Am J Physiol Cell Physiol AJP: Advances in Physiology Education
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 284: C718-C728, 2003. First published November 20, 2002; doi:10.1152/ajpcell.00359.2002
0363-6143/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/3/C718    most recent
00359.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (28)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Blumenthal, E. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Blumenthal, E. M.
Vol. 284, Issue 3, C718-C728, March 2003

Regulation of chloride permeability by endogenously produced tyramine in the Drosophila Malpighian tubule

Edward M. Blumenthal

Department of Biology and Center for Biological Timing, University of Virginia, Charlottesville, Virginia 22904-4328


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

The Malpighian (renal) tubule of Drosophila melanogaster is a useful model for studying epithelial transport. The purpose of this study was to identify factors responsible for modulating transepithelial chloride conductance in isolated tubules. I have found that tyrosine and several of its metabolites cause an increase in chloride conductance. The most potent of these agonists is tyramine, which is active at low nanomolar concentrations; the pharmacology of this response matches that of the previously published cloned insect tyramine receptor. In addition, the tubule appears capable of synthesizing tyramine from applied tyrosine, as shown by direct measurement of tyrosine decarboxylase activity. Immunohistochemical staining of tubules with an antibody against tyramine indicates that the principal cells are the sites of tyramine production, whereas previous characterization of the regulation of chloride conductance suggests that tyramine acts on the stellate cells. This is the first demonstration of a physiological role for an insect tyramine receptor.

tyrosine decarboxylase; yohimbine; tyramine receptor; biogenic amines


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

THE MALPIGHIAN TUBULES comprise the initial component of the insect excretory system and have been a useful model system for studying the regulation of epithelial ion transport (4, 17, 37). The fruit fly Drosophila melanogaster possesses two pairs of tubules; these are blind-ended simple tubular epithelia that empty into the digestive tract (17). The main segment of the tubule, in which the secretion of a potassium-rich primary urine occurs, contains two morphologically defined cell types, principal cells and stellate cells (52). Recent work has shown that the principal cells are both genetically and functionally heterogeneous (43, 49), although neither the molecular nor the physiological bases for this heterogeneity have been determined.

In Drosophila, as in other insects, cations move into the tubule lumen by active transport through the principal cells (4, 16, 25, 32). The electromotive force for this transport is generated by a vacuolar-type proton pump located in the apical membrane. Chloride moves passively into the lumen down its electrochemical gradient through a pathway that lies outside of the principal cells (32, 34). The anatomical site of this chloride shunt conductance, paracellular or transcellular through the stellate cells, has been controversial; however, regulation of chloride conductance in the Drosophila tubule is linked to intracellular calcium levels in the stellate cells (33). The net effect of ion transport in the Drosophila tubule is the establishment of a lumen-positive transepithelial potential (TEP) with an amplitude of ~50-60 mV.

Ion transport across the Drosophila tubule is a highly regulated process, falling under the control of at least three different second messenger systems. Cation transport through the principal cells can be stimulated by both cGMP and cAMP (32). The former is produced after treatment of tubules with the diuretic hormone cardioacceleratory peptide 2b (CAP2b) (15); production of cAMP is stimulated by a calcitonin-related peptide (14). In many other insect species, a corticotropin-releasing factor (CRF)-like diuretic peptide also acts through cAMP (13). In addition, the diuretic hormone leucokinin stimulates urine secretion by raising calcium levels in the stellate cells and increasing the amplitude of the chloride shunt conductance (33). Recently, a receptor for leucokinin has been cloned and found to be expressed exclusively in stellate cells (41). The biogenic amines serotonin and octopamine have diuretic activity on the tubules of multiple insect species (26, 31, 48); however, no aminergic modulation of Drosophila renal function has previously been reported.

In the tubules of many insects, including Drosophila, the TEP measured in vitro is not constant but instead undergoes large oscillations in amplitude (15, 30, 39, 53). Recent studies in the mosquito Aedes aegypti and in Drosophila have shown that these voltage oscillations are caused by fluctuations in transepithelial chloride conductance (5, 7), and in Drosophila they are dependent on increased intracellular calcium levels in the stellate cells (7). No function has yet been determined for these oscillations; neither have they been found to be caused by any particular stimulus. However, the occurrence of such oscillations in the tubules of several different insect species raises the possibility that they may be important for the regulation of normal ion transport. The initial purpose of this study was the identification of the factor responsible for the triggering of these oscillations; the result, as described below, was the identification and characterization of tyramine as a novel insect diuretic factor.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Materials. All chemicals were obtained from Sigma (St. Louis, MO).

Drosophila maintenance. Drosophila melanogaster (Canton-S) were maintained on a 12:12-h light-dark cycle at 23-25°C on cornmeal-molasses-yeast medium.

Tubule isolation. Posterior Malpighian tubules were dissected under dissecting saline from adults females 6-8 days posteclosion and placed in a tissue culture dish in which a 100-µl drop of 0.125 mg/ml poly-L-lysine had been dried to promote adhesion of the tubule to the dish, and the solution was replaced with recording medium (32). The dissecting/recording saline contained (in mM) 85 NaCl, 20 KCl, 3 CaCl2, 12 MgSO4, 7.5 NaHCO3, 4 NaH2PO4, 15 glucose, and 10 HEPES, pH 6.75 [osmolality = 255-270 mosmol/kgH2O as measured with a vapor pressure osmometer (Wescor, Logan, UT)]. Standard bathing medium (SBM) consisted of a 1:1 mixture of Schneider's Drosophila medium (Invitrogen, Carlsbad, CA) and a "diluting saline" containing 36 NaCl, 21 KCl, 15 MgCl2, 5 CaCl2, 4.8 NaHCO3, 2 NaH2PO4, 11.1 glucose, and 15 HEPES, pH 6.75. The composition of SBM, based on the compositions of the diluting saline and Schneider's medium (Invitrogen) is (in mM) 36 NaCl, 21 KCl, 5.2 CaCl2, 7.5 MgSO4, 7.5 MgCl2, 4.8 NaHCO3, 1.3 KH2PO4, 3.4 sodium phosphate, 7.5 HEPES, 0.7 alpha -ketoglutaric acid, 11.1 D-glucose, 0.43 fumaric acid, 0.38 malic acid, 0.42 succinic acid, 2.9 trehalose, 2.8 beta -alanine, 1.15 L-arginine, 1.5 L-aspartic acid, 0.25 L-cysteine, 0.21 L-cystine, 2.7 L-glutamic acid, 6.15 L-glutamine, 1.67 glycine, 1.29 L-histidine, 0.58 L-isoleucine, 0.58 L-leucine, 4.5 L-lysine HCl, 2.7 L-methionine, 0.45 L-phenylalanine, 7.4 L-proline, 1.19 L-serine, 1.47 L-threonine, 0.25 L-tryptophan, 1.38 L-tyrosine, 1.32 L-valine, and 1,000 mg/l yeastolate. The osmolality of SBM was 255-270 mosmol/kgH2O. The osmolality of these solutions is equal to that reported for adult Drosophila hemolymph (47) but is much lower than that used in other studies of Drosophila tubule physiology. This difference in osmolality explains the higher urine secretion rates and more prominent TEP oscillations than those reported by others (8). For the chloride replacement experiment, the low chloride media consisted of 10% normal dissecting/recording saline and 90% dissecting/recording saline in which NaCl, KCl, and CaCl2 had been replaced with 85 mM sodium isethionate, 10 mM K2SO4, and 3 mM CaSO4. Experiments were conducted within 2 h of tubule dissection.

Recording. The tubule lumen and principal cells were impaled with a sharp electrode (R > 25 MOhms) pulled from theta-glass (Sutter Instruments, Novato, CA) and filled with 3 M KCl. Potentials were amplified (Axopatch 200B; Axon Instruments, Foster City, CA), digitized at 100 Hz, and stored online. Recording and analysis were conducted using pCLAMP software (Axon Instruments). The peritubular bath was continuously perfused during recording. Drugs were applied to and removed from the bath during recording by switching perfusion lines.

Quantitation of electrophysiological responses. To compare the responses of tubules to various agonists, a response index was calculated as follows. A straight line was fitted to the TEP record for the 30 s preceding the drug application and then extrapolated through the time of the application. The area under the TEP trace and under the extrapolated line was measured for a period beginning 15 s after the beginning of the drug application and ending 15 s after the end of the drug application. The baseline for the integral was -10 mV, based on the observation that during maximal responses, the TEP drops to approximately this value. The response index was calculated as 1 - (area under the TEP trace/area under the extrapolated line). In occasional traces, small instabilities in the TEP led to extrapolated lines that did not accurately reflect the behavior of the TEP; in those cases, the 30-s fitting interval was adjusted to give a more accurate line.

RT-PCR. RT-PCR from whole fly and Malpighian tubule cDNA was performed as previously described (7). Primer sequences for the tyramine receptor (accession no. AB-073914) were ACAAGGACTCAGCGGGAGAATG and CGATGATGGTCAGCACGATAATG.

Urine secretion assay. The rate of urine secretion from isolated tubules was measured as described (16). Posterior tubules were dissected from adult females under SBM or saline (depending on the experiment) and then moved into a 15 µl of droplet of SBM or saline under mineral oil. One tubule was pulled out of the droplet and wrapped around a dissecting pin such that the cut end of the ureter and the lower section of the other tubule branch were pulled into the oil. Periodically, the secreted urine droplet was removed from the ureter with a fine glass rod, and its diameter was measured with an ocular micrometer. The volume of the droplet was calculated assuming spherical geometry. Collection intervals ranged from 12-20 min. Secretion rate was calculated as urine volume/collection time. For drug application, 12 µl of the bathing droplet was replaced twice with 12 µl of bathing solution + drug. The bathing droplet of control tubules was replaced twice with bathing solution alone.

Determination of chloride concentration in urine. The urine secretion assay was performed as described above. After the diameter of each urine droplet was measured, the droplet was taken up into a 250 nl of capillary tube (Drummond Scientific, Broomall, PA). The volume of the urine was again determined by measuring the length of the aqueous phase within the capillary. Any samples for which the two volume measurements disagreed by >10% were discarded from further analysis. The urine droplet was expelled into a tube containing 20 µl of H2O. Capillary electrophoresis was performed on the samples as described using a Waters Quanta 4000 (23). The elution time and area of the ultraviolet absorbance peaks were compared with standards of known composition and concentration, and the ion concentrations in the original urine droplet were then calculated.

Tyramine immunohistochemistry. Tubules were dissected from 7- to 9-day-old females under PBS and then incubated for 20 min in PBS containing 1 mM L-tyrosine before fixation. Immunostaining was performed as previously described (11), with the following modifications: the concentration of NaBH4 was 1%, and 0.1% BSA was added to the PMT solution. The primary antibody was a rabbit anti-tyramine antibody (Chemicon International, Temecula, CA), diluted 1:2,500. Immunostaining was detected with a biotinylated anti-rabbit secondary antibody, diluted 1:250 (Jackson ImmunoResearch, West Grove, PA), followed by the Vectastain peroxidase ABC kit (Vector Laboratories, Burlingame, CA) and incubation with DAB/peroxide/nickel.

Tyrosine decarboxylase enzyme assays. Assays for tyrosine decarboxylase (TDC) activity were performed on tubule extracts as described (28). Tubules from 18 adult females (4-7 days posteclosion) were homogenized on ice in 90 µl of buffer (50 mM Tris, pH 7.5, and 1 mM phenylthiourea). Protein content was measured in an aliquot of homogenate using the Bio-Rad protein assay reagent (Bio-Rad, Hercules, CA). Tubule homogenate (12 µl) was mixed with 48 µl of assay mix [100 mM sodium phosphate, pH 6.8, 0.1 mM pyridoxal phosphate, 1 mM beta -mercaptoethanol, 0.1 mM EDTA, and 20 µCi/ml L-[3,5-3H]tyrosine (Amersham, Piscataway, NJ)] and either incubated for 60 min at 30°C or placed on ice and processed immediately. Reactions were stopped by the addition of 300 µl of sodium phosphate, pH 8.0, and extracted with 100 µl of chloroform containing 100 mM diethylhexylphosphoric acid. The organic phase was reextracted with an additional 300 µl of sodium phosphate, and then 80 µl of the organic phase was placed into a scintillation vial and allowed to dry before the addition of scintillant and counting. Each experiment consisted of two zero-timepoint reactions (background) and three 60-min reactions; TDC activity was calculated by subtracting the averaged background counts from the averaged 60-min counts.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Isolated Drosophila Malpighian tubules exhibit a lumen-positive TEP that undergoes large oscillations in amplitude, but the cause of these oscillations has not yet been determined (7, 15). During the characterization of these oscillations, it became clear that although they were always present in tubules bathed in SBM, which contains tissue culture medium, oscillations were rarely seen when tubules were bathed in a simple saline. This effect of SBM is demonstrated most clearly by switching the bathing medium from saline to SBM; a typical response is shown in Fig. 1A. As is clear from this trace, SBM has two effects on the TEP. The first is a rapid and reversible depolarization and induction of oscillations. The appearance of oscillations is quantified by an increase in the coefficient of variation of the TEP (Fig. 1B, left). The second effect of SBM is an increase in the amplitude of the TEP that persists after the SBM is washed out (Fig. 1B, right). This study focuses on the depolarizing activity of SBM (however, see Fig. 7).


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 1.   A: electrophysiological response of a tubule to standard bathing medium (SBM). The bathing solution was switched from saline to SBM and back to saline, as indicated by the bar. B: quantitation of the effects of SBM on transepithelial potential (TEP) amplitude and coefficient of variation. * Significantly different from saline value; P < 0.05; paired t-test. **P < 0.0001; n.s., not significantly different from saline value; n = 6 tubules. Error bars in this and subsequent figures indicate SE.

SBM contains 50% Schneider's Drosophila medium, which is a mixture of yeast extract, salts, sugars, metabolic intermediates, and 20 amino acids (see METHODS for precise composition). To determine which component of the medium is responsible for the induction of oscillations, tubules were exposed to solutions containing different constituents of the complete medium. TEP oscillations were observed in the presence of either yeast extract or a mixture of all of the amino acids (data not shown). Individual testing of 10 of these amino acids revealed that tubules respond only to L-tyrosine. As shown in Fig. 2A, application of L-tyrosine causes the TEP to depolarize and oscillate in a manner indistinguishable to that induced by complete SBM.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 2.   Responses of tubules challenged with different concentrations of L-tyrosine (A) and tyramine (B) in saline. C: dose-response profiles of tyramine, L-tyrosine, DL-octopamine, and dopamine. n = 5-7 tubules/point. Individual tubules were challenged with up to 3 different concentrations of a single agonist; applications lasted 45 s and were separated by 3 min of saline. See METHODS for quantitation of the responses.

The amino acid tyrosine serves as a precursor for the synthesis of several biogenic amines (29, 45); tyrosine metabolism in insects is diagrammed in Fig. 3. Unlike in mammals, where a single aromatic amino acid decarboxylase acts upon both tyrosine and DOPA, insects possess separable TDC and DOPA decarboxylase (DDC) enzymes (54). Because it seemed possible that one of these metabolites could be mediating the effect of tyrosine, I tested three biogenic amines-dopamine, octopamine, and tyramine-on tubules. All three compounds elicited qualitatively similar electrical responses that also resembled those caused by tyrosine (Fig. 2B). At low doses, these amines caused the TEP to oscillate. Intermediate doses elicited a transient depolarization followed by oscillations, and high doses resulted in a sustained depolarization. This pattern of responses is quite similar to that observed in Aedes tubules to increasing doses of leucokinin (51). Strikingly, tyramine was several orders of magnitude more potent than any other compound tested, giving a measurable response at a concentration of 1 nM and a maximal response at ~100 nM (Fig. 2C). In contrast, octopamine caused measurable responses only at concentrations above 1 µM. The preferential response of tubules to tyramine over octopamine is particularly interesting, given that for many years, tyramine was thought simply to be a metabolic intermediate on the octopamine synthesis pathway. Only relatively recently have several lines of evidence suggested that tyramine can function as an independent signaling molecule; chief among these has been the cloning from Drosophila and other insect species of a receptor that is preferentially activated by tyramine over octopamine (2, 6, 40, 42, 46, 50).


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 3.   Pathways for metabolism of tyrosine in insects. TDC, tyrosine decarboxylase; Tbeta H, tyramine beta -hydroxylase; TH, tyrosine hydroxylase; DDC, DOPA decarboxylase.

To determine whether the antagonist pharmacology of the tubule response also matched that of the cloned tyramine receptor, I assayed the ability of several tyramine/octopamine receptor antagonists to block the depolarization elicited by an application of 50 nM tyramine. A full dose-response profile was generated for yohimbine, which is the most potent inhibitor of tyramine binding in the locust brain and to the cloned receptor (20, 46, 50); yohimbine blocked the response of tubules to 50 nM tyramine with a half-maximal concentration of ~300 nM. The rank-order potency of the three antagonists tested was yohimbine >=  phentolamine > metoclopramide (Fig. 4). This profile is very similar to that of an insect tyramine receptor stably expressed in a Drosophila cell line (50) and of the tyramine binding site in locust brain (20) but does not resemble that of any of the octopamine receptor subtypes (21). Consistent with the pharmacology, RT-PCR analysis shows that the gene encoding the tyramine receptor is expressed in the Malpighian tubules (Fig. 5).


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 4.   Antagonist pharmacology of the tyramine response. Tubules were treated with two 45-s applications of 50 nM tyramine (TA) separated by 3 min of saline. Yohimbine [1 µM (A) or 10 µM (B)] was added to the saline during the interval after the first TA application and during the second TA application. C: dose-response curve for yohimbine and single concentrations of phentolamine and metaclopramide, illustrating the relative potencies of the 3 antagonists. The ratio of the second TA response/first TA response is given; application profiles were identical to those shown in the first 2 panels. n = 4-6 tubules/point.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 5.   RT-PCR of tyramine receptor transcript from tubules. Lane 1: whole fly cDNA. Lane 2: tubule cDNA. Lane 3: tubule negative control (no reverse transcriptase). Lane 4: 100-bp ladder (Invitrogen). Expected products are 141 bp from mRNA and 700 bp from genomic DNA.

I next sought to characterize the ionic basis of the tyramine-induced depolarization. Previous work has shown that the TEP oscillations seen in the presence of SBM are due to fluctuations in the transepithelial chloride conductance (7). Because the Nernst potential for chloride between the peritubular bath and the lumen is near 0 mV, an increase in chloride conductance will cause the TEP to depolarize. It was therefore of interest to determine whether the tyramine-induced depolarizations were also associated with an increase in chloride conductance. Such was likely to be the case, both because high concentrations of tyramine cause the TEP to depolarize to near 0 mV and also because the electrical response of the tubule to tyramine resembles the response to leucokinin, which is known to increase chloride conductance (32). The chloride substitution experiment shown in Fig. 6 shows that tyramine does indeed cause a large increase in transepithelial chloride conductance, as indicated by the increased chloride diffusion potential in the presence of tyramine.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 6.   Tyramine increases transepithelial chloride conductance. A: trace recorded in saline. At bars marked "low Cl-," saline was switched to a saline in which 90% of the chloride was replaced with isethionate (see METHODS). At bars marked "TA," saline was switched to a saline containing 10 µM tyramine, first with normal chloride, then with 10% chloride during low Cl-/TA bar. A final application of low chloride saline was given after the electrode was withdrawn from the tubule to measure the diffusion potential at the open electrode. B: average responses to low chloride saline in the absence and presence of 10 µM TA. Responses were corrected for the electrode diffusion potential. n = 7 tubules; P < 5 × 10-7; paired t-test.

It is evident that the treatment of tubules with tyramine receptor agonists causes an electrical response indistinguishable from that induced by SBM. To determine whether the components of SBM act solely through the tyramine receptor, I measured the ability of yohimbine to block the response of the tubule to SBM. Figure 7A shows the TEP coefficient of variation measurements from tubules recorded in SBM in the presence of yohimbine; oscillations are blocked with a dose dependence very similar to that shown in Fig. 4 for the antagonism of tyramine responses. At the highest concentrations of yohimbine, TEP oscillations are completely absent, although the coefficient of variation is nonzero due to small fluctuations and drift in the TEP. Importantly, long-term (1-2 h) exposure to yohimbine did not appear to be toxic to the tubules, because there was no reduction in TEP amplitude with increasing concentrations of yohimbine. These results demonstrate that all of the oscillation-inducing activity of SBM is due to the activation of yohimbine-sensitive tyramine receptors.


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 7.   A: yohimbine eliminates SBM-induced oscillations. The graph shows the TEP coefficient of variation for tubules incubated in SBM with various concentrations of yohimbine for 1-1.8 h and then recorded in the same medium. n = 4-8 tubules/point. B and C: same experiment as in Fig. 1, but all recording solutions contain 100 µM yohimbine. n = 7 tubules. There is no significant effect of SBM + yohimbine on the TEP coefficient of variation; however, the increase in TEP amplitude is significant (P < 0.05; paired t-test). The starting TEP amplitudes of these tubules were not significantly different from those in Fig. 1, nor was the relative increase in amplitude after SBM treatment different (unpaired t-test).

Interestingly, the ability of SBM to increase the amplitude of the TEP, shown in Fig. 1, is not blocked by yohimbine. Figure 7, B and C, shows a similar experiment to that in Fig. 1, but in the presence of 100 µM yohimbine. Clearly, the blockade of the tyramine receptor prevents the depolarization and oscillations seen previously; however, the sustained increase in TEP amplitude is identical to that seen in Fig. 1. The time course of this increase is much more apparent in the absence of the depolarization and oscillations. This augmentation of the TEP could be due to a specific component of the SBM acting on a yohimbine-insensitive receptor; alternatively, exposure of the tubule to a rich medium such as SBM may result in a more general stimulation of epithelial transport. Also seen in the trace in Fig. 7B are a rapid hyperpolarization and depolarization when SBM is added and removed. These rapid effects are most likely due to differences in the ionic composition of saline and SBM (see METHODS). Most notably, SBM contains significantly less sodium than the saline, and removal of sodium from the peritubular bath leads to a hyperpolarization of the TEP (unpublished results).

Because yohimbine appears to be a selective blocker of tyraminergic signaling in the tubule, it is possible to use this antagonist to examine the role of tyramine in the function of the intact tubule. Urine secretion rates were measured in isolated tubules bathed in SBM; the addition of 100 µM yohimbine caused a 60% reduction in the rate of urine production (Fig. 8A). Measurements of the chloride concentration in the secreted urine droplets showed no effect of yohimbine (Fig. 8B). Thus the 60% reduction in secretion rate indicates a reduction in transepithelial chloride flux of the same magnitude. In isolated tubules bathed in SBM, therefore, approximately half of the transepithelial chloride transport occurs through a yohimbine-sensitive pathway, whereas the other half of the chloride transport persists in the absence of tyramine signaling.


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 8.   Effect of tyraminergic signaling on urine secretion and composition. A: inhibition of secretion rate by 100 µM yohimbine. n = 3 control and 7 yohimbine-treated tubules. Tubules were dissected and bathed in SBM. Yohimbine was added to the bathing droplet at the end of the second collection interval. For each tubule, each individual secretion rate measurement was normalized to the average of the first 2 measurements for that tubule. These average initial rates did not differ between the control and yohimbine-treated groups (3.2 ± 0.4 nl/min and 2.7 ± 0.3 nl/min, respectively). B: yohimbine treatment (100 µM) did not alter the concentration of chloride in the urine. n = 3 tubules; P = 0.5; paired t-test. C: stimulation of secretion by 1 µM tyramine. n = 5 control and 6 tyramine-treated tubules. Tubules were dissected and bathed in saline, and tyramine was added at the end of the second collection interval. Secretion rates were normalized as in A. Average initial rates did not differ between the control and tyramine-treated groups (1.5 ± 0.1 nl/min and 1.2 ± 0.2 nl/min, respectively).

If tyramine acts to stimulate transepithelial chloride flux, it should trigger diuresis when added to isolated tubules. Figure 8C shows that this is indeed the case. When added to tubules that were bathed in saline, 1 µM tyramine caused a 45% increase in urine secretion (P < 0.005, paired t-test).

The data shown in Fig. 2 demonstrate that tubules respond to tyrosine as well as tyramine, albeit at far greater concentrations. Tyrosine could be acting in one of two ways to elicit this response; it could be a weak agonist of the tyramine receptor, or it could be converted into tyramine by a TDC activity endogenous to the tubule. Two lines of evidence suggest that the latter is true. First, tubules contain a significant level of TDC activity. Assays of tubule extracts show a TDC activity of 18.8 ± 2.6 fmol tyramine · min-1 · mg-1 protein (n = 2 experiments). The only basis for comparison of this value with another Drosophila tissue is a report of TDC activity in extracts of adult brain of ~4 fmol · 10 min-1 · brain-1 (28). Converting the tubule activity yields a value for the activity from one fly's set of tubules of 0.21 ± 0.05 fmol/10 min; thus the tubules in a fly contain ~5% of the TDC activity of the brain. Given that the tubules consist of just over 300 cells (49), the amount of activity per cell is far higher in the tubules than in the brain.

The second line of evidence for endogenous conversion of tyrosine to tyramine is the observation that D-tyrosine, the inactive enantiomer of L-tyrosine, inhibits the response of wild-type tubules to L-tyrosine but not to tyramine. Figure 9 shows traces from tubules challenged with two applications of either L-tyrosine or tyramine; between the two applications, the tubule is treated with either D-tyrosine or saline. As quantified in Fig. 9C, the second response to L-tyrosine is nearly eliminated by the D-tyrosine application, whereas the tyramine response is unaffected. This selective antagonism would be virtually impossible to explain if L-tyrosine were a direct agonist of the tyramine receptor. If, however, the tubule is converting tyrosine to tyramine, there are many steps that could potentially be inhibited by D-tyrosine (see DISCUSSION). Taken together therefore, the D-tyrosine and TDC assay results provide strong evidence for endogenous production of tyramine by the Drosophila tubule.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 9.   Effect of D-tyrosine on the L-tyrosine response. A: responses of tubules to two 45-s applications of 500 µM L-tyrosine separated by a 3-min application of either 500 µM D-tyrosine (left trace) or saline (right trace). B: same as in A, except that the agonist is 50 nM tyramine. C: average ratios of the second response/first response, showing the effect of D-tyrosine on the second L-tyrosine response (P < 0.001 compared with saline; unpaired t-test) and the second tyramine response (not significantly different from saline). n = 5-6 tubules/condition. There were no significant differences in the amplitudes of the first responses from tubules treated with L-tyrosine/D-tyrosine vs. L-tyrosine/saline, tyramine/D-tyrosine vs. tyramine/saline, or L-tyrosine/D-tyrosine vs. tyramine/D-tyrosine.

The tubule is a heterogeneous tissue, and TEP measurements do not give any information as to cellular localization of function; therefore, it is important to determine which cell type is responsible for the production of tyramine. Because TDC is thought to be an intracellular enzyme (19), I reasoned that the tyramine-producing cells should contain relatively high levels of tyramine. Figure 10 shows the pattern of immunostaining seen with an antibody against tyramine. The principal cells are labeled, whereas stellate cells are stained either lightly or not at all. Thus the principal cells appear to be the major site of tyramine production.


View larger version (50K):
[in this window]
[in a new window]
 
Fig. 10.   Immunolabeling of tubules with an antibody against tyramine. A: immunoreactivity is apparent throughout the tubule, indicating staining of the principal cells, which make up the large majority of the epithelium. B: absence of staining in a control tubule treated without the primary antibody. C: higher magnification of tubule in A. A stellate cell (arrow) is visible as an unstained "window" in the tubule. The diameters of the tubules are ~35 µm.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

I have shown that tyramine causes an increase in chloride conductance across the Drosophila Malpighian tubule. The pharmacology of this response matches very closely that of the cloned insect tyramine receptor, both in the selectivity of tyramine over other biogenic amines, particularly octopamine, and in the rank-order potency of several tyramine/octopamine antagonists (40, 42, 46, 50). This represents the first report of a physiological response with the same pharmacology as the tyramine receptor and the first well-defined role for tyramine in an insect tissue. Three previous studies have implicated tyramine in other aspects of insect physiology. First, tyramine has been reported to be necessary for the sensitization of Drosophila to repeated applications of cocaine (28), although this function has not yet been localized anatomically. In addition, two brief reports showed differential effects of tyramine, compared with octopamine, in stimulating trehalose metabolism in isolated cockroach fat bodies (18) and in inhibiting the contraction of locust visceral muscle (22). No additional pharmacological characterization was performed in either system. Although I have not shown conclusively in the Drosophila tubule that the cloned tyramine receptor is responsible for the increased chloride conductance, the expression of the receptor in the tubule and the close match in the pharmacology of the response with that of the cloned receptor make this highly likely to be the case.

A recent paper has reported the identification of flies carrying a mutation (hono) in the tyramine receptor gene (24). These flies contain a transposon inserted upstream of the first noncoding exon of the receptor gene; this exon is ~25 kb upstream of the rest of the gene. I have found that, although the tubules of hono flies are hyposensitive to tyramine, tubules from the parental stock, which does not contain the transposon insertion, are similarly hyposensitive (unpublished results). Indeed, tubules from many common laboratory stocks are hyposensitive to tyramine; the genetic basis for this phenotype is currently under investigation. It is possible that the hono insertion does not affect the expression of the tyramine receptor in the tubule, perhaps due to the utilization of an alternative transcriptional start site or other tissue-specific message processing.

A model for the synthesis and action of tyramine in the tubule is presented in Fig. 11. Three features of this model merit discussion. The first is the synthesis and release of tyramine by the tubule. The evidence for this is as follows: first, tyrosine and tyramine both increase chloride conductance, and the actions of both are blocked by yohimbine with a very similar potency (compare Figs. 4C and 7A), suggesting that both stimulate the same receptor. Second, the D-tyrosine effect presented in Fig. 9 argues against a direct action of tyrosine at the tyramine receptor. Finally, the tubule contains significant TDC activity and so is capable of converting tyrosine to tyramine. Thus tyrosine must be taken up from the peritubular bath and decarboxylated into tyramine. This tyramine must then be released; release is most likely across the basolateral membrane because the tyramine receptor is accessible to agents applied to the peritubular bath, although I cannot exclude the possibility that tyramine can also act within the tubule lumen. The molecular mechanisms governing the uptake of tyrosine and subsequent release of tyramine are unknown, although the data shown in Fig. 9 suggest that one of these steps is inhibited by D-tyrosine.


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 11.   Model for tyraminergic signaling in the tubule. See text for details. A principal cell is at left, unshaded, and a stellate cell is at right, shaded.

The second feature of the model is that the principal cells are the site of tyramine production and release. This is a likely but not definitive conclusion from the data. Figure 10 clearly shows that principal cells contain tyramine and that stellate cells do not stain strongly with the antibody, but it remains possible that stellate cells are also capable of synthesizing tyramine. Interestingly, incubation of tubules in the absence of tyrosine, which the electrophysiology suggests should deplete the "releasable" pool of tyramine, does not lead to a noticeable reduction in tyramine immunoreactivity (data not shown), demonstrating that most of the immunostaining does not represent the releasable pool of tyramine. Clearly then, the production of tyramine by the tubule is likely to be compartmentalized, and further studies are needed for its conclusive localization.

The third feature of the model is that tyramine binds to receptors on the stellate cells. Previously, I showed that the TEP oscillations seen in SBM were governed by calcium levels in the stellate cells; the oscillations are eliminated by chelation of intracellular calcium, and treatment of tubules with leucokinin, which increases calcium levels specifically in stellate cells (33, 41), causes a long-lasting suppression of the oscillations (7). The current work has demonstrated that the TEP oscillations are the result of the activation of tyramine receptors, thereby linking this signaling pathway, albeit indirectly, with intracellular calcium levels in the stellate cells. Consistent with this hypothesis, activation of the cloned insect tyramine receptor can cause increases in intracellular calcium levels in several heterologous systems (40, 42, 44). It now appears likely that the leucokinin-induced suppression of oscillations resulted from a cross-desensitization of the leucokinin and tyramine signaling pathways and that both pathways converge at some point downstream of receptor activation to stimulate chloride transport. The pathway for this chloride transport, paracellular or transcellular, is still unknown, and both possibilities are shown on the model.

The action of tyramine by the tubule bears a striking resemblance to dopaminergic signaling in the mammalian kidney. In the latter case, dopamine is employed in the proximal tubule as a paracrine or autocrine hormone to regulate sodium transport (reviewed in Ref. 1). The dopamine is produced from circulating DOPA by an aromatic amino acid decarboxylase (AADC). Interestingly, AADC is also able to decarboxylate tyrosine to produce tyramine. Although DOPA is the preferred substrate, it has been calculated that due to the much higher levels of tyrosine than DOPA in the circulation, tyramine and dopamine should be produced in vivo at comparable rates (10). Indeed, the kidney contains high levels of tyramine (36), and a recently cloned mammalian tyramine receptor is expressed in the kidney (9, 12). There are currently no specific pharmacological tools for manipulating tyraminergic signaling in vertebrates-yohimbine is also an alpha -adrenergic antagonist-but it is possible that tyramine will prove to be important in vertebrate renal function as well.

The current work raises the possibility that chloride transport in the tubule may be more complicated than was previously appreciated. Until now, there has been no evidence for heterogeneity of chloride transport pathways; hence, agents that increase chloride conductance, such as leucokinin, are thought to increase the amplitude of the conductance pathway that is active in the unstimulated tubule (33, 34). The data shown in Fig. 8 suggest an alternative possibility; the tubule may possess multiple, pharmacologically separable pathways for chloride transport. At least one pathway is calcium sensitive and can be stimulated by leucokinin and tyramine. When tyraminergic signaling is blocked by yohimbine, however, there is still a significant level of chloride transport and urine secretion. This could represent a basal level of activation of the calcium-sensitive pathway, but it could also represent an additional, calcium-independent pathway. Unfortunately, the lack of specific pharmacological agents for blocking chloride conductance makes it difficult to distinguish between these two possibilities. It is hoped that the techniques available in Drosophila for the manipulation of gene expression may allow for the resolution of this issue.

Bathing solutions containing Schneider's medium have been used as the control medium in many studies involving Drosophila tubule function. It is clear from the current study that tubules bathed in SBM are not unstimulated relative to saline. Rather, SBM influences tubule physiology in at least two different ways; first, by increasing chloride conductance through the activation of tyramine receptors, and second, by increasing the amplitude of the TEP through an as-yet uncharacterized mechanism.

The stimulation of chloride conductance and urine secretion by tyramine is likely to be physiologically important in the intact fly and not simply an artifact of the recording conditions in vitro. Drosophila hemolymph contains a relatively high level of tyrosine (38), similar to that found in SBM, so the tyraminergic signaling pathway is almost certainly active in vivo. Moreover, because tyramine is a product of bacterial metabolism, it is likely to be present in the decomposing fruit on which the fly feeds. Food containing tyramine would therefore be expected to trigger a postfeeding diuretic response. In the locust, postfeeding diuresis is triggered by a CRF-like diuretic peptide hormone (3, 35); the response to tyramine in Drosophila would be different in that it would be mediated by a component of the food itself. Because the high rate of urine production by the tubules is thought to important for clearing toxins from the hemolymph (27, 37), it is tempting to speculate that the response to tyramine could have evolved to protect the fly from toxic substances that might be present in its food. Whatever the purpose, it is clear that tyramine represents an addition to the multiple signals already known to control renal function in insects.


    ACKNOWLEDGEMENTS

I thank Dr. Gene Block for support, Dr. Jay Hirsh and the members of his lab for helpful discussions, fly lines, equipment, and reagents, Dr. James Burnette for the tyramine receptor primers, Shannon Cole for assistance with the TDC assay, and Drs. Oliver Schneider and Robert Kelly for assistance with the capillary electrophoresis.


    FOOTNOTES

This work was supported by the University of Virginia and National Institute of Diabetes and Digestive and Kidney Diseases R21-DK-060860 to E. M. Blumenthal.

Address for reprint requests and other correspondence: E. M. Blumenthal, Dept. of Biology, Gilmer Hall, Univ. of Virginia, P.O. Box 400328, Charlottesville, VA 22904-4328 (E-mail: eb5f{at}virginia.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

First published November 20, 2002;10.1152/ajpcell.00359.2002

Received 2 August 2002; accepted in final form 18 November 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Aperia, AC. Intrarenal dopamine: a key signal in the interactive regulation of sodium metabolism. Annu Rev Physiol 62: 621-647, 2000[Web of Science][Medline].

2.   Arakawa, S, Gocayne JD, McCombie WR, Urquhart DA, Hall LM, Fraser CM, and Venter JC. Cloning, localization, and permanent expression of a Drosophila octopamine receptor. Neuron 4: 343-354, 1990[Web of Science][Medline].

3.   Audsley, N, Goldsworthy GJ, and Coast GM. Circulating levels of Locusta diuretic hormone: the effects of feeding. Peptides 18: 59-65, 1997[Web of Science][Medline].

4.   Beyenbach, KW. Mechanism and regulation of electrolyte transport in Malpighian tubules. J Insect Physiol 41: 197-207, 1995.

5.   Beyenbach, KW, Aneshansley DJ, Pannabecker TL, Masia R, Gray D, and Yu MJ. Oscillations of voltage and resistance in Malpighian tubules of Aedes aegypti. J Insect Physiol 46: 321-333, 2000[Web of Science][Medline].

6.   Blenau, W, Balfanz S, and Baumann A. Amtyr1: characterization of a gene from honeybee (Apis mellifera) brain encoding a functional tyramine receptor. J Neurochem 74: 900-908, 2000[Web of Science][Medline].

7.   Blumenthal, EM. Characterization of transepithelial potential oscillations in the Drosophila Malpighian tubule. J Exp Biol 204: 3075-3084, 2001[Abstract/Free Full Text].

8.   Blumenthal, EM. Modulation of tyramine signaling by osmolality in the Drosophila Malpighian tubule (Abstract). FASEB J 16 (107): 10, 2002.

9.   Borowsky, B, Adham N, Jones KA, Raddatz R, Artymyshyn R, Ogozalek KL, Durkin MM, Lakhlani PP, Bonini JA, Pathirana S, Boyle N, Pu X, Kouranova E, Lichtblau H, Ochoa FY, Branchek TA, and Gerald C. Trace amines: identification of a family of mammalian G protein-coupled receptors. Proc Natl Acad Sci USA 98: 8966-8971, 2001[Abstract/Free Full Text].

10.   Brier, ME, Bowsher RR, Mayer PR, and Henry DP. Conversion of p-tyrosine to p-tyramine in the isolated perfused rat kidney: modulation by perfusate concentrations of p-tyrosine. Life Sci 48: 901-907, 1991[Web of Science][Medline].

11.   Budnik, V, and White K. Catecholamine-containing neurons in Drosophila melanogaster: distribution and development. J Comp Neurol 268: 400-413, 1988[Web of Science][Medline].

12.   Bunzow, JR, Sonders MS, Arttamangkul S, Harrison LM, Zhang G, Quigley DI, Darland T, Suchland KL, Pasumamula S, Kennedy JL, Olson SB, Magenis RE, Amara SG, and Grandy DK. Amphetamine, 3,4-methylenedioxymethamphetamine, lysergic acid diethylamide, and metabolites of the catecholamine neurotransmitters are agonists of a rat trace amine receptor. Mol Pharmacol 60: 1181-1188, 2001[Abstract/Free Full Text].

13.   Coast, GM. Neuropeptides implicated in the control of diuresis in insects. Peptides 17: 327-336, 1996[Web of Science][Medline].

14.   Coast, GM, Webster SG, Schegg KM, Tobe SS, and Schooley DA. The Drosophila melanogaster homologue of an insect calcitonin-like diuretic peptide stimulates V-ATPase activity in fruit fly Malpighian tubules. J Exp Biol 204: 1795-1804, 2001[Abstract].

15.   Davies, SA, Huesmann GR, Maddrell SH, O'Donnell MJ, Skaer NJ, Dow JA, and Tublitz NJ. CAP2b, a cardioacceleratory peptide, is present in Drosophila and stimulates tubule fluid secretion via cGMP. Am J Physiol Regul Integr Comp Physiol 269: R1321-R1326, 1995[Abstract/Free Full Text].

16.   Dow, JA, Maddrell SH, Gortz A, Skaer NJ, Brogan S, and Kaiser K. The malpighian tubules of Drosophila melanogaster: a novel phenotype for studies of fluid secretion and its control. J Exp Biol 197: 421-428, 1994[Abstract].

17.   Dow, JAT, and Davies SA. The Drosophila melanogaster Malpighian Tubule. Adv Insect Physiol 28: 1-83, 2001.

18.   Downer, RG. Trehalose production in isolated fat body of the American cockroach, Periplaneta americana. Comp Biochem Physiol C 62C: 31-34, 1979[Medline].

19.   Facchini, PJ, Huber-Allanach KL, and Tari LW. Plant aromatic-amino acid decarboxylases: evolution, biochemistry, regulation, and metabolic engineering applications. Phytochemistry 54: 121-138, 2000[Web of Science][Medline].

20.   Hiripi, L, Juhos S, and Downer RG. Characterization of tyramine and octopamine receptors in the insect (Locusta migratoria migratorioides) brain. Brain Res 633: 119-126, 1994[Web of Science][Medline].

21.   Howell, KMR, and Evans PD. The characterization of presynaptic octopamine receptors modulating octopamine release from an identified neurone in the locust. J Exp Biol 201: 2053-2060, 1998[Abstract].

22.   Huddart, H, and Oldfield AC. Spontaneous activity of foregut and hindgut visceral muscle of the locust, Locusta migratoria. II. The effect of biogenic amines. Comp Biochem Physiol 73C: 303-311, 1982.

23.   Kelly, RG, Yuan J, Weyant CM, and Lewis KS. Applications of capillary electrophoresis in corrosion science and engineering. J Chromatogr A 834: 433-444, 1999.

24.   Kutsukake, M, Komatsu A, Yamamoto D, and Ishiwa-Chigusa S. A tyramine receptor gene mutation causes a defective olfactory behavior in Drosophila melanogaster. Gene 245: 31-42, 2000[Web of Science][Medline].

25.   Linton, SM, and O'Donnell MJ. Contributions of K+: Cl- cotransport and Na+/K+-ATPase to basolateral ion transport in Malpighian tubules of Drosophila melanogaster. J Exp Biol 202: 1561-1570, 1999[Abstract].

26.   Maddrell, SH, Pilcher DE, and Gardiner BO. Stimulatory effect of 5-hydroxytryptamine (serotonin) on secretion by malpighian tubules of insects. Nature 222: 784-785, 1969[Medline].

27.   Maddrell, SHP Characteristics of epithelial transport in insect malpighian tubules. In: Current Topics in Membranes and Transport, edited by Bronner F, and Kleinzeller A.. New York: Academic, 1980, p. 427-463.

28.   McClung, C, and Hirsh J. The trace amine tyramine is essential for sensitization to cocaine in Drosophila. Curr Biol 9: 853-860, 1999[Web of Science][Medline].

29.   Monastirioti, M. Biogenic amine systems in the fruit fly Drosophila melanogaster. Microsc Res Tech 45: 106-121, 1999[Web of Science][Medline].

30.   Morgan, PJ, and Mordue W. Stimulated fluid secretion is sodium dependent in the Malpighian tubules of Locusta migratoria. J Insect Physiol 27: 271-279, 1981.

31.   Morgan, PJ, and Mordue W. 5-Hydroxytryptamine stimulates fluid secretion in locust malpighian tubules independently of cAMP. Comp Biochem Physiol C 79: 305-310, 1984[Medline].

32.   O'Donnell, MJ, Dow JA, Huesmann GR, Tublitz NJ, and Maddrell SH. Separate control of anion and cation transport in malpighian tubules of Drosophila melanogaster. J Exp Biol 199: 1163-1175, 1996[Abstract].

33.   O'Donnell, MJ, Rheault MR, Davies SA, Rosay P, Harvey BJ, Maddrell SHP, Kaiser K, and Dow JAT Hormonally controlled chloride movement across Drosophila tubules is via ion channels in stellate cells. Am J Physiol Regul Integr Comp Physiol 43: R1039-R1049, 1998.

34.   Pannabecker, TL, Hayes TK, and Beyenbach KW. Regulation of epithelial shunt conductance by the peptide leucokinin. J Membr Biol 132: 63-76, 1993[Web of Science][Medline].

35.   Patel, M, Hayes T, and Coast G. Evidence for the hormonal function of a CRF-related diuretic peptide (Locusta-DP) in Locusta migratoria. J Exp Biol 198: 793-804, 1995[Medline].

36.   Philips, SR, Durden DA, and Boulton AA. Identification and distribution of p-tyramine in the rat. Can J Biochem 52: 366-373, 1974[Web of Science][Medline].

37.   Phillips, J. Comparative physiology of insect renal function. Am J Physiol Regul Integr Comp Physiol 241: R241-R257, 1981[Abstract/Free Full Text].

38.   Pierce, VA, Mueller LD, and Gibbs AG. Osmoregulation in Drosophila melanogaster selected for urea tolerance. J Exp Biol 202: 2349-2358, 1999[Abstract].

39.   Pilcher, DEM The influence of the diuretic hormone on the process of urine secretion by the Malpighian tubules of Carausius morosus. J Exp Biol 53: 465-484, 1970[Abstract/Free Full Text].

40.   Poels, J, Suner MM, Needham M, Torfs H, De Rijck J, De Loof A, Dunbar SJ, and Van den Broeck J. Functional expression of a locust tyramine receptor in murine erythroleukaemia cells. Insect Mol Biol 10: 541-548, 2001[Web of Science][Medline].

41.   Radford, JC, Davies SA, and Dow JA. Systematic G-protein-coupled receptor analysis in Drosophila melanogaster identifies a leucokinin receptor with novel roles. J Biol Chem 277: 38810-38817, 2002[Abstract/Free Full Text].

42.   Reale, V, Hannan F, Midgley JM, and Evans PD. The expression of a cloned Drosophila octopamine/tyramine receptor in Xenopus oocytes. Brain Res 769: 309-320, 1997[Web of Science][Medline].

43.   Rheault, MR, and O'Donnell MJ. Analysis of epithelial K+ transport in Malpighian tubules of Drosophila melanogaster: evidence for spatial and temporal heterogeneity. J Exp Biol 204: 2289-2299, 2001[Abstract/Free Full Text].

44.   Robb, S, Cheek TR, Hannan FL, Hall LM, Midgley JM, and Evans PD. Agonist-specific coupling of a cloned Drosophila octopamine/tyramine receptor to multiple second messenger systems. EMBO J 13: 1325-1330, 1994[Web of Science][Medline].

45.   Roeder, T. Biogenic amines and their receptors in insects. Comp Biochem Physiol 107C: 1-12, 1994.

46.   Saudou, F, Amlaiky N, Plassat JL, Borrelli E, and Hen R. Cloning and characterization of a Drosophila tyramine receptor. EMBO J 9: 3611-3617, 1990[Web of Science][Medline].

47.   Singleton, K, and Woodruff RI. The osmolarity of adult Drosophila hemolymph and its effect on oocyte-nurse cell electrical polarity. Dev Biol 161: 154-167, 1994[Web of Science][Medline].

48.   Skaer, NJ, Nassel DR, Maddrell SH, and Tublitz NJ. Neurochemical fine tuning of a peripheral tissue: peptidergic and aminergic regulation of fluid secretion by Malpighian tubules in the tobacco hawkmoth M. sexta. J Exp Biol 205: 1869-1880, 2002[Abstract/Free Full Text].

49.   Sözen, MA, Armstrong JD, Yang M, Kaiser K, and Dow JA. Functional domains are specified to single-cell resolution in a Drosophila epithelium. Proc Natl Acad Sci USA 94: 5207-5212, 1997[Abstract/Free Full Text].

50.   Vanden Broeck, J, Vulsteke V, Huybrechts R, and De Loof A. Characterization of a cloned locust tyramine receptor cDNA by functional expression in permanently transformed Drosophila S2 cells. J Neurochem 64: 2387-2395, 1995[Web of Science][Medline].

51.   Veenstra, JA, Pattillo JM, and Petzel DH. A single cDNA encodes all three Aedes leucokinins, which stimulate both fluid secretion by the malpighian tubules and hindgut contractions. J Biol Chem 272: 10402-10407, 1997[Abstract/Free Full Text].

52.   Wessing, A, and Eichelberg D. Malpighian tubules, rectal papillae and excretion. In: The Genetics and Biology of Drosophila, edited by Ashburner M, and Wright TRF. London: Academic, 1978, p. 1-42.

53.   Williams, JC, and Beyenbach KW. Differential effects of secretagogues on the electrophysiology of the Malpighian tubules of the yellow fever mosquito. J Comp Physiol [B] 154: 301-309, 1984.

54.   Yu, PH, and Sloley BD. Some aspects on L-dopa decarboxylase and p-tyrosine decarboxylase in the central nervous and peripheral tissues of the American cockroach Periplaneta americana. Comp Biochem Physiol C 87: 315-319, 1987[Medline].


Am J Physiol Cell Physiol 284(3):C718-C728
0363-6143/03 $5.00 Copyright © 2003 the American Physiological Society



This article has been cited by other articles:


Home page
J. Exp. Biol.Home page
E. M. Blumenthal
Isoform- and cell-specific function of tyrosine decarboxylase in the Drosophila Malpighian tubule
J. Exp. Biol., December 1, 2009; 212(23): 3802 - 3809.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
J. A. T. Dow
Insights into the Malpighian tubule from functional genomics
J. Exp. Biol., February 1, 2009; 212(3): 435 - 445.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
B. Brembs, F. Christiansen, H. J. Pfluger, and C. Duch
Flight Initiation and Maintenance Deficits in Flies with Genetically Altered Biogenic Amine Levels
J. Neurosci., October 10, 2007; 27(41): 11122 - 11131.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
E. M. Blumenthal
Modulation of tyramine signaling by osmolality in an insect secretory epithelium
Am J Physiol Cell Physiol, November 1, 2005; 289(5): C1261 - C1267.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. H. Cole, G. E. Carney, C. A. McClung, S. S. Willard, B. J. Taylor, and J. Hirsh
Two Functional but Noncomplementing Drosophila Tyrosine Decarboxylase Genes: DISTINCT ROLES FOR NEURAL TYRAMINE AND OCTOPAMINE IN FEMALE FERTILITY
J. Biol. Chem., April 15, 2005; 280(15): 14948 - 14955.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/3/C718    most recent
00359.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (28)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Blumenthal, E. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Blumenthal, E. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online