| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
-dependent
redox-mediated iNOS expression in hepatocytes
1 Duke University Medical Center, Durham, North Carolina 27710; and 2 National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20817
 |
ABSTRACT |
|---|
 TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
Nitric oxide (NO),
endogenously synthesized by inducible NO synthase (iNOS), serves
antioxidant and antiapoptotic functions in settings characterized
by oxidative stress and proinflammatory cytokines such as sepsis and
shock. However, the redox-sensitive mechanisms regulating hepatocyte
expression of iNOS are largely unknown. In interleukin-1
(IL-1)-stimulated hepatocytes exposed to superoxide, we demonstrate
that hepatocyte nuclear factor-4
(HNF-4) acts as an activator of
redox-associated hepatocyte iNOS expression at the level of protein,
mRNA, and promoter activation. In the absence of HNF-4, this
redox-mediated enhancement is ablated. HNF-4 functional activity is
associated with a unique serine/threonine kinase-mediated
phosphorylation pattern. This suggests that a redox-sensitive kinase
pathway targets HNF-4 to augment hepatocyte iNOS expression.
Previous studies have not addressed a redox-dependent kinase signaling
pathway that targets HNF-4 and enhances hepatocyte iNOS gene
transcription. A unique pattern of phosphorylation determines HNF-4
activity as a trans-activator of IL-1-mediated hepatocyte iNOS expression in the presence of oxidative stress.
kinase; phosphorylation; nitric oxide; Cre-lox; transcription; inducible nitric oxide synthase; hepatocyte nuclear factor-4
| |
INTRODUCTION |
|---|
|
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
IN THE PRESENCE OF
OXIDATIVE STRESS, the hepatocellular redox state upregulates
inducible nitric oxide synthase (iNOS) expression as an antioxidant
function. In IL-1-treated rat hepatocytes, we have demonstrated that
iNOS gene transcription and promoter activity are increased by oxidant
stress mediated by peroxide, superoxide, or acetaminophen. (10,
23, 24, 26, 31) Subsequently, in IL-1-stimulated rat
hepatocytes exposed to superoxide, we identified a redox-sensitive DR1
cis-acting activator element (nt 
1,327 to nt 1,315) in
the iNOS promoter: AGGTCAGGGGACA. The corresponding transcription
factor was isolated by DNA affinity chromatography, sequenced, and
identified to be hepatocyte nuclear factor-4 (HNF-4) (10,
23). HNF-4 is a member of the nuclear receptor superfamily of
transcription factors and was originally identified in the regulation
of liver-specific genes.(38) Subsequently, >55 distinct
target genes involved with lipid, amino acid, and glucose metabolism,
liver differentiation, cell structure, and immune function have been
identified for HNF-4. HNF-4 is highly conserved; amino acid
identity between rat and human varies from 89.7 to 100% among the
various functional domains of HNF-4. It binds DNA exclusively as a
homodimer, is localized primarily in the nucleus, and binds DR1
response elements with the consensus sequence: AGGTCAGGGG(T/A)CA. It
also binds several different coactivators in the absence of exogenously
added ligand (7, 9, 11, 16, 17, 20, 21, 37, 40). HNF-4
DNA binding activity and transactivation potential are tightly
regulated by its state of phosphorylation and acetylation. Although
HNF-4 activity is regulated by posttranslational modification,
redox-mediated posttranslational phosphorylation of HNF-4 has not
been examined in the context of hepatocyte iNOS expression. In this
article, we characterize the function of HNF-4 in redox-dependent
hepatocyte iNOS expression and demonstrate a crucial functional role
for the HNF-4 phosphorylation state. Our results suggest that the
redox-sensitive increase in hepatocyte iNOS expression is mediated
through a kinase pathway that targets HNF-4 as a transcriptional activator.
| |
MATERIALS AND METHODS |
|---|
|
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
Materials.
The rat hepatocyte iNOS promoter (GenBank X95629) was a gift from Prof.
W. Eberhardt (University of Basel, Switzerland). The HNF-4
expression vector was a gift from Dr. Francis M. Sladek (University of
California, Riverside, CA). Hepatocytes from conditional HNF-4
knockout mice (HNF-4fl/flAlbCre+/
) were
isolated in the laboratory of Drs. Yusuke Inoue and Frank J. Gonzalez
(National Institutes of Health, Bethesda, MD). Dominant-negative (DN)-HNF-4 that exhibits defective DNA binding as the result of a
mutation at thymine-316 was a gift from Dr. Haiyan Wang, Geneva, Switzerland.
Cell culture. Male NIH mice fed water and chow ad libitum were used for hepatocyte isolation as described by Schuetz et al. (36). Hepatocyte purity was assessed by leukocyte esterase staining and CD68 immunohistochemistry, whereas viability was assessed by trypan blue exclusion. Preparations were routinely >90% viable and >99.5% pure. ANA-1 macrophages were maintained in Dulbecco's modified Eagle medium (DMEM) with 10% heat-inactivated FCS, 100 units/ml penicillin, and 100 µg/ml streptomycin.
Induction of NO synthesis.
IL-1 (1,000 U/ml) was used in the absence of FCS to induce NO
synthesis. In selected instances, interferon-
(IFN-; 100 U/ml) or
tumor necrosis factor (TNF-; 500 U/ml) was substituted for IL-1
as alternative induction agents for iNOS. 1,2,3-benzenetriol (BZT; 100 µM), an autocatalytic source of superoxide at pH 7.4, was added to
induce oxidative stress. After incubation for 6 h at 37°C in 5%
CO2, the supernatants and cells were harvested for assays.
Assay of NO production. NO released from cells in culture was quantified by measurement of the NO metabolite, nitrite. Cell culture medium (50 µl) was removed from culture dish and centrifuged; the supernatants were mixed with 50 µl of sulfanilamide (1%) in 0.5 N HCl. After a 5-min incubation at room temperature, an equal volume of 0.02% N-(1-naphthyl) ethylenediamine was added. After incubation for 10 min at room temperature, the absorbance of samples at 540 nm was compared with that of an NaNO2 standard on a MAXLINE microplate reader.
Immunoblot analysis.
Cells or cell nuclei were lysed in buffer (0.8% NaCl, 0.02 KCl, 1%
SDS, 10% Triton X-100, 0.5% sodium deoxycholic acid, 0.144% Na2HPO4, and 0.024%
KH2PO4, pH 7.4) and centrifuged at 12,000 g for 10 min at 4°C. Protein concentration was determined
by absorbance at 650 nm using protein assay reagent (Bio-Rad).
Membranes were incubated with rabbit polyclonal antibody directed
against human HNF-4 (Santa Cruz Biochemicals, Santa Cruz, CA),
rabbit polyclonal antibody directed against human iNOS (Santa Cruz
Biochemicals), phosphotyrosine antibodies, PY350 (Santa Cruz
Biotechnology) and 4G10 (Upstate Biotechnology, Waltham, MA), or
61-8,100 antiphosphoserine antibody (Zymed, San Francisco, CA) and
71-8,200 antiphosphothreonine antibody (Zymed) for 1 h at
room temperature, washed three times in PBS-0.05% Tween, and incubated
with horseradish peroxidase-conjugated secondary antibody for 1 h
at room temperature. After an additional three washings, bound
peroxidase activity was detected by the enhanced chemiluminescence
detection system (Amersham Pharmacia, Piscataway, NJ).
RNA preparation and Northern blot analysis. Total RNA was isolated using TRIzol reagent (GIBCO BRL, Rockville, MD). The RNA samples (10 µg/lane) were fractionated by electrophoresis on a 1% agarose formaldehyde gel and transferred to a Hybond-C nylon membrane (Amersham Pharmacia). A 32P-dATP-labeled probe was constructed based on the rat iNOS cDNA sequence (GenBank AJ230461). Hybridization was performed at 42°C for 18 h in ULTRAhyb hybridization buffer (Ambion, Austin, TX). After hybridization, filters were washed twice and subjected to autoradiography. cDNA probes were prepared by random primer labeling, followed by purification using a Sephadex G-50 mini-column (BioMax, Odenton, MD).
Transient transfection analysis of the iNOS promoter.
ANA-1 macrophages and hepatocytes were transfected using the
lipofectamine technique (29). After cells were washed
twice with medium, 10 µg of plasmid DNA containing the iNOS promoter construct (1,845 bp; GenBank X95629) coupled to a chloramphenicol acetyltransferase (CAT) reporter gene were added per 107
cells in 1 ml of medium without serum. In selected instances, an
HNF-4 expression vector (10 µg) or a DN-HNF-4 expression vector
was cotransfected with the iNOS promoter plasmid construct. The
supernatant was assayed for CAT activity using a CAT ELISA technique
(Boehringer Mannheim, Indianapolis, IN). Transfection efficiency was
normalized by cotransfection of a -galactosidase reporter gene with
a constitutively active early SV40 promoter. All values are expressed
as pg CAT/mg protein.
Mutagenesis of iNOS promoter.
PCR-based site directed mutagenesis was performed on the two NF-
B
sites (NF-B site 1 at nt 114 and NF-B site 2 at nt 1044) and
the HNF-4 site in the context of the full-length iNOS promoter plasmid to generate mutant plasmids. The mutations were GGGGACTC to
GaaagCTC at NF-B nt 1044, GGGGATTT to GaaagTTT at NF-B nt 114, and AGGTCAGGGGACA to AGGTCAGcatACA at the HNF-4 site.
Chromatin immunoprecipitation assay.
Chromatin from hepatocytes was fixed and immunoprecipitated using the
ChIP assay kit (Upstate Biotechnology) as recommended by the
manufacturer. The purified chromatin was immunoprecipitated using 10 µg of anti-HNF-4 (Santa Cruz) or 5 µl of rabbit nonimmune serum.
The input fraction corresponded to 0.1 and 0.05% of the chromatin
solution before immunoprecipitation. After DNA purification, the
presence of the selected DNA sequence was assessed by PCR. The primers
used were as follows: CCAATTGACTGGTATGTGTG and GCTGGGCTGGGGAGATGGCT, and the PCR product was 275 bp in length. The PCR program was: 94°C × 4 min, followed by 94°C × 45 s, 55°C × 45 s, and 72°C × 45 s for a total of 28 cycles,
and then 72°C × 7 min. PCR products were resolved in 10%
acrylamide gels. The average size of the sonicated DNA fragments
subjected to immunoprecipitation was 500 bp as determined by ethidium
bromide gel electrophoresis. ChIP assays at addressing NF-B nt
1,044 utilized PCR primers: TGTACCTTAGACAAGGCAAAACA and
TGAGTTCTAGGACAAACTAGGGCT, while NF-B 114 utilized
AACTGCAAATGAGAGAACAGACAG and ATGCATTATTACGTCACTCTGTGG.
One-dimensional phosphopeptide mapping.
Cells were grown to a subconfluent state and incubated in the presence
of [32P]ATP (0.3 mCi/ml). HNF-4 was
immunoprecipitated, as previously described, and subjected to SDS-PAGE
(10, 23). The relevant band was excised, digested with
S. aureus V8 protease (5 µg/slice), and separated on an
8-15% polyacrylamide gradient gel. Autoradiography was then performed.
Statistical analysis. Data are expressed as means ± SE. Analysis was performed using the Students t-test. P values <0.05 were considered significant.
| |
RESULTS |
|---|
|
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
HNF-4 and redox-enhanced iNOS expression in hepatocytes.
In a model of rat hepatocytes, we have previously demonstrated that
IL-1-mediated iNOS expression is significantly increased in the
presence of superoxide- or peroxide-induced oxidative stress (23-25). To determine the role of HNF-4 in this
redox-enhanced iNOS expression, we utilized a mouse model to take
advantage of an HNF-4 Cre-lox conditional knockout (KO) system
(12). HNF-4 KO is otherwise embryonically
lethal. Hepatocytes were isolated from wild-type (WT) and HNF-4
Cre-lox knockout mice by the technique of retrograde vena caval
perfusion. Cells were stimulated with IL-1 (1,000 U/ml) in the
presence and absence of BZT (100 µM), an autocatalytic source of
superoxide at physiological pH. After a 6-h period of incubation,
culture medium levels of the NO metabolite, nitrite, (Table
1) and cellular expression of iNOS
protein and mRNA were determined (Fig.
1). Unstimulated cells served as
controls. In both WT and HNF-4 KO animals, IL-1 stimulation produced
medium levels of nitrite that were eightfold higher than controls.
Addition of BZT with IL-1 doubled nitrite expression in WT animals
only. BZT alone did not alter nitrite levels in either WT or HNF-4 KO cells. Similarly, IL-1 induced expression of iNOS protein and mRNA
in both WT and HNF-4 KO hepatocytes. However, IL-1 + BZT significantly augmented iNOS protein and mRNA levels in WT cells only.
In the absence of HNF-4, BZT did not augment IL-1-mediated hepatocyte iNOS expression.
|
|
to redox-sensitive iNOS
promoter activity, a CAT reporter plasmid construct containing the
full-length rat hepatocyte iNOS promoter was transfected into WT and
HNF-4 KO murine hepatocytes using the lipofectamine technique (Fig.
2). In WT and HNF-4 KO hepatocytes,
IL-1 stimulation increased CAT expression by tenfold. In contrast,
in WT cells only, IL-1 + BZT treatment increased CAT expression
by fivefold over that noted with IL-1. In the HNF-4 KO cells,
IL-1 + BZT did not alter iNOS promoter activity compared with
that of IL-1 stimulation alone. BZT alone did not alter CAT
expression. This indicates that HNF-4 is essential for
redox-mediated enhancement of hepatocyte iNOS promoter activity. These
data from WT murine hepatocytes duplicate our previous observations in
primary rat hepatocytes.
|
in this system, the
DN-HNF-4 expression vector was transfected into WT murine
hepatocytes. DN-HNF-4 exhibits defective DNA binding as the
result of a mutation at thymine-316. NO synthesis, as normalized for
transfection efficiency, was measured in cells exposed to IL-1
(1,000 U/ml) in the presence and absence of BZT (100 µM).
Unstimulated cells served as controls. In the absence of DN-HNF-4, NO
production was 6.3 ± 2.1, 43.2 ± 4.7, 5.5 ± 3.1, and
93 ± 6.7 nmol/mg protein in control, IL-1, BZT, and
IL-1 + BZT cells (P < 0.01 IL-1 vs.
control, BZT, and IL-1 + BZT cells; P < 0.01 IL-1 vs. IL-1 + BZT; n = 4). In the presence
of DN-HNF-4, NO production in control, IL-1, and BZT stimulated
cells was not statistically different from those noted in the absence
of DN-HNF-4. However, NO production in IL-1 + BZT cells with
DN-HNF-4 was 36.2 ± 4.6, a value that is threefold less than
that noted in the absence of DNF-4 (P < 0.01).
DN-HNF-4 was cotransfected with the iNOS-CAT promoter construct into
WT murine hepatocytes (Fig. 2). Similar to that noted in WT hepatocytes
without DN-HNF-4, CAT expression in the presence of DN-HNF-4 was
not statistically different in control, IL-1-, and BZT-treated
cells. However, in IL-1 + BZT cells with DN-HNF-4, CAT
expression was increased by only 1.5-fold over IL-1 cells (P < 0.02). The BZT-associated augmentation of
IL-1-induced iNOS promoter activation was decreased by threefold in
the presence of DN-HNF-4 (P < 0.02). These data
suggest that HNF-4 is required for redox enhancement of iNOS
promoter activity in murine hepatocytes.
HNF-4 and iNOS activity in ANA-1 macrophages.
Additional studies were performed in ANA-1 murine macrophages to
support the role of HNF-4 in the upregulation of iNOS promoter activity in the setting of IL-1 and BZT stimulation. ANA-1 cells do
not express HNF-4 under control, IL-1, BZT, and/or IL-1 + BZT treatment conditions. In ANA-1 macrophages, NO production was
10.2 ± 1.7, 24.3 ± 3.2, 9.1 ± 1.9, and 28.4 ± 4.3 nmol/mg protein in unstimulated controls, IL-1 (1,000 U/ml), BZT
(100 µM), and IL-1 and BZT cells, respectively. In ANA-1 cells,
cotransfection assays were then performed with 1) the
iNOS-CAT promoter construct alone, 2) iNOS-CAT and the
HNF-4 expression vector, or 3) iNOS CAT with the
DN-HNF-4 expression vector (Fig. 3).
In iNOS-CAT alone, iNOS + HNF-4, and iNOS + DN-HNF-4
transfection conditions, IL-1 stimulation of ANA-1 cells increased
CAT expression by over eightfold compared with unstimulated controls.
In the presence of IL-1 + BZT, CAT expression is increased
fourfold in iNOS + HNF-4 cells only. In the presence of BZT alone,
CAT expression for all three transfection conditions is not
significantly different from that of control cells. These data indicate
that constitutive HNF-4 expression in ANA-1 cells significantly
augments iNOS promoter trans-activation in the setting of
IL-1 + BZT stimulation. Interestingly, HNF-4 expression in
ANA-1 cells treated with only IL-1 does not increase CAT expression
compared with that noted in the absence of HNF-4 expression. This
result suggests that oxidative stress is a necessary component of the
signal transduction pathway by which HNF-4 augments cytokine-induced
iNOS promoter trans-activation.
|
Mutagenesis of NF-B and HNF-4 binding sites in the iNOS
promoter.
To determine whether HNF-4 acts independently of NF-B, an
essential transcription factor for iNOS transcription, the CAT reporter
containing the iNOS promoter was mutated at both NF-B binding sites
(nt 1044: GGGGATTTTCC to GaaagTTTTCC; nt 114: GGGGACTCTCC to
GaaagCTCTCC) and transfected into hepatocytes exposed to IL-1,
BZT, and IL-1 + BZT. Under all treatment conditions, CAT
activity was not different from that of unstimulated controls. These
data indicate that NF-B sites are essential for iNOS activation; HNF-4 functions as an activator that is dependent on NF-B (data not shown).
may lie in
augmentation of DNA binding of NF-B at either of its two DNA binding
sites, nt 965 and nt 109. ChIP assays were performed in WT
hepatocytes to examine in vitro NF-B binding in the hepatocyte iNOS
promoter (Fig. 4). NF-B binding was
exhibited at both binding sites; at each site, there was no difference
noted between IL-1 and IL-1 + BZT cells. Compared with the
extent of NF-B binding noted in IL-1 cells, this indicates that
HNF-4 does not augment NF-B DNA binding in the presence of
IL-1 + BZT. Also, BZT does not alter IL-1-mediated NF-B
binding. As expected, no NF-B binding was found in unstimulated
controls and BZT cells.
|
binding site in the iNOS CAT promoter was mutated, AGGTCA
G GGGACA to AGGTCA G catACA, to ablate HNF-4 homodimer binding.
Transient transfection assays were then repeated in WT hepatocytes.
With the use of this mutated iNOS promoter vector, CAT expression in
IL-1 + BZT was not statistically different from that of IL-1
cells (20.3 ± 3.1 vs. 23.2 ± 4.2 pg
CAT/mg/-galactosidase activity). These data indicate that mutation
of the HNF-4 DNA binding element ablates the increased iNOS promoter
activity seen in the presence of IL-1 + BZT.
Nuclear localization of HNF-4.
HNF-4 is primarily localized in the hepatocyte nucleus
(38). To determine whether IL-1 and/or BZT stimulation
alters nuclear localization of HNF-4, immunoblots were performed
with nuclear protein isolated from control-, IL-1-, BZT-, and
IL-1 + BZT-treated hepatocytes (Fig.
5). Nuclear levels of HNF-4 were not
altered by IL-1 or BZT stimulation at 6 or 12 h after
treatment. These data demonstrate that nuclear localization of HNF-4
is not altered by IL-1 and/or BZT stimulation. Cytoplasmic
expression of HNF-4 was undetectable at all time points and
treatment conditions (data not shown).
|
One-dimensional phosphopeptide mapping of HNF-4.
It is well known that tyrosine and serine/threonine phosphorylation (or
dephosphorylation) of transcription factors alters activator
subcellular localization, DNA binding properties, and transactivation
potential. To determine whether distinctive phosphorylation patterns of
HNF-4 are present among the various treatment conditions, one
dimensional phosphopeptide mapping of HNF-4 was performed in
control, IL-1-, BZT-, and IL-1 + BZT-treated hepatocytes in
the presence of [-32P] ATP. Immunoprecipitated
HNF-4 was then partially digested with V8 protease and
separated with 15% SDS-PAGE (Fig. 6).
These results demonstrate that HNF-4 is constitutively
phosphorylated in unstimulated cells, and the phosphorylation pattern
of HNF-4 is unaltered in the presence of IL-1 or BZT stimulation.
In contrast, IL-1 + BZT stimulation dramatically alters the
pattern and extent of HNF-4 phosphorylation.
|
+ BZT in the presence and absence of the tyrosine kinase inhibitor,
tyrphostin B46 (TYR; 40 µM), and the serine/threonine kinase
inhibitor, staurosporine (STA; 1 µM). As generalized kinase inhibition may have untoward effects on transcriptional machinery independent of effects on HNF-4 binding to the iNOS promoter, transient transfection assays were not utilized. Instead, ChIP assays
were performed to determine in vivo HNF-4 DNA binding (Fig.
7). In IL-1 + BZT-stimulated
hepatocytes, significantly decreased in vivo HNF-4 binding to the
iNOS promoter was noted in the presence of kinase inhibition.
One-dimensional phosphopeptide mapping of HNF-4 partially digested
with V8 protease was then performed to determine the effect
of STA and TYR on the IL-1 + BZT pattern of phosphorylation
(Fig. 8). These results indicate that the
distinct pattern of phosphorylation in IL-1 + BZT cells is
ablated in the presence of kinase inhibitors and is not different from
that of IL-1 cells. These results indicate that in vivo HNF-4 DNA
binding 1) is associated with a specific phosphorylation pattern, and 2) requires serine/threonine and/or tyrosine
phosphorylation. Further one-dimensional phosphopeptide mapping of
HNF-4 was performed using STA alone or TYR alone in the presence of
IL-1 + BZT stimulation. These results suggest that the unique
pattern of HNF-4 phosphorylation is inhibited in the presence of the
STA-mediated serine/threonine kinase inhibition.
|
|
, BZT, or IL-1 + BZT, HNF-4 was immunoprecipitated and subjected to immunoblot
analysis using phosphotyrosine antibodies, PY350 (Santa Cruz
Biotechnology) and 4G10 (Upstate Biotechnology, Waltham, MA), or
phosphoserine/threonine antibodies, 61-8,100 antiphosphoserine
antibody (Zymed) and 71-8,200 antiphosphothreonine antibody
(Zymed) (Fig. 9). In the presence of
phosphotyrosine antibodies, no differences were noted. In contrast, a
tenfold increase in labeling in IL-1 + BZT cells was noted in
the presence of the antiphosphoserine and antiphosphothreonine antibodies, suggesting that the unique HNF-4 phosphorylation pattern
noted in the presence of IL-1 + BZT stimulation is the result
of serine/threonine phosphorylation.
|
DNA
binding after cytokine and oxidant stimulation, hepatocytes were
stimulated with IL-1 + BZT in the presence and absence of the
serine/threonine kinase inhibitor, STA (1 µM). ChIP assays were
repeated, as above. In this setting, STA treatment ablated IL-1 + BZT induced HNF-4 DNA binding to the iNOS promoter (Fig. 7).
NO and HNF-4-enhanced iNOS expression.
To determine whether NO plays a role in HNF-4-enhanced iNOS promoter
activity, transient transfection studies with the iNOS promoter in WT
hepatocytes were repeated in the presence of a competitive substrate
inhibitor of iNOS, L-N-(1-iminoethyl)lysine hydrochloride (L-NIL; 100 µM) (Fig.
10). In this setting, inhibition of
iNOS activity did not alter the enhanced iNOS promoter activity noted
in the presence of IL-1 + BZT. Also, in IL-1 + BZT
cells, ChIP assays did not demonstrate a significant difference in
HNF-4 binding in the presence or absence of L-NIL (data
not shown). These results suggest that NO does not play a feedback
regulatory role in redox enhanced hepatocyte iNOS promoter activity or
HNF-4 DNA binding.
|
Oxidative stress and alternative inducers of hepatocyte iNOS.
We have previously demonstrated that alternative forms of oxidative
stress, such as acetaminophen and peroxide, can augment IL-1-mediated iNOS promoter activity in hepatocytes (25,
31). To determine the potential role of HNF-4 in TNF--
and/or IFN--induced iNOS expression, NO production was measured in
WT murine hepatocytes exposed to TNF- or IFN- in the presence or
absence of BZT. In selected instances, the serine/threonine kinase
inhibitor STA (1 µM) was added, or the DN-HNF-4 expression vector
was transfected (Table 2). In both
TNF-- and IFN--stimulated cells, NO production was significantly
increased with oxidative stress. Inhibition of serine-threonine kinase
activity or expression of DN-HNF-4 totally ablated redox-augmented
NO production. Subsequently, transient transfection studies were
performed with the iNOS promoter-reporter construct under the same
experimental conditions (Fig. 11). The resulting CAT expression mirrors those noted with determination of NO
production. In both TNF-- and IFN--stimulated cells, iNOS promoter activation was significantly increased with oxidative stress.
Inhibition of serine-threonine kinase activity or expression of
DN-HNF-4 totally ablated redox-augmented iNOS activation. These
results suggest that oxidative stress augments iNOS promoter activity
and NO production under TNF- or IFN- induction through a
mechanism that involves HNF-4 and serine-threonine kinase
activation.
|
|
| |
DISCUSSION |
|---|
|
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
In this study, we demonstrate that HNF-4 acts as an activator
of redox-associated hepatocyte iNOS expression at the level of protein,
mRNA, and promoter activation. In the absence of HNF-4, this
redox-mediated enhancement is ablated, as demonstrated by the HNF-4 KO
murine hepatocytes and the ANA-1 macrophage HNF-4/DN-HNF-4 cotransfection studies. In addition, in the setting of IL-1 + BZT, HNF-4 functional activity is associated with a unique
serine/threonine phosphorylation pattern that is independent of NO.
This would indicate that there exists a redox-sensitive
serine/threonine kinase pathway that targets HNF-4 to augment
hepatocyte iNOS expression. Based upon the ANA-1 data, we may presume
that this kinase pathway exists in the macrophage and is not exclusive
to the hepatocyte. In summary, our data indicate that a unique pattern of phosphorylation determines HNF-4 activity as a
trans-activator of IL-1-mediated hepatocyte iNOS
expression in the presence of oxidative stress. Redox-mediated
posttranslational phosphorylation of HNF-4 has not been previously
examined in the context of hepatocyte iNOS expression.
In sepsis and shock, the host response is characterized by production of proinflammatory cytokines and reactive oxygen species (ROS). These result in multiorgan dysfunction, a leading cause of mortality in the critically ill surgical patient. In this setting, hepatocyte injury and dysfunction are especially significant clinical problems (6, 15, 32-35, 43). Consequently, hepatocyte-derived NO has been extensively studied as a multifunctional free radical produced during shock and sepsis that may limit tissue injury (19, 27, 30). The pervasive nature and functional significance of hepatic iNOS expression is emphasized by the finding that 33/33 human patients undergoing exploratory laparotomy for trauma exhibited detectable iNOS mRNA in the liver (Timothy R. Billiar, unpublished observation). At Duke University Hospital, administration of intravenous methylene blue, an inhibitor of NO function, prior to reperfusion of hepatic allografts (n = 6) is associated with a fourfold increase in peak transaminase values, suggesting increased hepatocyte injury (Jacques Somma, Duke University Medical Center, unpublished observations). However, despite its importance, little is known about redox regulation of hepatocyte iNOS expression.
In the presence of oxidative stress, the hepatocellular redox state
upregulates iNOS expression as an antioxidant function. In
IL-1-treated rat hepatocytes, we showed that iNOS gene transcription and promoter activity are increased by oxidant stress mediated by
peroxide, superoxide, or acetaminophen (10, 23, 24, 26, 31). Subsequently, in IL-1-stimulated rat hepatocytes exposed to superoxide, we identified a redox-sensitive DR1
cis-acting activator element (nt 1,327 to nt 1,315) in
the iNOS promoter: AGGTCA G GGGACA. The corresponding transcription
factor was isolated by DNA affinity chromatography, sequenced, and
identified to be HNF-4 (10, 23).
Although fatty acyl coenzyme A thioesters have been proposed as ligands
for HNF-4, they do not affect binding of coactivator or corepressor
in vitro, and it remains unclear whether they are truly ligands
(4, 13, 14, 37). As a result, HNF-4 remains classified
as an orphan nuclear receptor. HNF-4 exhibits distinct functional
domains typical of nuclear hormone receptors. In the NH2-terminal region, AF-1 functions as a constitutive
activator of transcription, binds multiple protein targets, and may
recruit general transcription factors and chromatin remodeling
proteins. A highly conserved DNA binding domain (DBD), composed of two
zinc-coordinated modules, is responsible for specific binding to
cognate response elements. A flexible hinge region separates the DBD
and the putative ligand-binding domain (LBD). The adjacent region also
contains the dimerization interface and the transactivation function
AF-2. In the COOH terminus, the F domain is a highly variable repressor region (7, 9, 11, 20, 21, 37, 40). Posttranslational modification by phosphorylation is known to alter HNF-4 DNA-binding activity, transactivation potential, nuclear translocation, and/or degradation (18, 28, 39, 41, 42).
Cellular stress such as ROS and proinflammatory cytokines regulate intracellular signal transduction cascades and modulate transcription factor activity through calcium signaling, protein kinase, and protein phosphatase pathways. ROS may directly activate kinases by altering thiol-dependent protein-protein interactions, inhibiting phosphatase activity by oxidation of an active site cysteine residue and/or stimulating proteolysis of kinase regulatory proteins. Ultimately, redox regulated tyrosine- and serine/threonine-phosphorylation of transcription factors through tyrosine kinase and stress-activated protein kinase (SAPK) activities alter transcription factor subcellular localization, DNA binding properties, and transactivation potential. In particular, the SAPKs (ERK-1/2, BMK1, JNK, and p38 isoforms) are often the ultimate (and best-characterized) regulatory proteins in a series of sequential kinase reactions that target transcription factor modification in the setting of cellular stresses similar to those of our model (1, 2, 8, 22).
Redox-mediated posttranslational modification of HNF-4 has never
been previously addressed. HNF-4 DNA binding activity and transactivation potential are tightly regulated by its state of phosphorylation and acetylation. HNF-4 potentially contains 21 serine, 6 threonine, and 7 tyrosine phosphorylation sites (3, 18). In COS 7 cells, serine/threonine phosphorylation of
HNF-4 increases affinity and specificity of DNA binding by altering its tertiary structure (18). Tyrosine phosphorylation of
HNF-4 is required for DNA binding, transactivation, and subnuclear
localization in primary cultures of rat hepatocytes (21).
In contrast, protein kinase A-dependent phosphorylation within the DBD
inhibits DNA binding in HepG2 and Cos 1 cells (41). In
vivo experiments support the functional importance of HNF-4
phosphorylation state. In a murine model of 15% burn injury,
hepatocyte HNF-4 DNA binding is enhanced by serine phosphorylation
(Ref. 5 and Peter A. Burke, M.D., personal communication).
Dietary protein restriction or overnight fasting decreases hepatic
HNF-4 DNA binding activity as a result of decreased serine/threonine
phosphorylation (38, 41). Acetylation of HNF-4 is
crucial for proper nuclear retention, DNA binding, and promoter
activation in COS 1 and NIH 3T3 cells (18). Although
HNF-4 activity is certainly regulated by posttranslational modification, redox-mediated posttranslational phosphorylation or
acetylation of HNF-4 has not been examined.
In summary, experimental findings in models of sepsis and shock suggest
that NO synthesis serves an antioxidant function that is redox
modulated. However, the relationship between oxidative stress and iNOS
gene transcription remains unexplored. In IL-1-stimulated hepatocytes, we have demonstrated that 1) an HNF-4
functions as a redox-sensitive trans-activator of iNOS
transcription, and 2) HNF-4 exhibits a unique
redox-dependent phosphorylation pattern. Future experiments are
required to characterize the molecular regulatory pathway by which
HNF-4 integrates multiple extra- and intra-cellular signals mediated
by kinase cascades to precisely regulate redox-dependent hepatocyte
iNOS gene expression. These considerations are crucial to our
understanding of HNF-4 as a novel and, as yet, poorly described
redox-sensitive mechanism that regulates hepatocyte iNOS expression as
an antiapoptotic and antioxidant function in the setting of sepsis
and shock.
| |
ACKNOWLEDGEMENTS |
|---|
This work was supported by National Institutes of Health Grants AI-44629 and GM-65113 (to P. C. Kuo) and the American College of Surgeons Clowes Development Award (to P. C. Kuo).
| |
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: P. C. Kuo, Dept. of Surgery, DUMC, 110 Bell Bldg., Box 3522, Durham, NC 27710 (E-mail: kuo00004{at}mc.duke.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
First published December 4, 2002;10.1152/ajpcell.00394.2002
Received 28 August 2002; accepted in final form 26 November 2002.
| |
REFERENCES |
|---|
|
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
1.
Allen, RG,
and
Tresini M.
Oxidative stress and gene regulation.
Free Radic Biol Med
28:
463-499,
2000[Web of Science][Medline].
2.
Berk, BC.
Redox signals that regulate the vascular response to injury.
Thromb Haemost
82:
810-817,
1999[Web of Science][Medline].
3.
Blom, N,
Gammeltoft S,
and
Brunak S.
Sequence and structure-based prediction of eukaryotic protein phosphorylation sites.
J Mol Biol
294:
1351-1362,
1999[Web of Science][Medline].
4.
Bogan, AA,
Dallas-Yang Q,
Ruse MDJ,
Maeda Y,
Jiang G,
Nepomuceno L,
Scanlan TS,
Cohen FE,
and
Sladek FM.
Analysis of protein dimerization and ligand binding of orphan receptor HNF4.
J Mol Biol
302:
831-851,
2000[Web of Science][Medline].
5.
Burke, PM,
Luo M,
and
Yaffe MFR
Burn injury modifies the DNA binding of HNF-4, a liver specific transcription factor by posttranslational modification (Abstract).
Shock
7, Suppl:
17,
1997[Web of Science][Medline].
6.
Clowes, GHA,
Hirsch E,
George BC,
Bigatello LM,
Mazuski JE,
and
Villee CA.
Survival from sepsis: the significance of altered protein metabolism regulated by proteolysis inducing factor, the circulating cleavage factor of interleukin-1.
Ann Surg
202:
446-458,
1985[Web of Science][Medline].
7.
Fraser, JD,
Martinez V,
Straney R,
and
Briggs MR.
DNA binding and transcription activation specificity of hepatocyte nuclear factor 4.
Nucleic Acids Res
26:
2702-2707,
1998
8.
Gabbita, SP,
Robinson KA,
Stewart CA,
Floyd RA,
and
Hensley K.
Redox regulatory mechanisms of cellular signal transduction.
Arch Biochem Biophys
376:
1-13,
2000[Web of Science][Medline].
9.
Green, VJ,
Kokkotou E,
and
Ladias JA.
Critical structural elements and multitarget protein interactions of the transcriptional activator AF-1 of hepatocyte nuclear factor 4.
J Biol Chem
273:
29950-29957,
1998
10.
Guo, H,
Cai CQ,
and
Kuo PC.
Hepatocyte nuclear factor-4 mediates redox sensitivity of inducible nitric oxide synthase gene transcription.
J Biol Chem
277:
5054-5060,
2002
11.
Hadzopoulou-Cladaras, M,
Kistanova E,
Evagelopoulou C,
Zeng S,
Cladaras C,
and
Ladias JA.
Functional domains of the nuclear receptor hepatocyte nuclear factor 4.
J Biol Chem
272:
539-550,
1997
12.
Hayhurst, GP,
Lee YH,
Lambert G,
Ward JM,
and
Gonzalez FJ.
Hepatocyte nuclear factor 4 (nuclear receptor 2A1) is essential for maintenance of hepatic gene expression and lipid homeostasis.
Mol Cell Biol
21:
1393-1403,
2001
13.
Hertz, R,
Magenheim J,
Berman I,
and
Bar-Tana J.
Fatty acyl-CoA thioesters are ligands of hepatic nuclear factor-4.
Nature
392:
512-516,
1998[Medline].
14.
Hertz, R,
Sheena V,
Kalderon B,
Berman I,
and
Bar-Tana J.
Suppression of hepatocyte nuclear factor-4 by acyl-CoA thioesters of hypolipidemic peroxisome proliferators.
Biochem Pharmacol
61:
1057-1062,
2001[Web of Science][Medline].
15.
Jarrar, D,
Wang P,
Cioffi WG,
Bland KI,
and
Chaudry IH.
Critical role of oxygen radicals in the initiation of hepatic depression after trauma hemorrhage.
J Trauma
49:
879-885,
2000[Web of Science][Medline].
16.
Jiang, G,
Lee U,
and
Sladek FM.
Proposed mechanism for the stabilization of nuclear receptor DNA binding via protein dimerization.
Mol Cell Biol
17:
6546-6554,
1997[Abstract].
17.
Jiang, G,
Nepomuceno L,
Hopkins K,
and
Sladek FM.
Exclusive homodimerization of the orphan receptor hepatocyte nuclear factor 4 defines a new subclass of nuclear receptors.
Mol Cell Biol
15:
5131-5143,
1995[Abstract].
18.
Jiang, G,
Nepomuceno L,
Yang Q,
and
Sladek FM.
Serine/threonine phosphorylation of orphan receptor hepatocyte nuclear factor 4.
Arch Biochem Biophys
340:
1-9,
1997[Web of Science][Medline].
19.
Kelly, E,
Morris SM,
and
Billiar TR.
Nitric oxide, sepsis, and arginine metabolism.
J Parenter Enteral Nutr
19:
234-238,
1995
20.
Kistanova, E,
Dell H,
Tsantili P,
Falvey E,
Cladaras C,
and
Hadzopoulou-Cladaras M.
The activation function-1 of hepatocyte nuclear factor-4 is an acidic activator that mediates interactions through bulky hydrophobic residues.
Biochem J
356:
635-642,
2001[Web of Science][Medline].
21.
Ktistaki, E,
Ktistakis NT,
Papadogeorgaki E,
and
Talianidis I.
Recruitment of hepatocyte nuclear factor 4 into specific intranuclear compartments depends on tyrosine phosphorylation that affects its DNA-binding and transactivation potential.
Proc Natl Acad Sci USA
92:
9876-9880,
1995
22.
Kunsch, C,
and
Medford RM.
Oxidative stress as a regulator of gene expression in the vasculature.
Circ Res
85:
753-766,
1999
23.
Kuo, PC,
Abe K,
and
Schroeder RA.
Superoxide enhances interleukin 1-mediated transcription of the hepatocyte-inducible nitric oxide synthase gene.
Gastroenterology
118:
608-618,
2000[Web of Science][Medline].
24.
Kuo, PC,
and
Abe KY.
Interleukin-1 induced production of nitric oxide inhibits benzenetriol mediated oxidative injury in rat hepatocytes.
Gastroenterology
109:
206-216,
1995[Web of Science][Medline].
25.
Kuo, PC,
Schroeder RA,
and
Loscalzo J.
Nitric oxide and acetaminophen mediated oxidative injury: modulation of interleukin-1 induced nitric oxide synthesis in cultured rat hepatocytes.
J Pharmacol Exp Ther
282:
1072-1083,
1997
26.
Kuo, PC,
and
Slivka A.
Nitric oxide decreases oxidant mediated hepatocyte injury.
J Surg Res
56:
594-600,
1994[Web of Science][Medline].
27.
Liu, S,
Beckman JS,
and
Ku DD.
Peroxynitrite, a product of superoxide and nitric oxide, produces coronary vasorelaxation in dogs.
J Pharmacol Exp Ther
268:
1114-1121,
1994
28.
Malik, S,
and
Karathanasis SK.
TFIIB-directed transcriptional activation by the orphan nuclear receptor hepatocyte nuclear factor 4.
Mol Cell Biol
16:
1824-1831,
1996[Abstract].
29.
Meszaros, KS,
Aberle S,
White M,
and
Parent JB.
Immunoreactivity and bioactivity of lipopolysaccharide binding protein in normal and heat inactivated sera.
Infect Immun
63:
363-365,
1995[Abstract].
30.
Nathan, C.
Nitric oxide as a secretory product of mammalian cells.
FASEB J
6:
1157-1175,
1992.
31.
Punzalan, C,
Cai C,
Schroeder RA,
and
Kuo PC.
Redox regulation of the rat hepatocyte iNOS promoter.
Surgery
126:
450-455,
1999[Web of Science][Medline].
32.
Ramos-Kelly, JR,
Toledo-Pereyra LH,
Jordan J,
Rivera-Chavez F,
Rohs T,
Holevar M,
Dixon RA,
Yun E,
and
Ward PA.
Multiple selectin blockade with a small molecule inhibitor downregulates liver chemokine expression and neutrophil infiltration after hemorrhagic shock.
J Trauma
49:
92-100,
1999[Web of Science].
33.
Rolando, N,
Wade J,
Davalos M,
Wendon J,
Philpott-Howard J,
and
Williams R.
The systemic inflammatory response syndrome in acute liver failure.
Hepatology
32:
734-739,
2000[Web of Science][Medline].
34.
Rosenblatt, S,
Clowes G,
George BC,
Hirsch E,
and
Lindberg B.
Exchange of amino acids by muscle and liver in sepsis.
Arch Surg
118:
167-175,
1983
35.
Sax, HC,
Talamini MA,
Hasselgren PO,
Rosenblum L,
and
Ogle CK.
Increased synthesis of secreted hepatic proteins during abdominal sepsis.
J Surg Res
44:
109-116,
1988[Web of Science][Medline].
36.
Schuetz, EG,
Wrighton SA,
Safe GH,
and
Guzelian PS.
Regulation of cytochrome P450 by phenobarbital and phenobarbital-like inducers in adult rat hepatocytes in primary monolayer culture and in vitro.
Biochemistry
25:
1124-1133,
1986[Medline].
37.
Sladek, FM,
Ruse MDJ,
Nepomuceno L,
Huang SM,
and
Stallcup MR.
Modulation of transcriptional activation and coactivator interaction by a splicing variation in the F domain of nuclear receptor hepatocyte nuclear factor 41.
Mol Cell Biol
19:
6509-6522,
1999
38.
Sladek, R,
and
Giguere V.
Orphan nuclear receptors: an emerging family of metabolic regulators.
Adv Pharmacol
47:
23-87,
2000[Medline].
39.
Soutoglou, E,
Katrakili N,
and
Talianidis I.
Acetylation regulates transcription factor activity at multiple levels.
Mol Cell
5:
745-751,
2000[Web of Science][Medline].
40.
Suaud, L,
Formstecher P,
and
Laine E.
The activity of the activation function 2 of the human hepatocyte nuclear factor 4 (HNF-4) is differently modulated by F domains from various origins.
Biochem J
340:
161-169,
1999[Web of Science][Medline].
41.
Viollet, B,
Kahn A,
and
Raymondjean M.
Protein kinase A-dependent phosphorylation modulates DNA-binding activity of hepatocyte nuclear factor 4.
Mol Cell Biol
17:
4208-4219,
1997[Abstract].
42.
Wang, B,
Cai SR,
Gao C,
Sladek FM,
and
Ponder KP.
Lipopolysaccharide results in a marked decrease in hepatocyte nuclear factor 4 in rat liver.
Hepatology
34:
979-989,
2001[Web of Science][Medline].
43.
Weigand, MA,
Schmidt H,
Pourmahmoud M,
Zhao Q,
Martin E,
and
Bardenheuer HJ.
Circulating intercellular adhesion molecule-1 as an early predictor of hepatic failure in patients with septic shock.
Crit Care Med
27:
2656-2661,
1999[Web of Science][Medline].
This article has been cited by other articles:
|
|
 |
|
  K. Klein, G. A. Kullak-Ublick, M. Wagner, M. Trauner, and J. J. Eloranta Hepatocyte nuclear factor-4{alpha} and bile acids regulate human concentrative nucleoside transporter-1 gene expression Am J Physiol Gastrointest Liver Physiol, April 1, 2009; 296(4): G936 - G947. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Guo, C. Gao, Z. Mi, J. Zhang, and P. C. Kuo Characterization of the PC4 Binding Domain and its Interactions with HNF4{alpha} J. Biochem., May 1, 2007; 141(5): 635 - 640. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Sauvaget, V. Chauffeton, S. Dugue-Pujol, A.-D. Kalopissis, I. Guillet-Deniau, F. Foufelle, J. Chambaz, A. Leturque, P. Cardot, and A. Ribeiro In Vitro Transcriptional Induction of the Human Apolipoprotein A-II Gene by Glucose Diabetes, March 1, 2004; 53(3): 672 - 678. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P.-Y. Cheng, M. Wang, and E. T. Morgan Rapid Transcriptional Suppression of Rat Cytochrome P450 Genes by Endotoxin Treatment and Its Inhibition by Curcumin J. Pharmacol. Exp. Ther., December 1, 2003; 307(3): 1205 - 1212. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |
