Am J Physiol Cell Physiol Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 284: C1090-C1099, 2003. First published December 4, 2002; doi:10.1152/ajpcell.00394.2002
0363-6143/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/4/C1090    most recent
00394.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guo, H.
Right arrow Articles by Kuo, P. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guo, H.
Right arrow Articles by Kuo, P. C.
Vol. 284, Issue 4, C1090-C1099, April 2003

Serine/threonine phosphorylation regulates HNF-4alpha -dependent redox-mediated iNOS expression in hepatocytes

Hongtao Guo1, Junping Wei1, Yusuke Inoue2, Frank J. Gonzalez2, and Paul C. Kuo1

1 Duke University Medical Center, Durham, North Carolina 27710; and 2 National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20817


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Nitric oxide (NO), endogenously synthesized by inducible NO synthase (iNOS), serves antioxidant and antiapoptotic functions in settings characterized by oxidative stress and proinflammatory cytokines such as sepsis and shock. However, the redox-sensitive mechanisms regulating hepatocyte expression of iNOS are largely unknown. In interleukin-1beta (IL-1beta )-stimulated hepatocytes exposed to superoxide, we demonstrate that hepatocyte nuclear factor-4alpha (HNF-4alpha ) acts as an activator of redox-associated hepatocyte iNOS expression at the level of protein, mRNA, and promoter activation. In the absence of HNF-4alpha , this redox-mediated enhancement is ablated. HNF-4alpha functional activity is associated with a unique serine/threonine kinase-mediated phosphorylation pattern. This suggests that a redox-sensitive kinase pathway targets HNF-4alpha to augment hepatocyte iNOS expression. Previous studies have not addressed a redox-dependent kinase signaling pathway that targets HNF-4alpha and enhances hepatocyte iNOS gene transcription. A unique pattern of phosphorylation determines HNF-4alpha activity as a trans-activator of IL-1beta -mediated hepatocyte iNOS expression in the presence of oxidative stress.

kinase; phosphorylation; nitric oxide; Cre-lox; transcription; inducible nitric oxide synthase; hepatocyte nuclear factor-4alpha


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

IN THE PRESENCE OF OXIDATIVE STRESS, the hepatocellular redox state upregulates inducible nitric oxide synthase (iNOS) expression as an antioxidant function. In IL-1beta -treated rat hepatocytes, we have demonstrated that iNOS gene transcription and promoter activity are increased by oxidant stress mediated by peroxide, superoxide, or acetaminophen. (10, 23, 24, 26, 31) Subsequently, in IL-1beta -stimulated rat hepatocytes exposed to superoxide, we identified a redox-sensitive DR1 cis-acting activator element (nt -1,327 to nt -1,315) in the iNOS promoter: AGGTCAGGGGACA. The corresponding transcription factor was isolated by DNA affinity chromatography, sequenced, and identified to be hepatocyte nuclear factor-4alpha (HNF-4alpha ) (10, 23). HNF-4alpha is a member of the nuclear receptor superfamily of transcription factors and was originally identified in the regulation of liver-specific genes.(38) Subsequently, >55 distinct target genes involved with lipid, amino acid, and glucose metabolism, liver differentiation, cell structure, and immune function have been identified for HNF-4alpha . HNF-4alpha is highly conserved; amino acid identity between rat and human varies from 89.7 to 100% among the various functional domains of HNF-4alpha . It binds DNA exclusively as a homodimer, is localized primarily in the nucleus, and binds DR1 response elements with the consensus sequence: AGGTCAGGGG(T/A)CA. It also binds several different coactivators in the absence of exogenously added ligand (7, 9, 11, 16, 17, 20, 21, 37, 40). HNF-4alpha DNA binding activity and transactivation potential are tightly regulated by its state of phosphorylation and acetylation. Although HNF-4alpha activity is regulated by posttranslational modification, redox-mediated posttranslational phosphorylation of HNF-4alpha has not been examined in the context of hepatocyte iNOS expression. In this article, we characterize the function of HNF-4alpha in redox-dependent hepatocyte iNOS expression and demonstrate a crucial functional role for the HNF-4alpha phosphorylation state. Our results suggest that the redox-sensitive increase in hepatocyte iNOS expression is mediated through a kinase pathway that targets HNF-4alpha as a transcriptional activator.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Materials. The rat hepatocyte iNOS promoter (GenBank X95629) was a gift from Prof. W. Eberhardt (University of Basel, Switzerland). The HNF-4alpha expression vector was a gift from Dr. Francis M. Sladek (University of California, Riverside, CA). Hepatocytes from conditional HNF-4alpha knockout mice (HNF-4alpha fl/flAlbCre+/-) were isolated in the laboratory of Drs. Yusuke Inoue and Frank J. Gonzalez (National Institutes of Health, Bethesda, MD). Dominant-negative (DN)-HNF-4alpha that exhibits defective DNA binding as the result of a mutation at thymine-316 was a gift from Dr. Haiyan Wang, Geneva, Switzerland.

Cell culture. Male NIH mice fed water and chow ad libitum were used for hepatocyte isolation as described by Schuetz et al. (36). Hepatocyte purity was assessed by leukocyte esterase staining and CD68 immunohistochemistry, whereas viability was assessed by trypan blue exclusion. Preparations were routinely >90% viable and >99.5% pure. ANA-1 macrophages were maintained in Dulbecco's modified Eagle medium (DMEM) with 10% heat-inactivated FCS, 100 units/ml penicillin, and 100 µg/ml streptomycin.

Induction of NO synthesis. IL-1beta (1,000 U/ml) was used in the absence of FCS to induce NO synthesis. In selected instances, interferon-gamma (IFN-gamma ; 100 U/ml) or tumor necrosis factor (TNF-alpha ; 500 U/ml) was substituted for IL-1beta as alternative induction agents for iNOS. 1,2,3-benzenetriol (BZT; 100 µM), an autocatalytic source of superoxide at pH 7.4, was added to induce oxidative stress. After incubation for 6 h at 37°C in 5% CO2, the supernatants and cells were harvested for assays.

Assay of NO production. NO released from cells in culture was quantified by measurement of the NO metabolite, nitrite. Cell culture medium (50 µl) was removed from culture dish and centrifuged; the supernatants were mixed with 50 µl of sulfanilamide (1%) in 0.5 N HCl. After a 5-min incubation at room temperature, an equal volume of 0.02% N-(1-naphthyl) ethylenediamine was added. After incubation for 10 min at room temperature, the absorbance of samples at 540 nm was compared with that of an NaNO2 standard on a MAXLINE microplate reader.

Immunoblot analysis. Cells or cell nuclei were lysed in buffer (0.8% NaCl, 0.02 KCl, 1% SDS, 10% Triton X-100, 0.5% sodium deoxycholic acid, 0.144% Na2HPO4, and 0.024% KH2PO4, pH 7.4) and centrifuged at 12,000 g for 10 min at 4°C. Protein concentration was determined by absorbance at 650 nm using protein assay reagent (Bio-Rad). Membranes were incubated with rabbit polyclonal antibody directed against human HNF-4alpha (Santa Cruz Biochemicals, Santa Cruz, CA), rabbit polyclonal antibody directed against human iNOS (Santa Cruz Biochemicals), phosphotyrosine antibodies, PY350 (Santa Cruz Biotechnology) and 4G10 (Upstate Biotechnology, Waltham, MA), or 61-8,100 antiphosphoserine antibody (Zymed, San Francisco, CA) and 71-8,200 antiphosphothreonine antibody (Zymed) for 1 h at room temperature, washed three times in PBS-0.05% Tween, and incubated with horseradish peroxidase-conjugated secondary antibody for 1 h at room temperature. After an additional three washings, bound peroxidase activity was detected by the enhanced chemiluminescence detection system (Amersham Pharmacia, Piscataway, NJ).

RNA preparation and Northern blot analysis. Total RNA was isolated using TRIzol reagent (GIBCO BRL, Rockville, MD). The RNA samples (10 µg/lane) were fractionated by electrophoresis on a 1% agarose formaldehyde gel and transferred to a Hybond-C nylon membrane (Amersham Pharmacia). A 32P-dATP-labeled probe was constructed based on the rat iNOS cDNA sequence (GenBank AJ230461). Hybridization was performed at 42°C for 18 h in ULTRAhyb hybridization buffer (Ambion, Austin, TX). After hybridization, filters were washed twice and subjected to autoradiography. cDNA probes were prepared by random primer labeling, followed by purification using a Sephadex G-50 mini-column (BioMax, Odenton, MD).

Transient transfection analysis of the iNOS promoter. ANA-1 macrophages and hepatocytes were transfected using the lipofectamine technique (29). After cells were washed twice with medium, 10 µg of plasmid DNA containing the iNOS promoter construct (1,845 bp; GenBank X95629) coupled to a chloramphenicol acetyltransferase (CAT) reporter gene were added per 107 cells in 1 ml of medium without serum. In selected instances, an HNF-4alpha expression vector (10 µg) or a DN-HNF-4alpha expression vector was cotransfected with the iNOS promoter plasmid construct. The supernatant was assayed for CAT activity using a CAT ELISA technique (Boehringer Mannheim, Indianapolis, IN). Transfection efficiency was normalized by cotransfection of a beta -galactosidase reporter gene with a constitutively active early SV40 promoter. All values are expressed as pg CAT/mg protein.

Mutagenesis of iNOS promoter. PCR-based site directed mutagenesis was performed on the two NF-kappa B sites (NF-kappa B site 1 at nt -114 and NF-kappa B site 2 at nt -1044) and the HNF-4alpha site in the context of the full-length iNOS promoter plasmid to generate mutant plasmids. The mutations were GGGGACTC to GaaagCTC at NF-kappa B nt -1044, GGGGATTT to GaaagTTT at NF-kappa B nt -114, and AGGTCAGGGGACA to AGGTCAGcatACA at the HNF-4alpha site.

Chromatin immunoprecipitation assay. Chromatin from hepatocytes was fixed and immunoprecipitated using the ChIP assay kit (Upstate Biotechnology) as recommended by the manufacturer. The purified chromatin was immunoprecipitated using 10 µg of anti-HNF-4alpha (Santa Cruz) or 5 µl of rabbit nonimmune serum. The input fraction corresponded to 0.1 and 0.05% of the chromatin solution before immunoprecipitation. After DNA purification, the presence of the selected DNA sequence was assessed by PCR. The primers used were as follows: CCAATTGACTGGTATGTGTG and GCTGGGCTGGGGAGATGGCT, and the PCR product was 275 bp in length. The PCR program was: 94°C × 4 min, followed by 94°C × 45 s, 55°C × 45 s, and 72°C × 45 s for a total of 28 cycles, and then 72°C × 7 min. PCR products were resolved in 10% acrylamide gels. The average size of the sonicated DNA fragments subjected to immunoprecipitation was 500 bp as determined by ethidium bromide gel electrophoresis. ChIP assays at addressing NF-kappa B nt -1,044 utilized PCR primers: TGTACCTTAGACAAGGCAAAACA and TGAGTTCTAGGACAAACTAGGGCT, while NF-kappa B -114 utilized AACTGCAAATGAGAGAACAGACAG and ATGCATTATTACGTCACTCTGTGG.

One-dimensional phosphopeptide mapping. Cells were grown to a subconfluent state and incubated in the presence of [gamma -32P]ATP (0.3 mCi/ml). HNF-4alpha was immunoprecipitated, as previously described, and subjected to SDS-PAGE (10, 23). The relevant band was excised, digested with S. aureus V8 protease (5 µg/slice), and separated on an 8-15% polyacrylamide gradient gel. Autoradiography was then performed.

Statistical analysis. Data are expressed as means ± SE. Analysis was performed using the Students t-test. P values <0.05 were considered significant.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

HNF-4alpha and redox-enhanced iNOS expression in hepatocytes. In a model of rat hepatocytes, we have previously demonstrated that IL-1beta -mediated iNOS expression is significantly increased in the presence of superoxide- or peroxide-induced oxidative stress (23-25). To determine the role of HNF-4alpha in this redox-enhanced iNOS expression, we utilized a mouse model to take advantage of an HNF-4alpha Cre-lox conditional knockout (KO) system (12). HNF-4alpha KO is otherwise embryonically lethal. Hepatocytes were isolated from wild-type (WT) and HNF-4alpha Cre-lox knockout mice by the technique of retrograde vena caval perfusion. Cells were stimulated with IL-1beta (1,000 U/ml) in the presence and absence of BZT (100 µM), an autocatalytic source of superoxide at physiological pH. After a 6-h period of incubation, culture medium levels of the NO metabolite, nitrite, (Table 1) and cellular expression of iNOS protein and mRNA were determined (Fig. 1). Unstimulated cells served as controls. In both WT and HNF-4 KO animals, IL-1beta stimulation produced medium levels of nitrite that were eightfold higher than controls. Addition of BZT with IL-1beta doubled nitrite expression in WT animals only. BZT alone did not alter nitrite levels in either WT or HNF-4 KO cells. Similarly, IL-1beta induced expression of iNOS protein and mRNA in both WT and HNF-4 KO hepatocytes. However, IL-1beta  + BZT significantly augmented iNOS protein and mRNA levels in WT cells only. In the absence of HNF-4alpha , BZT did not augment IL-1beta -mediated hepatocyte iNOS expression.

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Nitric oxide production in murine hepatocytes



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 1.   Inducible nitric oxide synthase (iNOS) protein and mRNA expression in wild-type and hepatocyte nuclear factor 4alpha (HNF-4alpha ) Cre-lox knockout hepatocytes. Hepatocytes were isolated from wild-type and HNF-4alpha Cre-lox knockout (KO) mice by the technique of retrograde vena caval perfusion. Cells were stimulated with interleukin 1beta (IL-1beta ; 1,000 U/ml) in the presence and absence of 1,2,3-benzenetriol (BZT; 100 µM), an autocatalytic source of superoxide at physiological pH. Unstimulated cells served as controls. After a 6-h period of incubation, immunoblot and Northern blot analysis were performed. Blots are representative of 3 experiments. A: immunoblot analysis of iNOS protein expression. B: Northern blot analysis of steady state iNOS mRNA expression. beta -actin serves as the internal control for both wild-type and HNF-4 KO hepatocytes.

To examine the contribution of HNF-4alpha to redox-sensitive iNOS promoter activity, a CAT reporter plasmid construct containing the full-length rat hepatocyte iNOS promoter was transfected into WT and HNF-4 KO murine hepatocytes using the lipofectamine technique (Fig. 2). In WT and HNF-4 KO hepatocytes, IL-1beta stimulation increased CAT expression by tenfold. In contrast, in WT cells only, IL-1beta  + BZT treatment increased CAT expression by fivefold over that noted with IL-1beta . In the HNF-4 KO cells, IL-1beta  + BZT did not alter iNOS promoter activity compared with that of IL-1beta stimulation alone. BZT alone did not alter CAT expression. This indicates that HNF-4alpha is essential for redox-mediated enhancement of hepatocyte iNOS promoter activity. These data from WT murine hepatocytes duplicate our previous observations in primary rat hepatocytes.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2.   Transient transfection analysis of hepatocyte iNOS promoter function in wild-type and HNF-4alpha Cre-lox knockout hepatocytes. Hepatocytes were isolated from wild-type and HNF-4alpha Cre-lox knockout mice by the technique of retrograde vena caval perfusion. Hepatocytes were transfected using the lipofectamine technique. After cells were washed twice with medium, 10 µg of plasmid DNA containing the iNOS promoter construct (1,845 bp; GenBank X95629) coupled to a chloramphenicol acetyltransferase (CAT) reporter gene was added. In selected instances, a dominant-negative (DN)-HNF-4alpha expression vector was cotransfected with the iNOS promoter plasmid construct. After 24 h, cells were stimulated with IL-1beta (1,000 U/ml) in the presence and absence of BZT (100 µM). Unstimulated cells served as controls. After 6 h, the supernatant was assayed for chloramphenicol acetyltransferase (CAT) activity using a CAT ELISA technique. Transfection efficiency was normalized by cotransfection of a beta -galactosidase reporter gene with a constitutively active early SV40 promoter. All values are expressed as pg CAT/mg protein. Data are expressed as means ± SE of 3 experiments performed in triplicate. *P < 0.01 vs. WT, HNF-4alpha , or WT-DN-HNF-4alpha control; #P < 0.01 vs. WT IL-1beta or WT + DN-HNF-4alpha with IL-1B + BZT; **P < 0.01 vs. WT IL-1beta  + BZT; ##P < 0.05 vs. WT under IL-1beta  + BZT or HNF-4 KO under IL-1beta  + BZT.

To further corroborate the role of HNF-4alpha in this system, the DN-HNF-4alpha expression vector was transfected into WT murine hepatocytes. DN-HNF-4alpha exhibits defective DNA binding as the result of a mutation at thymine-316. NO synthesis, as normalized for transfection efficiency, was measured in cells exposed to IL-1beta (1,000 U/ml) in the presence and absence of BZT (100 µM). Unstimulated cells served as controls. In the absence of DN-HNF-4, NO production was 6.3 ± 2.1, 43.2 ± 4.7, 5.5 ± 3.1, and 93 ± 6.7 nmol/mg protein in control, IL-1beta , BZT, and IL-1beta  + BZT cells (P < 0.01 IL-1beta vs. control, BZT, and IL-1beta  + BZT cells; P < 0.01 IL-1beta vs. IL-1beta  + BZT; n = 4). In the presence of DN-HNF-4alpha , NO production in control, IL-1beta , and BZT stimulated cells was not statistically different from those noted in the absence of DN-HNF-4alpha . However, NO production in IL-1beta  + BZT cells with DN-HNF-4alpha was 36.2 ± 4.6, a value that is threefold less than that noted in the absence of DNF-4alpha (P < 0.01).

DN-HNF-4alpha was cotransfected with the iNOS-CAT promoter construct into WT murine hepatocytes (Fig. 2). Similar to that noted in WT hepatocytes without DN-HNF-4alpha , CAT expression in the presence of DN-HNF-4alpha was not statistically different in control, IL-1beta -, and BZT-treated cells. However, in IL-1beta  + BZT cells with DN-HNF-4alpha , CAT expression was increased by only 1.5-fold over IL-1beta cells (P < 0.02). The BZT-associated augmentation of IL-1beta -induced iNOS promoter activation was decreased by threefold in the presence of DN-HNF-4alpha (P < 0.02). These data suggest that HNF-4alpha is required for redox enhancement of iNOS promoter activity in murine hepatocytes.

HNF-4alpha and iNOS activity in ANA-1 macrophages. Additional studies were performed in ANA-1 murine macrophages to support the role of HNF-4alpha in the upregulation of iNOS promoter activity in the setting of IL-1beta and BZT stimulation. ANA-1 cells do not express HNF-4alpha under control, IL-1beta , BZT, and/or IL-1beta  + BZT treatment conditions. In ANA-1 macrophages, NO production was 10.2 ± 1.7, 24.3 ± 3.2, 9.1 ± 1.9, and 28.4 ± 4.3 nmol/mg protein in unstimulated controls, IL-1beta (1,000 U/ml), BZT (100 µM), and IL-1beta and BZT cells, respectively. In ANA-1 cells, cotransfection assays were then performed with 1) the iNOS-CAT promoter construct alone, 2) iNOS-CAT and the HNF-4alpha expression vector, or 3) iNOS CAT with the DN-HNF-4alpha expression vector (Fig. 3). In iNOS-CAT alone, iNOS + HNF-4, and iNOS + DN-HNF-4 transfection conditions, IL-1beta stimulation of ANA-1 cells increased CAT expression by over eightfold compared with unstimulated controls. In the presence of IL-1beta  + BZT, CAT expression is increased fourfold in iNOS + HNF-4 cells only. In the presence of BZT alone, CAT expression for all three transfection conditions is not significantly different from that of control cells. These data indicate that constitutive HNF-4alpha expression in ANA-1 cells significantly augments iNOS promoter trans-activation in the setting of IL-1beta  + BZT stimulation. Interestingly, HNF-4alpha expression in ANA-1 cells treated with only IL-1beta does not increase CAT expression compared with that noted in the absence of HNF-4alpha expression. This result suggests that oxidative stress is a necessary component of the signal transduction pathway by which HNF-4alpha augments cytokine-induced iNOS promoter trans-activation.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 3.   Transient transfection analysis of iNOS promoter activity in ANA-1 murine macrophages. ANA-1 macrophages were transfected using the lipofectamine technique. After cells were washed twice with medium, 10 µg of plasmid DNA containing the iNOS promoter construct (1,845 bp; GenBank X95629) coupled to a CAT reporter gene were added. In selected instances, an HNF-4alpha expression vector (10 µg) or DN-HNF-4alpha expression vector was cotransfected with the iNOS promoter plasmid construct. After 24 h, cells were stimulated with IL-1beta (1,000 U/ml) in the presence and absence of BZT (100 µM). Unstimulated cells served as controls. After 6 h, the supernatant was assayed for CAT activity using a CAT ELISA technique. Transfection efficiency was normalized by cotransfection of a beta -galactosidase reporter gene with a constitutively active early SV40 promoter. All values are expressed as pg CAT/mg protein. Data are expressed as means ± SE of 3 experiments performed in triplicate. *P < 0.01 vs. control ANA-1, control ANA-1 + WT HNF-4, or control ANA-1 + DN-HNF-4; #P < 0.01 vs. IL-1beta -treated ANA-1 + HNF-4. WT, wild type.

Mutagenesis of NF-kappa B and HNF-4alpha binding sites in the iNOS promoter. To determine whether HNF-4alpha acts independently of NF-kappa B, an essential transcription factor for iNOS transcription, the CAT reporter containing the iNOS promoter was mutated at both NF-kappa B binding sites (nt -1044: GGGGATTTTCC to GaaagTTTTCC; nt -114: GGGGACTCTCC to GaaagCTCTCC) and transfected into hepatocytes exposed to IL-1beta , BZT, and IL-1beta  + BZT. Under all treatment conditions, CAT activity was not different from that of unstimulated controls. These data indicate that NF-kappa B sites are essential for iNOS activation; HNF-4alpha functions as an activator that is dependent on NF-kappa B (data not shown).

Another potential mechanism for the action of HNF-4alpha may lie in augmentation of DNA binding of NF-kappa B at either of its two DNA binding sites, nt -965 and nt -109. ChIP assays were performed in WT hepatocytes to examine in vitro NF-kappa B binding in the hepatocyte iNOS promoter (Fig. 4). NF-kappa B binding was exhibited at both binding sites; at each site, there was no difference noted between IL-1beta and IL-1beta  + BZT cells. Compared with the extent of NF-kappa B binding noted in IL-1beta cells, this indicates that HNF-4alpha does not augment NF-kappa B DNA binding in the presence of IL-1beta  + BZT. Also, BZT does not alter IL-1beta -mediated NF-kappa B binding. As expected, no NF-kappa B binding was found in unstimulated controls and BZT cells.


View larger version (52K):
[in this window]
[in a new window]
 
Fig. 4.   Chromatin immunoprecipitation assay of hepatocyte iNOS promoter NF-kappa B (nt -114) and NF-kappa B (nt -1044) binding. Chromatin from hepatocytes was fixed and immunoprecipitated using the ChIP assay kit as recommended by the manufacturer. The purified chromatin was immunoprecipitated using 10 µg of anti-NF-kappa B p50 (Santa Cruz) or 5 µl of rabbit nonimmune serum. The input fraction corresponded to 0.1 and 0.05% of the chromatin solution before immunoprecipitation. After DNA purification, the presence of the selected DNA sequence was assessed by PCR. Blot is representative of 4 experiments.

The HNF-4alpha binding site in the iNOS CAT promoter was mutated, AGGTCA G GGGACA to AGGTCA G catACA, to ablate HNF-4alpha homodimer binding. Transient transfection assays were then repeated in WT hepatocytes. With the use of this mutated iNOS promoter vector, CAT expression in IL-1beta  + BZT was not statistically different from that of IL-1beta cells (20.3 ± 3.1 vs. 23.2 ± 4.2 pg CAT/mg/beta -galactosidase activity). These data indicate that mutation of the HNF-4alpha DNA binding element ablates the increased iNOS promoter activity seen in the presence of IL-1beta  + BZT.

Nuclear localization of HNF-4alpha . HNF-4alpha is primarily localized in the hepatocyte nucleus (38). To determine whether IL-1beta and/or BZT stimulation alters nuclear localization of HNF-4alpha , immunoblots were performed with nuclear protein isolated from control-, IL-1beta -, BZT-, and IL-1beta  + BZT-treated hepatocytes (Fig. 5). Nuclear levels of HNF-4alpha were not altered by IL-1beta or BZT stimulation at 6 or 12 h after treatment. These data demonstrate that nuclear localization of HNF-4alpha is not altered by IL-1beta and/or BZT stimulation. Cytoplasmic expression of HNF-4alpha was undetectable at all time points and treatment conditions (data not shown).


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 5.   Nuclear levels of HNF-4alpha transcription factor. Cells were stimulated with IL-1beta (1,000 U/ml) in the presence and absence of BZT (100 µM). Unstimulated cells served as controls. After 0, 6, and 12 h of incubation, immunoblot analysis of HNF-4alpha was performed in nuclear protein. Blot is representative of 3 experiments.

One-dimensional phosphopeptide mapping of HNF-4alpha . It is well known that tyrosine and serine/threonine phosphorylation (or dephosphorylation) of transcription factors alters activator subcellular localization, DNA binding properties, and transactivation potential. To determine whether distinctive phosphorylation patterns of HNF-4alpha are present among the various treatment conditions, one dimensional phosphopeptide mapping of HNF-4alpha was performed in control, IL-1beta -, BZT-, and IL-1beta  + BZT-treated hepatocytes in the presence of [gamma -32P] ATP. Immunoprecipitated HNF-4alpha was then partially digested with V8 protease and separated with 15% SDS-PAGE (Fig. 6). These results demonstrate that HNF-4alpha is constitutively phosphorylated in unstimulated cells, and the phosphorylation pattern of HNF-4alpha is unaltered in the presence of IL-1beta or BZT stimulation. In contrast, IL-1beta  + BZT stimulation dramatically alters the pattern and extent of HNF-4alpha phosphorylation.


View larger version (95K):
[in this window]
[in a new window]
 
Fig. 6.   One-dimensional phosphopeptide map of HNF-4alpha V8 protease digest. Cells were grown to a subconfluent state and incubated in the presence of [gamma -32P]ATP (0.3 mCi/ml). Cells were stimulated with IL-1beta (1,000 U/ml) in the presence and absence of BZT (100 µM). Unstimulated cells served as controls. After 6 h, HNF-4alpha was immunoprecipitated and subjected to SDS-PAGE (10). The relevant band was excised, digested with S. aureus V8 protease (5 µg/slice), and separated on an 8-15% polyacrylamide gradient gel. Autoradiography was then performed. Blot is representative of 4 experiments. Arrows designate new sites of phosphorylation.

The functional consequence of this unique pattern of phosphorylation was then determined. Hepatocytes were stimulated with IL-1beta  + BZT in the presence and absence of the tyrosine kinase inhibitor, tyrphostin B46 (TYR; 40 µM), and the serine/threonine kinase inhibitor, staurosporine (STA; 1 µM). As generalized kinase inhibition may have untoward effects on transcriptional machinery independent of effects on HNF-4alpha binding to the iNOS promoter, transient transfection assays were not utilized. Instead, ChIP assays were performed to determine in vivo HNF-4alpha DNA binding (Fig. 7). In IL-1beta  + BZT-stimulated hepatocytes, significantly decreased in vivo HNF-4alpha binding to the iNOS promoter was noted in the presence of kinase inhibition. One-dimensional phosphopeptide mapping of HNF-4alpha partially digested with V8 protease was then performed to determine the effect of STA and TYR on the IL-1beta  + BZT pattern of phosphorylation (Fig. 8). These results indicate that the distinct pattern of phosphorylation in IL-1beta  + BZT cells is ablated in the presence of kinase inhibitors and is not different from that of IL-1beta cells. These results indicate that in vivo HNF-4alpha DNA binding 1) is associated with a specific phosphorylation pattern, and 2) requires serine/threonine and/or tyrosine phosphorylation. Further one-dimensional phosphopeptide mapping of HNF-4alpha was performed using STA alone or TYR alone in the presence of IL-1beta  + BZT stimulation. These results suggest that the unique pattern of HNF-4alpha phosphorylation is inhibited in the presence of the STA-mediated serine/threonine kinase inhibition.


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 7.   Chromatin immunoprecipitation assay of iNOS promoter HNF-4alpha binding. Chromatin from hepatocytes was fixed and immunoprecipitated using the ChIP assay kit as recommended by the manufacturer. The purified chromatin was immunoprecipitated using 10 µg of anti-HNF-4alpha or 5 µl of rabbit nonimmune serum. The input fraction corresponded to 0.1 and 0.05% of the chromatin solution before immunoprecipitation. After DNA purification, the presence of the selected DNA sequence was assessed by PCR. Blot is representative of 4 experiments. TYR, tyrphostin B46; STA, staurosporine.



View larger version (80K):
[in this window]
[in a new window]
 
Fig. 8.   One-dimensional phosphopeptide map of HNF-4alpha V8 protease digest. Cells were grown to a subconfluent state and incubated in the presence of [gamma -32P]ATP (0.3 mCi/ml). Cells were stimulated with IL-1beta (1,000 U/ml) and BZT (100 µM). In selected instances, the tyrosine kinase inhibitor tyrphostin B46 (40 µM) and the serine/threonine kinase inhibitor staurosporine (1 µM) were added. Unstimulated cells served as controls. After 6 h, HNF-4alpha was immunoprecipitated and subjected to SDS-PAGE (10). The relevant band was excised, digested with S. aureus V8 protease (5 µg/slice), and separated on an 8-15% polyacrylamide gradient gel. Autoradiography was then performed. Blot is representative of 3 experiments.

After hepatocyte treatment with IL-1beta , BZT, or IL-1beta  + BZT, HNF-4alpha was immunoprecipitated and subjected to immunoblot analysis using phosphotyrosine antibodies, PY350 (Santa Cruz Biotechnology) and 4G10 (Upstate Biotechnology, Waltham, MA), or phosphoserine/threonine antibodies, 61-8,100 antiphosphoserine antibody (Zymed) and 71-8,200 antiphosphothreonine antibody (Zymed) (Fig. 9). In the presence of phosphotyrosine antibodies, no differences were noted. In contrast, a tenfold increase in labeling in IL-1beta  + BZT cells was noted in the presence of the antiphosphoserine and antiphosphothreonine antibodies, suggesting that the unique HNF-4alpha phosphorylation pattern noted in the presence of IL-1beta  + BZT stimulation is the result of serine/threonine phosphorylation.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 9.   Immunoblot analysis of HNF-4alpha phosphotyrosine and phosphoserine/threonine levels. Cells were stimulated with IL-1beta (1,000 U/ml) in the presence and absence of BZT (100 µM). Unstimulated cells served as controls. After 0, 6, and 12 h of incubation, immunoblot analysis of phosphotyrosine and phosphoserine/threonine HNF-4alpha was performed. Blot is representative of 3 experiments.

To confirm that serine/threonine phosphorylation mediates HNF-4alpha DNA binding after cytokine and oxidant stimulation, hepatocytes were stimulated with IL-1beta  + BZT in the presence and absence of the serine/threonine kinase inhibitor, STA (1 µM). ChIP assays were repeated, as above. In this setting, STA treatment ablated IL-1beta  + BZT induced HNF-4alpha DNA binding to the iNOS promoter (Fig. 7).

NO and HNF-4alpha -enhanced iNOS expression. To determine whether NO plays a role in HNF-4alpha -enhanced iNOS promoter activity, transient transfection studies with the iNOS promoter in WT hepatocytes were repeated in the presence of a competitive substrate inhibitor of iNOS, L-N-(1-iminoethyl)lysine hydrochloride (L-NIL; 100 µM) (Fig. 10). In this setting, inhibition of iNOS activity did not alter the enhanced iNOS promoter activity noted in the presence of IL-1beta  + BZT. Also, in IL-1beta  + BZT cells, ChIP assays did not demonstrate a significant difference in HNF-4alpha binding in the presence or absence of L-NIL (data not shown). These results suggest that NO does not play a feedback regulatory role in redox enhanced hepatocyte iNOS promoter activity or HNF-4alpha DNA binding.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 10.   Transient transfection analysis of the effect of nitric oxide on iNOS promoter activity in wild-type hepatocytes. Hepatocytes were transfected using the lipofectamine technique. After cells were washed twice with medium, 10 µg of plasmid DNA containing the iNOS promoter construct (1,845 bp; GenBank X95629) coupled to a CAT reporter gene was added. After 24 h, cells were stimulated with IL-1beta (1,000 U/ml) in the presence and absence of BZT (100 µM). Unstimulated cells served as controls. In selected instances, a competitive substrate inhibitor of iNOS, [L-N-(1-iminoethyl)lysine hydrochloride] (L-NIL; 100 µM) was added. After 6 h, the supernatant was assayed for CAT activity using a CAT ELISA technique. Transfection efficiency was normalized by cotransfection of a beta -galactosidase reporter gene with a constitutively active early SV40 promoter. All values are expressed as pg CAT/mg protein. Data are expressed as means ± SE of 3 experiments performed in triplicate. *P < 0.01 vs. control; #P < 0.01 vs. IL-1beta .

Oxidative stress and alternative inducers of hepatocyte iNOS. We have previously demonstrated that alternative forms of oxidative stress, such as acetaminophen and peroxide, can augment IL-1beta -mediated iNOS promoter activity in hepatocytes (25, 31). To determine the potential role of HNF-4alpha in TNF-alpha - and/or IFN-gamma -induced iNOS expression, NO production was measured in WT murine hepatocytes exposed to TNF-alpha or IFN-gamma in the presence or absence of BZT. In selected instances, the serine/threonine kinase inhibitor STA (1 µM) was added, or the DN-HNF-4alpha expression vector was transfected (Table 2). In both TNF-alpha - and IFN-gamma -stimulated cells, NO production was significantly increased with oxidative stress. Inhibition of serine-threonine kinase activity or expression of DN-HNF-4alpha totally ablated redox-augmented NO production. Subsequently, transient transfection studies were performed with the iNOS promoter-reporter construct under the same experimental conditions (Fig. 11). The resulting CAT expression mirrors those noted with determination of NO production. In both TNF-alpha - and IFN-gamma -stimulated cells, iNOS promoter activation was significantly increased with oxidative stress. Inhibition of serine-threonine kinase activity or expression of DN-HNF-4alpha totally ablated redox-augmented iNOS activation. These results suggest that oxidative stress augments iNOS promoter activity and NO production under TNF-alpha or IFN-gamma induction through a mechanism that involves HNF-4alpha and serine-threonine kinase activation.

                              
View this table:
[in this window]
[in a new window]
 
Table 2.   TNF and IFN-induced NO production in murine hepatocytes



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 11.   Transient transfection analysis of iNOS promoter activity in murine hepatocytes. Hepatocytes were transfected using the lipofectamine technique. After cells were washed twice with medium, 10 µg of plasmid DNA containing the iNOS promoter construct (1,845 bp; GenBank X95629) coupled to a CAT reporter gene were added. After 24 h, cells were stimulated with tumor necrosis factor-alpha (TNF-alpha ; 500 U/ml) or interferon-gamma (IFN-gamma ; 100 U/ml) in the presence and absence of BZT (100 µM). Unstimulated cells served as controls. In selected instances, the serine/threonine kinase inhibitor STA (1 µM) was added, or the DN-HNF-4alpha expression vector was cotransfected. After 6 h, the supernatant was assayed for CAT activity using a CAT ELISA technique. Transfection efficiency was normalized by cotransfection of a beta -galactosidase reporter gene with a constitutively active early SV40 promoter. All values are expressed as pg CAT/mg protein. Data are expressed as means ± SE of 3 experiments performed in triplicate. *P < 0.01 vs. unstimulated cells; **P < 0.01 vs. cytokine stimulated, cytokine + BZT + DN-HNF-4alpha , and cytokine + BZT + STA; #P < 0.01 vs. cytokine + BZT.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

In this study, we demonstrate that HNF-4alpha acts as an activator of redox-associated hepatocyte iNOS expression at the level of protein, mRNA, and promoter activation. In the absence of HNF-4alpha , this redox-mediated enhancement is ablated, as demonstrated by the HNF-4 KO murine hepatocytes and the ANA-1 macrophage HNF-4alpha /DN-HNF-4 cotransfection studies. In addition, in the setting of IL-1beta  + BZT, HNF-4alpha functional activity is associated with a unique serine/threonine phosphorylation pattern that is independent of NO. This would indicate that there exists a redox-sensitive serine/threonine kinase pathway that targets HNF-4alpha to augment hepatocyte iNOS expression. Based upon the ANA-1 data, we may presume that this kinase pathway exists in the macrophage and is not exclusive to the hepatocyte. In summary, our data indicate that a unique pattern of phosphorylation determines HNF-4alpha activity as a trans-activator of IL-1beta -mediated hepatocyte iNOS expression in the presence of oxidative stress. Redox-mediated posttranslational phosphorylation of HNF-4alpha has not been previously examined in the context of hepatocyte iNOS expression.

In sepsis and shock, the host response is characterized by production of proinflammatory cytokines and reactive oxygen species (ROS). These result in multiorgan dysfunction, a leading cause of mortality in the critically ill surgical patient. In this setting, hepatocyte injury and dysfunction are especially significant clinical problems (6, 15, 32-35, 43). Consequently, hepatocyte-derived NO has been extensively studied as a multifunctional free radical produced during shock and sepsis that may limit tissue injury (19, 27, 30). The pervasive nature and functional significance of hepatic iNOS expression is emphasized by the finding that 33/33 human patients undergoing exploratory laparotomy for trauma exhibited detectable iNOS mRNA in the liver (Timothy R. Billiar, unpublished observation). At Duke University Hospital, administration of intravenous methylene blue, an inhibitor of NO function, prior to reperfusion of hepatic allografts (n = 6) is associated with a fourfold increase in peak transaminase values, suggesting increased hepatocyte injury (Jacques Somma, Duke University Medical Center, unpublished observations). However, despite its importance, little is known about redox regulation of hepatocyte iNOS expression.

In the presence of oxidative stress, the hepatocellular redox state upregulates iNOS expression as an antioxidant function. In IL-1beta -treated rat hepatocytes, we showed that iNOS gene transcription and promoter activity are increased by oxidant stress mediated by peroxide, superoxide, or acetaminophen (10, 23, 24, 26, 31). Subsequently, in IL-1beta -stimulated rat hepatocytes exposed to superoxide, we identified a redox-sensitive DR1 cis-acting activator element (nt -1,327 to nt -1,315) in the iNOS promoter: AGGTCA G GGGACA. The corresponding transcription factor was isolated by DNA affinity chromatography, sequenced, and identified to be HNF-4alpha (10, 23).

Although fatty acyl coenzyme A thioesters have been proposed as ligands for HNF-4alpha , they do not affect binding of coactivator or corepressor in vitro, and it remains unclear whether they are truly ligands (4, 13, 14, 37). As a result, HNF-4alpha remains classified as an orphan nuclear receptor. HNF-4alpha exhibits distinct functional domains typical of nuclear hormone receptors. In the NH2-terminal region, AF-1 functions as a constitutive activator of transcription, binds multiple protein targets, and may recruit general transcription factors and chromatin remodeling proteins. A highly conserved DNA binding domain (DBD), composed of two zinc-coordinated modules, is responsible for specific binding to cognate response elements. A flexible hinge region separates the DBD and the putative ligand-binding domain (LBD). The adjacent region also contains the dimerization interface and the transactivation function AF-2. In the COOH terminus, the F domain is a highly variable repressor region (7, 9, 11, 20, 21, 37, 40). Posttranslational modification by phosphorylation is known to alter HNF-4alpha DNA-binding activity, transactivation potential, nuclear translocation, and/or degradation (18, 28, 39, 41, 42).

Cellular stress such as ROS and proinflammatory cytokines regulate intracellular signal transduction cascades and modulate transcription factor activity through calcium signaling, protein kinase, and protein phosphatase pathways. ROS may directly activate kinases by altering thiol-dependent protein-protein interactions, inhibiting phosphatase activity by oxidation of an active site cysteine residue and/or stimulating proteolysis of kinase regulatory proteins. Ultimately, redox regulated tyrosine- and serine/threonine-phosphorylation of transcription factors through tyrosine kinase and stress-activated protein kinase (SAPK) activities alter transcription factor subcellular localization, DNA binding properties, and transactivation potential. In particular, the SAPKs (ERK-1/2, BMK1, JNK, and p38 isoforms) are often the ultimate (and best-characterized) regulatory proteins in a series of sequential kinase reactions that target transcription factor modification in the setting of cellular stresses similar to those of our model (1, 2, 8, 22).

Redox-mediated posttranslational modification of HNF-4alpha has never been previously addressed. HNF-4alpha DNA binding activity and transactivation potential are tightly regulated by its state of phosphorylation and acetylation. HNF-4alpha potentially contains 21 serine, 6 threonine, and 7 tyrosine phosphorylation sites (3, 18). In COS 7 cells, serine/threonine phosphorylation of HNF-4alpha increases affinity and specificity of DNA binding by altering its tertiary structure (18). Tyrosine phosphorylation of HNF-4alpha is required for DNA binding, transactivation, and subnuclear localization in primary cultures of rat hepatocytes (21). In contrast, protein kinase A-dependent phosphorylation within the DBD inhibits DNA binding in HepG2 and Cos 1 cells (41). In vivo experiments support the functional importance of HNF-4alpha phosphorylation state. In a murine model of 15% burn injury, hepatocyte HNF-4alpha DNA binding is enhanced by serine phosphorylation (Ref. 5 and Peter A. Burke, M.D., personal communication). Dietary protein restriction or overnight fasting decreases hepatic HNF-4alpha DNA binding activity as a result of decreased serine/threonine phosphorylation (38, 41). Acetylation of HNF-4alpha is crucial for proper nuclear retention, DNA binding, and promoter activation in COS 1 and NIH 3T3 cells (18). Although HNF-4alpha activity is certainly regulated by posttranslational modification, redox-mediated posttranslational phosphorylation or acetylation of HNF-4alpha has not been examined.

In summary, experimental findings in models of sepsis and shock suggest that NO synthesis serves an antioxidant function that is redox modulated. However, the relationship between oxidative stress and iNOS gene transcription remains unexplored. In IL-1beta -stimulated hepatocytes, we have demonstrated that 1) an HNF-4alpha functions as a redox-sensitive trans-activator of iNOS transcription, and 2) HNF-4alpha exhibits a unique redox-dependent phosphorylation pattern. Future experiments are required to characterize the molecular regulatory pathway by which HNF-4alpha integrates multiple extra- and intra-cellular signals mediated by kinase cascades to precisely regulate redox-dependent hepatocyte iNOS gene expression. These considerations are crucial to our understanding of HNF-4alpha as a novel and, as yet, poorly described redox-sensitive mechanism that regulates hepatocyte iNOS expression as an antiapoptotic and antioxidant function in the setting of sepsis and shock.


    ACKNOWLEDGEMENTS

This work was supported by National Institutes of Health Grants AI-44629 and GM-65113 (to P. C. Kuo) and the American College of Surgeons Clowes Development Award (to P. C. Kuo).


    FOOTNOTES

Address for reprint requests and other correspondence: P. C. Kuo, Dept. of Surgery, DUMC, 110 Bell Bldg., Box 3522, Durham, NC 27710 (E-mail: kuo00004{at}mc.duke.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

First published December 4, 2002;10.1152/ajpcell.00394.2002

Received 28 August 2002; accepted in final form 26 November 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Allen, RG, and Tresini M. Oxidative stress and gene regulation. Free Radic Biol Med 28: 463-499, 2000[Web of Science][Medline].

2.   Berk, BC. Redox signals that regulate the vascular response to injury. Thromb Haemost 82: 810-817, 1999[Web of Science][Medline].

3.   Blom, N, Gammeltoft S, and Brunak S. Sequence and structure-based prediction of eukaryotic protein phosphorylation sites. J Mol Biol 294: 1351-1362, 1999[Web of Science][Medline].

4.   Bogan, AA, Dallas-Yang Q, Ruse MDJ, Maeda Y, Jiang G, Nepomuceno L, Scanlan TS, Cohen FE, and Sladek FM. Analysis of protein dimerization and ligand binding of orphan receptor HNF4alpha . J Mol Biol 302: 831-851, 2000[Web of Science][Medline].

5.   Burke, PM, Luo M, and Yaffe MFR Burn injury modifies the DNA binding of HNF-4, a liver specific transcription factor by posttranslational modification (Abstract). Shock 7, Suppl: 17, 1997[Web of Science][Medline].

6.   Clowes, GHA, Hirsch E, George BC, Bigatello LM, Mazuski JE, and Villee CA. Survival from sepsis: the significance of altered protein metabolism regulated by proteolysis inducing factor, the circulating cleavage factor of interleukin-1. Ann Surg 202: 446-458, 1985[Web of Science][Medline].

7.   Fraser, JD, Martinez V, Straney R, and Briggs MR. DNA binding and transcription activation specificity of hepatocyte nuclear factor 4. Nucleic Acids Res 26: 2702-2707, 1998[Abstract/Free Full Text].

8.   Gabbita, SP, Robinson KA, Stewart CA, Floyd RA, and Hensley K. Redox regulatory mechanisms of cellular signal transduction. Arch Biochem Biophys 376: 1-13, 2000[Web of Science][Medline].

9.   Green, VJ, Kokkotou E, and Ladias JA. Critical structural elements and multitarget protein interactions of the transcriptional activator AF-1 of hepatocyte nuclear factor 4. J Biol Chem 273: 29950-29957, 1998[Abstract/Free Full Text].

10.   Guo, H, Cai CQ, and Kuo PC. Hepatocyte nuclear factor-4alpha mediates redox sensitivity of inducible nitric oxide synthase gene transcription. J Biol Chem 277: 5054-5060, 2002[Abstract/Free Full Text].

11.   Hadzopoulou-Cladaras, M, Kistanova E, Evagelopoulou C, Zeng S, Cladaras C, and Ladias JA. Functional domains of the nuclear receptor hepatocyte nuclear factor 4. J Biol Chem 272: 539-550, 1997[Abstract/Free Full Text].

12.   Hayhurst, GP, Lee YH, Lambert G, Ward JM, and Gonzalez FJ. Hepatocyte nuclear factor 4alpha (nuclear receptor 2A1) is essential for maintenance of hepatic gene expression and lipid homeostasis. Mol Cell Biol 21: 1393-1403, 2001[Abstract/Free Full Text].

13.   Hertz, R, Magenheim J, Berman I, and Bar-Tana J. Fatty acyl-CoA thioesters are ligands of hepatic nuclear factor-4alpha . Nature 392: 512-516, 1998[Medline].

14.   Hertz, R, Sheena V, Kalderon B, Berman I, and Bar-Tana J. Suppression of hepatocyte nuclear factor-4alpha by acyl-CoA thioesters of hypolipidemic peroxisome proliferators. Biochem Pharmacol 61: 1057-1062, 2001[Web of Science][Medline].

15.   Jarrar, D, Wang P, Cioffi WG, Bland KI, and Chaudry IH. Critical role of oxygen radicals in the initiation of hepatic depression after trauma hemorrhage. J Trauma 49: 879-885, 2000[Web of Science][Medline].

16.   Jiang, G, Lee U, and Sladek FM. Proposed mechanism for the stabilization of nuclear receptor DNA binding via protein dimerization. Mol Cell Biol 17: 6546-6554, 1997[Abstract].

17.   Jiang, G, Nepomuceno L, Hopkins K, and Sladek FM. Exclusive homodimerization of the orphan receptor hepatocyte nuclear factor 4 defines a new subclass of nuclear receptors. Mol Cell Biol 15: 5131-5143, 1995[Abstract].

18.   Jiang, G, Nepomuceno L, Yang Q, and Sladek FM. Serine/threonine phosphorylation of orphan receptor hepatocyte nuclear factor 4. Arch Biochem Biophys 340: 1-9, 1997[Web of Science][Medline].

19.   Kelly, E, Morris SM, and Billiar TR. Nitric oxide, sepsis, and arginine metabolism. J Parenter Enteral Nutr 19: 234-238, 1995[Abstract/Free Full Text].

20.   Kistanova, E, Dell H, Tsantili P, Falvey E, Cladaras C, and Hadzopoulou-Cladaras M. The activation function-1 of hepatocyte nuclear factor-4 is an acidic activator that mediates interactions through bulky hydrophobic residues. Biochem J 356: 635-642, 2001[Web of Science][Medline].

21.   Ktistaki, E, Ktistakis NT, Papadogeorgaki E, and Talianidis I. Recruitment of hepatocyte nuclear factor 4 into specific intranuclear compartments depends on tyrosine phosphorylation that affects its DNA-binding and transactivation potential. Proc Natl Acad Sci USA 92: 9876-9880, 1995[Abstract/Free Full Text].

22.   Kunsch, C, and Medford RM. Oxidative stress as a regulator of gene expression in the vasculature. Circ Res 85: 753-766, 1999[Abstract/Free Full Text].

23.   Kuo, PC, Abe K, and Schroeder RA. Superoxide enhances interleukin 1beta -mediated transcription of the hepatocyte-inducible nitric oxide synthase gene. Gastroenterology 118: 608-618, 2000[Web of Science][Medline].

24.   Kuo, PC, and Abe KY. Interleukin-1 induced production of nitric oxide inhibits benzenetriol mediated oxidative injury in rat hepatocytes. Gastroenterology 109: 206-216, 1995[Web of Science][Medline].

25.   Kuo, PC, Schroeder RA, and Loscalzo J. Nitric oxide and acetaminophen mediated oxidative injury: modulation of interleukin-1 induced nitric oxide synthesis in cultured rat hepatocytes. J Pharmacol Exp Ther 282: 1072-1083, 1997[Abstract/Free Full Text].

26.   Kuo, PC, and Slivka A. Nitric oxide decreases oxidant mediated hepatocyte injury. J Surg Res 56: 594-600, 1994[Web of Science][Medline].

27.   Liu, S, Beckman JS, and Ku DD. Peroxynitrite, a product of superoxide and nitric oxide, produces coronary vasorelaxation in dogs. J Pharmacol Exp Ther 268: 1114-1121, 1994[Abstract/Free Full Text].

28.   Malik, S, and Karathanasis SK. TFIIB-directed transcriptional activation by the orphan nuclear receptor hepatocyte nuclear factor 4. Mol Cell Biol 16: 1824-1831, 1996[Abstract].

29.   Meszaros, KS, Aberle S, White M, and Parent JB. Immunoreactivity and bioactivity of lipopolysaccharide binding protein in normal and heat inactivated sera. Infect Immun 63: 363-365, 1995[Abstract].

30.   Nathan, C. Nitric oxide as a secretory product of mammalian cells. FASEB J 6: 1157-1175, 1992.

31.   Punzalan, C, Cai C, Schroeder RA, and Kuo PC. Redox regulation of the rat hepatocyte iNOS promoter. Surgery 126: 450-455, 1999[Web of Science][Medline].

32.   Ramos-Kelly, JR, Toledo-Pereyra LH, Jordan J, Rivera-Chavez F, Rohs T, Holevar M, Dixon RA, Yun E, and Ward PA. Multiple selectin blockade with a small molecule inhibitor downregulates liver chemokine expression and neutrophil infiltration after hemorrhagic shock. J Trauma 49: 92-100, 1999[Web of Science].

33.   Rolando, N, Wade J, Davalos M, Wendon J, Philpott-Howard J, and Williams R. The systemic inflammatory response syndrome in acute liver failure. Hepatology 32: 734-739, 2000[Web of Science][Medline].

34.   Rosenblatt, S, Clowes G, George BC, Hirsch E, and Lindberg B. Exchange of amino acids by muscle and liver in sepsis. Arch Surg 118: 167-175, 1983[Abstract/Free Full Text].

35.   Sax, HC, Talamini MA, Hasselgren PO, Rosenblum L, and Ogle CK. Increased synthesis of secreted hepatic proteins during abdominal sepsis. J Surg Res 44: 109-116, 1988[Web of Science][Medline].

36.   Schuetz, EG, Wrighton SA, Safe GH, and Guzelian PS. Regulation of cytochrome P450 by phenobarbital and phenobarbital-like inducers in adult rat hepatocytes in primary monolayer culture and in vitro. Biochemistry 25: 1124-1133, 1986[Medline].

37.   Sladek, FM, Ruse MDJ, Nepomuceno L, Huang SM, and Stallcup MR. Modulation of transcriptional activation and coactivator interaction by a splicing variation in the F domain of nuclear receptor hepatocyte nuclear factor 4alpha 1. Mol Cell Biol 19: 6509-6522, 1999[Abstract/Free Full Text].

38.   Sladek, R, and Giguere V. Orphan nuclear receptors: an emerging family of metabolic regulators. Adv Pharmacol 47: 23-87, 2000[Medline].

39.   Soutoglou, E, Katrakili N, and Talianidis I. Acetylation regulates transcription factor activity at multiple levels. Mol Cell 5: 745-751, 2000[Web of Science][Medline].

40.   Suaud, L, Formstecher P, and Laine E. The activity of the activation function 2 of the human hepatocyte nuclear factor 4 (HNF-4alpha ) is differently modulated by F domains from various origins. Biochem J 340: 161-169, 1999[Web of Science][Medline].

41.   Viollet, B, Kahn A, and Raymondjean M. Protein kinase A-dependent phosphorylation modulates DNA-binding activity of hepatocyte nuclear factor 4. Mol Cell Biol 17: 4208-4219, 1997[Abstract].

42.   Wang, B, Cai SR, Gao C, Sladek FM, and Ponder KP. Lipopolysaccharide results in a marked decrease in hepatocyte nuclear factor 4 alpha  in rat liver. Hepatology 34: 979-989, 2001[Web of Science][Medline].

43.   Weigand, MA, Schmidt H, Pourmahmoud M, Zhao Q, Martin E, and Bardenheuer HJ. Circulating intercellular adhesion molecule-1 as an early predictor of hepatic failure in patients with septic shock. Crit Care Med 27: 2656-2661, 1999[Web of Science][Medline].


Am J Physiol Cell Physiol 284(4):C1090-C1099
0363-6143/03 $5.00 Copyright © 2003 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
K. Klein, G. A. Kullak-Ublick, M. Wagner, M. Trauner, and J. J. Eloranta
Hepatocyte nuclear factor-4{alpha} and bile acids regulate human concentrative nucleoside transporter-1 gene expression
Am J Physiol Gastrointest Liver Physiol, April 1, 2009; 296(4): G936 - G947.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
H. Guo, C. Gao, Z. Mi, J. Zhang, and P. C. Kuo
Characterization of the PC4 Binding Domain and its Interactions with HNF4{alpha}
J. Biochem., May 1, 2007; 141(5): 635 - 640.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
D. Sauvaget, V. Chauffeton, S. Dugue-Pujol, A.-D. Kalopissis, I. Guillet-Deniau, F. Foufelle, J. Chambaz, A. Leturque, P. Cardot, and A. Ribeiro
In Vitro Transcriptional Induction of the Human Apolipoprotein A-II Gene by Glucose
Diabetes, March 1, 2004; 53(3): 672 - 678.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
P.-Y. Cheng, M. Wang, and E. T. Morgan
Rapid Transcriptional Suppression of Rat Cytochrome P450 Genes by Endotoxin Treatment and Its Inhibition by Curcumin
J. Pharmacol. Exp. Ther., December 1, 2003; 307(3): 1205 - 1212.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/4/C1090    most recent
00394.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guo, H.
Right arrow Articles by Kuo, P. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guo, H.
Right arrow Articles by Kuo, P. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online