Am J Physiol Cell Physiol Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 284: C389-C403, 2003. First published October 3, 2002; doi:10.1152/ajpcell.00052.2002
0363-6143/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/2/C389    most recent
00052.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (27)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thi, M. M.
Right arrow Articles by Spray, D. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thi, M. M.
Right arrow Articles by Spray, D. C.
Vol. 284, Issue 2, C389-C403, February 2003

Fluid shear stress remodels expression and function of junctional proteins in cultured bone cells

Mia M. Thi1,2, Takashi Kojima2, Stephen C. Cowin1, Sheldon Weinbaum1, and David C. Spray1,2

1 New York Center for Biomedical Engineering, City College of the City University of New York, New York, 10031; and 2 Department of Neuroscience, Albert Einstein College of Medicine, Yeshiva University, Bronx, New York 10461


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

We tested the hypothesis that fluid shear stress (tau ) modifies the expression, function, and distribution of junctional proteins [connexin (Cx)43, Cx45, and zona occludens (ZO)-1] in cultured bone cells. Cell lines with osteoblastic (MC3T3-E1 cells) and osteocytic (MLO-Y4 cells) phenotypes were exposed to tau -values of 5 or 20 dyn/cm2 for 1-3 h. Immunostaining indicated that at 5 dyn/cm2, the distribution of Cx43, Cx45, and ZO-1 was moderately disrupted at cell membranes; at 20 dyn/cm2, disruption was more severe. Intercellular coupling was significantly decreased at both shear stress levels. Western blots showed the downregulation of membrane-bound Cx43 and ZO-1 and the upregulation of cytosolic Cx43 and Cx45 at different levels of shear stress. Similarly, Northern blots revealed that expression of Cx43, Cx45, and ZO-1 was selectively up- and downregulated in response to different shear stress levels. These results indicate that in cultured bone cells, fluid shear stress disrupts junctional communication, rearranges junctional proteins, and determines de novo synthesis of specific connexins to an extent that depends on the magnitude of the shear stress. Such disconnection from the bone cell network may provide part of the signal whereby the disconnected cells or the remaining network initiate focal bone remodeling.

gap junctions; connexin; zona occludens-1; mechanotransduction; bone remodeling


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

BONE DRAMATICALLY CHANGES its structure and mass in response to static and dynamic loads. It has been well established that bending loads in bone cause small deformations in the bone matrix, which in turn generate fluid pressure differences that lead to fluid flow from the compression to the tension side. The resulting fluid shear stress (tau ) is proposed to be one of the factors by which the bone cell network senses mechanical loading (7, 51, 54, 61). At physiological whole-tissue strain levels (<0.2%), culture studies have demonstrated that fluid flow is a more potent stimulator of bone cells than is substrate deformation itself (38, 59). Previous experimental studies have shown that bone cells release signaling molecules such as prostaglandins, nitric oxide (NO), Ca2+, and other second messengers in response to the fluid shear stress (3, 18, 20, 24, 41).

One mechanism of bone remodeling by which second messenger signals spread throughout the bone cell network involves gap junction channels that connect osteoblasts and bone-lining cells along the surfaces of Haversian and Volkmann canals and osteocytes that are embedded within the bone matrix (15, 22, 62). The connexin proteins that form gap junctions are encoded by a gene family with as many as 21 members in mammals (56). Connexins are expressed with an overlapping pattern of tissue specificity; connexin43 (Cx43) and connexin45 (Cx45) are the gap junction proteins that have been associated with bone cells (5, 33, 34, 48, 57).

Gap junction channels, including those formed by Cx43 and Cx45, are permeable to signaling ions and second messenger molecules (46). Gap junctional communication of such signals between bone cells gives rise to modulation of hormonal responses in the osteoblastic network (53), regulation of gene expression (29), and propagation of intracellular signals (12). Moreover, connexin expression and function are essential for normal osteogenesis and bone mineralization (30, 31, 34).

Connexins may also play roles in addition to the formation of pathways for intercellular communication. Recent studies have shown that connexins directly interact with both adherens and tight junction-associated proteins including zona occludens-1 (ZO-1), claudins, and beta -catenin (1, 16, 26, 37, 50). Accordingly, it has been proposed that connexins are part of a multimolecular signaling complex, the "Nexus" (47). From the standpoint of the studies described here, ZO-1 has been shown to interact with gap junction proteins Cx43 and Cx45 in osteoblastic cells (28) where ZO-1 binding to connexins may play a role in the organization, trafficking, and/or stabilization of gap junction proteins (28, 49).

Regulation of gap junctional communication in response to load-induced biophysical signals has been examined in both vascular endothelial (6, 10) and bone cells (4, 13, 62, 63). Although such studies have generally reported an increase in Cx43 expression, changes in functional coupling in the bone cell network have not been as consistently demonstrated.

In this study, we tested the hypothesis that fluid shear stress of the magnitude that is expected to occur in bone tissue modifies the expression, distribution, and function of connexins (Cx43 and Cx45) and an associated protein (ZO-1). Well-characterized cell lines, MC3T3-E1 osteoblastic and MLO-Y4 osteocytic cells, were used in our experiments. Our results demonstrate that in both osteoblastic and osteocytic cell lines, fluid shear stress disrupts cell-to-cell junctional communication, rearranges gap junction proteins, and determines de novo synthesis of specific connexins to an extent that depends on the magnitude of the shear stress. Such disconnection from the bone cell network due to fluid shear stress may provide part of the signal whereby the disconnected cells or the remaining network initiates focal bone remodeling.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Cell culture. Osteoblastlike MC3T3-E1 cells (obtained from Dr. Kenneth J. McLeod, SUNY, Stony Brook) were cultured in alpha -MEM (GIBCO-BRL, Grand Island, NY) that contained 1% penicillin-streptomycin (GIBCO-BRL) and 5% fetal bovine serum (FBS, Gemini Bio-Products, Woodland, CA), and osteocyte-like MLO-Y4 cells (obtained from Dr. Lynda F. Bonewald, Univ. TX Health Science Center) were cultured in alpha -MEM that contained 1% penicillin-streptomycin, 10% FBS, and 2.5% calf serum (GIBCO-BRL) at 37°C with 95% O2-5% CO2. For each cell type, confluent monolayers of cells were grown on glass slides in static conditions and transferred to the flow apparatus to expose the monolayers to a fluid tau -value of 5 or 20 dyn/cm2 for 1, 2, or 3 h. These durations were chosen based on the turnover rates of Cx43 and Cx45, which exhibit half-lives of 1.5 and 3 h, respectively (9).

Flow chamber and experiment. The fluid-flow setup consisted of a parallel-plate flow chamber (Cytodyne, La Jolla, CA) and a recirculating flow circuit. This circuit included a variable-speed peristaltic pump (Taitec, Saitama, Japan), pulse dampener (Cole-Palmer Instruments, Vernon Hills, IL), and a reservoir with culture medium (alpha -MEM with 1% FBS) maintained at 37°C with 95% O2-5% CO2. This system produces laminar flow over a cell monolayer. A flow rate was chosen to yield a tau -value of 5 or 20 dyn/cm2 using the equation tau  = 6Qµ/bh2, where Q is flow rate, µ is medium viscosity, and b and h are channel width and height, respectively. Control cells were kept under static conditions with the same culture medium at 37°C.

Alkaline phosphatase staining. To determine whether cells retained the differentiated phenotypes, both cell lines were routinely checked for alkaline phosphatase activity. Cells were fixed with 4% formaldehyde and permeabilized with 70% ethyl alcohol (EtOH). Cells were then rinsed with 0.2 M Tris(hydroxymethyl)-aminomethane (Sigma, St. Louis, MO) and incubated in naphthol AS-BI phosphate (Sigma) with fast red violet LB salt (Sigma) plus Tris · HCl for 30 min (2). After several washes with distilled water, cells were counterstained with Mayer's hematoxylin (Sigma) for 2 min. The cells were then washed with distilled water and mounted for analysis.

Cell viability studies. Cells from both control and shear stress-exposed samples were analyzed for health and viability using the Live/Dead Viability/Cytotoxity kit (Molecular Probes, Eugene, OR). Cells were rinsed a few times with 1× PBS and incubated with 4 µM eithidium homodimer-1 (EthD-1) and 2 µM of calcein-acetoxymethyl ester in 1× PBS for 30 min as recommended by the manufacturer. Live cells, which retained the polyanionic dye calcein, gave rise to green fluorescence; dead cells, which took up EthD-1 through membrane damage, produced red fluorescence. Live and dead cells were counted from 10 cell fields for all of the samples, and percentages of live and dead cells were calculated.

Immunofluorescence studies. Both control and shear stress-exposed cells were fixed with 2% formaldehyde, permeabilized with 0.4% Triton X-100 (Sigma), and blocked with 10% goat serum (GIBCO-BRL) in 1× PBS. The cells were then incubated with primary polyclonal antibodies against Cx43, Cx45 (courtesy of Dr. E. Hertzberg, AECOM and Dr. T. Steinberg, Washington Univ. School of Medicine), ZO-1 (Zymed, South San Francisco, CA), and secondary antibody conjugated to Alexa 488 (Molecular Probes). For F-actin staining, cells were incubated with rhodamine-labeled phalloidin (Sigma) immediately after fixation. The coverslips were mounted on slides, examined on a Nikon Eclipse TE300 microscope, and photographed using a SPOT-RT digital camera (Diagnostic Instruments, Sterling Heights, MI).

Western blot analysis. Controls and shear stress-exposed (1 and 3 h) samples were lysed in 80 µl of lysis buffer [10 mM Tris · HCl, pH 7.5, and 2 mM phenylmethylsulfonyl fluoride (PMSF)], sonicated, and centrifuged (14,000 rpm for 30 min) as described by Guan et al. (17). Pellets and supernatants from the samples were collected for crude membrane and cytosolic protein analyses. Samples were loaded onto 10% SDS-PAGE gels (Bio-Rad Laboratories, Hercules, CA) for separation and were electrophoretically transferred to nitrocellulose membranes (Schleicher and Schuell, Keene, NH). The membranes were probed with primary polyclonal and monoclonal antibodies to Cx43, Cx45, and ZO-1, polyclonal beta -actin (Sigma), and monoclonal GAPDH (Research Diagnostics, Flanders, NJ), followed by secondary antibody incubation with horseradish peroxidase (HP)-conjugated anti-rabbit and anti-mouse IgGs (Santa Cruz Biotech, Santa Cruz, CA). The protein bands were detected using the Amersham ECL detection kit (Amersham Biosciences, Piscataway, NJ) and were exposed on Fuji X-ray film. The intensity of the bands was analyzed using Scion NIH Image software (Scion, Frederick, MD). Measured intensities for all experiments were first normalized with respect to internal controls (GAPDH for cytosolic proteins and beta -actin for membrane-bound proteins) and then with respect to controls.

Northern blot analysis. Total RNA from the samples was extracted using TRIzol reagent (GIBCO-BRL) and was quantified as previously described (52). Total RNA (10 µg) from the samples was separated on 1.2% formaldehyde-agarose gel and was transferred onto a Gene Screen hybridization transfer membrane (NEN Life Science Products, Boston, MA). Membranes were hybridized with appropriate denatured random-primed probes. The rat cDNA probes used were full-length Cx43 and Cx45 (obtained from Dr. Eric Beyer, Univ. of Chicago Medical School) and 18S labeled with [32P]dCTP using the Megaprime labeling system (Amersham Biosciences). The membranes were then exposed to the phosphor screen overnight, scanned on a Storm PhosphorImager system, and quantified using ImageQuant software (Molecular Dynamics, Sunnyvale, CA). All acquired data were first normalized with respect to 18S RNA band intensity, and then all experimental data were normalized with respect to control data.

RT-PCR and semiquantitative RT-PCR analyses. RT-PCR was performed as previously described (52). For semiquantitative PCR, a 9:1 ratio of competimers and 18S primers (Ambion, Austin, TX) was added to the PCR mixture. Conditions applied for PCR using a PTC-100 programmable thermal controller (MJ Research, Watertown, MA) were 94°C for 30 s, 55°C for 30 s, 72°C for 30 s for 30 cycles, and 72°C for 8 min. Reaction products were analyzed by electrophoresis on 2% agarose gels and were quantified using Kodak 1D Scientific Imaging Systems. The following primers were used for each cDNA amplification: mCx43, TACCACGCCACCACTGGC (sense), AATCTCCAGGTCATC AGG (antisense); mCx45, AAAGAGGAGAGCCAACCAAA (sense), GTCCCAAACCCTAAGTG AAGC (antisense) (11); mZO-1, CATAGAATAGACTCCCCTGG (sense), GCTTGAGACCTCAT ACCTGT (antisense) (21); and mosteocalcin, gacaaagccttcatgtccaagc (sense), TTTGAG ACCGTCGAGCCGAAA (antisense) (23).

Scrape loading. Quantitative scrape loading as described by Pina-Benabou et al. (40) was used to analyze gap junctional communication after cells were exposed to shear stress. Incisions on the cell monolayers of control and shear stress-exposed samples were made with a fine razor blade in two or three different regions on the slides. The slides were incubated with 0.5% Lucifer yellow (Sigma) at 37°C, rinsed with 1× PBS, and fixed with 2% formaldehyde. The intensity of the dye spread from the damaged cells to the neighboring cells was observed using a Nikon Eclipse TE300 microscope and was photographed with a SPOT-RT digital camera. Extent of dye spread was quantified as linear distance perpendicular to the scrape using Scion NIH Image software.

Statistical analysis. Data were analyzed using one-way ANOVA (SigmaStat, Chicago, IL). Northern blot analyses are presented as means ± SE of six experiments. Western blot, quantitative RT-PCR, and scrape-loading analyses are presented as means ± SE of three experiments. A significant difference compared with controls is indicated as * P < 0.05.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Osteoblast and osteocyte cell lines express gap junction proteins associated with osteogenesis and tight junction-associated protein ZO-1. We used the osteoblastic cell line MC3T3-E1 (57) and the osteocytic cell line MLO-Y4 (23) to compare expression, distribution, and function of gap junctions associated with osteogenesis (34). As shown in Fig. 1A in which the cell cytoskeleton was stained with phalloidin, these cell lines show quite different morphologies. Whereas the osteoblast cells exhibit flattened, epitheliod shapes and a close packing arrangement, the osteocyte cells exhibit a more stellate shape with rounded somata and multiple processes extending for variable distances to neighboring cells. Because phenotypic expression of differentiated cell markers may vary in cell lines maintained under different conditions and after prolonged passage, we determined expression levels of alkaline phosphatase and osteocalcin in the MC3T3-E1 and MLO-Y4 cell lines under conditions used in our studies. Alkaline phosphatase activity was higher in the osteoblasts than in the osteocytes (Fig. 1B), whereas the osteocytic cell line but not the osteoblastic cell line expressed measurable osteocalcin mRNA (Fig. 1C). RT-PCR results showed that under normal conditions, both types of immortalized cell lines expressed mRNAs that encode Cx43, Cx45, and ZO-1 (Fig. 1C). These data indicate that mRNAs corresponding to the osteogenic gap junction proteins and the tight junction protein ZO-1 are expressed in both cell lines.


View larger version (62K):
[in this window]
[in a new window]
 
Fig. 1.   Morphologies, osteoblastic and osteocytic phenotypes, and expression of junctional mRNAs in MC3T3-E1 and MLO-Y4 cell lines. Phalloidin staining for F-actin (A) indicated that the cell types possessed quite different morphologies. Osteoblastic (MC3T3-E1) cell line expressed more alkaline phosphatase (B), whereas osteocytic (MLO-Y4) cell line expressed more osteocalcin (C) as described previously (23). RT-PCR results (C) showed that under normal conditions, both of these cell lines expressed mRNAs corresponding to osteogenic gap junction proteins connexin (Cx)43 and Cx45 and the tight junction-associated protein zona occludens (ZO)-1.

Fluid shear stress does not affect cell viability but disrupts cell-to-cell communication and rearranges gap junction proteins Cx43 and Cx45 and associated ZO-1 protein in cultured bone cells. The overall experimental design critically depends on maintenance of cell viability during periods of shear stress exposure. To determine the extent to which cells were injured by the procedure, we performed the Live/Dead assay on both cell types with no shear stress and with 5 and 20 dyn/cm2 of shear stress for 3 h. Both MC3T3-E1 and MLO-Y4 cells were viable after 3 h of exposure to fluid shear stress. As shown, applying this assay to osteoblastic (Fig. 2A) and osteocytic (Fig. 2B) cells revealed that the percentages of live cells in normal and shear stress-exposed cells were all >80%. ANOVA analysis revealed that the percentage of dead cells was lower than live cells for controls and for each treatment, but the percentage of dead cells did not significantly differ among the groups.


View larger version (69K):
[in this window]
[in a new window]
 
Fig. 2.   Assessment of health and viability of MC3T3-E1 and MLO-Y4 cells. Cells were subjected to low (5 dyn/cm2) and high (20 dyn/cm2) shear stress (tau ) for 3 h; control cells were maintained for the same time periods under no-flow conditions. To assess cell health and viability, cells were incubated with 4 µM of eithidium homodimer-1 (EthD-1) and 2 µM of calcein-acetoxymethyl ester. Live cells, which retain calcein, gave rise to green fluorescence, and dead cells, which retain EthD-1 through damaged membranes, produced red fluorescence. Cell viability as well as morphological changes in MC3T3-E1 (A) and MLO-Y4 (B) cells were observed after exposure to fluid shear stress. Live and dead cells were counted from 10 cell fields for all the samples, and percentages of live and dead cells were calculated. All data are presented as means ± SE, n = 10; *P < 0.05.

Immunofluorescence microscopy was used to analyze the effect of fluid shear stress on the distribution and arrangement of Cx43, Cx45, and ZO-1 at cell borders as well as in perinuclear areas in cultured osteoblast and osteocyte cell lines. Under control (no-flow) conditions, MC3T3-E1 cells possessed extensive contact with neighboring cells. Immunostaining of control MC3T3-E1 cells revealed abundant punctate and linear appositional staining of Cx43 and ZO-1 at cell borders as well as Cx43 immunoreactivity in perinuclear regions; both Cx43 and ZO-1 also showed diffuse cytoplasmic staining throughout the osteoblastic cells (Fig. 3A). Overlays of images acquired from cells double-labeled for Cx43 and ZO-1 (Fig. 4A) indicated that overlap was virtually complete at membrane appositions, although more Cx43 was detected intracellularly. Wispy Cx45 immunostaining was also present at appositional regions, although it was mainly concentrated at perinuclear regions within the cells (see Fig. 3A).


View larger version (84K):
[in this window]
[in a new window]
 
Fig. 3.   Fluid shear stress disrupts cell-to-cell communication and rearranges gap junction proteins Cx43 and Cx45 and the tight junction-associated protein ZO-1 in MC3T3-E1 and MLO-Y4 cells. Cells were subjected to low (5 dyn/cm2) and high (20 dyn/cm2) shear stress for 1 or 3 h; control cells were maintained for the same time periods under no-flow conditions. Effects of fluid shear stress on the distribution and arrangement of Cx43, Cx45, and ZO-1 in MC3T3-E1 and MLO-Y4 cells were analyzed using immunofluorescence microscopy. Formaldehyde-fixed, Triton X-100-permeabilized samples of control (A, D), tau  = 5 dyn/cm2 exposed for 3 h (B, E), or tau  = 20 dyn/cm2 exposed for 3 h (C, F) cells were stained with primary polyclonal or monoclonal antibodies against Cx43, ZO-1, and Cx45 followed by fluorescein-conjugated goat anti-rabbit or anti-mouse IgGs. Control MC3T3-E1 cells (A) possessed abundant punctate and linear appositional staining of Cx43 and ZO-1 at cell borders as well as Cx43 immunoreactivity in perinuclear regions. Cx45 was present at appositional regions but was mainly concentrated at perinuclear regions of the cells. Exposure to low shear stress (tau  = 5 dyn/cm2; B) caused cells to become elongated and moderately decreased Cx43 and ZO-1 at the appositional membranes, whereas perinuclear distribution of Cx43 notably increased. Low shear stress (C) led to reduced appositional and increased cytoplasmic staining of Cx45; at tau  = 20 dyn/cm2, significant disruptions of both Cx43 and ZO-1 at the opposing cell membranes were observed as exposure time increased from 1 to 3 h. Cx45 distribution in perinuclear regions was more prominent at tau  = 20 dyn/cm2. In control MLO-Y4 cells (D), Cx43 and ZO-1 were concentrated at the tips of the cell processes at regions of contact with neighboring cells with perinuclear distribution of Cx43. There was very faint staining for Cx45 at the tips of opposing cell processes of the control cells. Dramatic morphological changes were observed at both low and high levels of shear stress. When cells were exposed to low shear stress (tau  = 5 dyn/cm2; E), Cx43 and ZO-1 at the tips of the opposing cell processes were moderately decreased, whereas perinuclear distribution of Cx43 increased; perinuclear distribution of Cx45 moderately increased when exposed to low shear stress (tau  = 5 dyn/cm2). At tau  = 20 dyn/cm2 (F), significant disruption of both Cx43 and ZO-1 at the opposing cell membranes was observed for all exposure durations with the slight increase in cytoplasmic and perinuclear staining of Cx43; high shear stress significantly increased perinuclear distribution of Cx45 as exposure time increased from 1 to 3 h. Flow direction is indicated (arrows); bar, 50 µm.



View larger version (74K):
[in this window]
[in a new window]
 
Fig. 4.   Fluid shear stress dramatically reduced the colocalization of Cx43 and ZO-1 in MC3T3-E1 and MLO-Y4 cells. Cells were subjected to low (tau  = 5 dyn/cm2) and high (tau  = 20 dyn/cm2) shear stress levels for 1 or 3 h, and control cells were kept in static conditions. Effects of fluid shear stress on the colocalization of Cx43 and ZO-1 in MC3T3-E1 (A) and MLO-Y4 (B) cells were analyzed using immunofluorescence microscopy. Formaldehyde-fixed, Triton X-100-permeabilized samples were double-labeled with primary polyclonal and monoclonal antibodies against Cx43 and ZO-1 followed by fluorescein-conjugated goat anti-rabbit and anti-mouse IgGs. Flow direction (arrows) and colocalization of Cx43 and ZO-1 (arrowheads) are indicated; bar, 20 µm.

Exposure of MC3T3-E1 osteoblast cells to both levels of shear stress resulted in changes in cell morphology (see Fig. 3, B and C) and in redistribution of connexins and ZO-1 within the cells. Even as early as 1 h after exposure to 5 dyn/cm2 of sheer stress, cells began to elongate with respect to flow direction and lost the majority of direct cell-body contact with neighboring cells; such anisotropy was even more apparent after longer duration exposures to higher shear stress. Shear stress rapidly affected Cx43 distribution in osteoblastic cells when MC3T3-E1 cells were exposed to a tau -value of 5 dyn/cm2. The distribution of Cx43 was moderately disrupted at cell membranes with increased perinuclear and cytoplasmic staining being detectable as early as within 1 h of exposure time (data not shown). Increased perinuclear and cytoplasmic staining for Cx43 with concomitant additional reduction in appositional staining was even more apparent at 3 h of exposure at 5 dyn/cm2 of sheer stress (see Fig. 3B). Although ZO-1 distribution was also altered by flow, it was altered differently than Cx43. At 1 h of low shear stress, ZO-1 distribution was largely appositional (data not shown), which was similar to the controls, whereas disruption was observed only at 3 h (see Fig. 3B). In contrast to Cx43, diffuse cytoplasmic ZO-1 staining was only occasionally detectable. Exposure to 20 dyn/cm2 of shear stress for both 1 and 3 h produced more pronounced disruption of both Cx43 and ZO-1 at the cell membrane and a moderate increase of Cx43 perinuclear and cytoplasmic staining (see Fig. 3C). Overlay images of Cx43 and ZO-1 from shear stress-exposed samples clearly show a dramatic reduction in overlap of these proteins at the contact cell borders (Fig. 4A). With regard to Cx45, low shear stress (especially at 3 h) led to reduced appositional and increased cytoplasmic staining; this change in Cx45 distribution was more prominent at 20 dyn/cm2 of shear stress (see Fig. 3C).

Control MLO-Y4 osteocyte cells possessed rounded cell bodies with numerous cell processes and were connected to neighboring cells via these processes. Immunostaining of these control cells revealed that Cx43 and ZO-1 were concentrated at the tips of the cell processes at regions of contact with neighboring cells, with Cx43 also showing perinuclear distribution (see Fig. 3D). Similar to MC3T3-E1 cells, colocalization of Cx43 and ZO-1 in control MLO-Y4 cells indicated that overlap was found at the tips of opposing cell processes (Fig. 4B). For Cx45, there was very faint staining at the tips of some opposing processes of the control cells (see Fig. 3D). Dramatic morphological changes were observed at both low and high levels of shear stress. The cell processes became smaller in diameter and somewhat more numerous, whereas the cell bodies became smaller and more rounded. When MLO-Y4 cells were subjected to 5 dyn/cm2 of shear stress for 1 or 3 h, Cx43 and ZO-1 at the tips of opposing cell processes were moderately decreased, whereas perinuclear distribution of Cx43 notably increased (see Fig. 3E). At 20 dyn/cm2 of shear stress, significant disruption of both Cx43 and ZO-1 at the opposing membrane tips was observed for both exposure durations (see Fig. 3F, which illustrates results for 3 h) with a slight increase in cytoplasmic and perinuclear staining of Cx43. Colocalization of Cx43 and ZO-1 was also reduced at the opposing tips of the cell processes after exposure to tau -values of both 5 and 20 dyn/cm2 (Fig. 4B). Immunofluorescence for Cx45 indicated that perinuclear distribution became more prominent as shear stress increased (see Fig. 3, E and F). These results suggest that both levels of fluid shear stress reorganize the distribution of junctional proteins as early as within 1 h of exposure time, which would be expected to produce an effect on junctional communication.

Intercellular coupling in cultured bone cells is significantly decreased by fluid shear stress. Previous studies (4, 57) have shown that MC3T3-E1 and MLO-Y4 cells are coupled by functional gap junction channels. In this study, we used the scrape-loading technique to quantitatively examine the effects of fluid shear stress on cell-to-cell coupling. Our scrape-loading data indicated that intercellular coupling significantly decreased in MC3T3-E1 cells; this change was more pronounced with higher shear stress and longer duration. As shown in Fig. 5A, the extent of dye spread in control MC3T3-E1 cells was 270.4 ± 10.7 µm. This dye-transfer distance was reduced to 237.4 ± 4.7 or 120.8 ± 5.0 µm when cells were exposed to the lower tau -value of 5 dyn/cm2 for 1 or 3 h, respectively. At the high tau -value of 20 dyn/cm2, the degree of dye transfer was dramatically reduced to 168.4 ± 4.7 µm for the shorter duration and 106 ± 6.3 µm for the longer duration (Fig. 5, bar graphs).


View larger version (78K):
[in this window]
[in a new window]
 
Fig. 5.   Intercellular coupling in MC3T3-E1 and MLO-Y4 cells is significantly decreased by fluid shear stress. Cell-to-cell coupling in MC3T3-E1 (A) and MLO-Y4 (B) cells after the exposure of fluid shear stress was quantitatively examined using the scrape-loading technique. Incisions on the cell monolayers of control and shear-exposed samples incubated with 0.5% Lucifer yellow were made with a razor blade. Dye-spread distance from the damaged cells to neighboring cells was quantified using Scion NIH Image software. Data are presented as means ± SE, n = 4; *P < 0.05. Bar, 100 µm.

MLO-Y4 cells showed more uniform changes in dye coupling when exposed to shear stress. As shown in Fig. 5B, the average dye-transfer distance for control MLO-Y4 cells was 109.5 ± 4.3 µm. When cells were exposed to 5 dyn/cm2 of shear stress for 1 or 3 h, this dye-transfer distance was significantly decreased to 72 ± 4.9 or 62.1 ± 3.7 µm (Fig. 5, bar graphs). Similar decreases were observed with the samples that were exposed to a high tau -value of 20 dyn/cm2 for 1 or 3 h. These data imply that both levels of fluid shear stress inhibited intercellular coupling, which in turn supports the conclusion that both levels also disrupt cell-to-cell junctional communication and redistribute the junctional proteins depending on the duration and level of shear stress.

Fluid shear stress downregulates ZO-1 and phosphorylated Cx43 in cultured bone cells. We performed Western blot analyses for crude membrane and cytosolic proteins to determine the extent to which fluid shear stress regulates levels of Cx43, Cx45, and ZO-1 within each cell type. For Cx43, multiple bands were detected in Western blots corresponding to different extents and/or types of phosphorylation (35, 36), where NP is the dephosphorylated form and P1 and P2 designate phosphorylated Cx43 species. For both cell lines at all shear stress levels, there was a similar pattern in which the P2 form of Cx43 from the membrane was significantly decreased in the membrane fraction, whereas all three forms of Cx43 were dramatically increased in the cytosolic fraction. For osteoblastic MC3T3-E1 cells, densitometric analysis of membrane-bound Cx43 bands showed significant downregulation of the P2 form of Cx43 at 3 h for both 5 and 20 dyn/cm2 of shear stress. By contrast, NP, P1, and P2 forms of cytosolic Cx43 increased after exposure to both levels of shear stress (Fig. 6A). Similarly, densitometric analysis of membrane-bound Cx43 for MLO-Y4 cells revealed downregulation of the P2 form at both 5 and 20 dyn/cm2 of shear stress, whereas cytosolic Cx43 noticeably increased in response to both levels of shear stress, especially to 5 dyn/cm2 (Fig. 6B). In both MC3T3-E1 and MLO-Y4 cells, Cx45 was detectable only in the cytosolic fraction, and low levels of shear stress seemed to downregulate Cx45, whereas high levels of shear stress appeared to upregulate Cx45 at both exposure times (Fig. 7A). Western blots using ZO-1-specific antibodies revealed that for both shear stress levels, this membrane-bound protein was downregulated at longer exposure times in both MC3T3-E1 and MLO-Y4 cells (Fig. 7B). These data indicate that fluid shear stress regulates the level of Cx45 and ZO-1 expression and abundance of all three forms of Cx43. Notably, the P2 form of the membrane-bound Cx43 decreased as the duration of the shear stress increased. Such a correlation of decreased P2 with decreased dye coupling is consistent with previous reports on other cell types (see DISCUSSION).


View larger version (55K):
[in this window]
[in a new window]
 
Fig. 6.   Fluid shear stress downregulates phosphorylation of membrane-bound Cx43 and upregulates all three forms of cytosolic Cx43 in MC3T3-E1 (A) and MLO-Y4 (B) cells. Western blot analyses for both membrane-bound and cytosolic proteins were performed to determine the extent to which fluid shear stress regulates levels of Cx43 and Cx45. Cells were lysed, and membrane-bound and cytosolic proteins were prepared from control (lanes 1 and 4), 1-h exposure of tau  = 5 dyn/cm2 (lane 2), 3-h exposure of tau  = 5 dyn/cm2 (lane 3), 1-h exposure of tau  = 20 dyn/cm2 (lane 5), or 3-h exposure of tau  = 20 dyn/cm2 (lane 6) cells. Western blot analyses were performed using antibodies against Cx43, beta -actin, and GAPDH for membrane and cytosolic portions of MC3T3-E1 and MLO-Y4 cells. Densitometric analysis of Cx43 bands (NP, nonphosphorylated band; P1 and P2, phosphorylated bands 1 and 2, respectively) from three independent experiments were performed using Scion NIH Image software. All acquired data were first normalized with respect to internal controls (beta -actin for membrane-bound and GAPDH for cytosolic proteins) and then normalized with respect to control data. All data are presented as means ± SE, n = 3; *P < 0.05.



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 7.   High-magnitude shear stress upregulates cytosolic Cx45 whereas both levels of shear stress downregulate membrane-bound ZO-1 in cultured bone cells. Effects of fluid shear stress on the protein levels of Cx45 and ZO-1 were determined using Western blot analysis. Cells were lysed, and membrane-bound and cytosolic proteins were prepared from controls (lanes 1 and 4), 1-h exposure of tau  = 5 dyn/cm2 (lane 2), 3-h exposure of tau  = 5 dyn/cm2 (lane 3), 1-h exposure of tau  = 20 dyn/cm2 (lane 5), or 3-h exposure of tau  = 20 dyn/cm2 (lane 6) cells. Western blot analysis was performed using antibodies against Cx45, GAPDH (A), ZO-1, and beta -actin (B) for MC3T3-E1 and MLO-Y4 cells. Densitometric analyses of cytosolic Cx45 and membrane-bound ZO-1 proteins from three independent experiments were performed using Scion NIH Image software. All acquired data were first normalized with respect to internal controls (beta -actin for membrane-bound and GAPDH for cytosolic proteins) and then normalized with respect to control data. All data are presented as means ± SE, n = 3; *P < 0.05.

Selective regulation of Cx43, Cx45, and ZO-1 expression in response to different shear stress levels. Previous studies on endothelial cells have shown that fluid flow and mechanical stretch alter the expression of Cx43 (6, 10). Therefore, in this study, we analyzed the consequence of fluid shear stress on the expression of Cx43, Cx45, and ZO-1 mRNAs in osteoblastic and osteocytic cell lines using Northern blot analysis and semiquantitative RT-PCR. In both cell lines, different levels of shear stress seemed to regulate expression of Cx43 and Cx45 in a reciprocal or compensatory manner. As shown in Fig. 8A, Cx43 mRNA levels increased 1.5-2-fold for MC3T3-E1 cells and 1.25- to 1.5-fold for MLO-Y4 cells at 5 dyn/cm2 of shear stress for 1, 2, or 3 h, yet no apparent changes were found from the controls at 20 dyn/cm2 of shear stress for any of the durations for either cell types. By contrast, Cx45 mRNA remained the same as the controls at the lower shear stress level for all durations and increased to 1.25- to 1.75-fold at 20 dyn/cm2 of shear stress for 1, 2, or 3 h (Fig. 8B). With regard to ZO-1 mRNA, there were no detectable changes with respect to control in MC3T3-E1 cells at the lower shear stress level, whereas the mRNA level was decreased to half that of controls at the higher shear stress level (Fig. 9A). However, more dramatic effects on ZO-1 expression were seen in MLO-Y4 cells, where ZO-1 mRNA was profoundly decreased at both 5 and 20 dyn/cm2 of shear stress for 1-, 2-, or 3-h exposure times (Fig. 9B). These data suggest that for both cell lines, lower shear stress (5 dyn/cm2) upregulates the expression of Cx43, whereas higher shear stress (20 dyn/cm2) upregulates the expression of Cx45. By contrast, ZO-1 is downregulated at high shear stress levels in the osteoblastic cell line and even more strikingly at both shear stresses in the osteocytic cell line.


View larger version (72K):
[in this window]
[in a new window]
 
Fig. 8.   Low-magnitude shear stress upregulates Cx43, whereas high-magnitude shear stress upregulates Cx45 in both MC3T3-E1 and MLO-Y4 cells. Northern blot analyses of Cx43 (A) and Cx45 (B) expression in MC3T3-E1 and MLO-Y4 cells. Total RNA was prepared from control (lanes 1 and 5), 1-h exposure of tau  = 5 dyn/cm2 (lane 2), 2-h exposure of tau  = 5 dyn/cm2 (lane 3), 3-h exposure of tau  = 5 dyn/cm2 (lane 4), 1-h exposure of tau  = 20 dyn/cm2 (lane 6), 2-h exposure of tau  = 20 dyn/cm2 (lane 7), or 3-h exposure of tau  = 20 dyn/cm2 (lane 8) cells. RNA (10 µg) was loaded in each lane and probed by hybridization at high stringency with 32P-labeled rat Cx43 cDNA (as described in MATERIALS AND METHODS). Densitometric analyses of Cx43 mRNA bands from six independent experiments were performed using ImageQuant software. All acquired data were first normalized with respect to corresponding 18S intensity, and then all experimental data were normalized with respect to control data. All data are presented as means ± SE, n = 6; *P < 0.05.



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 9.   Fluid shear stress downregulates ZO-1 mRNA in both MC3T3-E1 and MLO-Y4 cells. Semiquantitative RT-PCR analyses of ZO-1 in MC3T3-E1 (A) and MLO-Y4 (B) cells. Total RNA was prepared from controls (lane 1), 1-h exposure of tau  = 5 dyn/cm2 (lane 2), 2-h exposure of tau  = 5 dyn/cm2 (lane 3), 3-h exposure of tau  = 5 dyn/cm2 (lane 4), 1-h exposure of tau  = 20 dyn/cm2 (lane 5), 2-h exposure of tau  = 20 dyn/cm2 (lane 6), or 3-h exposure of tau  = 20 dyn/cm2 (lane 7) cells. RT-PCR was performed using the Thermoscript RT-PCR system. Densitometric analyses of ZO-1 mRNA bands from three independent experiments were performed using 1D Kodak Scientific Imaging systems. All acquired data were first normalized with corresponding 18S intensity, and then all experimental data were normalized with respect to control data. All data are presented as means ± SE, n = 3; *P < 0.05.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

In this study, we found that steady fluid shear stress modifies expression, function, and distribution of connexins (Cx43 and Cx45) and an associated tight junction protein (ZO-1) in cultured bone cells. Our results strongly suggest that fluid shear stress disrupts cell-to-cell communication and rearranges the gap junction proteins Cx43 and Cx45 and an associated protein ZO-1 in both MC3T3-E1 and MLO-Y4 cells. This disrupted gap junctional communication and rearrangement of Cx43, Cx45, and ZO-1 depended on the magnitude of the shear stress as well as the exposure duration. Our results as well as others (4, 14, 23, 57, 58) indicate that the major gap junction protein that mediates cell-to-cell communication in both cell types is Cx43. Our finding that the selective reduction in the P2 form of membrane-bound Cx43 correlates with the loss of dye coupling is consistent with previous reports, which indicate that Cx43 phosphorylation is important for its function (35, 36). Elevated levels of all three forms (NP, P1, and P2) of cytosolic Cx43 after exposure to fluid shear stress suggest that newly synthesized as well as internalized Cx43 contributed to the increases in cytosolic Cx43 level. We believe that this significant increase in cytosolic Cx43 level was mainly due to the internalization of membrane-bound Cx43, because newly synthesized Cx43 should mostly be in NP form. Furthermore, based on the cytosolic Cx43 analysis, low shear stress seemed to be regulating Cx43 in both cell types, whereas high shear stress appeared to be upregulating cytosolic Cx45. At the level of mRNA, Cx43, Cx45, and ZO-1 all showed interesting changes with fluid-induced shear stress. Expression of Cx43 and Cx45 mRNA was selectively upregulated in response to different shear stress levels, whereas both magnitudes of shear stress inhibited ZO-1 expression. Together, these results show for the first time that in cultured bone cells, fluid shear stress disrupts cell-to-cell junctional communication, rearranges junctional proteins, and determines de novo synthesis of specific connexins in a manner that depends on the magnitude of the shear stress.

There is increasing evidence that fluid shear stress regulates Cx43 in vascular smooth muscle (6), vascular endothelial (10), and cultured bone cells (4). Our observation of the disruption and translocation or internalization of Cx43 from the membrane after exposure to laminar flow in both MC3T3-E1 and MLO-Y4 cells is in agreement with the findings of DePaola and coworkers (10) for endothelial cells in the laminar flow region at 5 h of exposure time. We speculate that fluid shear stress of short duration (1 or 3 h) reduces intercellular communication as a consequence of morphological changes (4, 39), loss and/or internalization of membrane-bound Cx43 (10, 27, 35, 36), and possibly also inhibited trafficking of newly synthesized Cx43 to the membrane. Our finding that plasmalemmal ZO-1 immunostaining decreased in a somewhat similar manner to Cx43 indicates that ZO-1 and Cx43 might interact in MC3T3-E1 and MLO-Y4 cells as has been reported for other cell types (16, 19, 28, 50). Because interaction with ZO-1 has been suggested to stabilize Cx43 at the cell surface (49), the downregulation of ZO-1 by shear stress might lead to redistribution of Cx43 to intracellular compartments.

Functional studies on junctional communication have indicated that during shear stress exposure, dye coupling is reduced as gap junction protein expression decreases on the appositional membranes. Our observation of impaired dye coupling during the early period of laminar shear stress in cultured bone cells was similar to that reported for endothelial cells (10). Hence, these results verify our conclusion that fluid shear stress disrupts cell-to-cell communication. Biochemical evidence for the redistribution of Cx43 due to fluid shear stress is provided by the observed decrease in Cx43 P2 from the membrane, which is believed to be the predominant form of this gap junction protein that forms functional gap junction channels (35, 36) and an increase in all three forms of Cx43 in the cytosol.

Our findings on the distribution of Cx43, intercellular coupling, and the phosphorylation level of Cx43 after the steady shear stress exposure in MLO-Y4 cells differ from a recent report (4), which states that migration of Cx43 from the perinuclear region toward the dendritic processes and intercellular coupling increased after MLO-Y4 cells were subjected to fluid flow. Although differences might have arisen from usage of different antibodies, the analytical methods applied, or the composition of culture media, the previous study noted a lack of correlation between Cx43 distribution and the enhanced intercellular coupling, which suggests that another connexin might upregulate cell-to-cell communication after shear stress exposure. We analyzed both Cx43 and Cx45 in our experiments, and our data suggest that although Cx43 is the major gap junction protein that regulates junctional communication in MC3T3-E1 and MLO-Y4 cells, Cx45 can be upregulated under high shear stress conditions. The previous study also analyzed various osteoblastic cells (2T3, ROS17/2.8, MC3T3-E1), reported no effect of fluid flow on cell-to-cell communication, and concluded that osteoblasts are less responsive than osteocytes to such stimuli (see also Ref. 25). However, numerous previous studies on osteoblastic cells have clearly demonstrated that stress enhances the production of second messengers such as cAMP, NO, Ca2+, and prostaglandin (18, 20, 24, 41, 45) and alters cell morphology including the reorganization of the actin cytoskeleton (39). Our data indicate that osteoblastic MC3T3-E1 cells do respond to fluid shear stress.

We have observed differential mRNA expression of Cx43, Cx45, and ZO-1 in response to different shear stress levels. Low shear stress upregulated Cx43 expression in both cell types, whereas high shear stress upregulated Cx45 expression in both cell types. Previous studies have shown that when Cx43 function is inhibited in avian osteogenic tissue, Cx45 is upregulated to fulfill at least some aspect of the missing functions (33). Such selective upregulation of Cx43 and Cx45 by different levels of shear stress provides evidence that patterns of gene expression are transduced by the mechanical stimulus that would be expected to qualitatively alter the junctional phenotype and may correspond to either differentiation or dedifferentiation of bone cells (13, 31, 33, 34, 42, 44).

Although the mechanochemical transduction cascade leading from shear stress to altered gene expression patterns remains to be fully elucidated, fluid shear stress has been shown to enhance second-messenger production in cultured bone cells. In bone cells, cAMP is regulated by prostaglandin, and both are increased under fluid-flow conditions (41); cAMP has been shown to upregulate both the mRNA and protein of Cx43 and Cx45 in cultured cardiac myocytes (8). Therefore, a possible mechanism by which cultured bone cells might respond to fluid flow would involve disruption of cell-to-cell communication and enhanced production of prostaglandins. This would elevate cAMP, which in turn would upregulate expression and phosphorylation of either Cx43 or Cx45 depending on the magnitude of the shear stress and the duration of the exposure period. Subsequently, cellular differentiation would be initiated, and disconnected cells or the remaining network would begin focal bone remodeling.

The decrease in ZO-1 mRNA and protein expression with increased levels of shear stress that we have observed may also play an important role in bone remodeling. Truncation mutants of the tight junction protein ZO-1 have been shown to disrupt epithelial cell morphology, which suggests that ZO-1 may be involved in the regulation of cellular differentiation (43). Moreover, downregulation of ZO-1 and occludin appear to be related to phenotypic changes associated with epithelial cell transformation (32). Therefore, it seems likely that ZO-1 may also be involved in mediating cell differentiation in cultured bone cells.

The results described here were obtained under in vitro conditions in tissue culture. In vivo, there is increasing evidence that osteocyte cell processes are surrounded by the pericellular matrix with transverse tethering filaments (55), whereas in culture, there is no encircling support structure. In addition, the recent theoretical model by You et al. (60) brings to our attention that in vivo, the fluid shear stresses on the cell body are much smaller than those on the membrane in cell processes, so that the fluid drag force on the transverse filaments in the pericellular matrix is much greater than the fluid shear force on the cell-process membrane. Therefore, it is possible that under in vitro conditions the actin cytoskeleton in the cell body responds to the fluid shear stress rather than the more rigid actin bundle in the cell process. However, You et al. (60) predicted that the fluid drag on the tethering filaments can produce a 20- to 100-fold amplification in the strain on the actin filament bundle in the cell process. This amplification is sufficient to elicit intracellular signaling responses in all cell cultures with deformed substrates.

In summary, we have shown that fluid-induced shear stress is an important biophysical signal in bone mechanotransduction. Our observations suggest that in both osteoblastic and osteocytic cell lines, fluid shear stress of the magnitude expected to occur in bone tissue disrupts junctional communication, rearranges junctional proteins, and determines de novo synthesis of specific connexins to an extent that depends on the magnitude of the shear stress. Such disconnection from the bone cell network due to the fluid shear stress may provide part of the signal whereby the disconnected cells or the remaining network initiates focal bone remodeling.


    ACKNOWLEDGEMENTS

We thank Marcia Urban for technical assistance, Dr. Wei Li for advice on separating membrane and cytosolic Cx43, Dr. Karen Cusato for advice on use of the Live/Dead cell assay, Dr. Elliot L. Hertzberg (Albert Einstein College of Medicine) and Dr. Thomas H. Steinberg (Washington University School of Medicine) for generous supply of Cx43 and Cx45 antibodies, and Dr. Kenneth J. McLeod (State University of New York, Stony Brook) and Dr. Lynda F. Bonewald (University of Texas Health Science Center) for graciously providing the MC3T3-E1 and MLO-Y4 cell lines.


    FOOTNOTES

This work was supported primarily by National Institutes of Health (NIH) Grant HL-19454 (principal investigator, S. Weinbaum) and a Gillecce Fellowship (City University of New York Graduate School) with additional support provided by NIH Grants DK-41918 and NS-34931 (principal investigator, D. C. Spray).

Address for reprint requests and other correspondence: D. C. Spray, Albert Einstein College of Medicine, Dept. of Neuroscience, 1300 Morris Park Ave., Bronx, NY 10461 (E-mail: spray{at}aecom.yu.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

First published October 3, 2002;10.1152/ajpcell.00052.2002

Received 1 February 2002; accepted in final form 30 September 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Ai, Z, Fischer A, Spray DC, Brown AM, and Fishman GI. Wnt-1 regulation of connexin43 in cardiac myocytes. J Clin Invest 105: 161-171, 2000[Web of Science][Medline].

2.   Burstone, MS. Histochemical demonstration of phosphatases in frozen sections with naphthol AS-phosphates. J Histochem Cytochem 9: 146-153, 1961[Web of Science][Medline].

3.   Cheng, B, Kato Y, Zhao S, Luo J, Sprague E, Bonewald LF, and Jiang JX. PGE2 is essential for gap junction-mediated intercellular communication between osteocyte-like MLO-Y4 cells in response to mechanical strain. Endocrinology 142: 3464-3473, 2001[Abstract/Free Full Text].

4.   Cheng, B, Zhao S, Luo J, Sprague E, Bonewald LF, and Jiang JX. Expression of functional gap junctions and regulation by fluid flow in osteocyte-like MLO-Y4 cells. J Bone Miner Res 16: 249-259, 2001[Web of Science][Medline].

5.   Civitelli, R, Beyer EC, Warlow PM, Robertson AJ, Geist ST, and Steinberg TH. Connexin43 mediates direct intercellular communication in human osteoblastic cell networks. J Clin Invest 91: 1888-1896, 1993[Web of Science][Medline].

6.   Cowan, DB, Lye SJ, and Langille BL. Regulation of vascular connexin43 gene expression by mechanical loads. Circ Res 82: 786-793, 1998[Abstract/Free Full Text].

7.   Cowin, SC, Weinbaum S, and Zeng Y. A case for bone canaliculi as the anatomical site of strain generated potentials. J Biomech 28: 1281-1297, 1995[Web of Science][Medline].

8.   Darrow, BJ, Fast VG, Kleber AG, Beyer EC, and Saffitz JE. Functional and structural assessment of intercellular communication. Increased conduction velocity and enhanced connexin expression in dibutyryl cAMP-treated cultured cardiac myocytes. Circ Res 79: 174-183, 1996[Abstract/Free Full Text].

9.   Darrow, BJ, Laing JG, Lampe PD, Saffitz JE, and Beyer EC. Expression of multiple connexins in cultured neonatal rat ventricular myocytes. Circ Res 76: 381-387, 1995[Abstract/Free Full Text].

10.   DePaola, N, Davies PF, Pritchard WF, Jr, Florez L, Harbeck N, and Polacek DC. Spatial and temporal regulation of gap junction connexin43 in vascular endothelial cells exposed to controlled disturbed flows in vitro. Proc Natl Acad Sci USA 96: 3154-3159, 1999[Abstract/Free Full Text].

11.   Dermietzel, R, Gao Y, Scemes E, Vieira D, Urban M, Kremer M, Bennett MV, and Spray DC. Connexin43 null mice reveal that astrocytes express multiple connexins. Brain Res Rev 32: 45-56, 2000[Medline].

12.   Donahue, HJ. Gap junctions and biophysical regulation of bone cell differentiation. Bone 26: 417-422, 2000[Medline].

13.   Donahue, HJ, Li Z, Zhou Z, and Yellowley CE. Differentiation of human fetal osteoblastic cells and gap junctional intercellular communication. Am J Physiol Cell Physiol 278: C315-C322, 2000[Abstract/Free Full Text].

14.   Donahue, HJ, McLeod KJ, Rubin CT, Andersen J, Grine EA, Hertzberg EL, and Brink PR. Cell-to-cell communication in osteoblastic networks: cell line-dependent hormonal regulation of gap junction function. J Bone Miner Res 10: 881-889, 1995[Web of Science][Medline].

15.   Doty, SB. Morphological evidence of gap junctions between bone cells. Calcif Tissue Int 33: 509-512, 1981[Web of Science][Medline].

16.   Giepmans, BN, and Moolenaar WH. The gap junction protein connexin43 interacts with the second PDZ domain of the zona occludens-1 protein. Curr Biol 8: 931-934, 1998[Web of Science][Medline].

17.   Guan, X, Wilson S, Schlender KK, and Ruch RJ. Gap-junction disassembly and connexin 43 dephosphorylation induced by 18 beta -glycyrrhetinic acid. Mol Carcinog 16: 157-164, 1996[Web of Science][Medline].

18.   Hillsley, MV, and Frangos JA. Bone tissue engineering: the role of interstitial fluid flow. Biotechnol Bioeng 43: 573-581, 1994[Web of Science][Medline].

19.   Howarth, AG, Hughes MR, and Stevenson BR. Detection of the tight junction-associated protein ZO-1 in astrocytes and other nonepithelial cell types. Am J Physiol Cell Physiol 262: C461-C469, 1992[Abstract/Free Full Text].

20.   Hung, CT, Allen FD, Pollack SR, and Brighton CT. Intracellular Ca2+ stores and extracellular Ca2+ are required in the real-time Ca2+ response of bone cells experiencing fluid flow. J Biomech 29: 1411-1417, 1996[Web of Science][Medline].

21.   Itoh, M, Nagafuchi A, Yonemura S, Kitani-Yasuda T, Tsukita S, and Tsukita S. The 220-kD protein colocalizing with cadherins in non-epithelial cells is identical to ZO-1, a tight junction-associated protein in epithelial cells: cDNA cloning and immunoelectron microscopy. J Cell Biol 121: 491-502, 1993[Abstract/Free Full Text].

22.   Jeansonne, BG, Feagin FF, McMinn RW, Shoemaker RL, and Rehm WS. Cell-to-cell communication of osteoblasts. J Dent Res 58: 1415-1423, 1979[Abstract/Free Full Text].

23.   Kato, Y, Windle JJ, Koop BA, Mundy GR, and Bonewald LF. Establishment of an osteocyte-like cell line, MLO-Y4. J Bone Miner Res 12: 2014-2023, 1997[Web of Science][Medline].

24.   Klein-Nulend, J, Semeins CM, Ajubi NE, Nijweide PJ, and Burger EH. Pulsating fluid flow increases nitric oxide (NO) synthesis by osteocytes but not periosteal fibroblasts---correlation with prostaglandin upregulation. Biochem Biophys Res Commun 217: 640-648, 1995[Web of Science][Medline].

25.   Klein-Nulend, J, van der Plas PA, Semeins CM, Ajubi NE, Frangos JA, Nijweide PJ, and Burger EH. Sensitivity of osteocytes to biomechanical stress in vitro. FASEB J 9: 441-445, 1995[Abstract/Free Full Text].

26.   Kojima, T, Sawada N, Chiba H, Kokai Y, Yamamoto M, Urban M, Lee GH, Hertzberg EL, Mochizuki Y, and Spray DC. Induction of tight junctions in human connexin 32 (hCx32)-transfected mouse hepatocytes: connexin 32 interacts with occludin. Biochem Biophys Res Commun 266: 222-229, 1999[Web of Science][Medline].

27.   Krutovskikh, VA, Mesnil M, Mazzoleni G, and Yamasaki H. Inhibition of rat liver gap junction intercellular communication by tumor-promoting agents in vivo. Association with aberrant localization of connexin proteins. Lab Invest 72: 571-577, 1995[Web of Science][Medline].

28.   Laing, JG, Manley-Markowski RN, Koval M, Civitelli R, and Steinberg TH. Connexin45 interacts with zonula occludens-1 and connexin43 in osteoblastic cells. J Biol Chem 276: 23051-23055, 2001[Abstract/Free Full Text].

29.   Lecanda, F, Towler DA, Ziambaras K, Cheng SL, Koval M, Steinberg TH, and Civitelli R. Gap junctional communication modulates gene expression in osteoblastic cells. Mol Biol Cell 9: 2249-2258, 1998[Abstract/Free Full Text].

30.   Lecanda, F, Warlow PM, Sheikh S, Furlan F, Steinberg TH, and Civitelli R. Connexin43 deficiency causes delayed ossification, craniofacial abnormalities, and osteoblast dysfunction. J Cell Biol 151: 931-944, 2000[Abstract/Free Full Text].

31.   Li, Z, Zhou Z, Yellowley CE, and Donahue HJ. Inhibiting gap junctional intercellular communication alters expression of differentiation markers in osteoblastic cells. Bone 25: 661-666, 1999[Medline].

32.   Marzioni, D, Banita M, Felici A, Paradinas FJ, Newlands E, De Nictolis M, Muhlhauser J, and Castellucci M. Expression of ZO-1 and occludin in normal human placenta and in hydatidiform moles. Mol Hum Reprod 7: 279-285, 2001[Abstract/Free Full Text].

33.   Minkoff, R, Bales ES, Kerr CA, and Struss WE. Antisense oligonucleotide blockade of connexin expression during embryonic bone formation: evidence of functional compensation within a multigene family. Dev Genet 24: 43-56, 1999[Web of Science][Medline].

34.   Minkoff, R, Rundus VR, Parker SB, Hertzberg EL, Laing JG, and Beyer EC. Gap junction proteins exhibit early and specific expression during intramembranous bone formation in the developing chick mandible. Anat Embryol (Berl) 190: 231-241, 1994[Medline].

35.   Musil, LS, Cunningham BA, Edelman GM, and Goodenough DA. Differential phosphorylation of the gap junction protein connexin43 in junctional communication-competent and -deficient cell lines. J Cell Biol 111: 2077-2088, 1990[Abstract/Free Full Text].

36.   Musil, LS, and Goodenough DA. Biochemical analysis of connexin43 intracellular transport, phosphorylation, and assembly into gap junctional plaques. J Cell Biol 115: 1357-1374, 1991[Abstract/Free Full Text].

37.   Nusrat, A, Chen JA, Foley CS, Liang TW, Tom J, Cromwell M, Quan C, and Mrsny RJ. The coiled-coil domain of occludin can act to organize structural and functional elements of the epithelial tight junction. J Biol Chem 275: 29816-29822, 2000[Abstract/Free Full Text].

38.   Owan, I, Burr DB, Turner CH, Qiu J, Tu Y, Onyia JE, and Duncan RL. Mechanotransduction in bone: osteoblasts are more responsive to fluid forces than mechanical strain. Am J Physiol Cell Physiol 273: C810-C815, 1997[Abstract/Free Full Text].

39.   Pavalko, FM, Chen NX, Turner CH, Burr DB, Atkinson S, Hsieh YF, Qiu J, and Duncan RL. Fluid shear-induced mechanical signaling in MC3T3-E1 osteoblasts requires cytoskeleton-integrin interactions. Am J Physiol Cell Physiol 275: C1591-C1601, 1998[Abstract/Free Full Text].

40.   Pina-Benabou, MH, Srinivas M, Spray DC, and Scemes E. Calmodulin kinase pathway mediates the K+-induced increase in gap junctional communication between mouse spinal cord astrocytes. J Neurosci 21: 6635-6643, 2001[Abstract/Free Full Text].

41.   Reich, KM, Gay CV, and Frangos JA. Fluid shear stress as a mediator of osteoblast cyclic adenosine monophosphate production. J Cell Physiol 143: 100-104, 1990[Web of Science][Medline].

42.   Romanello, M, Moro L, Pirulli D, Crovella S, and D'Andrea P. Effects of cAMP on intercellular coupling and osteoblast differentiation. Biochem Biophys Res Commun 282: 1138-1144, 2001[Web of Science][Medline].

43.   Ryeom, SW, Paul D, and Goodenough DA. Truncation mutants of the tight junction protein ZO-1 disrupt corneal epithelial cell morphology. Mol Biol Cell 11: 1687-1696, 2000[Abstract/Free Full Text].

44.   Schiller, PC, Roos BA, and Howard GA. Parathyroid hormone up-regulation of connexin 43 gene expression in osteoblasts depends on cell phenotype. J Bone Miner Res 12: 2005-2013, 1997[Web of Science][Medline].

45.   Smalt, R, Mitchell FT, Howard RL, and Chambers TJ. Induction of NO and prostaglandin E2 in osteoblasts by wall-shear stress but not mechanical strain. Am J Physiol Endocrinol Metab 273: E751-E758, 1997[Abstract/Free Full Text].

46.   Spray, DC. Molecular physiology of gap junction channels. Clin Exp Pharmacol Physiol 23: 1038-1040, 1996[Web of Science][Medline].

47.   Spray, DC, Duffy HS, and Scemes E. Gap junctions in glia. Types, roles, and plasticity. Adv Exp Med Biol 468: 339-359, 1999[Web of Science][Medline].

48.   Steinberg, TH, Civitelli R, Geist ST, Robertson AJ, Hick E, Veenstra RD, Wang HZ, Warlow PM, Westphale EM, and Laing JG. Connexin43 and connexin45 form gap junctions with different molecular permeabilities in osteoblastic cells. EMBO J 13: 744-750, 1994[Web of Science][Medline].

49.   Toyofuku, T, Akamatsu Y, Zhang H, Kuzuya T, Tada M, and Hori M. c-Src regulates the interaction between connexin-43 and ZO-1 in cardiac myocytes. J Biol Chem 276: 1780-1788, 2001[Abstract/Free Full Text].

50.   Toyofuku, T, Yabuki M, Otsu K, Kuzuya T, Hori M, and Tada M. Direct association of the gap junction protein connexin-43 with ZO-1 in cardiac myocytes. J Biol Chem 273: 12725-12731, 1998[Abstract/Free Full Text].

51.   Turner, CH, Forwood MR, and Otter MW. Mechanotransduction in bone: do bone cells act as sensors of fluid flow? FASEB J 8: 875-878, 1994[Abstract].

52.   Urban, M, Rozental R, and Spray DC. A simple RT-PCR-based strategy for screening connexin identity. Braz J Med Biol Res 32: 1029-1037, 1999[Web of Science][Medline].

53.   Vander Molen, MA, Rubin CT, McLeod KJ, McCauley LK, and Donahue HJ. Gap junctional intercellular communication contributes to hormonal responsiveness in osteoblastic networks. J Biol Chem 271: 12165-12171, 1996[Abstract/Free Full Text].

54.   Weinbaum, S, Cowin SC, and Zeng Y. A model for the excitation of osteocytes by mechanical loading-induced bone fluid shear stresses. J Biomech 27: 339-360, 1994[Web of Science][Medline].

55.   Weinbaum, S, Guo P, and You L. A new view of mechanotransduction and strain amplification in cells with microvilli and cell processes. Biorheology 38: 119-142, 2001[Web of Science][Medline].

56.   Willecke, K, Eiberger J, Degen J, Eckardt D, Romualdi A, Guldenage M, Deutsch U, and Sohl G. Structural and functional diversity of connexin genes in the mouse and human genome. Biol Chem 383: 725-737, 2002[Web of Science][Medline].

57.   Yamaguchi, DT, Ma D, Lee A, Huang J, and Gruber HE. Isolation and characterization of gap junctions in the osteoblastic MC3T3-E1 cell line. J Bone Miner Res 9: 791-803, 1994[Web of Science][Medline].

58.   Yellowley, CE, Li Z, Zhou Z, Jacobs CR, and Donahue HJ. Functional gap junctions between osteocytic and osteoblastic cells. J Bone Miner Res 15: 209-217, 2000[Web of Science][Medline].

59.   You, J, Yellowley CE, Donahue HJ, Zhang Y, Chen Q, and Jacobs CR. Substrate deformation levels associated with routine physical activity are less stimulatory to bone cells relative to loading-induced oscillatory fluid flow. J Biomech Eng 122: 387-393, 2000[Web of Science][Medline].

60.   You, L, Cowin SC, Schaffler MB, and Weinbaum S. A model for strain amplification in the actin cytoskeleton of osteocytes due to fluid drag on pericellular matrix. J Biomech 34: 1375-1386, 2001[Web of Science][Medline].

61.   Zeng, Y, Cowin SC, and Weinbaum S. A fiber matrix model for fluid flow and streaming potentials in the canaliculi of an osteon. Ann Biomed Eng 22: 280-292, 1994[Web of Science][Medline].

62.   Zhang, D, Cowin SC, and Weinbaum S. Electrical signal transmission and gap junction regulation in a bone cell network: a cable model for an osteon. Ann Biomed Eng 25: 357-374, 1997[Web of Science][Medline].

63.   Ziambaras, K, Lecanda F, Steinberg TH, and Civitelli R. Cyclic stretch enhances gap junctional communication between osteoblastic cells. J Bone Miner Res 13: 218-228, 1998[Web of Science][Medline].


Am J Physiol Cell Physiol 284(2):C389-C403
0363-6143/03 $5.00 Copyright © 2003 the American Physiological Society



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
A. J. Siller-Jackson, S. Burra, S. Gu, X. Xia, L. F. Bonewald, E. Sprague, and J. X. Jiang
Adaptation of Connexin 43-Hemichannel Prostaglandin Release to Mechanical Loading
J. Biol. Chem., September 26, 2008; 283(39): 26374 - 26382.
[Abstract] [Full Text] [PDF]


Home page
DMMHome page
H. Y. Stevens, B. Melchior, K. S. Bell, S. Yun, J.-C. Yeh, and J. A. Frangos
PECAM-1 is a critical mediator of atherosclerosis
Dis. Model. Mech., September 1, 2008; 1(2-3): 175 - 181.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
A. F. Taylor, M. M. Saunders, D. L. Shingle, J. M. Cimbala, Z. Zhou, and H. J. Donahue
Mechanically stimulated osteocytes regulate osteoblastic activity via gap junctions
Am J Physiol Cell Physiol, January 1, 2007; 292(1): C545 - C552.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
A. M. Sorkin, K. C. Dee, and M. L. Knothe Tate
"Culture shock" from the bone cell's perspective: emulating physiological conditions for mechanobiological investigations
Am J Physiol Cell Physiol, December 1, 2004; 287(6): C1527 - C1536.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
V. I. Sikavitsas, G. N. Bancroft, H. L. Holtorf, J. A. Jansen, and A. G. Mikos
Mineralized matrix deposition by marrow stromal osteoblasts in 3D perfusion culture increases with increasing fluid shear forces
PNAS, December 9, 2003; 100(25): 14683 - 14688.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/2/C389    most recent
00052.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (27)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thi, M. M.
Right arrow Articles by Spray, D. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thi, M. M.
Right arrow Articles by Spray, D. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online