Am J Physiol Cell Physiol Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 284: C1006-C1020, 2003. First published December 11, 2002; doi:10.1152/ajpcell.00258.2002
0363-6143/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Videos
Right arrow All Versions of this Article:
284/4/C1006    most recent
00258.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (14)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Estacion, M.
Right arrow Articles by Schilling, W. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Estacion, M.
Right arrow Articles by Schilling, W. P.
Vol. 284, Issue 4, C1006-C1020, April 2003

Blockade of maitotoxin-induced endothelial cell lysis by glycine and L-alanine

Mark Estacion, Justin S. Weinberg, William G. Sinkins, and William P. Schilling

Rammelkamp Center for Education and Research, MetroHealth Medical Center and Department of Physiology and Biophysics, Case Western Reserve University, School of Medicine, Cleveland, Ohio 44109


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The maitotoxin (MTX)-induced cell death cascade in bovine aortic endothelial cells (BAECs) is a model for oncotic/necrotic cell death. The cascade is initiated by an increase in cytosolic free Ca2+ concentration ([Ca2+]i), which is followed by the biphasic uptake of vital dyes. The initial phase of dye entry reflects activation of large pores and correlates with surface membrane bleb formation; the second phase reflects cell lysis. In the present study, the effect of the cytoprotective amino acid glycine was examined. Glycine had no effect on MTX-induced change in [Ca2+]i or on the first phase of vital dye uptake but produced a concentration-dependent (EC50 ~1 mM) inhibition of the second phase of dye uptake. No cytoprotective effect was observed with L-valine, L-proline, or D-alanine, whereas L-alanine was equieffective to glycine. Furthermore, glycine had no effect on MTX-induced bleb formation. To test the hypothesis that glycine specifically blocks formation of a lytic "pore," the loss of fluorescence from BAECs transiently expressing GFP and concatemers of GFP ranging in size from 27 to 162 kDa was examined using time-lapse videomicroscopy. MTX-induced loss of GFP was rapid, correlated with the second phase of dye uptake, and was relatively independent of molecular size. The MTX-induced loss of GFP from BAECs was completely blocked by glycine. The data suggest that the second "lytic" phase of MTX-induced endothelial cell death reflects formation of a novel permeability pathway that allows macromolecules such as GFP or LDH to escape, yet can be prevented by the cytoprotective agents glycine and L-alanine.

necrosis; vital dyes; membrane blebs; time-lapse videomicroscopy; fura 2


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

BECAUSE OF ITS UNIQUE LOCATION and varied function, the vascular endothelium plays an active role in the development or progression of various cardiovascular diseases including atherosclerosis, hypertension, and ischemic-reperfusion injury. Specifically, endothelial cell function may be compromised in disease states as a result of oxidative stress arising, for example, from activation of leukocytes, the products of drug metabolism, uptake of oxidized lipoproteins, and/or the reduction of molecular oxygen (3, 20, 28, 29). Such cellular insults, which ultimately lead to either apoptotic or necrotic (oncotic) cell death, share a common feature; i.e., they appear to trigger a rise in cytosolic free Ca2+ concentration ([Ca2+]i) (26, 29, 34). Although the immediate downstream molecular events linking a rise in [Ca2+]i to oncosis and/or apoptosis remain largely unknown, defining the biochemical steps in the cell death cascade may be essential to our understanding of vascular disease and the ultimate design of effective therapeutic interventions.

Natural products such as cholera toxin, pertussis toxin, tetrodotoxin, digitalis, ryanodine, and thapsigargin have proved extremely useful for the identification and characterization of specific biochemical pathways important for cell signaling. Maitotoxin (MTX), isolated from the dinoflagellate Gambierdiscus toxicus, is the most potent marine toxin known and a major causative agent of ciguatera seafood poisoning. The reported LD50 value in mice is 0.2 µg/kg (33). When added to cells at subnanomolar concentrations, MTX activates Ca2+-permeable, nonselective cation channels (CaNSC) and produces a dramatic increase in [Ca2+]i (2, 6, 11, 15, 22, 31, 36, 43). In a variety of nonexcitable cells, the MTX-induced rise in [Ca2+]i is followed closely in time by the opening of large endogenous pores in the plasmalemma of defined molecular size (31, 32). These pores, which allow molecules of less than ~800 Da to enter or exit the cell, appear to play an important role in MTX-induced oncotic cell death and hence have been designated as cytolytic/oncotic pores, or COP. The formation or activation of COP can be monitored by measuring uptake of ethidium- and propidium-based vital dyes that are normally excluded from the cytoplasm but that exhibit increased fluorescence following access to cellular nucleic acids. By simultaneously recording phase and fluorescence images using time-lapse videomicroscopy, we have recently shown that MTX-induced vital dye uptake in bovine aortic endothelial cells (BAECs) is biphasic (12). The rate of dye uptake during the initial phase is inversely proportional to dye molecular weight, but the second phase appears to be all-or-nothing and independent of molecular size. The second phase of dye uptake correlates with lactate dehydrogenase (LDH) release and therefore reflects cell lysis. Thus the MTX-induced cell death cascade consists of three distinct phases: 1) activation of CaNSC, 2) formation or activation of COP, and 3) cytolysis. Although the timing of each phase varies from cell to cell, it is important to note that this cascade is seen in all cell types examined to date (32). The ubiquitous nature of the MTX-induced response suggests a fundamental mechanism that is specific and conserved. Furthermore, the MTX-induced cell death cascade is virtually identical to that produced by activation of purinergic receptors of the P2Z/P2X7 subtype (31, 32), suggesting that activation of Ca2+-permeable cation channels of different types is linked to cell death via the formation or activation of COP.

The changes in plasmalemmal permeability associated with challenge by MTX are accompanied by dramatic alterations in cell morphology (12). Specifically, MTX causes formation of spherical membrane blebs that extend out from the surface of the cell with a diameter of 3-5 µm. The initial formation of membrane blebs occurs during the first phase of dye uptake and thus correlates with COP formation or activation. During the second phase of dye uptake, the preformed blebs dilate into enormous spheres that often dwarf the parent cell in size and number. Although the kinetics of lysis have never been determined at the single-cell level, LDH release correlates not with deflation or rupture of the blebs but, rather, with dramatic bleb dilation. The mechanisms involved in MTX-induced bleb formation and dilation remain unknown.

To better evaluate the contribution of COP to the cell death cascade, specific high-affinity antagonists or blockers are needed. Evidence has accumulated over the last 15 years indicating that small amino acids such as glycine and alanine have cytoprotective effects against a variety of oxidative, metabolic, and chemical insults (5, 7, 21, 23, 25, 37, 39-42). Furthermore, glycine appears to be a key component in storage/perfusion solutions employed for liver transplantation, protecting against hepatic ischemia-reperfusion injury (1, 4, 19, 27). In kidney tubules, glycine affords protection against a variety of insults that deplete energy stores and elevate [Ca2+]i (38, 40). Interestingly, in the presence of glycine, ATP-depleted renal proximal tubule cells can survive and subsequently proliferate despite loss of ion concentration gradients and sustained increases in [Ca2+]i to values between 10 and 100 µM (8). Although the mechanism of glycine action remains unknown, the molecular target appears to be extracellular, because impermeable glycine mimetics afford similar cytoprotection against ATP depletion-induced damage (9). Recent studies have shown that glycine blocks necrotic cell death of cultured hepatic sinusoidal endothelial cells exposed to cyanide, a form of chemical hypoxia, and it was suggested, on the basis of the uptake of vital dyes and fluorescent dextrans of varying molecular weights, that glycine blocks the opening of a death "channel" that allows large macromolecules to enter and exit the cell (24). Thus the purpose of the present study was to determine whether glycine could protect against MTX-induced cell death in vascular endothelial cells. The results demonstrate that glycine has no effect on MTX-induced rise in [Ca2+]i or on vital dye uptake via COP in BAECs. Likewise, glycine failed to prevent the MTX-induced membrane bleb formation or dilation. However, glycine completely blocked MTX-induced cell lysis. These results suggest that glycine supplementation or infusion may be an effective therapeutic regime for ciguatera seafood poisoning. Perhaps more importantly, these results suggest commonality in the final lytic step of necrosis induced by a variety of insults in a variety of cell types.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Solutions and reagents. HEPES-buffered saline (HBS) contained 140 mM NaCl, 5 mM KCl, 1 mM MgCl2, 1.8 mM CaCl2, 10 mM D-glucose, 15 mM HEPES, and 0.1% bovine serum albumin, pH adjusted to 7.4 at 37°C with NaOH. Fura 2 acetoxymethyl ester (fura 2-AM), ethidium bromide (EB), propidium iodide (PI), YO-PRO-1, and POPO-3 were obtained from Molecular Probes (Eugene, OR). MTX was obtained from Wako Bioproducts (Richmond, VA) and stored as a stock solution in ethanol at -20°C. The D and L enantiomers of alanine were obtained from Sigma Chemical and were stated to be 98% pure based on TLC assay. U-73343 [1-(6-{[17beta -3-methoxyestra-1,3,5(10)-trien-17-yl]amino}hexyl)- 2,5-pyrrolidinedione], the inactive analog of the phospholipase C inhibitor U-73312, was obtained from CalBiochem.

Cell culture. BAECs were cultured as previously described (10, 30) by using Dulbecco's modified Eagle's medium (GIBCO) supplemented with 10% fetal bovine serum (Hyclone, Logan UT), 100 µg/ml streptomycin, 100 µg/ml penicillin, and 2 mM glutamine (complete-DMEM). All cultures demonstrated a contact-inhibited cobblestone appearance typical of endothelial cells.

Measurement of the apparent cytosolic free Ca2+ concentration. [Ca2+]i was measured using the fluorescent indicator fura 2 as previously described (30). Experiments were performed with cells in the twelfth to twentieth passage and 2-3 days postconfluency. Briefly, cells were harvested and resuspended in HBS containing 20 µM fura 2-AM. After 30 min of incubation at 37°C, the cell suspension was diluted ~10-fold with HBS, incubated for an additional 30 min, washed, and resuspended in fresh HBS. Aliquots from this final suspension were subjected to centrifugation and washed twice immediately before fluorescence was measured. Fluorescence was recorded with an SLM 8100 spectrophotofluorometer; excitation wavelength alternated between 340 and 380 nm every second, and fluorescence intensity was monitored at an emission wavelength of 510 nm. All measurements were performed at 37°C.

Measurement of vital dye uptake. An aliquot (2 ml) of dispersed cells suspended in HBS at 37°C was placed in a cuvette. After the addition of EB (final concentration 2.5 µM), fluorescence was recorded at 1-s intervals as a function of time with excitation and emission wavelengths of 302 and 560 nm, respectively. All EB fluorescence values are corrected for background (extracellular) dye fluorescence and expressed as the percentage relative to the value obtained following complete permeabilization of the cells with 50 µM digitonin. Uptake of POPO-3 (1 µM) and YO-PRO-1 (1 µM) was determined as described for ethidium with excitation/emission wavelengths of 530/565 and 468/510, respectively.

Measurement of LDH release. Aliquots of dispersed cells (2 ml) were incubated at 37°C for various lengths of time in the presence and absence of MTX. The cells were pelleted by centrifugation for 15 s at 12,000 rpm in an Eppendorf centrifuge (model 5415C). The supernatants were removed and placed on ice. Enzyme activity in aliquots (50 µl) of the supernatants was determined using the LD-L kit from Sigma. All values are expressed as the percentage of LDH released relative to the value obtained following permeabilization of the cells with 50 µM digitonin.

Time-lapse videomicroscopy. BAECs in complete-DMEM were sparsely seeded on circular glass coverslips and used within 2-3 days of seeding. The coverslips were mounted in temperature-controlled perfusion chambers and placed on the stage of a Nikon Diaphot inverted microscope. The cells were illuminated with light from a 75-W xenon lamp that was passed through filter cubes (Molecular Probes) appropriate for EB, PI, and POPO-3 (model O-5722) or YO-PRO-1 and green fluorescent protein (GFP) (model O-5717). Epifluorescence was recorded with a SPOT camera (Diagnostic Instruments, Sterling Heights, MI), and images were acquired and analyzed using SimplePCI imaging software (Compix, Cranberry Township, PA). During each experiment, phase and fluorescence image pairs were collected at 30-s intervals with shutter controllers switching between light and fluorescent illumination. The fluorescence images were used to quantify dye uptake or GFP loss. For dye uptake, a region over individual cells was defined and the fluorescence intensity of the region was quantified as a function of time. Phase images were digitally merged with the corresponding fluorescence images, and time-lapse videos were created using the SimplePCI software. To quantify total GFP fluorescence, a region of interest was drawn around the GFP-positive cell such that it fully enclosed the cell throughout the entire experiment (i.e., including the blebs). The corrected total GFP signal was obtained by subtracting the average background level, determined from a nearby control region lacking cells, over the entire region of interest. The background-subtracted GFP fluorescence was summed for all the pixels within the region of interest. These data were then normalized to the baseline established during the first 5 min to enable comparison between cells. For long-term experiments (Figs. 9-13), BAECs were seeded on 35-mm plastic tissue culture dishes.

Creation of GFP concatemers. The starting point for creation of GFP concatemers was the expression vector pEGFP-C1 (Clontech), which is designed to allow expression of GFP fusion proteins in mammalian cells. Typically, the gene of interest is cloned into a multiple cloning site, in frame, 3' to the vector copy of GFP lacking a stop codon. For this investigation, the gene of interest was one or more copies of GFP itself. PCR primers were generated to amplify GFP as well as to add appropriate bases at the 5'- and 3'-ends to create convenient restriction sites. For example, the primers TTCAGATCTATGGTGAGCAAGGGCGAGGAGCTGTTC (forward) and TTAAGCTTCTTGTACAGCTCGTCCATGCC (reverse) were used to amplify a copy of GFP with BglII and HindIII sites at the 5'- and 3'-ends, respectively. The PCR product was subcloned into pEGFP-C1 to produce the GFP-2 expression plasmid. Larger concatemers were created sequentially with similar PCR products and the following pairs of restriction sites: GFP-3, HindIII and SalI; GFP-4, SalI and SacII; and GFP-5, SacII and BamHI. To create the GFP-6 plasmid, the multiple cloning site of GFP-5 (containing 4 copies of GFP) was excised with BglII and BamHI and subcloned into the BamHI site of the GFP-2 plasmid.

Transfection of BAECs with GFP constructs. Cells were seeded onto 35-mm culture dishes and maintained until they reached 90-95% confluence. A single dish of cells was transfected with 2 µg of GFP cDNA, using Lipofectamine 2000 (Invitrogen). Twenty-four hours after transfection, the cells were dispersed with trypsin-EDTA and reseeded onto 12-mm glass coverslips (6-9 coverslips per 35-mm dish). The coverslips were used for experimentation 24-48 h after seeding.

Electrophoresis and Western blotting. To obtain protein samples for electrophoretic analysis, we harvested a dish of transfected cells by scraping with a rubber policeman. Cells were pelleted by centrifugation, washed once with ice-cold PBS, and resuspended in a lysis buffer containing 20 mM Tris (pH 8.0), 150 mM NaCl, 1 mM EDTA, 1% NP-40, and protease inhibitor cocktail (Roche). After 1 h on ice, insoluble material was removed by centrifugation. Lysate proteins were separated by SDS-PAGE (7.5% acrylamide), transferred to polyvinylidene difluoride membranes, and incubated with anti-GFP antibodies (sc-8334; Santa Cruz Biotechnology). After being washed, the membrane was incubated with horseradish peroxidase-conjugated anti-rabbit secondary IgG (NA934; Amersham) and the protein bands were detected by chemiluminescence (ECL Plus; Amersham). Apparent molecular mass was estimated by comparison with biotinylated standards (Bio-Rad).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

As previously reported (12), addition of MTX to BAECs suspended in normal Ca2+-containing buffer in the absence of glycine produced a biphasic uptake of the vital dye EB (Fig. 1A). The first phase reflects opening of COP, whereas the second phase correlates with LDH release and is indicative of cell lysis. Supplementation of the buffer with 5 mM glycine had no effect on the first phase of EB uptake but completely blocked the second lytic phase (Fig. 1). The effect of glycine was dose dependent. At concentrations <5 mM, glycine appeared to primarily cause a delay in the time to cell lysis. However, in the presence of 5 mM glycine, MTX-induced cell lysis was prevented, even when examined 48 h after MTX addition (see below). To determine whether glycine could block MTX-induced rise in [Ca2+]i, which appears to be required for activation of COP and for the subsequent cell lysis, MTX was added to fura 2-loaded BAECs suspended in normal Ca2+-containing buffer. As shown in Fig. 1B, glycine (5 mM) had no effect on the rise in [Ca2+]i. As a positive control, we tested the effect of U-73343, a compound previously shown to block all phases of the MTX-induced response in BAECs (13). U-73343 (10 µM) completely blocked the rise in [Ca2+]i after the addition of MTX (Fig. 1B). Together, these results suggest that glycine has no effect on MTX-induced activation of CaNSC or COP but selectively blocks MTX-induced cell lysis.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 1.   Effect of glycine on maitotoxin (MTX)-induced responses in bovine aortic endothelial cells (BAECs). A: ethidium bromide (EB) uptake in BAECs was determined from the increase in fluorescence as a function of time as described in MATERIALS AND METHODS. Five traces are shown superimposed. For each trace, cells were suspended in HEPES-buffered saline (HBS) supplemented with the concentration of glycine (Gly) indicated. EB was added to the cuvette at 50 s, and MTX (0.3 nM) was added at 100 s. (In this and all subsequent figures, values given indicate final concentrations.) Values are normalized to the maximum fluorescence obtained by addition of digitonin at the end of each trace. Results are representative of 5 independent experiments. B: fura 2-loaded BAECs were suspended in HBS and cytosolic free Ca2+ concentration ([Ca2+]i) was calculated from the fluorescence ratio as a function of time as described in MATERIALS AND METHODS. Four average traces are shown superimposed. MTX was added to the cuvette at the time indicated (arrow) in the absence (triangle ) or presence of 5 mM glycine () or 10 µM U-73343 (diamond ) as indicated. Control trace in the absence of MTX is also shown (). Curves represent mean values from 3 independent experiments; symbols represent means ± SE at selected time points (i.e., at 50-s intervals). Previous studies have shown that MTX causes the efflux of fura 2 from the cells at later times (31). For this reason, the y-axis is labeled "apparent" [Ca2+]i.

Previous studies have shown that the uptake of vital dyes via COP is inversely proportional to dye molecular weight (12). To confirm that glycine has no effect on COP, we compared the uptake of vital dyes of increasing molecular weights, specifically those of EB (MW 314), YO-PRO-1 (MW 375), and POPO-3 (MW 715). In each case, the presence of glycine (5 mM) in the extracellular buffer had no effect on the rate of dye uptake during the first phase but completely blocked dye uptake during the second lytic phase (Fig. 2). Furthermore, glycine had no apparent effect on the permeability of the COP pathway, i.e., dye influx via COP followed the sequence EB > YO-PRO-1 > POPO-3 in either the presence or absence of glycine, consistent with the hypothesis that COP is a static pore of fixed size and defined permeability (Fig. 2D).


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2.   Effect of glycine on MTX-induced uptake of vital dyes. Uptake of EB (MW 314; A), YO-PRO-1 (MW 375; B), and POPO-3 (MW 715; C) in response to MTX was measured as a function of time in the absence (filled symbols) or presence (open symbols) of 5 mM glycine. Curves represent mean values from 3 independent experiments; symbols represent means ± SE at selected time points (i.e., every 100 s). D: dye uptake in the presence of glycine (from A-C) replotted on an expanded y-scale.

To determine whether the effect of glycine on MTX-induced cell lysis is specific, we examined the effect of various amino acids on dye uptake. The presence of L-valine, L-leucine, or L-proline (5 mM) in the extracellular buffer had no effect on either the time course or magnitude of MTX-induced YO-PRO-1 uptake (Fig. 3). In contrast, L-alanine was just as effective as glycine at blocking the second phase of dye uptake, whereas D-alanine produced only a slight delay but did not prevent cell lysis. The slight effect seen with D-alanine may in fact reflect contamination with L-alanine, because the purity of these compounds was only 98%. These results demonstrate that glycine and L-alanine selectively block MTX-induced cell lysis and that this response exhibits stereospecificity.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 3.   Effect of selected amino acids on MTX-induced vital dye uptake. YO-PRO-1 uptake in BAECs was determined from the increase in fluorescence as a function of time as described in MATERIALS AND METHODS. Seven traces are shown superimposed. YO-PRO was added at t = 50 s, and MTX (0.3 nM) was added at t = 100 s. For each trace, cells were suspended in HBS supplemented with 5 mM of the following amino acids: glycine (black-triangle), L-alanine (down-triangle), D-alanine (), L-proline (triangle ), L-leucine (open circle ), L-valine (), or no amino acid (black-down-triangle ). Curves represent mean values from 3 independent experiments; symbols represent means ± SE at selected time points (i.e., every 100 s).

In the above-described experiments, glycine was added to the extracellular buffer at time 0, i.e., ~100 s before challenge with MTX. To evaluate the kinetics of the glycine effect, we performed EB uptake experiments in which glycine was added either before stimulation with MTX or at various time intervals after stimulation with MTX (Fig. 4). Addition of glycine either before or 200 s after MTX completely inhibited the second lytic phase of EB uptake. Addition of glycine 300 s after MTX, which is before the lytic phase has begun, substantially attenuated the second phase of dye uptake, suggesting that only a modest fraction of cells undergo cell lysis. This finding argues that glycine acts rapidly to block cell death but that some of the cells were committed to lyse during the interval between MTX challenge and the subsequent glycine addition. Consistent with this hypothesis, glycine added 400 s after MTX was still able to protect a small fraction of cells, even though the lytic phase was already well underway. Because these measurements reflect the entire population of cells in the cuvette, the results suggest that at the single-cell level, a variable delay must exist between addition of MTX and the start of the lytic phase.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 4.   Time dependence of glycine-induced blockade of vital dye uptake. Six traces are shown superimposed. EB uptake was determined in the absence of glycine (control) or in the presence of 5 mM glycine added to the cuvette at the times indicated at the end of each trace. Curves represent mean values from 3 independent experiments; symbols represent means ± SE at selected time points (i.e., every 100 s).

LDH has a molecular mass of ~140 kDa, and the release of LDH is commonly used as an index of cell lysis. To confirm that glycine blocks cell lysis, we compared release of LDH from BAECs suspended in normal extracellular buffer or in buffer containing 5 mM glycine. LDH release 10 min after MTX (0.3 nM) addition was 90 ± 7 and 16 ± 3% (means ± SE, n = 3, P < 0.001) in the absence and presence of glycine, respectively. For comparison, MTX-induced LDH release in the presence of U-73343 (to block all MTX-induced responses) was 3 ± 0.6%. Thus, although glycine greatly attenuates cell lysis, LDH release was not completely blocked as predicted by the dye uptake experiments. However, previous studies have shown that MTX causes substantial membrane bleb formation (12) (also, see text below). These blebs appear to be fragile and subject to detachment from the cell surface by the mechanical forces experienced during pelleting of the cells by centrifugation before LDH was measured. Thus only a fraction of the LDH recovered in the extracellular buffer may reflect true cell lysis. We therefore developed a method to detect lysis at the single-cell level that was based on the loss of fluorescence from BAECs transiently expressing GFP. Transfection of BAECs with a GFP expression vector resulted in diffuse green fluorescence in a small number of the cells in each field of view. The effect of MTX on GFP fluorescence was monitored using videomicroscopy. Phase and fluorescence image pairs, obtained every 30 s, are shown at selected time points as a montage in Fig. 5. Fluorescence was quantified at each time point as described in MATERIALS AND METHODS and evaluated as a function of time (Fig. 5, bottom). As shown in the phase images, blebs began to form on the surface of the cell within 10 min of MTX addition. The cell-associated fluorescence, which initially appears diffuse within the cytoplasm, was also distributed in the membrane blebs, consistent with the hypothesis that the bleb lumen is contiguous with the cytoplasmic space. After a delay of about 20 min, the fluorescence image dimmed and became indistinguishable from background. During the loss of GFP from the cell, the blebs did not rupture or burst. On the contrary, some of the membrane blebs continued to grow in size during and immediately after the loss of GFP. This is most evident in time-lapse Video 1. Please refer to the Supplementary Material1 for this article (published online at the American Journal of Physiology-Cell Physiology web site) to view the time-lapse videos (Videos 1-5).


View larger version (65K):
[in this window]
[in a new window]
 
Fig. 5.   MTX-induced loss of green fluorescent protein (GFP) from a single BAEC. BAECs transfected with GFP were grown on glass coverslips and bathed in HBS at 37°C. Phase and fluorescence image pairs were obtained every 30 s for 30 min as described in MATERIALS AND METHODS. MTX (0.3 nM) was added to the bath solution at t = 5 min. A: montage shows a pair of images at each indicated time point; the merged phase and fluorescence image is shown on the left and the GFP fluorescence only is shown on the right. B: an analysis of the total GFP fluorescence as a function of time for the cell in the montage. A time-lapse video of this experiment (Video 1) can be viewed online as Supplementary Material to this article.

To demonstrate that the loss of GFP correlates with the second phase of vital dye uptake, we monitored the loss of GFP from a transfected BAEC simultaneously with EB uptake. Dual-fluorescence image pairs were acquired along with a phase image as a function of time after MTX addition. An example of one such experiment is shown as a montage in Fig. 6, top. Initially, the cell exhibited normal morphology and green fluorescence but lacked EB staining. Within 10 min of MTX addition (i.e., t = 15 min), the cell exhibited substantial blebbing of the plasmalemma and a slight but detectable uptake of EB. During this time, there was no loss of GFP as indicated by the green fluorescence signal. However, by 17 min after MTX (i.e., t = 22 min), the green fluorescence was noticeably reduced and the EB uptake was clearly more intense. At 21 min after MTX (i.e., t = 26 min), GFP loss from the cell was almost complete and the nucleus was brightly stained with EB. Again, the blebs have not ruptured or deflated but remained intact during loss of GFP (i.e., during cell lysis). A similar profile of GFP loss and EB uptake was obtained for several GFP-expressing cells in a parallel experiment (Fig. 6, bottom). These results demonstrate that the loss of GFP from the cell correlates with the second phase of EB uptake. If the time course of EB uptake exactly matched the release of GFP, the normalized uptake and efflux curves for each cell should cross at the 50% point. However, as shown in Fig. 6, bottom, the curves consistently cross at ~25%. Thus the release of GFP seems to occur more rapidly than the uptake of EB. This probably reflects the additional step required for the increase in EB fluorescence; i.e., EB must enter the cell and subsequently bind to nucleic acids before the fluorescence is observed. Thus dye binding, rather than cell lysis, appears to be rate limiting. The time-lapse video of the cell shown in Fig. 6 was created from the merged phase, GFP, and EB fluorescence images (Video 2). Again, the video clearly shows that many of the blebs continued to expand during and immediately after GFP release from the cell. We also noted that cell lysis, as indicated by the rapid staining of the nucleus with EB, was delayed in the cells expressing GFP. As shown in a full field view of one experiment (Video 3), the green cells were among the last to stain with EB. This was a consistent observation in >16 experiments where dye uptake was simultaneously monitored with GFP release. The reason for this apparent cytoprotection by expression of GFP remains unclear.


View larger version (44K):
[in this window]
[in a new window]
 
Fig. 6.   Simultaneous measurement of MTX-induced GFP loss and EB uptake. BAECs transfected with GFP were grown on glass coverslips and bathed in HBS containing EB at 37°C. A phase image and dual-fluorescence images (taken 4 s apart) were obtained every 30 s for 40 min as described in MATERIALS AND METHODS. MTX (0.3 nM) was added to the bath solution at t = 5 min. A: montage shows 4 images from a selected cell (phase, GFP alone, EB alone, and combined phase/dual fluorescence) taken at the indicated time points. Size bars = 10 µm. B: an analysis of the total GFP fluorescence (dashed lines) and EB fluorescence (solid lines) from several GFP-positive cells shown with each cell plotted using a different color. For clarity, the symbols at each time point have been omitted. Two time-lapse videos of these experiments (Video 2 and Video 3) can be viewed online as Supplementary Material to this article.

The GFP expression vector encodes a protein of ~27 kDa. Though this is much larger than the fluorescent dyes we have used, it is much smaller than LDH. Furthermore, previous studies have suggested that the lytic pore actually increases in size or dilates with time (7), allowing increasingly larger molecules to enter the cell. We therefore constructed expression vectors containing concatemers of the GFP cDNA encoding a series of fluorescent proteins of increasing molecular mass from 27 to 162 kDa. We reasoned that if the lytic pore dilates with time, the delay between MTX addition and subsequent GFP release, i.e., cell lysis, should be directly proportional to the molecular size of the GFP construct. A Western blot of cell lysates obtained from BAECs individually transfected with GFP-1 through GFP-6 was probed with an anti-GFP antibody. The results demonstrated that for each of the constructs, a single protein of appropriate molecular mass was expressed in BAECs (data not shown). We next measured the MTX-induced GFP loss from single BAECs transfected with each GFP concatemer. The normalized total GFP fluorescence from several independent single cells (different colors) is shown in Fig. 7. For GFP-1, there was a delay from the time of MTX addition to the time of GFP loss that varied from 5 to 25 min. After the initial delay, the rate of loss of GFP-1 fluorescence was similar for each cell; i.e., fluorescence decreased from ~100% to near zero over 2-3 min. The loss of GFP-2 showed essentially the same characteristics, i.e., a variable delay followed by nearly complete loss of GFP-2 signal over 2-3 min. Likewise, for each of the larger constructs, the majority of cells exhibited GFP loss with kinetics similar to GFP-1, suggesting that the lytic pore cannot discriminate between GFP-1 and GFP-6. The main difference in response among the GFP concatemers was the presence of a subset of cells that seemed to show an incomplete loss of GFP fluorescence over the time course of the experiment. The number of cells showing an incomplete loss of fluorescence increased as the molecular size of the GFP increased, suggesting that this may reflect a decrease in the rate of diffusion of the larger GFP proteins. Importantly, the delay time (mean ± SD) between MTX addition and GFP release was 15.8 ± 4, 12.0 ± 6, 18.8 ± 4, 10.2 ± 5, 16.4 ± 4, or 17.4 ± 8 min for GFP-1 through GFP-6, respectively. Thus no correlation was found between the delay time and GFP size. These results are consistent with activation of a lytic pore of fixed dimension that does not dilate with time.


View larger version (54K):
[in this window]
[in a new window]
 
Fig. 7.   MTX-induced efflux of GFP concatemers. BAECs transfected with GFP concatemers were grown on glass coverslips and bathed in HBS at 37°C. A phase and fluorescence image pair was obtained every 30 s for 40 min as described in MATERIALS AND METHODS. MTX (0.3 nM) was added to the bath solution at t = 5 min. A-F: an analysis of total GFP fluorescence from single cells as a function of time with each cell plotted as a line of different color (symbols omitted). The GFP-1 image (A) represents 27 cells from 10 experiments; GFP-2 image (B) represents 25 cells from 8 experiments; GFP-3 image (C) represents 27 cells from 5 experiments; GFP-4 image (D) represents 27 cells from 10 experiments; GFP-5 image (E) represents 14 cells from 6 experiments; and GFP-6 image (F) represents 23 cells from 9 experiments.

The cuvette experiments described above suggest that glycine rapidly blocks cell lysis even when added sometime after MTX. It is possible that glycine either prevents formation of the pore or blocks the pore once it is formed. If the lytic pore forms but is blocked by the presence of glycine, removal of glycine from the bath solution should result in the immediate and rapid loss of GFP from the cell. However, if glycine prevents formation of the pore, we might expect a delay between removal of glycine and subsequent GFP loss. A glycine washout experiment is shown in Fig. 8. In the absence of glycine, cell lysis (i.e., GFP-1 loss) occurred within 20-30 min following MTX addition. In sharp contrast, no GFP-1 loss was observed for 35 min when MTX was added in the presence of 5 mM glycine. In the continuous presence of MTX, cell lysis occurred with a delay of 20-30 min following removal of glycine from the bath solution. This result demonstrates that the effect of glycine is reversible and is consistent with the hypothesis that glycine prevents lytic pore formation. The images in Fig. 8 (and the associated Video 4) show the progression of bleb size following removal of glycine from the bath and after GFP loss from the cells. Many of the blebs continued to grow in size even after glycine withdrawal. At the end of the experiment, some of the blebs had dramatically dilated and were only faintly visible above the focal plane.


View larger version (55K):
[in this window]
[in a new window]
 
Fig. 8.   Effect of glycine on MTX-induced efflux of GFP. GFP fluorescence was quantified as described in Fig. 5 in single BAECs in the absence (A) or in the initial presence (B) of 5 mM glycine. MTX (0.3 nM) was added to the bath at t = 5 min. After 40 min, glycine was removed from the bath solution as indicated by the horizontal bar (B), and fluorescence was subsequently recorded in the continuous presence of MTX. Images taken immediately before glycine removal (38 min; C), immediately before GFP loss (56 min; D), and after 3 of the cells released their GFP (72 min; E) are shown. Size bars = 20 µm.

The above experiments showed that glycine cytoprotection extends for at least 35 min following MTX addition (Fig. 8). To determine whether glycine protective effects extend for longer times, we challenged BAECs with MTX and used the uptake of PI as an index of cell lysis. Preliminary studies showed that PI uptake via COP was extremely slow and that nuclei staining with PI closely matched GFP release. MTX (0.3 nM) was added to BAECs bathed in complete culture medium in the absence or presence of 5 mM glycine, and the cells were returned to the incubator for 30 min, 4 h, 24 h, or 48 h. At each time point, dishes were removed from the incubator and placed on the stage of the imaging microscope, and PI was immediately added to the bath. As shown in Fig. 9, cells rapidly stained with PI after 30 min of MTX treatment in the absence of glycine. However, in the presence of glycine, no staining was observed despite pronounced membrane bleb formation. Focusing above the cells (Fig. 9, bottom) shows that the surface of the monolayer was covered by a large number of giant balloonlike membrane blebs. Identical results were obtained 4 h after MTX addition, but the blebs in the presence of glycine were enormous relative to the size of the cell (Fig. 10). This effect was even more pronounced 24 h after MTX addition to the culture medium (Fig. 11). We also noted that the nuclei (or nucleoli) became increasingly phase-bright between the 4- and 24-h time point, but the meaning of this observation is unclear at the present time. Over 4 to 48 h, MTX-treated BAECs in the absence of glycine were increasingly sparse in number, stained rapidly with PI, and exhibited a granular appearance (Figs. 9-12). It is noteworthy that in the absence of glycine, BAECs appear to lose their blebs between 30 min and 4 h. This may reflect detachment or release of the blebs from the cell surface, which probably occurs during movement of the culture dish from the incubator to the microscope stage. In many of the videos created during the course of these experiments, large blebs can be seen floating across the field of view (e.g., see Video 5), suggesting that the tethering of the blebs to the cell surface is fragile. After 48 h of MTX treatment in the presence of glycine, the nuclei of the BAECs remained phase-bright, but there were fewer blebs and the cells tended to grow in islands exhibiting the typical endothelial cell cobblestone morphology (Fig. 12). One of the cells shown in Fig. 12 was in the process of cell division (see arrow). Together, these results suggest that the cells indeed remain viable in the presence of glycine for at least 48 h.


View larger version (103K):
[in this window]
[in a new window]
 
Fig. 9.   BAEC viability 30 min after MTX treatment. MTX (0.3 nM) was added to complete medium in culture dishes seeded with BAECs in the absence or presence of 5 mM glycine. The dishes were returned to the incubator for 30 min and subsequently placed on the stage of the imaging microscope, and propidium iodide (PI) was added to the bath at the time indicated (A). Values represent mean fluorescence as a function of time for the individual cells shown in the images in the absence () or presence (open circle ) of glycine. Images shown (merged phase and fluorescence images) were taken at 3 min in the absence (B) or presence of glycine (C and D). D is the same field of view as C with the focus adjusted to a plane above the cells. Size bars = 10 µm. Results are representative of 3 experiments.



View larger version (99K):
[in this window]
[in a new window]
 
Fig. 10.   BAEC viability 4 h after MTX treatment. The experimental protocol is the same as described in Fig. 9 at 4 h after MTX treatment. Values in A represent mean fluorescence as a function of time for the individual cells shown in images in the absence () or presence (open circle ) of glycine. Images shown (merged phase and fluorescence images) were taken at 3 min in the absence (B) or presence of glycine (C and D). D is the same field of view as C with the focus adjusted to a plane above the cells. Size bars = 10 µm. Results are representative of 3 experiments.



View larger version (99K):
[in this window]
[in a new window]
 
Fig. 11.   BAEC viability 24 h after MTX treatment. The experimental protocol is the same as described in Fig. 9 at 24 h after MTX treatment. Values in A represent mean fluorescence as a function of time for the individual cells shown in images in the absence () or presence (open circle ) of glycine. Images shown (merged phase and fluorescence images) were taken at 3 min in the absence (B) or presence of glycine (C and D). D is the same field of view as C with the focus adjusted to a plane above the cells. Size bars = 10 µm. Results are representative of 3 experiments.



View larger version (93K):
[in this window]
[in a new window]
 
Fig. 12.   BAEC viability 48 h after MTX treatment. The experimental protocol is the same as described in Fig. 9 at 48 h after MTX treatment. Values in A represent mean fluorescence as a function of time for the individual cells shown in the images in the absence () or presence (open circle ) of glycine; arrow indicates a cell undergoing mitosis. Images shown (merged phase and fluorescence images) were taken at 3 min in the absence (B) or presence of glycine (C and D). D is the same field of view as C with the focus adjusted to a plane above the cells. Size bars = 10 µm. Results are representative of 3 experiments.

To further demonstrate the long-term cytoprotection of glycine, we transiently transfected BAECs with GFP-1 and subsequently challenged them with MTX. Green fluorescence and PI uptake were monitored at 30 min, 4 h, 24 h, and 48 h after MTX addition (Fig. 13). No green cells were observed in the absence of glycine 4 h after MTX; however, green cells were observed in the presence of glycine at all time points up to 48 h. Again, cells in the presence of glycine did not stain with PI. Overall, these experiments provide strong support for the conclusion that glycine cytoprotection is long lasting.


View larger version (134K):
[in this window]
[in a new window]
 
Fig. 13.   Long-term effect of glycine on MTX-induced loss of GFP. BAECs transiently expressing GFP-1 were incubated with MTX (0.3 nM) in the absence or presence of 5 mM glycine for 30 min, 4 h, 24 h, or 48 h. Merged phase and fluorescence images are shown at the indicated time points. Green cells were not observed in the absence of glycine at 4, 24, or 48 h after MTX addition. Size bars = 10 µm. Results are representative of 3 experiments.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The MTX-induced cell death cascade consists of three distinct phases (12, 31, 32). First, MTX activates CaNSC, which causes a dramatic increase in [Ca2+]i and depolarization of the plasmalemma. This is followed by activation or formation of large pores (i.e., COP) that allow the uptake of vital dyes into the cell. The final phase, cell lysis, is the terminal event and is generally thought to represent irreversible cell death. The results of the present study show that the small amino acids glycine and L-alanine specifically block MTX-induced cell lysis. The cytoprotective effect was concentration dependent, rapid, long lasting, selective, reversible, and stereospecific. Glycine had no effect on MTX-induced change in [Ca2+]i, so it seems unlikely that glycine blocks either MTX binding to its receptor or the ability of MTX to activate CaNSC. Furthermore, glycine had no effect on activation of COP or the associated bleb formation. Thus the downstream changes in membrane permeability and cellular morphology associated with dissipation of ionic gradients are likewise not targets of glycine cytoprotective effects. Together, the results suggest that glycine and L-alanine prevent MTX-induced cell lysis by interaction with a specific binding site. Previous studies have shown that the cytoprotective effect of glycine can be mimicked by strychnine (21, 35, 42), a known antagonist at the neuronal glycine receptor. An impermeable strychnine-fluorescein conjugate likewise affords cytoprotection, suggesting that glycine binds to specific sites located on the extracellular surface of the cell (9). The identity of the binding sites and the actual mechanism by which glycine binding blocks cell lysis remains unknown.

It has previously been suggested that oncosis/necrosis is a form of "accidental" cell death reflecting rupture of the plasmalemma, presumably as the result of massive swelling secondary to water movement (17, 18). Although it seems likely that osmotic changes within the cell, driven by collapse of normal ion concentration gradients, must, at least in part, drive the initial bleb formation and dilation, several observations suggest that MTX-induced cell lysis does not reflect cell bursting due to colloid osmotic pressure. In the absence of glycine, MTX-induced blebs dilate to enormous size and continue to expand despite the rapid uptake of vital dyes and complete loss of LDH or GFP. Bursting or rupture of the blebs was not observed over the time course of the experiments. In fact, the blebs continue to appear as smooth spherical structures without obvious tears or discontinuities. One possible explanation is that the blebs are separate from the intracellular space and respond to osmotic changes independently of the cell proper. However, expressed GFP is seen in both the cell and the blebs, and in some cases appears to be concentrated within the blebs as they grow in size. This observation is most clearly seen in the time-lapse videos. Most cells challenged with MTX develop multiple blebs. Occasionally, one bleb on a single cell may appear to shrink in size, but this was generally associated with a massive dilation of another bleb on the same cell. These results suggest that the internal milieu of the bleb is contiguous with the cytoplasmic space. Furthermore, the dimming of the GFP signal (i.e., GFP loss from the cell) appears to be homogenous across the cell and blebs. Thus the lysis event does not appear to be selectively localized to either the bleb or the cell proper. Although glycine completely blocks the release of cytosolic proteins such as LDH and GFP concatemers, glycine has no effect on either bleb formation or dilation. In fact, when viewed hours after MTX challenge in the presence of glycine, the membrane blebs appear as large balloonlike structures covering the surface of the endothelial cell monolayer. Thus the mechanisms of bleb formation and the underlying pressures that are responsible for bleb dilation appear to be unaffected by glycine. These results provide support for the hypothesis that the lytic phase is not the result of accidental membrane rupture but, rather, reflects the activation or formation of specific endogenous channels of large dimension.

What is the size of the lytic pore? Energy-depleted MDCK cells undergo changes in cell morphology, including formation and swelling of membrane blebs, uptake of vital dyes, and release of LDH, in a fashion similar to that observed with MTX (7). As in the present study, glycine had no effect on the morphological changes observed in MDCK cells but completely blocked the permeability change, i.e., blocked cell lysis. In this study, time-dependent uptake of large fluoresceinated dextrans was used to determine the size the lytic pore. The experiments suggested that the lytic pore grows in size with a sharp cutoff between 70 and 140 kDa. The effect of glycine on cell death induced by chemical hypoxia in liver sinusoidal endothelial cells has also been reported (24). Again, glycine blocked cell lysis but had no effect on membrane bleb formation. These investigators reported that dextrans ranging from 40 to 500 kDa were taken up by the cells during the lytic event. Although these two studies suggest that the size of the lytic pore may vary with cell type, or with the method used to initiate cell death, neither of these studies quantified fluorophore uptake. In the present study, the kinetics of lytic pore formation at the single-cell level were evaluated with the use of time-lapse fluorescence videomicroscopy. To determine whether the lytic pore dilates with time, we quantified the efflux of GFP concatemers. If the pore dilated with time, we expected to see a consistent lengthening of the latency of the time between MTX addition and subsequent GFP loss as the size of the GFP molecule increased. If MTX-induced cell lysis was due to the opening or insertion of large pores of fixed size, then we expected to see essentially a fixed latency, but the subsequent rate of loss of GFP would decrease with increasing molecular size. Our observations are inconsistent with a pore dilation model because there was no correlation between GFP size and the latency. For the majority of cells examined, the rate of loss of the GFP-concatemers, once the lysis event was initiated in each cell, was similar for each of the GFP concatemers. Thus it would appear that the size of the membrane pore is much larger than any of the constructs we have tested so far. In several cells expressing the larger GFP constructs, the rate of GFP loss following the lysis event was slow and often incomplete. The slow rate of loss may reflect a decrease in diffusion as the size of the GFP molecule increases. The incomplete loss of the larger GFP molecules in a fraction of the cells suggests that the membrane pore may not be stable and may inactivate or close before all the larger GFP molecules diffuse out of the cell. The rate of lytic pore inactivation might be expected to depend on the cytosolic milieu and therefore exhibit cell-to-cell variability. These possibilities await further investigation.

MTX activates a cell death cascade that is similar to that produced by activation of purinergic receptors or induced by various stress events commonly associated with ischemia-reperfusion injury and/or Ca2+-overload conditions. Furthermore, it is clear that glycine provides significant protection, suggesting commonality in the final lytic pathway. The concentration of glycine required for the blockade of MTX-induced cell lysis is in the millimolar range, which is similar to previous reports for the effect of glycine in kidney and liver cell preparations (7, 24, 42). The normal concentration of glycine in blood is ~300 µM. Clinical studies on the beneficial effects of glycine supplementation on the neuroleptic-resistant negative symptoms of schizophrenia have shown that glycine blood levels in the millimolar range can be maintained without acute or long-term deleterious effects (14, 16). Thus it may be possible to obtain significant therapeutic effect with a relatively small increase in blood glycine. In the present study, cell viability, as determined by exclusion of PI and retention of GFP, is maintained for at least 48 h following MTX challenge, suggesting that glycine cytoprotection is long lasting. Thus glycine supplementation may be a simple and effective means to attenuate the symptoms of ciguatera seafood poisoning.


    ACKNOWLEDGEMENTS

We acknowledge the technical assistance of Milana Belich.


    FOOTNOTES

This work was supported in part by National Institute of General Medical Sciences Grant GM-52019, National Heart, Lung, and Blood Institute Grant HL-65323, and American Heart Association Grant 9950014N.

Address for reprint requests and other correspondence: W. P. Schilling, Rammelkamp Center for Education and Research, Rm. R322, MetroHealth Medical Center, 2500 MetroHealth Drive, Cleveland, OH 44109-1998 (E-mail:wschilling{at}metrohealth.org).

1 Supplemental material to this article (Videos 1-5) is available online at http://ajpcell.physiology.org/cgi/content/full/284/4/1006/DC1.

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

First published December 11, 2002;10.1152/ajpcell.00258.2002

Received 31 May 2002; accepted in final form 27 November 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Bachmann, S, Peng XX, Currin RT, Thurman RG, and Lemasters JJ. Glycine in Carolina rinse solution reduces reperfusion injury, improves graft function, and increases survival after rat liver transplantation. Transplant Proc 27: 741-742, 1995[ISI][Medline].

2.   Bielfeld-Ackermann, A, Range C, and Korbmacher C. Maitotoxin (MTX) activates a non-selective cation channel in Xenopus laevis oocytes. Pflügers Arch 436: 329-337, 1998[ISI][Medline].

3.   Cai, H, and Harrison DG. Endothelial dysfunction in cardiovascular diseases: the role of oxidant stress. Circ Res 87: 840-844, 2000[Abstract/Free Full Text].

4.   Currin, RT, Caldwell-Kenkel JC, Lichtman SN, Bachmann S, Takei Y, Kawano S, Thurman RG, and Lemasters JJ. Protection by Carolina rinse solution, acidotic pH, and glycine against lethal reperfusion injury to sinusoidal endothelial cells of rat livers stored for transplantation. Transplantation 15: 1549-1558, 1996.

5.   Dickson, RC, Bronk SF, and Gores GJ. Glycine cytoprotection during lethal hepatocellular injury from adenosine triphosphate depletion. Gastroenterology 102: 2098-2107, 1992[ISI][Medline].

6.   Dietl, P, and Völkl H. Maitotoxin activates a nonselective cation channel and stimulates Ca2+ entry in MDCK renal epithelial cells. Mol Pharmacol 45: 300-305, 1994[Abstract].

7.   Dong, Z, Patel Y, Saikumar P, Weinberg JM, and Venkatachalam MA. Development of porous defects in plasma membranes of adenosine triphosphate-depleted Madin-Darby canine kidney cells and its inhibition by glycine. Lab Invest 78: 657-667, 1998[ISI][Medline].

8.   Dong, Z, Saikumar P, Griess GA, Weinberg JM, and Venkatachalam MA. Intracellular Ca2+ thresholds that determine survival or death of energy-deprived cells. Am J Pathol 152: 231-240, 1998[Abstract].

9.   Dong, Z, Venkatachalam MA, Weinberg JM, Saikumar P, and Patel Y. Protection of ATP-depleted cells by impermeant strychnine derivatives. Am J Pathol 158: 1021-1028, 2001[Abstract/Free Full Text].

10.   Eskin, SG, Sybers HD, Trevino L, Lie JT, and Chimoskey JE. Comparison of tissue-cultured bovine endothelial cells from aorta and saphenous vein. In Vitro 14: 903-910, 1978[ISI][Medline].

11.   Estacion, M, Nguyen HB, and Gargus JJ. Calcium is permeable through a maitotoxin-activated nonselective cation channel in mouse L cells. Am J Physiol Cell Physiol 270: C1145-C1152, 1996[Abstract/Free Full Text].

12.   Estacion, M, and Schilling WP. Maitotoxin-induced membrane blebbing and cell death in bovine aortic endothelial cells. BMC Physiol 1: 2, 2001[Medline].

13.   Estacion, M, and Schilling WP. Blockade of maitotoxin-induced oncotic cell death reveals zeiosis. BMC Physiol 2: 2, 2002[Medline].

14.   Goff, DC, and Coyle JT. The emerging role of glutamate in the pathophysiology and treatment of schizophrenia. Am J Psychiatry 158: 1367-1377, 2001[Abstract/Free Full Text].

15.   Gusovsky, F, and Daly JW. Maitotoxin: a unique pharmacological tool for research on calcium-dependent mechanisms. Biochem Pharmacol 39: 1633-1639, 1990[ISI][Medline].

16.   Heresco-Levy, U, Javitt DC, Ermilov M, Mordel C, Silipo G, and Lichtenstein M. Efficacy of high-dose glycine in the treatment of enduring negative symptoms of schizophrenia. Arch Gen Psychiatry 56: 29-36, 1999[Abstract/Free Full Text].

17.   Kroemer, G, Dallaporta B, and Resche-Rigon M. The mitochondrial death/life regulator in apoptosis and necrosis. Annu Rev Physiol 60: 619-642, 1998[ISI][Medline].

18.   Leist, M, and Nicotera P. The shape of cell death. Biochem Biophys Res Commun 236: 1-9, 1997[ISI][Medline].

19.   Lemasters, JJ, and Thurman RG. Reperfusion injury after liver preservation for transplantation. Annu Rev Pharmacol Toxicol 37: 327-338, 1997[ISI][Medline].

20.   Lum, H, and Roebuck KA. Oxidant stress and endothelial cell dysfunction. Am J Physiol Cell Physiol 280: C719-C741, 2001[Abstract/Free Full Text].

21.   Miller, GW, Lock EA, and Schnellmann RG. Strychnine and glycine protect renal proximal tubules from various nephrotoxicants and act in the late phase of necrotic cell injury. Toxicol Appl Pharmacol 125: 192-197, 1994[ISI][Medline].

22.   Musgrave, IF, Seifert R, and Schultz G. Maitotoxin activates cation channels distinct from the receptor-activated non-selective cation channels of HL-60 cells. Biochem J 301: 437-441, 1994[Medline].

23.   Nichols, JC, Bronk SF, Mellgren RL, and Gores GJ. Inhibition of nonlysosomal calcium-dependent proteolysis by glycine during anoxic injury of rat hepatocytes. Gastroenterology 106: 168-176, 1994[ISI][Medline].

24.   Nishimura, Y, and Lemasters JJ. Glycine blocks opening of a death channel in cultured hepatic sinusoidal endothelial cells during chemical hypoxia. Cell Death Differ 8: 850-858, 2001[ISI][Medline].

25.   Nishimura, Y, Romer LH, and Lemasters JJ. Mitochondrial dysfunction and cytoskeletal disruption during chemical hypoxia to cultured hepatic sinusoidal endothelial cells: the pH paradox and cytoprotection by glucose, acidotic pH and glycine. Hepatology 27: 1039-1049, 1998[ISI][Medline].

26.   Orrenius, S, McConkey DJ, Bellomo G, and Nicotera P. Role of Ca2+ in toxic cell killing. Trends Pharmacol Sci 10: 281-285, 1989[Medline].

27.   Schemmer, P, Bradford BU, Rose ML, Bunzendahl H, Raleigh JA, Lemasters JJ, and Thurman RG. Intravenous glycine improves survival in rat liver transplantation. Am J Physiol Gastrointest Liver Physiol 276: G924-G932, 1999[Abstract/Free Full Text].

28.   Schiffrin, EL. A critical review of the role of endothelial factors in the pathogenesis of hypertension. J Cardiovasc Pharmacol 38, Suppl 2: S3-S6, 2001.

29.   Schilling, WP, and Elliott SJ. Ca2+ signaling mechanisms of vascular endothelial cells and their role in oxidant-induced endothelial cell dysfunction. Am J Physiol Heart Circ Physiol 262: H1617-H1630, 1992[Abstract].

30.   Schilling, WP, Rajan L, and Strobl-Jager E. Characterization of the bradykinin-stimulated calcium influx pathway of cultured vascular endothelial cells: saturability, selectivity and kinetics. J Biol Chem 264: 12838-12848, 1989[Abstract/Free Full Text].

31.   Schilling, WP, Sinkins WG, and Estacion M. Maitotoxin activates a nonselective cation channel and a P2Z/P2X7-like cytolytic pore in human skin fibroblasts. Am J Physiol Cell Physiol 277: C755-C765, 1999[Abstract/Free Full Text].

32.   Schilling, WP, Wasylyna T, Dubyak GR, Humphreys BD, and Sinkins WG. Maitotoxin and P2Z/P2X7 purinergic receptor stimulation activate a common cytolytic pore. Am J Physiol Cell Physiol 277: C766-C776, 1999[Abstract/Free Full Text].

33.   Takahashi, M, Ohizumi Y, and Yasumoto T. Maitotoxin, a Ca2+ channel activator candidate. J Biol Chem 257: 7287-7289, 1982[Abstract/Free Full Text].

34.   Trump, BF, and Berezesky IK. Calcium-mediated cell injury and cell death. FASEB J 9: 219-228, 1995[Abstract].

35.   Venkatachalam, MA, Weinberg JM, Patel Y, Saikumar P, and Dong Z. Cytoprotection of kidney epithelial cells by compounds that target amino acid gated chloride channels. Kidney Int 49: 449-460, 1996[ISI][Medline].

36.   Weber, WM, Popp C, Clauss W, and Van Driessche W. Maitotoxin induces insertion of different ion channels into the Xenopus oocyte plasma membrane via Ca2+-stimulated exocytosis. Pflügers Arch 439: 363-369, 2000[ISI][Medline].

37.   Weinberg, JM, Davis JA, Abarzua M, and Rajan T. Cytoprotective effects of glycine and glutathione against hypoxic injury to renal tubules. J Clin Invest 80: 1446-1454, 1987[ISI][Medline].

38.   Weinberg, JM, Davis JA, and Venkatachalam MA. Cytosolic-free calcium increases to greater than 100 micromolar in ATP-depleted proximal tubules. J Clin Invest 100: 713-722, 1997[ISI][Medline].

39.   Weinberg, JM, Varani J, Johnson KJ, Roeser NF, Dame MK, Davis JA, and Venkatachalam MA. Protection of human umbilical vein endothelial cells by glycine and structurally similar amino acids against calcium and hydrogen peroxide-induced lethal cell injury. Am J Pathol 140: 457-471, 1992[Abstract].

40.   Weinberg, JM, Venkatachalam MA, Roeser NF, Davis JA, Varani J, and Johnson KJ. Amino acid protection of cultured kidney tubule cells against calcium ionophore-induced lethal cell injury. Lab Invest 65: 671-678, 1991[ISI][Medline].

41.   Wetzels, JF, Wang X, Gengaro PE, Nemenoff RA, Burke TJ, and Schrier RW. Glycine protection against hypoxic but not phospholipase A2-induced injury in rat proximal tubules. Am J Physiol Renal Fluid Electrolyte Physiol 264: F94-F99, 1993[Abstract/Free Full Text].

42.   Wheeler, MD, Ikejema K, Enomoto N, Stacklewitz RF, Seabra V, Zhong Z, Yin M, Schemmer P, Rose ML, Rusyn I, Bradford B, and Thurman RG. Glycine: a new anti-inflammatory immunonutrient. Cell Mol Life Sci 56: 843-856, 1999[ISI][Medline].

43.   Worley, JF, McIntyre MS, III, Spencer B, and Dukes ID. Depletion of intracellular Ca2+ stores activates a maitotoxin- sensitive nonselective cationic current in beta -cells. J Biol Chem 269: 32055-32058, 1994[Abstract/Free Full Text].


Am J Physiol Cell Physiol 284(4):C1006-C1020
0363-6143/03 $5.00 Copyright © 2003 the American Physiological Society



This article has been cited by other articles: