCA protein assay reagent were purchased from Pierce (Rockford, IL). SB-202190, U0126, and LY-294002 were purchased from Calbiochem (La Jolla, CA). Antibodies for phospho (Ser276)-Akt, total Akt, phospho (Thr202/Tyr204)-p44/42, and total p44/42 MAPK were purchased from Cell Signaling Technology (Beverly, MA). Akt kinase assay kit, p44/42 MAPK assay kit, and p38 MAPK assay kit were purchased from Cell Signaling Technology (Beverly, MA). Recombinant HMGB1 (rHMGB1) was prepared as described previously (3, 41).
Isolation and culture of human neutrophils. Peripheral blood was obtained from healthy volunteers under a protocol approved by the University of Colorado Health Sciences Center Institutional Review Board. Neutrophils (purity >99.0%) were isolated by plasma-Percoll gradients after dextran sedimentation of erythrocytes (14). Neutrophils were resuspended in RPMI 1640 at a final concentration of 5 × 106 cells/ml and stimulated with 0-1,000 ng/ml rHMGB1 or 100 ng/ml LPS. The p38 MAPK inhibitor SB-202190 (30 µM), the MEK1/2 inhibitor U0126 (10 µM), or the phosphatidylinositol 3-kinase (PI 3-K) inhibitor LY-294002 (100 µM) was added to the neutrophil cultures for 1 h before HMGB1 or LPS stimulation. Neutrophil viability as assessed by trypan blue staining was consistently >95% after 1 h in control or LPS-stimulated cultures as well as under conditions where LY-294002 or U0126 was added to the cells for 1 h. The concentrations of kinase inhibitors have previously been used by ourselves and others (8, 32, 33, 50, 51). Specificity of these concentrations of inhibitors was verified by demonstrating that LY-294002 did not affect LPS-induced activation of SAPK/JNK or MEK1/2 and that U0126 did not alter LPS-associated SAPK/JNK activation in neutrophils. Cultures were supplemented with polymyxin B (10 µg/ml) to block any effects of contaminating endotoxin.
Gene array analysis. RNA was isolated from neutrophils using an RNeasy kit according to the manufacturer's protocol (Qiagen, Valencia, CA). Total RNA (20 µg) was converted to double-stranded cDNA (ds-cDNA) using the Superscript Choice System (Life Technologies). An oligo-dT primer containing a T7 RNA polymerase promoter (Genset, Kents Store, VA) was utilized. After second-strand synthesis, the reaction mixture was extracted with phenol-chloroform-isoamyl alcohol, and the ds-cDNA was recovered by ethanol precipitation. In vitro transcription was performed to generate biotin-labeled cRNA using a RNA transcript labeling kit (Enzo, Farmingdale, NY), and 3.3 µl of ds-cDNA template were transcribed in the presence of a mixture of biotin-labeled ribonucleotides. Biotin-labeled cRNA was purified using an RNeasy affinity column. To ensure optimal hybridization to the oligonucleotide array, we performed fragmentation of cRNA such that the fragments were between 35 and 200 bases in length by incubating the cRNA at 94°C for 35 min in fragmentation buffer. The sample was then added to a hybridization solution containing 100 mM MES, 1 M NaCl, and 20 mM EDTA in the presence of 0.01% Tween 20. The final concentration of the fragmented cRNA was 0.05 µg/µl. Hybridization was performed by incubating 200 µl of the sample. The sample was loaded on a test chip to determine the quality of mRNA by using known housekeeping genes. After passing the test chip, samples were loaded on Affymetrix GeneChip Human Genome U95Av2 (12,626 genes) chips (Affymetrix, Santa Clara, CA). Hybridization occurred at 45°C for 16 h using GeneChip Hybridization Oven 640 (Affymetrix). After hybridization, the hybridization solutions were removed, and the arrays were washed and stained with streptavidin-phycoerythrin using a GeneChipFluidics Station 400 (Affymetrix). Arrays were read at a resolution of 6 µm using an HP Gene Array Scanner (Affymetrix). Detailed protocols for data analysis of Affymetrix microarrays and extensive documentation of the sensitivity and quantitative aspects of the method have been described previously (13, 25).
Real-time quantitative RT-PCR.
Total cellular RNA was isolated from human neutrophils using Trizol
reagent (Life Technologies), as recommended by the manufacturer. Real-time RT-PCR was performed with specific primers and probes corresponding to the proinflammatory cytokine genes IL-1
, IL-8, and
TNF-
. For each mRNA detection, a fluorogenic probe and two primers
for PCR (forward and reverse) were synthesized (Perkin-Elmer Life
Sciences). The internal oligonucleotide probe was labeled with the
fluorescent dyes carboxyfluorescein (FAM) at the 5'-end and
N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA) at the
3'-end. For human IL-1
mRNA detection, the forward and reverse
primers were 5'-343CACGATGCACCTGTACGATCA363-3'
and
5'-410AGACATCACCAAGCTTTTTTGCT388-3',
respectively. The internal probe was
5'-(FAM)-365TGAACTGCACGCTCCGGGACTCA386-(TAMRA)-3'.
The forward and reverse primers for human IL-8 were 5'-13CTGGCCGTGGCTCTCTTG31-3' and
5'-82CCTTGGCAAAACTGCACCTT63-3', respectively.
The internal probe was
5'-(FAM)-33CAGCCTTCCTGATTTCTGCAGCTCTGTGT61-(TAMRA)-3'.
For human TNF-
mRNA detection, the forward and reverse primers were
5'-251TCTTCTCGAACCCCGAGTGA272-3' and
5'-320GGAGCTGCCCCTCAGCTT303-3',
respectively. The internal probe was
5'-(FAM)-273AGCCTGTAGCCCATGTTGTAGCAAACCCT301- (TAMRA)-3'.
To optimize the primer sets, we performed a primer optimization
experiment as described in the manufacturer's protocol. Based on
primer optimization, the primer and probe concentrations for IL-1
,
IL-8, and TNF-
consisted of 100 nM of both primers and 200 nM for
the probe, used in each reaction with 100 ng of total cellular RNA. In
each experiment, ribosomal RNA control probe, forward primer, and
reverse primer (Perkin-Elmer) at concentrations of 50 nM were used to
normalize for the amount of RNA in each sample.
Preparation of Bcl-xL and monoamine oxidase B probes.
A 280-bp human monoamine oxidase B cDNA fragment was amplified by
RT-PCR using the following primers: sense, 5'-GTGGGAGGCAGGACTTACAC-3'; and antisense, 5'-TCACTCGGAATCTCTCGCCC-3'. A 350-bp of human
Bcl-xL cDNA fragment was amplified by RT-PCR using the
following primers: sense, 5'-ATGGCAACCCATCCTGGCAC-3'; and antisense,
5'-AGCTGCGATCCGACTCACCA-3'. For human
-actin, the following primers
were used: sense, 5'-TCATGAAGTGTGACGTTGACATCCGT-3'; and antisense,
5'-CTTAGAAGCATTTGCGCTGCACGATG-3', resulting in a 285-bp band.
-actin were performed as follows:
denaturation at 95°C for 30 s, annealing at 57°C for 45 s, and extension at 72°C for 1 min. The final extension was carried
out for 8 min. The PCR products were characterized using 1% agarose
gel electrophoresis.
Electrophoretic mobility shift assays.
To obtain nuclear extracts from neutrophils, we suspended cells in
lysis buffer containing 10 mM Tris · HCl (pH
7.5), 1.5 mM MgCl2, 10 mM KCl, 0.5 mM DTT, 0.5 mM PMSF, 0.1 mM Na3VO4, and 0.1% Triton X-100, and the
samples were incubated on ice for 20 min. After cytoplasm was removed
from the nuclei by 15 passages through a 25-gauge needle, the nuclei
were collected by centrifugation at 5,000 g for 10 min at
4°C. The pellets were suspended in extraction buffer containing 20 mM
Tris · HCl (pH 7.5), 1.5 mM MgCl2,
420 mM NaCl, 0.2 mM EDTA, 0.1% Triton X-100, 25% glycerol, 0.5 mM EDTA, 0.5 mM PMSF, and 0.1 mM Na3VO4. After a
30-min incubation on ice, the suspension was centrifuged at 14,000 g for 20 min at 4°C and the supernatants were collected.
The protein concentration in the supernatants was determined using
Coomassie Plus protein assay reagent (Pierce). Nuclear extracts (5 µg) were incubated at room temperature for 15 min in 20 µl of
reaction buffer containing 10 mM Tris · HCl (pH
7.5), 1 mM MgCl2, 0.5 mM EDTA, 0.5 mM DTT, 50 mM NaCl, and
4% glycerol with 32P end-labeled, double-stranded
oligonucleotide probe specific for the
B site,
5'-GCCATGGGGGGATCCCCG AAG TCC-3' (Geneka Biotechnology) and
1 µg of poly(dI-dC) · poly(dI-dC). In some
experiments, unlabeled NF-
B or mutant NF-
B oligonucleotide (Santa
Cruz Biotechnology, Santa Cruz, CA) was added to the samples at
200-fold excess before the addition of labeled probe. For supershift
studies, 1 µl of anti-p65 was added to the DNA-binding reaction just
before the 5-min incubation. The complexes were resolved on 5%
polyacrylamide gels in Tris · HCl (pH
8.0)-borate-EDTA buffer at 10 V/cm. Dried gels were exposed with Kodak
Biomax MS film (Rochester, NY) for 1-24 h at
70°C.
p38 MAPK, Akt, and ERK1/2 immunoprecipitation and kinase assays.
After culture of neutrophils from the same donor with or without
protein kinase inhibitors and HMGB1, neutrophils were placed in a lysis
buffer containing 20 mM Tris · HCl (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 2.5 mM sodium
pyrophosphate, 1 mM
-glycerol phosphate, 1 mM
Na3VO4, and 1 µg/ml leupeptin. The lysate was
sonicated four times for 5 s at 4°C and centrifuged at 15,000 g for 10 min at 4°C, and the supernatant was transferred to a fresh tube. The amount of protein was measured using the Micro BCA
protein assay reagent kit (Pierce), and 200 µg of lysate were
incubated with a 1:50 dilution of immobilized Akt, p38, or p42/44 MAPK
protein A-conjugated antibodies overnight with gentle rocking at 4°C.
The mixture was centrifuged at 15,000 g for 30 s at
4°C, and the pellet was washed twice with fresh lysis buffer, followed by two washes with kinase buffer containing 25 mM
Tris · HCl (pH 7.5), 5 mM
-glycerol phosphate,
2 mM DTT, 0.1 mM Na3VO4, and 10 mM
MgCl2. The pellet was resuspended in kinase buffer
supplemented with 200 mM ATP and 2 µg of ATF-2 fusion protein for the
p38 MAPK assay, 1 µg of GSK-3 fusion protein for the Akt assay, or
Elk-1 fusion protein for the ERK1/2 assay as a substrate. The mixture was then incubated for 30 min at 30°C. The reaction was terminated with the addition of Laemmli sample buffer and boiled for 5 min. The
proteins were separated by gel electrophoresis, transferred to
nitrocellulose, and probed with antibodies to phospho-ATF-2 (Thr71), phospho-GSK-3
/
, or phospho-Elk-1
(Ser383). Additionally, we confirmed that the same amount
of protein was immunoprecipitated from each sample by establishing that
similar amounts of
-actin were present for each condition. Specific
bands were visualized by an enhanced chemiluminescence detection system with subsequent exposure to X-ray film. Quantification was performed by
image analysis using densitometry (ChemiDoc system; Bio-Rad, Hercules, CA).
Statistical analysis. The data are shown as means ± SE and represent information from three separate experiments. Statistical significance was determined by analysis of variance after the normality of the data was verified, followed by the Tukey-Kramer multiple comparisons test. A P value <0.05 was considered significant.
| |
RESULTS |
|---|
|
|
|---|
HMGB1 and LPS induce distinct patterns of gene expression in
neutrophils.
The hierarchical clustering method was used to identify gene expression
patterns in neutrophils stimulated by either HMGB1 or LPS for 1 h,
and the results were compared with patterns obtained from experiments
using unstimulated neutrophils. As shown in Fig. 1, a total of 470 genes showed at least
twofold increase in expression among neutrophils cultured with either
HMGB1 or LPS. Of these 470 genes, the expression of 95 genes was
increased by both LPS and HMGB1. The expression of 140 genes was
upregulated at least twofold by HMGB1 but not LPS, whereas the
expression of 235 genes was increased by LPS but not HMGB1 (Fig.
1A).
|
|
Effects of HMGB1 on proinflammatory cytokine and chemokine
expression in human neutrophils.
To determine the molecular basis for HMGB1-mediated neutrophil
activation, we examined mRNA levels of IL-1
, IL-8, and TNF-
in
neutrophils cultured with LPS or HMGB1. In the gene array experiments shown in Fig. 1, the expression of IL-1
and IL-8 was increased approximately twofold by LPS and HMGB1, and the expression of TNF-
was increased sevenfold by LPS and fivefold by HMGB1. Real-time RT-PCR
analysis revealed induction of IL-1
, IL-8, and TNF-
mRNA as early
as 30 min after addition of HMGB1 to the cells. Cytokine gene
expression was HMGB1 concentration dependent (Fig. 2,
A-C). Maximum expression
levels of IL-1
and TNF-
were found in neutrophils 60 min after
exposure to HMGB1 (Fig. 2, A and B), whereas
maximum levels of IL-8 mRNA were present 30 min after culture with
HMGB1. LPS stimulation of neutrophils produced alterations in the
magnitude and timing of IL-8 and IL-1
mRNA expression that were
similar to those observed after exposure to HMGB1 (Fig. 2, A
and C), whereas expression of TNF-
mRNA in neutrophils
appeared to reach maximal levels at later time points after culture
with LPS compared with HMGB1 (Fig. 2B).
|
HMGB1 induced kinase activation in human neutrophils.
LPS can activate multiple signaling pathways including PI 3-K/Akt,
ERK1/2, and p38 MAPK in fibroblasts, macrophages, and neutrophils (4, 20, 21, 31, 32, 33, 38, 48, 50). To determine whether
HMGB1 activates similar pathways in neutrophils, we cultured human
neutrophils with HMGB1 and directly examined the extent of activation
of Akt, ERK1/2, and p38 MAPK. As shown in Fig.
3, HMGB1 increased the activation of p38
MAPK by approximately fourfold in neutrophils and had lesser effects on
Akt and ERK1/2.
|
, TNF-
, and IL-8 gene expression (Fig. 4,
A-C). Of note, inhibition
of p38 MAPK had a greater effect on HMGB1-induced cytokine expression
than did blockade of MEK1/2 or PI 3-K, suggesting a relatively greater
role for p38 MAPK in HMGB1-initiated inflammatory processes.
|
HMGB1 increases nuclear translocation of NF-
B in human
neutrophils.
Stimulation of neutrophils with LPS increases nuclear translocation of
NF-
B and NF-
B-dependent gene expression (26, 28, 44,
49). Figure 5A shows
that HMGB1 also leads to increased nuclear translocation of NF-
B in
human neutrophils. In these experiments, specificity of NF-
B binding
was confirmed by demonstrating that inclusion of 200-fold molar excess
of unlabeled competitor probe prevented the appearance of the specific
NF-
B band. In contrast, no competition was observed with a NF-
B
mutant oligonucleotide. In supershift experiments, addition of antisera
to p50 decreased the intensity of the NF-
B band, whereas with
antisera specific for the p65 subunit of NF-
B, generation of a
slow-migrating protein-DNA complex was observed, showing that the
B binding proteins induced by HMGB1 included the heterodimeric
p65-containing NF-
B complex. Amounts of p65 protein were also
increased in the nucleus of neutrophils after exposure to HMGB1 (Fig.
5B).
|
Effects of protein kinase inhibitors on HMGB1-induced NF-
B
translocation.
The p38 MAPK, ERK1/2, and PI 3-K pathways have all been shown to be
involved in cytokine-or LPS-induced nuclear translocation of NF-
B
(20, 21, 31, 32, 33, 38, 50). To examine whether
HMGB1-induced NF-
B activation also involves p38, ERK1/2, or PI 3-K
signal transduction pathways, we used specific kinase inhibitors (Fig.
6). Inhibition of signaling pathways
involving p38 or ERK1/2, but not Akt, prevented HMGB1-induced nuclear
translocation of NF-
B. Blockade of p38 MAPK had greater effects on
NF-
B activation than did inhibition of ERK1/2. These results are
consistent with those shown in Fig. 4, where inhibition of p38 had
greater effects on HMGB1-induced expression of cytokines whose
transcription is dependent on NF-
B than did blockade of ERK1/2 or
Akt activation.
|
HMGB1 induces p38 MAPK activity in a time-dependent manner.
Exposure of neutrophils to LPS results in activation of p38 MAPK
(31-33). As shown in Fig. 2, p38 MAPK activity was
increased approximately fourfold in HMGB1-stimulated neutrophils. To
determine whether HMGB1 induced a pattern of p38 activation in
neutrophils that was similar to that seen after LPS stimulation, we
performed kinetic experiments in HMGB1- and LPS-stimulated neutrophils
(Fig. 7A). Increased activity
of p38 MAPK was found at early (0-5 min) and later (30-60
min) time points after exposure of neutrophils to HMGB1. In contrast,
p38 MAPK was activated only at the later time points (30 and 60 min) in
LPS-stimulated neutrophils, similar to previously published data
(31, 32). Only minimal alterations in levels of
phosphorylated Akt and p44/42 MAPK were present at the time points
examined after exposure to HMGB1 (Fig. 7B).
|
| |
DISCUSSION |
|---|
|
|
|---|
HMGB1 is released in delayed manner from activated macrophages and
monocytes in response to stimulation by LPS, but like other proinflammatory cytokines, HMGB1 itself induces the production of
proinflammatory cytokines from macrophages (3). Although HMGB1 has been detected in human neutrophils (36), and
high levels of HMGB1 occur in association with neutrophil-mediated diseases (1, 41), the role of HMGB1 in mediating
neutrophil responses has not been previously described. In the present
studies, we show that HMGB1 increases nuclear translocation of NF-
B
as well as the expression of proinflammatory cytokines among human neutrophils. We also demonstrate that p38 MAPK, Akt, and ERK1/2 are
involved in HMGB1-induced neutrophil activation.
In response to LPS, neutrophils demonstrate nuclear accumulation of
NF-
B/Rel proteins, increased nuclear NF-
B binding activity, and
enhanced expression of mRNA transcripts encoding NF-
B-dependent cytokines and chemokines, such as IL-1
, TNF-
, and IL-8 (28, 36, 44, 49). Signaling pathways involving p38 MAPK, ERK1/2, and
PI 3-K are activated in neutrophils cultured with LPS and contribute to
enhanced nuclear translocation of NF-
B in this setting (20,
21, 31, 32, 33, 38, 50). Similar findings were found in the
present studies when human neutrophils were cultured with HMGB1,
suggesting that parallel mechanisms of cellular activation are induced
by HMGB1 and LPS. However, differences in the kinetics of cytokine
expression and kinase activation were apparent between LPS and HMGB1.
For example, peak levels of TNF-
mRNA were present 60 min after
stimulation with HMGB1 but occurred after 240 min with LPS. Similarly,
activation of p38 occurred within 5 min with HMGB1 but was first seen
only 30 min after culture with LPS. Additionally, gene array studies,
although showing similarities in the patterns of gene expression by
neutrophils cultured with HMGB1 or LPS, also demonstrated differences
between the two stimuli, indicating that distinct mechanisms of
neutrophil activation were initiated by HMGB1 or LPS.
The receptor for advanced glycation end products (RAGE), a multiligand
member of the immunoglobulin superfamily of cell surface molecules,
interacts with HMGB1 and triggers activation of key cell signaling
pathways (37). Binding of HMGB1 to RAGE leads to neurite
outgrowth and enhanced expression of tissue-type plasminogen activator
by macrophages (16, 17, 34). In these cell populations, engagement of RAGE leads to activation of NF-
B through a
redox-dependent pathway involving Ras (23). In addition,
RAGE ligation has been shown to activate ERK1/2, p38, and SAPK/JNK
kinases (17, 23, 47), as well as the small GTPases, Rac
and cdc42 (17). In addition to being present on neurites
and macrophages, RAGE also exists on monocytes as well as glioma,
endothelial, and smooth muscle cells (11, 16, 17, 34, 37).
Although RAGE has not been directly demonstrated to be present on
neutrophils, the fact that synthetic human S100A12, a member of the
s100/calgranulin family and a ligand for RAGE, is chemotactic for
neutrophils suggests that such receptors are functional, exist on
neutrophils, and are likely to interact with HMGB1 (15,
35). It is plausible that signaling through RAGE by HMGB1 can
contribute to the responses observed here, but these results do not
exclude the possible contribution of other receptors.
The present studies show that HMGB1 potently activates p38 and, to a
lesser extent, ERK1/2 and PI 3-K in neutrophils. These kinases appear
to be involved in enhancing nuclear translocation of NF-
B as well as
in the expression of proinflammatory cytokines in HMGB1-stimulated
neutrophils. As noted above, ligation of RAGE has previously been shown
to result in activation of p38 and NF-
B in C6 rat glioma cells
(37). In C6 cells, HMGB1-induced activation of NF-
B
also was shown to be dependent on Ras, implying a role for downstream
kinases, including ERK1/2, in this process. However, in neuroblastoma
cells stably transfected with full-length RAGE, PI 3-K did not appear
to be involved in HMGB1-induced neurite outgrowth (17),
consistent with the minimal role found for the PI 3-K/Akt pathway in
the present experiments.
In our studies, incubation of neutrophils with HMGB1 resulted in a
fourfold increase in the activation of p38, a substantially greater
increase than what was found for PI 3-K or ERK1/2. Consistent with this
effect, inhibition of p38 resulted in a more profound decrease of
NF-
B activation and expression of proinflammatory cytokines than did
blockade of MEK1/2 or PI 3-K. An important role for p38 in modulating
HMGB1-induced neutrophil responses is not surprising given the
importance of the p38 MAPK cascade in regulating many neutrophil
responses to proinflammatory stimuli, such as LPS and cytokines.
Inhibition of p38 produces significant decreases among neutrophils in
adhesion (33), chemotaxis (51), oxidative
burst (43), synthesis of TNF-
and IL-8 (33,
46), secretion of secondary and tertiary granules
(29), and activation of NF-
B (33). In
addition to being directly involved in nuclear translocation of NF-
B
(33), p38 may also enhance NF-
B transactivation by
phosphorylating TATA-binding protein in the NF-
B-associated transcriptional apparatus (8). Although engagement
of toll-like receptor 4 (TLR4) receptors by LPS activates p38
(46), our present results show that culture of neutrophils
with HMGB1 also leads to p38 activation. This does not necessarily
imply a role for TLR4 in mediating the effects of HMGB1 on neutrophil
function, since ligation of RAGE by HMGB1 has been demonstrated to lead to p38 activation (37). Whether overlap exists between
downstream events initiated by TLR4 and RAGE ligation, or even if
cooperation between TLR4 and RAGE is involved in HMGB1 signaling, is
unknown at present but is a focus of ongoing investigation.
In previous studies (1), we demonstrated that HMGB1 could
initiate acute neutrophil-dependent inflammatory responses in vivo.
However, it was not clear from those experiments whether HMGB1 could
directly stimulate neutrophils or whether intermediate cell
populations, such as macrophages, were necessary. The present studies
show that HMGB1 itself can activate neutrophils to produce proinflammatory mediators, such as IL-1
, IL-8, and TNF-
, that are
known to have important roles in inflammation and related diseases.
Because HMGB1 is released with delayed kinetics, often over a period of
several hours, after exposure of cells to LPS and proinflammatory
stimuli, such as TNF-
, it may be capable of potentiating
inflammatory processes, such as sepsis or acute lung injury, that are
initiated by these stimuli under in vivo conditions (3,
41). Similarly, while HMGB1 itself is an attractive therapeutic
target for inflammatory conditions, the present results also suggest
that therapies directed at inhibition of intracellular signaling
pathways, such as p38, may also be able to attenuate the
proinflammatory effects of HMGB1.
| |
ACKNOWLEDGEMENTS |
|---|
This work was supported in part by National Heart, Lung, and Blood Institute Grants HL-62221 and 1-P01-HL-068743 (to E. Abraham).
| |
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: E. Abraham, Division of Pulmonary Sciences and Critical Care Medicine, Univ. of Colorado Health Sciences Center, Box C272, 4200 E. Ninth Ave., Denver, CO 80262 (E-mail: edward.abraham{at}uchsc.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
10.1152/ajpcell.00322.2002
Received 11 July 2002; accepted in final form 22 November 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Abraham, E,
Arcaroli J,
Carmody A,
Wang H,
and
Tracey KJ.
HMG-1 as a mediator of acute lung inflammation.
J Immunol
165:
2950-2954,
2000
2.
Abraham, E,
Carmody A,
Shenkar R,
and
Arcaroli J.
Neutrophils as early immunologic effectors in hemorrhage- or endotoxemia-induced acute lung injury.
Am J Physiol Lung Cell Mol Physiol
279:
L1137-L1145,
2000
3.
Andersson, U,
Wang H,
Palmblad K,
Aveberger A,
Bloom O,
Erlandsson-Harris H,
Janson A,
Kokkola R,
Zhang M,
Yang H,
and
Tracey KJ.
High mobility group 1 protein (HMG-1) stimulates proinflammatory cytokine synthesis in human monocytes.
J Exp Med
192:
565-570,
2000
4.
Arcaroli, J,
Yum HK,
Kupfner J,
Park JS,
Yang KY,
and
Abraham E.
Role of p38 MAP kinase in the development of acute lung injury.
Clin Immunol
101:
211-219,
2001[Web of Science][Medline].
5.
Bandeira-Melo, C,
Phoofolo M,
and
Weller PF.
Extranuclear lipid bodies, elicited by CCR3-mediated signaling pathways, are the sites of chemokine-enhanced leukotriene C4 production in eosinophils and basophils.
J Biol Chem
276:
22779-22787,
2001
6.
Bustin, M.
Revised nomenclature for high mobility group (HMG) chromosomal proteins.
Trends Biochem Sci
26:
152-153,
2001[Web of Science][Medline].
7.
Calogero, S,
Grassi F,
Aguzzi A,
Voigtländer T,
Ferrier P,
Ferrari S,
and
Bianchi ME.
The lack of chromosomal protein HMG1 does not disrupt cell growth, but causes lethal hypoglycaemia in newborn mice.
Nat Genet
22:
276-280,
1999[Web of Science][Medline].
8.
Carter, AB,
Knudtson KL,
Monick MM,
and
Hunninghake GW.
The p38 mitogen-activated protein kinase is required for NF-
B-dependent gene expression. The role of TATA-binding protein (TBP).
J Biol Chem
274:
30858-30863,
1999
9.
Conrad, PW,
Conforti L,
Kobayashi S,
Beitner-Johnson D,
Rust RT,
Yuan Y,
Kim HW,
Kim RH,
Seta K,
and
Millhorn DE.
The molecular basis of O2 sensing and hypoxia tolerance in pheochromocytoma cells.
Comp Biochem Physiol B Biochem Mol Biol
128:
187-204,
2001[Medline].
10.
Crespo, P,
Xu N,
Simonds WF,
and
Gutkind JS.
Ras-dependent activation of MAP kinase pathway mediated by G-protein beta gamma subunits.
Nature
369:
418-420,
1994[Medline].
11.
Degryse, B,
Bonaldi T,
Scaffidi P,
Müller S,
Resnati M,
Sanvito F,
Arrigoni G,
and
Bianchi ME.
The High Mobility Group Boxes of the nuclear protein HMG1 induce chemotaxis and cytoskeleton reorganization in rat smooth muscle cells.
J Cell Biol
152:
1197-2006,
2001
12.
De Zutter, GS,
and
Davis RJ.
Pro-apoptotic gene expression mediated by the p38 mitogen-activated protein kinase signal transduction pathway.
Proc Natl Acad Sci USA
98:
6168-6173,
2001
13.
Golub, TR,
Slonim DK,
Tamayo P,
Huard C,
Gaasenbeek M,
Mesirov JP,
Coller H,
Loh ML,
Downing JR,
Caligiuri MA,
Bloomfield CD,
and
Lander ES.
Molecular classification of cancer: class discovery and class prediction by gene expression monitoring.
Science
286:
531-537,
1999
14.
Haslett, C,
Guthrie LA,
Kopaniak MM,
Johnston RB, Jr,
and
Henson PM.
Modulation of multiple neutrophil functions by preparative methods or trace concentrations of bacterial lipopolysaccharide.
Am J Pathol
119:
101-110,
1985[Abstract].
15.
Hofmann, MA,
Drury S,
Fu C,
Qu W,
Taguchi A,
Lu Y,
Avila C,
Kambham N,
Bierhaus A,
Nawroth P,
Neurath MF,
Slattery T,
Beach D,
McClary J,
Nagashima M,
Morser J,
Stern DM,
and
Schmidt AM.
RAGE mediates a novel proinflammatory axis: a central cell surface receptor for S100/calgranulin polypeptides.
Cell
97:
889-901,
1999[Web of Science][Medline].
16.
Hori, O,
Brett J,
Slattery T,
Cao R,
Zhang J,
Chen JX,
Nagashima M,
Lundh ER,
Vijay S,
Nitecki D,
Morser J,
Stern D,
and
Schmidt AM.
The receptor for advanced glycation end products (RAGE) is a cellular binding site for amphoterin.
J Biol Chem
270:
25752-25761,
1995
17.
Huttunen, H,
Fages C,
and
Rauvala H.
Receptor for advanced glycation end products (RAGE)-mediated neutrite outgrowth and activation of NF-
B require the cytoplasmic domain of the receptor but different downstream signaling pathways.
J Biol Chem
274:
19919-19924,
1999
18.
Jones, A,
Fujiyama C,
Blanche C,
Moore JW,
Fuggle S,
Cranston D,
Bicknell R,
and
Harris AL.
Relation of vascular endothelial growth factor production to expression and regulation of hypoxia-inducible factor-1
and hypoxia-inducible factor-2
in human bladder tumors and cell lines.
Clin Cancer Res
7:
1263-1272,
2001
19.
Kampen, GT,
Stafford S,
Adachi T,
Jinquan T,
Quan S,
Grant JA,
Skov PS,
Poulsen LK,
and
Alam R.
Eotaxin induces degranulation and chemotaxis of eosinophils through the activation of ERK2 and p38 mitogen-activated protein kinases.
Blood
95:
1911-1917,
2000
20.
Klein, JB,
Buridi A,
Coxon PY,
Rane MJ,
Manning T,
Kettritz R,
and
McLeish KR.
Role of extracellular signal-regulated kinase and phosphatidylinositol-3 kinase in chemoattractant and LPS delay of constitutive neutrophil apoptosis.
Cell Signal
13:
335-343,
2001[Web of Science][Medline].
21.
Klein, JB,
Rane MJ,
Scherzer JA,
Coxon PY,
Kettritz R,
Mathiesen JM,
Buridi A,
and
McLeish KR.
Granulocyte-macrophage colony-stimulating factor delays neutrophil constitutive apoptosis through phosphoinositide 3-kinase and extracellular signal-regulated kinase pathways.
J Immunol
164:
4286-4291,
2000
22.
Lakics, V,
Medvedev AE,
Okada S,
and
Vogel SN.
Inhibition of LPS-induced cytokines by Bcl-xL in a murine macrophage cell line.
J Immunol
165:
2729-2737,
2000
23.
Lander, HL,
Tauras JM,
Ogiste JS,
Moss RA,
and
Schmidt AM.
Activation of the receptor for advanced glycation end products triggers a p21ras-dependent mitogen-activated protein kinase pathway regulated by oxidant stress.
J Biol Chem
272:
17810-17814,
1997
24.
Liu, Y,
Honda S,
Kohsaka S,
and
Nakajima K.
Plasminogen enhances the secretion of plasminogen activator inhibitor-1 from cultured rat astrocytes.
Neurosci Lett
282:
137-140,
2000[Web of Science][Medline].
25.
Lockhart, DJ,
Dong H,
Byrne MC,
Follettie MT,
Gallo MV,
Chee MS,
Mittmann M,
Wang C,
Kobayashi M,
Horton H,
and
Brown EL.
Expression monitoring by hybridization to high-density oligonucleotide arrays.
Nat Biotechnol
14:
1675-1680,
1996[Web of Science][Medline].
26.
Lord, PC,
Wilmoth LM,
Mizel SB,
and
McCall CE.
Expression of interleukin-1 alpha and beta genes by human blood polymorphonuclear leukocytes.
J Clin Invest
87:
1312-1321,
1991[Web of Science][Medline].
27.
Martin, TR,
Rubenfeld GD,
Ruzinski JT,
Goodman RB,
Steinberg KP,
Leturcq DJ,
Moriarty AM,
Raghu G,
Baughman RP,
and
Hudson LD.
Relationship between soluble CD14, lipopolysaccharide binding protein, and the alveolar inflammatory response in patients with acute respiratory distress syndrome.
Am J Respir Crit Care Med
155:
937-944,
1997[Abstract].
28.
McDonald, PP,
Bald A,
and
Cassatella MA.
Activation of the NF-
B pathway by inflammatory stimuli in human neutrophils.
Blood
89:
3421-3433,
1997
29.
Mocsai, A,
Jakus Z,
Vantus T,
Berton G,
Lowell CA,
and
Ligeti E.
Kinase pathways in chemoattractant-induced degranulation of neutrophils: the role of p38 mitogen-activated protein kinase activated by Src family kinases.
J Immunol
164:
4321-4331,
2000
30.
Murga, C,
Laguinge L,
Wetzker R,
Cuadrado A,
and
Gutkind JS.
Activation of Akt/protein kinase B by G protein-coupled receptors. A role for
and 
subunits of heterotrimeric G proteins acting through phosphatidylinositol-3-OH kinase
.
J Biol Chem
273:
19080-19085,
1998
31.
Nahas, N,
Molski TF,
Fernandez GA,
and
Sha'afi RI.
Tyrosine phosphorylation and activation of a new mitogen-activated protein (MAP)-kinase cascade in human neutrophils stimulated with various agonists.
Biochem J
15:
247-253,
1996.
32.
Nick, JA,
Avdi NJ,
Gerwins P,
Johnson GL,
and
Worthen GS.
Activation of a p38 mitogen-activated protein kinase in human neutrophils by lipopolysaccharide.
J Immunol
156:
4867-4875,
1996[Abstract].
33.
Nick, JA,
Avdi NJ,
Young SK,
Lehman LA,
McDonald PP,
Frasch SC,
Billstrom MA,
Henson PM,
Johnson GL,
and
Worthen GS.
Selective activation and functional significance of p38
mitogen-activated protein kinase lipopolysaccharide-stimulated neutrophils.
J Clin Invest
103:
851-858,
1999[Web of Science][Medline].
34.
Parkkinen, J,
Raulo E,
Merenmies J,
Nolo R,
Kajander EO,
Baumann M,
and
Rauvala H.
Amphoterin, the 30-kDa protein in a family of HMG1-type polypeptides. Enhanced expression in transformed cells, leading edge localization and interactions with plasminogen activation.
J Biol Chem
268:
19726-19738,
1993
35.
Schmidt, AM,
Yan SD,
Yan SF,
and
Stern DM.
The multiligand receptor RAGE as a progression factor amplifying immune and inflammatory responses.
J Clin Invest
108:
949-955,
2001[Web of Science][Medline].
36.
Sobajima, J,
Ozaki S,
Osakada F,
Uesugi H,
Shirakawa H,
Yoshida M,
and
Nakao K.
Novel autoantigens of perinuclear anti-neutrophil cytoplasmic antibodies (P-ANCA) in ulcerative colitis: non-histone chromosomal proteins, HMG1 and HMG2.
Clin Exp Immunol
107:
135-140,
1997[Web of Science][Medline].
37.
Taguchi, A,
Blood DC,
del Toro G,
Canet A,
Lee DC,
Qu W,
Tanji N,
Lu Y,
Lalla E,
Fu C,
Hofmann MA,
Kislinger T,
Ingram M,
Lu A,
Tanaka H,
Hori O,
Ogawa S,
Stern DM,
and
Schmidt AM.
Blockage of RAGE-amphoterin signalling suppresses tumour growth and metastasis.
Nature
405:
354-360,
2000[Medline].
38.
Tilton, B,
Andjelkovic M,
Didichenko SA,
Hemmings BA,
and
Thelen M.
G-Protein-coupled receptors and Fc
-receptors mediate activation of Akt/protein kinase B in human phagocytes.
J Biol Chem
272:
8096-8101,
1997.
39.
Tilton, B,
Ho L,
Oberlin E,
Loetscher P,
Baleux F,
Clark-Lewis I,
and
Thelen M.
Signal transduction by CXC chemokine receptor 4 stromal cell-derived factor 1 stimulates prolonged protein kinase B and extracellular signal-regulated kinase 2 activation in T lymphocytes.
J Exp Med
192:
313-324,
2000
40.
Wang, C,
Deng L,
Hong M,
Akkaraju GR,
Inoue J,
and
Chen ZJ.
TAK1 is a ubiquitin-dependent kinase of MKK and IKK.
Nature
412:
346-351,
2001[Medline].
41.
Wang, H,
Bloom O,
Zhang M,
Vishnubhakat JM,
Ombrellino M,
Che J,
Frazier A,
Yang H,
Ivanova S,
Borovikova L,
Manogue KR,
Faist E,
Abraham E,
Andersson J,
Andersson U,
Molina PE,
Abumrad NN,
Sama A,
and
Tracey KJ.
HMG-1 as a late mediator of endotoxin lethality in mice.
Science
285:
248-251,
1999
42.
Wang, LS,
Liu HJ,
Broxmeyer HE,
and
Lu L.
Interleukin-11 enhancement of VLA-5 mediated adhesion of CD34+ cells from cord blood to fibronectin is associated with the PI-3 kinase pathway.
In Vivo
14:
331-337,
2000[Web of Science][Medline].
43.
Ward, RA,
Nakamura M,
and
McLeish KR.
Priming of the neutrophil respiratory burst involves p38 mitogen-activated protein kinase-dependent exocytosis of flavocytochrome b558-containing granules.
J Biol Chem
275:
367130-36719,
2000.
44.
Weinstein, SL,
Sanghera JS,
Lemke K,
DeFranco AL,
and
Pelech SL.
Bacterial lipopolysaccharide induces tyrosine phosphorylation and activation of mitogen-activated protein kinases in macrophages.
J Biol Chem
267:
14955-14962,
1992
45.
Yamauchi, J,
Kawano T,
Nagao M,
Kaziro Y,
and
Itoh H.
Gi-dependent activation of c-Jun N-terminal kinase in human embryonal kidney 293 cells.
J Biol Chem
275:
7633-7640,
2000
46.
Yang, H,
Young DW,
Gusovsky F,
and
Chow JC.
Cellular events mediated by lipopolysaccharide-stimulated toll-like receptor 4. MD-2 is required for activation of mitogen-activated protein kinases and Elk-1.
J Biol Chem
275:
20861-20866,
2000
47.
Yeh, CH,
Sturgis L,
Haidacher J,
Zhang XN,
Sherwood SJ,
Bjercke RJ,
Juhasz O,
Crow MT,
Tilton RG,
and
Denner L.
Requirement for p38 and p44/p42 mitogen-activated protein kinases in RAGE-mediated nuclear factor-
B transcriptional activation and cytokine secretion.
Diabetes
50:
1495-1504,
2001
48.
Yoshinari, D,
Takeyoshi I,
Koibuchi Y,
Matsumoto K,
Kawashima Y,
Koyama T,
Ohwada S,
and
Morishita Y.
Effects of a dual inhibitor of tumor necrosis factor-
and interleukin-1 on lipopolysaccharide-induced lung injury in rats: involvement of the p38 mitogen-activated protein kinase pathway.
Crit Care Med
29:
628-634,
2001[Web of Science][Medline].
49.
Yoza, BK,
Hu J,
and
McCall CE.
Protein-tyrosine kinase activation is required for lipopolysaccharide induction of interleukin 1
and NF-
B activation, but not NF-
B nuclear translocation.
J Biol Chem
271:
18306-18309,
1996
50.
Yum, HK,
Arcaroli J,
Kupfner J,
Shenkar R,
Penninger JM,
Sasaki T,
Yang KY,
Park JS,
and
Abraham E.
Involvement of PI3-K in neutrophil activation and the development of acute lung injury.
J Immunol
167:
6601-6608,
2001
51.
Zu, YL,
Qi J,
Gilchrist A,
Fernandez GA,
Vazquez-Abad D,
Kreutzer DL,
Huan CK,
and
Sha'afi RI.
p38 mitogen-activated protein kinase activation is required for human neutrophil function triggered by TNF-alpha or FMLP stimulation.
J Immunol
160:
1982-1989,
1998
This article has been cited by other articles:
![]() |
D. Tang, R. Kang, W. Xiao, H. Zhang, M. T. Lotze, H. Wang, and X. Xiao Quercetin Prevents LPS-Induced High-Mobility Group Box 1 Release and Proinflammatory Function Am. J. Respir. Cell Mol. Biol., December 1, 2009; 41(6): 651 - 660. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. S. Hreggvidsdottir, T. Ostberg, H. Wahamaa, H. Schierbeck, A.-C. Aveberger, L. Klevenvall, K. Palmblad, L. Ottosson, U. Andersson, and H. E. Harris The alarmin HMGB1 acts in synergy with endogenous and exogenous danger signals to promote inflammation J. Leukoc. Biol., September 1, 2009; 86(3): 655 - 662. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Murakami, T. Obata, K. Kuwahara-Arai, H. Tamura, K. Hiramatsu, and I. Nagaoka Antimicrobial cathelicidin polypeptide CAP11 suppresses the production and release of septic mediators in D-galactosamine-sensitized endotoxin shock mice Int. Immunol., August 1, 2009; 21(8): 905 - 912. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Watanabe, H. Keino, Y. Sato, A. Kudo, H. Kawakami, and A. A. Okada High Mobility Group Box Protein-1 in Experimental Autoimmune Uveoretinitis Invest. Ophthalmol. Vis. Sci., May 1, 2009; 50(5): 2283 - 2290. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Gazzar, B. K. Yoza, X. Chen, B. A. Garcia, N. L. Young, and C. E. McCall Chromatin-Specific Remodeling by HMGB1 and Linker Histone H1 Silences Proinflammatory Genes during Endotoxin Tolerance Mol. Cell. Biol., April 1, 2009; 29(7): 1959 - 1971. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. B. Coffelt and A. B. Scandurro Tumors Sound the Alarmin(s) Cancer Res., August 15, 2008; 68(16): 6482 - 6485. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zhang, S. Tasaka, Y. Shiraishi, K. Fukunaga, W. Yamada, H. Seki, Y. Ogawa, K. Miyamoto, Y. Nakano, N. Hasegawa, et al. Role of Soluble Receptor for Advanced Glycation End Products on Endotoxin-induced Lung Injury Am. J. Respir. Crit. Care Med., August 15, 2008; 178(4): 356 - 362. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Zicari, C. Centonze, M. Realacci, B. Buchetti, A. Pietropolli, and C. Ticconi Estradiol 17-{beta} and Progesterone Modulate Inducible Nitric Oxide Synthase and High Mobility Group Box 1 Expression in Human Endometrium Reproductive Sciences, July 1, 2008; 15(6): 559 - 566. [Abstract] [PDF] |
||||
![]() |
J. R. Klune, T. R. Billiar, and A. Tsung HMGB1 preconditioning: therapeutic application for a danger signal? J. Leukoc. Biol., March 1, 2008; 83(3): 558 - 563. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Tang, R. Kang, W. Xiao, H. Wang, S. K. Calderwood, and X. Xiao The Anti-inflammatory Effects of Heat Shock Protein 72 Involve Inhibition of High-Mobility-Group Box 1 Release and Proinflammatory Function in Macrophages J. Immunol., July 15, 2007; 179(2): 1236 - 1244. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. Pisetsky The Role of Nuclear Macromolecules in Innate Immunity Proceedings of the ATS, July 1, 2007; 4(3): 258 - 262. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Ellerman, C. K. Brown, M. de Vera, H. J. Zeh, T. Billiar, A. Rubartelli, and M. T. Lotze Masquerader: High Mobility Group Box-1 and Cancer Clin. Cancer Res., May 15, 2007; 13(10): 2836 - 2848. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Yang, Q. Chen, H. Yang, K. J. Tracey, M. Bustin, and J. J. Oppenheim High mobility group box-1 protein induces the migration and activation of human dendritic cells and acts as an alarmin J. Leukoc. Biol., January 1, 2007; 81(1): 59 - 66. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. N. Ogawa, A. Ishizaka, S. Tasaka, H. Koh, H. Ueno, F. Amaya, M. Ebina, S. Yamada, Y. Funakoshi, J. Soejima, et al. Contribution of High-Mobility Group Box-1 to the Development of Ventilator-induced Lung Injury Am. J. Respir. Crit. Care Med., August 15, 2006; 174(4): 400 - 407. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Gruber, C. D. Coldren, M. D. Woolum, G. P. Cosgrove, C. Zeng, A. E. Baron, M. D. Moore, C. D. Cool, G. S. Worthen, K. K. Brown, et al. Human Lung Project: Evaluating Variance of Gene Expression in the Human Lung Am. J. Respir. Cell Mol. Biol., July 1, 2006; 35(1): 65 - 71. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-B. Kim, J. Sig Choi, Y.-M. Yu, K. Nam, C.-S. Piao, S.-W. Kim, M.-H. Lee, P.-L. Han, J.-s. Park, and J.-K. Lee HMGB1, a novel cytokine-like mediator linking acute neuronal death and delayed neuroinflammation in the postischemic brain. J. Neurosci., June 14, 2006; 26(24): 6413 - 6421. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Park, F. Gamboni-Robertson, Q. He, D. Svetkauskaite, J.-Y. Kim, D. Strassheim, J.-W. Sohn, S. Yamada, I. Maruyama, A. Banerjee, et al. High mobility group box 1 protein interacts with multiple Toll-like receptors Am J Physiol Cell Physiol, March 1, 2006; 290(3): C917 - C924. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. Kwak, S. Mitra, K. Bdeir, D. Strassheim, J. S. Park, J. Y. Kim, S. Idell, D. Cines, and E. Abraham The kringle domain of urokinase-type plasminogen activator potentiates LPS-induced neutrophil activation through interaction with {alpha}V{beta}3 integrins J. Leukoc. Biol., October 1, 2005; 78(4): 937 - 945. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yang, H. Wang, C. J. Czura, and K. J. Tracey The cytokine activity of HMGB1 J. Leukoc. Biol., July 1, 2005; 78(1): 1 - 8. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Y. Kim, J. S. Park, D. Strassheim, I. Douglas, F. Diaz del Valle, K. Asehnoune, S. Mitra, S. H. Kwak, S. Yamada, I. Maruyama, et al. HMGB1 contributes to the development of acute lung injury after hemorrhage Am J Physiol Lung Cell Mol Physiol, May 1, 2005; 288(5): L958 - L965. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Tsung, R. Sahai, H. Tanaka, A. Nakao, M. P. Fink, M. T. Lotze, H. Yang, J. Li, K. J. Tracey, D. A. Geller, et al. The nuclear factor HMGB1 mediates hepatic injury after murine liver ischemia-reperfusion J. Exp. Med., April 4, 2005; 201(7): 1135 - 1143. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Chen, J. Li, M. Ochani, B. Rendon-Mitchell, X. Qiang, S. Susarla, L. Ulloa, H. Yang, S. Fan, S. M. Goyert, et al. Bacterial endotoxin stimulates macrophages to release HMGB1 partly through CD14- and TNF-dependent mechanisms J. Leukoc. Biol., November 1, 2004; 76(5): 994 - 1001. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Park, D. Svetkauskaite, Q. He, J.-Y. Kim, D. Strassheim, A. Ishizaka, and E. Abraham Involvement of Toll-like Receptors 2 and 4 in Cellular Activation by High Mobility Group Box 1 Protein J. Biol. Chem., February 27, 2004; 279(9): 7370 - 7377. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |