|
|
||||||||
1 New York Center for Biomedical Engineering, City College of the City University of New York, New York, 10031; and 2 Department of Neuroscience, Albert Einstein College of Medicine, Yeshiva University, Bronx, New York 10461
| |
ABSTRACT |
|---|
|
|
|---|
We tested the hypothesis that fluid
shear stress (
) modifies the expression, function, and distribution
of junctional proteins [connexin (Cx)43, Cx45, and zona occludens
(ZO)-1] in cultured bone cells. Cell lines with osteoblastic (MC3T3-E1
cells) and osteocytic (MLO-Y4 cells) phenotypes were exposed to
-values of 5 or 20 dyn/cm2 for 1-3 h.
Immunostaining indicated that at 5 dyn/cm2, the
distribution of Cx43, Cx45, and ZO-1 was moderately disrupted at cell
membranes; at 20 dyn/cm2, disruption was more severe.
Intercellular coupling was significantly decreased at both shear stress
levels. Western blots showed the downregulation of membrane-bound Cx43
and ZO-1 and the upregulation of cytosolic Cx43 and Cx45 at different
levels of shear stress. Similarly, Northern blots revealed that
expression of Cx43, Cx45, and ZO-1 was selectively up- and
downregulated in response to different shear stress levels. These
results indicate that in cultured bone cells, fluid shear stress
disrupts junctional communication, rearranges junctional proteins, and
determines de novo synthesis of specific connexins to an extent that
depends on the magnitude of the shear stress. Such disconnection from
the bone cell network may provide part of the signal whereby the
disconnected cells or the remaining network initiate focal bone remodeling.
gap junctions; connexin; zona occludens-1; mechanotransduction; bone remodeling
| |
INTRODUCTION |
|---|
|
|
|---|
BONE DRAMATICALLY
CHANGES its structure and mass in response to static and dynamic
loads. It has been well established that bending loads in bone cause
small deformations in the bone matrix, which in turn generate fluid
pressure differences that lead to fluid flow from the compression to
the tension side. The resulting fluid shear stress (
) is proposed to
be one of the factors by which the bone cell network senses mechanical
loading (7, 51, 54, 61). At physiological whole-tissue
strain levels (<0.2%), culture studies have demonstrated that fluid
flow is a more potent stimulator of bone cells than is substrate
deformation itself (38, 59). Previous experimental studies
have shown that bone cells release signaling molecules such as
prostaglandins, nitric oxide (NO), Ca2+, and other second
messengers in response to the fluid shear stress (3, 18, 20, 24,
41).
One mechanism of bone remodeling by which second messenger signals spread throughout the bone cell network involves gap junction channels that connect osteoblasts and bone-lining cells along the surfaces of Haversian and Volkmann canals and osteocytes that are embedded within the bone matrix (15, 22, 62). The connexin proteins that form gap junctions are encoded by a gene family with as many as 21 members in mammals (56). Connexins are expressed with an overlapping pattern of tissue specificity; connexin43 (Cx43) and connexin45 (Cx45) are the gap junction proteins that have been associated with bone cells (5, 33, 34, 48, 57).
Gap junction channels, including those formed by Cx43 and Cx45, are permeable to signaling ions and second messenger molecules (46). Gap junctional communication of such signals between bone cells gives rise to modulation of hormonal responses in the osteoblastic network (53), regulation of gene expression (29), and propagation of intracellular signals (12). Moreover, connexin expression and function are essential for normal osteogenesis and bone mineralization (30, 31, 34).
Connexins may also play roles in addition to the formation of pathways
for intercellular communication. Recent studies have shown that
connexins directly interact with both adherens and tight
junction-associated proteins including zona occludens-1 (ZO-1),
claudins, and
-catenin (1, 16, 26, 37, 50). Accordingly, it has been proposed that connexins are part of a multimolecular signaling complex, the "Nexus" (47).
From the standpoint of the studies described here, ZO-1 has been shown to interact with gap junction proteins Cx43 and Cx45 in osteoblastic cells (28) where ZO-1 binding to connexins may play a role
in the organization, trafficking, and/or stabilization of gap junction proteins (28, 49).
Regulation of gap junctional communication in response to load-induced biophysical signals has been examined in both vascular endothelial (6, 10) and bone cells (4, 13, 62, 63). Although such studies have generally reported an increase in Cx43 expression, changes in functional coupling in the bone cell network have not been as consistently demonstrated.
In this study, we tested the hypothesis that fluid shear stress of the magnitude that is expected to occur in bone tissue modifies the expression, distribution, and function of connexins (Cx43 and Cx45) and an associated protein (ZO-1). Well-characterized cell lines, MC3T3-E1 osteoblastic and MLO-Y4 osteocytic cells, were used in our experiments. Our results demonstrate that in both osteoblastic and osteocytic cell lines, fluid shear stress disrupts cell-to-cell junctional communication, rearranges gap junction proteins, and determines de novo synthesis of specific connexins to an extent that depends on the magnitude of the shear stress. Such disconnection from the bone cell network due to fluid shear stress may provide part of the signal whereby the disconnected cells or the remaining network initiates focal bone remodeling.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cell culture.
Osteoblastlike MC3T3-E1 cells (obtained from Dr. Kenneth J. McLeod,
SUNY, Stony Brook) were cultured in
-MEM (GIBCO-BRL, Grand Island,
NY) that contained 1% penicillin-streptomycin (GIBCO-BRL) and 5%
fetal bovine serum (FBS, Gemini Bio-Products, Woodland, CA), and
osteocyte-like MLO-Y4 cells (obtained from Dr. Lynda F. Bonewald, Univ.
TX Health Science Center) were cultured in
-MEM that contained 1%
penicillin-streptomycin, 10% FBS, and 2.5% calf serum (GIBCO-BRL) at
37°C with 95% O2-5% CO2. For each cell
type, confluent monolayers of cells were grown on glass slides in
static conditions and transferred to the flow apparatus to expose the
monolayers to a fluid
-value of 5 or 20 dyn/cm2 for 1, 2, or 3 h. These durations were chosen based on the turnover rates
of Cx43 and Cx45, which exhibit half-lives of 1.5 and 3 h,
respectively (9).
Flow chamber and experiment.
The fluid-flow setup consisted of a parallel-plate flow chamber
(Cytodyne, La Jolla, CA) and a recirculating flow circuit. This circuit
included a variable-speed peristaltic pump (Taitec, Saitama, Japan),
pulse dampener (Cole-Palmer Instruments, Vernon Hills, IL), and a
reservoir with culture medium (
-MEM with 1% FBS) maintained at
37°C with 95% O2-5% CO2. This system
produces laminar flow over a cell monolayer. A flow rate was
chosen to yield a
-value of 5 or 20 dyn/cm2 using
the equation
= 6
µ/bh2, where
is flow rate, µ is medium viscosity, and b and
h are channel width and height, respectively. Control cells
were kept under static conditions with the same culture medium at
37°C.
Alkaline phosphatase staining. To determine whether cells retained the differentiated phenotypes, both cell lines were routinely checked for alkaline phosphatase activity. Cells were fixed with 4% formaldehyde and permeabilized with 70% ethyl alcohol (EtOH). Cells were then rinsed with 0.2 M Tris(hydroxymethyl)-aminomethane (Sigma, St. Louis, MO) and incubated in naphthol AS-BI phosphate (Sigma) with fast red violet LB salt (Sigma) plus Tris · HCl for 30 min (2). After several washes with distilled water, cells were counterstained with Mayer's hematoxylin (Sigma) for 2 min. The cells were then washed with distilled water and mounted for analysis.
Cell viability studies. Cells from both control and shear stress-exposed samples were analyzed for health and viability using the Live/Dead Viability/Cytotoxity kit (Molecular Probes, Eugene, OR). Cells were rinsed a few times with 1× PBS and incubated with 4 µM eithidium homodimer-1 (EthD-1) and 2 µM of calcein-acetoxymethyl ester in 1× PBS for 30 min as recommended by the manufacturer. Live cells, which retained the polyanionic dye calcein, gave rise to green fluorescence; dead cells, which took up EthD-1 through membrane damage, produced red fluorescence. Live and dead cells were counted from 10 cell fields for all of the samples, and percentages of live and dead cells were calculated.
Immunofluorescence studies. Both control and shear stress-exposed cells were fixed with 2% formaldehyde, permeabilized with 0.4% Triton X-100 (Sigma), and blocked with 10% goat serum (GIBCO-BRL) in 1× PBS. The cells were then incubated with primary polyclonal antibodies against Cx43, Cx45 (courtesy of Dr. E. Hertzberg, AECOM and Dr. T. Steinberg, Washington Univ. School of Medicine), ZO-1 (Zymed, South San Francisco, CA), and secondary antibody conjugated to Alexa 488 (Molecular Probes). For F-actin staining, cells were incubated with rhodamine-labeled phalloidin (Sigma) immediately after fixation. The coverslips were mounted on slides, examined on a Nikon Eclipse TE300 microscope, and photographed using a SPOT-RT digital camera (Diagnostic Instruments, Sterling Heights, MI).
Western blot analysis.
Controls and shear stress-exposed (1 and 3 h) samples were lysed
in 80 µl of lysis buffer [10 mM Tris · HCl, pH
7.5, and 2 mM phenylmethylsulfonyl fluoride (PMSF)], sonicated, and
centrifuged (14,000 rpm for 30 min) as described by Guan et al.
(17). Pellets and supernatants from the samples were
collected for crude membrane and cytosolic protein analyses. Samples
were loaded onto 10% SDS-PAGE gels (Bio-Rad Laboratories, Hercules,
CA) for separation and were electrophoretically transferred to
nitrocellulose membranes (Schleicher and Schuell, Keene, NH). The
membranes were probed with primary polyclonal and monoclonal antibodies
to Cx43, Cx45, and ZO-1, polyclonal
-actin (Sigma), and monoclonal
GAPDH (Research Diagnostics, Flanders, NJ), followed by secondary
antibody incubation with horseradish peroxidase (HP)-conjugated
anti-rabbit and anti-mouse IgGs (Santa Cruz Biotech, Santa Cruz, CA).
The protein bands were detected using the Amersham ECL detection kit
(Amersham Biosciences, Piscataway, NJ) and were exposed on Fuji X-ray
film. The intensity of the bands was analyzed using Scion NIH Image
software (Scion, Frederick, MD). Measured intensities for all
experiments were first normalized with respect to internal controls
(GAPDH for cytosolic proteins and
-actin for membrane-bound
proteins) and then with respect to controls.
Northern blot analysis. Total RNA from the samples was extracted using TRIzol reagent (GIBCO-BRL) and was quantified as previously described (52). Total RNA (10 µg) from the samples was separated on 1.2% formaldehyde-agarose gel and was transferred onto a Gene Screen hybridization transfer membrane (NEN Life Science Products, Boston, MA). Membranes were hybridized with appropriate denatured random-primed probes. The rat cDNA probes used were full-length Cx43 and Cx45 (obtained from Dr. Eric Beyer, Univ. of Chicago Medical School) and 18S labeled with [32P]dCTP using the Megaprime labeling system (Amersham Biosciences). The membranes were then exposed to the phosphor screen overnight, scanned on a Storm PhosphorImager system, and quantified using ImageQuant software (Molecular Dynamics, Sunnyvale, CA). All acquired data were first normalized with respect to 18S RNA band intensity, and then all experimental data were normalized with respect to control data.
RT-PCR and semiquantitative RT-PCR analyses. RT-PCR was performed as previously described (52). For semiquantitative PCR, a 9:1 ratio of competimers and 18S primers (Ambion, Austin, TX) was added to the PCR mixture. Conditions applied for PCR using a PTC-100 programmable thermal controller (MJ Research, Watertown, MA) were 94°C for 30 s, 55°C for 30 s, 72°C for 30 s for 30 cycles, and 72°C for 8 min. Reaction products were analyzed by electrophoresis on 2% agarose gels and were quantified using Kodak 1D Scientific Imaging Systems. The following primers were used for each cDNA amplification: mCx43, TACCACGCCACCACTGGC (sense), AATCTCCAGGTCATC AGG (antisense); mCx45, AAAGAGGAGAGCCAACCAAA (sense), GTCCCAAACCCTAAGTG AAGC (antisense) (11); mZO-1, CATAGAATAGACTCCCCTGG (sense), GCTTGAGACCTCAT ACCTGT (antisense) (21); and mosteocalcin, gacaaagccttcatgtccaagc (sense), TTTGAG ACCGTCGAGCCGAAA (antisense) (23).
Scrape loading. Quantitative scrape loading as described by Pina-Benabou et al. (40) was used to analyze gap junctional communication after cells were exposed to shear stress. Incisions on the cell monolayers of control and shear stress-exposed samples were made with a fine razor blade in two or three different regions on the slides. The slides were incubated with 0.5% Lucifer yellow (Sigma) at 37°C, rinsed with 1× PBS, and fixed with 2% formaldehyde. The intensity of the dye spread from the damaged cells to the neighboring cells was observed using a Nikon Eclipse TE300 microscope and was photographed with a SPOT-RT digital camera. Extent of dye spread was quantified as linear distance perpendicular to the scrape using Scion NIH Image software.
Statistical analysis. Data were analyzed using one-way ANOVA (SigmaStat, Chicago, IL). Northern blot analyses are presented as means ± SE of six experiments. Western blot, quantitative RT-PCR, and scrape-loading analyses are presented as means ± SE of three experiments. A significant difference compared with controls is indicated as * P < 0.05.
| |
RESULTS |
|---|
|
|
|---|
Osteoblast and osteocyte cell lines express gap junction proteins
associated with osteogenesis and tight junction-associated protein
ZO-1.
We used the osteoblastic cell line MC3T3-E1 (57) and the
osteocytic cell line MLO-Y4 (23) to compare expression,
distribution, and function of gap junctions associated with
osteogenesis (34). As shown in Fig.
1A in which the cell
cytoskeleton was stained with phalloidin, these cell lines show quite
different morphologies. Whereas the osteoblast cells exhibit flattened,
epitheliod shapes and a close packing arrangement, the osteocyte cells
exhibit a more stellate shape with rounded somata and multiple
processes extending for variable distances to neighboring cells.
Because phenotypic expression of differentiated cell markers may vary in cell lines maintained under different conditions and after prolonged
passage, we determined expression levels of alkaline phosphatase and
osteocalcin in the MC3T3-E1 and MLO-Y4 cell lines under conditions used
in our studies. Alkaline phosphatase activity was higher in the
osteoblasts than in the osteocytes (Fig. 1B), whereas the
osteocytic cell line but not the osteoblastic cell line expressed
measurable osteocalcin mRNA (Fig. 1C). RT-PCR results showed
that under normal conditions, both types of immortalized cell lines
expressed mRNAs that encode Cx43, Cx45, and ZO-1 (Fig. 1C).
These data indicate that mRNAs corresponding to the osteogenic gap
junction proteins and the tight junction protein ZO-1 are expressed in
both cell lines.
|
Fluid shear stress does not affect cell viability but disrupts
cell-to-cell communication and rearranges gap junction proteins Cx43
and Cx45 and associated ZO-1 protein in cultured bone cells.
The overall experimental design critically depends on maintenance of
cell viability during periods of shear stress exposure. To determine
the extent to which cells were injured by the procedure, we performed
the Live/Dead assay on both cell types with no shear stress and with 5 and 20 dyn/cm2 of shear stress for 3 h. Both MC3T3-E1
and MLO-Y4 cells were viable after 3 h of exposure to fluid shear
stress. As shown, applying this assay to osteoblastic (Fig.
2A) and osteocytic (Fig. 2B) cells revealed that the percentages of live cells in
normal and shear stress-exposed cells were all >80%. ANOVA analysis
revealed that the percentage of dead cells was lower than live cells
for controls and for each treatment, but the percentage of dead cells did not significantly differ among the groups.
|
|
|
-value of 5 dyn/cm2. The
distribution of Cx43 was moderately disrupted at cell membranes with
increased perinuclear and cytoplasmic staining being detectable as
early as within 1 h of exposure time (data not shown). Increased perinuclear and cytoplasmic staining for Cx43 with concomitant additional reduction in appositional staining was even more apparent at
3 h of exposure at 5 dyn/cm2 of sheer stress (see Fig.
3B). Although ZO-1 distribution was also altered by flow, it
was altered differently than Cx43. At 1 h of low shear stress,
ZO-1 distribution was largely appositional (data not shown), which was
similar to the controls, whereas disruption was observed only at 3 h (see Fig. 3B). In contrast to Cx43, diffuse cytoplasmic
ZO-1 staining was only occasionally detectable. Exposure to 20 dyn/cm2 of shear stress for both 1 and 3 h produced
more pronounced disruption of both Cx43 and ZO-1 at the cell membrane
and a moderate increase of Cx43 perinuclear and cytoplasmic staining
(see Fig. 3C). Overlay images of Cx43 and ZO-1 from shear
stress-exposed samples clearly show a dramatic reduction in overlap of
these proteins at the contact cell borders (Fig. 4A). With
regard to Cx45, low shear stress (especially at 3 h) led to
reduced appositional and increased cytoplasmic staining; this change in
Cx45 distribution was more prominent at 20 dyn/cm2 of shear
stress (see Fig. 3C).
Control MLO-Y4 osteocyte cells possessed rounded cell bodies with
numerous cell processes and were connected to neighboring cells via
these processes. Immunostaining of these control cells revealed that
Cx43 and ZO-1 were concentrated at the tips of the cell processes at
regions of contact with neighboring cells, with Cx43 also showing
perinuclear distribution (see Fig. 3D). Similar to MC3T3-E1
cells, colocalization of Cx43 and ZO-1 in control MLO-Y4 cells
indicated that overlap was found at the tips of opposing cell processes
(Fig. 4B). For Cx45, there was very faint staining at the
tips of some opposing processes of the control cells (see Fig.
3D). Dramatic morphological changes were observed at both low and high levels of shear stress. The cell processes became smaller
in diameter and somewhat more numerous, whereas the cell bodies became
smaller and more rounded. When MLO-Y4 cells were subjected to 5 dyn/cm2 of shear stress for 1 or 3 h, Cx43 and ZO-1 at
the tips of opposing cell processes were moderately decreased, whereas
perinuclear distribution of Cx43 notably increased (see Fig.
3E). At 20 dyn/cm2 of shear stress, significant
disruption of both Cx43 and ZO-1 at the opposing membrane tips was
observed for both exposure durations (see Fig. 3F, which
illustrates results for 3 h) with a slight increase in cytoplasmic
and perinuclear staining of Cx43. Colocalization of Cx43 and ZO-1 was
also reduced at the opposing tips of the cell processes after exposure
to
-values of both 5 and 20 dyn/cm2 (Fig.
4B). Immunofluorescence for Cx45 indicated that perinuclear distribution became more prominent as shear stress increased (see Fig.
3, E and F). These results suggest that both
levels of fluid shear stress reorganize the distribution of junctional
proteins as early as within 1 h of exposure time, which would be
expected to produce an effect on junctional communication.
Intercellular coupling in cultured bone cells is significantly
decreased by fluid shear stress.
Previous studies (4, 57) have shown that MC3T3-E1 and
MLO-Y4 cells are coupled by functional gap junction channels. In this
study, we used the scrape-loading technique to quantitatively examine
the effects of fluid shear stress on cell-to-cell coupling. Our
scrape-loading data indicated that intercellular coupling significantly
decreased in MC3T3-E1 cells; this change was more pronounced with
higher shear stress and longer duration. As shown in Fig.
5A, the extent of dye spread
in control MC3T3-E1 cells was 270.4 ± 10.7 µm. This
dye-transfer distance was reduced to 237.4 ± 4.7 or 120.8 ± 5.0 µm when cells were exposed to the lower
-value of 5 dyn/cm2 for 1 or 3 h, respectively. At the high
-value of 20 dyn/cm2, the degree of dye transfer was
dramatically reduced to 168.4 ± 4.7 µm for the shorter duration
and 106 ± 6.3 µm for the longer duration (Fig. 5, bar graphs).
|
-value of 20 dyn/cm2 for 1 or 3 h. These data imply that both levels of fluid shear stress inhibited
intercellular coupling, which in turn supports the conclusion that both
levels also disrupt cell-to-cell junctional communication and
redistribute the junctional proteins depending on the duration and
level of shear stress.
Fluid shear stress downregulates ZO-1 and phosphorylated Cx43 in
cultured bone cells.
We performed Western blot analyses for crude membrane and cytosolic
proteins to determine the extent to which fluid shear stress regulates
levels of Cx43, Cx45, and ZO-1 within each cell type. For Cx43,
multiple bands were detected in Western blots corresponding to
different extents and/or types of phosphorylation (35,
36), where NP is the dephosphorylated form and P1 and P2
designate phosphorylated Cx43 species. For both cell lines at all shear
stress levels, there was a similar pattern in which the P2 form of Cx43
from the membrane was significantly decreased in the membrane fraction,
whereas all three forms of Cx43 were dramatically increased in the
cytosolic fraction. For osteoblastic MC3T3-E1 cells, densitometric
analysis of membrane-bound Cx43 bands showed significant downregulation
of the P2 form of Cx43 at 3 h for both 5 and 20 dyn/cm2 of shear stress. By contrast, NP, P1, and P2 forms
of cytosolic Cx43 increased after exposure to both levels of shear
stress (Fig. 6A). Similarly,
densitometric analysis of membrane-bound Cx43 for MLO-Y4 cells revealed
downregulation of the P2 form at both 5 and 20 dyn/cm2 of
shear stress, whereas cytosolic Cx43 noticeably increased in response
to both levels of shear stress, especially to 5 dyn/cm2
(Fig. 6B). In both MC3T3-E1 and MLO-Y4 cells, Cx45 was
detectable only in the cytosolic fraction, and low levels of shear
stress seemed to downregulate Cx45, whereas high levels of shear stress appeared to upregulate Cx45 at both exposure times (Fig.
7A). Western blots using
ZO-1-specific antibodies revealed that for both shear stress levels,
this membrane-bound protein was downregulated at longer exposure times
in both MC3T3-E1 and MLO-Y4 cells (Fig. 7B). These data
indicate that fluid shear stress regulates the level of Cx45 and ZO-1
expression and abundance of all three forms of Cx43. Notably, the P2
form of the membrane-bound Cx43 decreased as the duration of the shear
stress increased. Such a correlation of decreased P2 with decreased dye
coupling is consistent with previous reports on other cell types (see
DISCUSSION).
|
|
Selective regulation of Cx43, Cx45, and ZO-1 expression in response
to different shear stress levels.
Previous studies on endothelial cells have shown that fluid flow
and mechanical stretch alter the expression of Cx43 (6, 10). Therefore, in this study, we analyzed the consequence of fluid shear stress on the expression of Cx43, Cx45, and ZO-1 mRNAs in
osteoblastic and osteocytic cell lines using Northern blot analysis and
semiquantitative RT-PCR. In both cell lines, different levels of shear
stress seemed to regulate expression of Cx43 and Cx45 in a reciprocal
or compensatory manner. As shown in Fig. 8A, Cx43 mRNA levels increased
1.5-2-fold for MC3T3-E1 cells and 1.25- to 1.5-fold for MLO-Y4
cells at 5 dyn/cm2 of shear stress for 1, 2, or 3 h,
yet no apparent changes were found from the controls at 20 dyn/cm2 of shear stress for any of the durations for either
cell types. By contrast, Cx45 mRNA remained the same as the controls at
the lower shear stress level for all durations and increased to 1.25- to 1.75-fold at 20 dyn/cm2 of shear stress for 1, 2, or
3 h (Fig. 8B). With regard to ZO-1 mRNA, there were no
detectable changes with respect to control in MC3T3-E1 cells at the
lower shear stress level, whereas the mRNA level was decreased to half
that of controls at the higher shear stress level (Fig.
9A). However, more dramatic
effects on ZO-1 expression were seen in MLO-Y4 cells, where ZO-1 mRNA
was profoundly decreased at both 5 and 20 dyn/cm2 of shear
stress for 1-, 2-, or 3-h exposure times (Fig. 9B). These
data suggest that for both cell lines, lower shear stress (5 dyn/cm2) upregulates the expression of Cx43, whereas higher
shear stress (20 dyn/cm2) upregulates the expression of
Cx45. By contrast, ZO-1 is downregulated at high shear stress levels in
the osteoblastic cell line and even more strikingly at both shear
stresses in the osteocytic cell line.
|
|
| |
DISCUSSION |
|---|
|
|
|---|
In this study, we found that steady fluid shear stress modifies expression, function, and distribution of connexins (Cx43 and Cx45) and an associated tight junction protein (ZO-1) in cultured bone cells. Our results strongly suggest that fluid shear stress disrupts cell-to-cell communication and rearranges the gap junction proteins Cx43 and Cx45 and an associated protein ZO-1 in both MC3T3-E1 and MLO-Y4 cells. This disrupted gap junctional communication and rearrangement of Cx43, Cx45, and ZO-1 depended on the magnitude of the shear stress as well as the exposure duration. Our results as well as others (4, 14, 23, 57, 58) indicate that the major gap junction protein that mediates cell-to-cell communication in both cell types is Cx43. Our finding that the selective reduction in the P2 form of membrane-bound Cx43 correlates with the loss of dye coupling is consistent with previous reports, which indicate that Cx43 phosphorylation is important for its function (35, 36). Elevated levels of all three forms (NP, P1, and P2) of cytosolic Cx43 after exposure to fluid shear stress suggest that newly synthesized as well as internalized Cx43 contributed to the increases in cytosolic Cx43 level. We believe that this significant increase in cytosolic Cx43 level was mainly due to the internalization of membrane-bound Cx43, because newly synthesized Cx43 should mostly be in NP form. Furthermore, based on the cytosolic Cx43 analysis, low shear stress seemed to be regulating Cx43 in both cell types, whereas high shear stress appeared to be upregulating cytosolic Cx45. At the level of mRNA, Cx43, Cx45, and ZO-1 all showed interesting changes with fluid-induced shear stress. Expression of Cx43 and Cx45 mRNA was selectively upregulated in response to different shear stress levels, whereas both magnitudes of shear stress inhibited ZO-1 expression. Together, these results show for the first time that in cultured bone cells, fluid shear stress disrupts cell-to-cell junctional communication, rearranges junctional proteins, and determines de novo synthesis of specific connexins in a manner that depends on the magnitude of the shear stress.
There is increasing evidence that fluid shear stress regulates Cx43 in vascular smooth muscle (6), vascular endothelial (10), and cultured bone cells (4). Our observation of the disruption and translocation or internalization of Cx43 from the membrane after exposure to laminar flow in both MC3T3-E1 and MLO-Y4 cells is in agreement with the findings of DePaola and coworkers (10) for endothelial cells in the laminar flow region at 5 h of exposure time. We speculate that fluid shear stress of short duration (1 or 3 h) reduces intercellular communication as a consequence of morphological changes (4, 39), loss and/or internalization of membrane-bound Cx43 (10, 27, 35, 36), and possibly also inhibited trafficking of newly synthesized Cx43 to the membrane. Our finding that plasmalemmal ZO-1 immunostaining decreased in a somewhat similar manner to Cx43 indicates that ZO-1 and Cx43 might interact in MC3T3-E1 and MLO-Y4 cells as has been reported for other cell types (16, 19, 28, 50). Because interaction with ZO-1 has been suggested to stabilize Cx43 at the cell surface (49), the downregulation of ZO-1 by shear stress might lead to redistribution of Cx43 to intracellular compartments.
Functional studies on junctional communication have indicated that during shear stress exposure, dye coupling is reduced as gap junction protein expression decreases on the appositional membranes. Our observation of impaired dye coupling during the early period of laminar shear stress in cultured bone cells was similar to that reported for endothelial cells (10). Hence, these results verify our conclusion that fluid shear stress disrupts cell-to-cell communication. Biochemical evidence for the redistribution of Cx43 due to fluid shear stress is provided by the observed decrease in Cx43 P2 from the membrane, which is believed to be the predominant form of this gap junction protein that forms functional gap junction channels (35, 36) and an increase in all three forms of Cx43 in the cytosol.
Our findings on the distribution of Cx43, intercellular coupling, and the phosphorylation level of Cx43 after the steady shear stress exposure in MLO-Y4 cells differ from a recent report (4), which states that migration of Cx43 from the perinuclear region toward the dendritic processes and intercellular coupling increased after MLO-Y4 cells were subjected to fluid flow. Although differences might have arisen from usage of different antibodies, the analytical methods applied, or the composition of culture media, the previous study noted a lack of correlation between Cx43 distribution and the enhanced intercellular coupling, which suggests that another connexin might upregulate cell-to-cell communication after shear stress exposure. We analyzed both Cx43 and Cx45 in our experiments, and our data suggest that although Cx43 is the major gap junction protein that regulates junctional communication in MC3T3-E1 and MLO-Y4 cells, Cx45 can be upregulated under high shear stress conditions. The previous study also analyzed various osteoblastic cells (2T3, ROS17/2.8, MC3T3-E1), reported no effect of fluid flow on cell-to-cell communication, and concluded that osteoblasts are less responsive than osteocytes to such stimuli (see also Ref. 25). However, numerous previous studies on osteoblastic cells have clearly demonstrated that stress enhances the production of second messengers such as cAMP, NO, Ca2+, and prostaglandin (18, 20, 24, 41, 45) and alters cell morphology including the reorganization of the actin cytoskeleton (39). Our data indicate that osteoblastic MC3T3-E1 cells do respond to fluid shear stress.
We have observed differential mRNA expression of Cx43, Cx45, and ZO-1 in response to different shear stress levels. Low shear stress upregulated Cx43 expression in both cell types, whereas high shear stress upregulated Cx45 expression in both cell types. Previous studies have shown that when Cx43 function is inhibited in avian osteogenic tissue, Cx45 is upregulated to fulfill at least some aspect of the missing functions (33). Such selective upregulation of Cx43 and Cx45 by different levels of shear stress provides evidence that patterns of gene expression are transduced by the mechanical stimulus that would be expected to qualitatively alter the junctional phenotype and may correspond to either differentiation or dedifferentiation of bone cells (13, 31, 33, 34, 42, 44).
Although the mechanochemical transduction cascade leading from shear stress to altered gene expression patterns remains to be fully elucidated, fluid shear stress has been shown to enhance second-messenger production in cultured bone cells. In bone cells, cAMP is regulated by prostaglandin, and both are increased under fluid-flow conditions (41); cAMP has been shown to upregulate both the mRNA and protein of Cx43 and Cx45 in cultured cardiac myocytes (8). Therefore, a possible mechanism by which cultured bone cells might respond to fluid flow would involve disruption of cell-to-cell communication and enhanced production of prostaglandins. This would elevate cAMP, which in turn would upregulate expression and phosphorylation of either Cx43 or Cx45 depending on the magnitude of the shear stress and the duration of the exposure period. Subsequently, cellular differentiation would be initiated, and disconnected cells or the remaining network would begin focal bone remodeling.
The decrease in ZO-1 mRNA and protein expression with increased levels of shear stress that we have observed may also play an important role in bone remodeling. Truncation mutants of the tight junction protein ZO-1 have been shown to disrupt epithelial cell morphology, which suggests that ZO-1 may be involved in the regulation of cellular differentiation (43). Moreover, downregulation of ZO-1 and occludin appear to be related to phenotypic changes associated with epithelial cell transformation (32). Therefore, it seems likely that ZO-1 may also be involved in mediating cell differentiation in cultured bone cells.
The results described here were obtained under in vitro conditions in tissue culture. In vivo, there is increasing evidence that osteocyte cell processes are surrounded by the pericellular matrix with transverse tethering filaments (55), whereas in culture, there is no encircling support structure. In addition, the recent theoretical model by You et al. (60) brings to our attention that in vivo, the fluid shear stresses on the cell body are much smaller than those on the membrane in cell processes, so that the fluid drag force on the transverse filaments in the pericellular matrix is much greater than the fluid shear force on the cell-process membrane. Therefore, it is possible that under in vitro conditions the actin cytoskeleton in the cell body responds to the fluid shear stress rather than the more rigid actin bundle in the cell process. However, You et al. (60) predicted that the fluid drag on the tethering filaments can produce a 20- to 100-fold amplification in the strain on the actin filament bundle in the cell process. This amplification is sufficient to elicit intracellular signaling responses in all cell cultures with deformed substrates.
In summary, we have shown that fluid-induced shear stress is an important biophysical signal in bone mechanotransduction. Our observations suggest that in both osteoblastic and osteocytic cell lines, fluid shear stress of the magnitude expected to occur in bone tissue disrupts junctional communication, rearranges junctional proteins, and determines de novo synthesis of specific connexins to an extent that depends on the magnitude of the shear stress. Such disconnection from the bone cell network due to the fluid shear stress may provide part of the signal whereby the disconnected cells or the remaining network initiates focal bone remodeling.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Marcia Urban for technical assistance, Dr. Wei Li for advice on separating membrane and cytosolic Cx43, Dr. Karen Cusato for advice on use of the Live/Dead cell assay, Dr. Elliot L. Hertzberg (Albert Einstein College of Medicine) and Dr. Thomas H. Steinberg (Washington University School of Medicine) for generous supply of Cx43 and Cx45 antibodies, and Dr. Kenneth J. McLeod (State University of New York, Stony Brook) and Dr. Lynda F. Bonewald (University of Texas Health Science Center) for graciously providing the MC3T3-E1 and MLO-Y4 cell lines.
| |
FOOTNOTES |
|---|
This work was supported primarily by National Institutes of Health (NIH) Grant HL-19454 (principal investigator, S. Weinbaum) and a Gillecce Fellowship (City University of New York Graduate School) with additional support provided by NIH Grants DK-41918 and NS-34931 (principal investigator, D. C. Spray).
Address for reprint requests and other correspondence: D. C. Spray, Albert Einstein College of Medicine, Dept. of Neuroscience, 1300 Morris Park Ave., Bronx, NY 10461 (E-mail: spray{at}aecom.yu.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
First published October 3, 2002;10.1152/ajpcell.00052.2002
Received 1 February 2002; accepted in final form 30 September 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Ai, Z,
Fischer A,
Spray DC,
Brown AM,
and
Fishman GI.
Wnt-1 regulation of connexin43 in cardiac myocytes.
J Clin Invest
105:
161-171,
2000[ISI][Medline].
2.
Burstone, MS.
Histochemical demonstration of phosphatases in frozen sections with naphthol AS-phosphates.
J Histochem Cytochem
9:
146-153,
1961[ISI][Medline].
3.
Cheng, B,
Kato Y,
Zhao S,
Luo J,
Sprague E,
Bonewald LF,
and
Jiang JX.
PGE2 is essential for gap junction-mediated intercellular communication between osteocyte-like MLO-Y4 cells in response to mechanical strain.
Endocrinology
142:
3464-3473,
2001
4.
Cheng, B,
Zhao S,
Luo J,
Sprague E,
Bonewald LF,
and
Jiang JX.
Expression of functional gap junctions and regulation by fluid flow in osteocyte-like MLO-Y4 cells.
J Bone Miner Res
16:
249-259,
2001[ISI][Medline].
5.
Civitelli, R,
Beyer EC,
Warlow PM,
Robertson AJ,
Geist ST,
and
Steinberg TH.
Connexin43 mediates direct intercellular communication in human osteoblastic cell networks.
J Clin Invest
91:
1888-1896,
1993[ISI][Medline].
6.
Cowan, DB,
Lye SJ,
and
Langille BL.
Regulation of vascular connexin43 gene expression by mechanical loads.
Circ Res
82:
786-793,
1998
7.
Cowin, SC,
Weinbaum S,
and
Zeng Y.
A case for bone canaliculi as the anatomical site of strain generated potentials.
J Biomech
28:
1281-1297,
1995[ISI][Medline].
8.
Darrow, BJ,
Fast VG,
Kleber AG,
Beyer EC,
and
Saffitz JE.
Functional and structural assessment of intercellular communication. Increased conduction velocity and enhanced connexin expression in dibutyryl cAMP-treated cultured cardiac myocytes.
Circ Res
79:
174-183,
1996
9.
Darrow, BJ,
Laing JG,
Lampe PD,
Saffitz JE,
and
Beyer EC.
Expression of multiple connexins in cultured neonatal rat ventricular myocytes.
Circ Res
76:
381-387,
1995
10.
DePaola, N,
Davies PF,
Pritchard WF, Jr,
Florez L,
Harbeck N,
and
Polacek DC.
Spatial and temporal regulation of gap junction connexin43 in vascular endothelial cells exposed to controlled disturbed flows in vitro.
Proc Natl Acad Sci USA
96:
3154-3159,
1999
11.
Dermietzel, R,
Gao Y,
Scemes E,
Vieira D,
Urban M,
Kremer M,
Bennett MV,
and
Spray DC.
Connexin43 null mice reveal that astrocytes express multiple connexins.
Brain Res Rev
32:
45-56,
2000[Medline].
12.
Donahue, HJ.
Gap junctions and biophysical regulation of bone cell differentiation.
Bone
26:
417-422,
2000[Medline].
13.
Donahue, HJ,
Li Z,
Zhou Z,
and
Yellowley CE.
Differentiation of human fetal osteoblastic cells and gap junctional intercellular communication.
Am J Physiol Cell Physiol
278:
C315-C322,
2000
14.
Donahue, HJ,
McLeod KJ,
Rubin CT,
Andersen J,
Grine EA,
Hertzberg EL,
and
Brink PR.
Cell-to-cell communication in osteoblastic networks: cell line-dependent hormonal regulation of gap junction function.
J Bone Miner Res
10:
881-889,
1995[ISI][Medline].
15.
Doty, SB.
Morphological evidence of gap junctions between bone cells.
Calcif Tissue Int
33:
509-512,
1981[ISI][Medline].
16.
Giepmans, BN,
and
Moolenaar WH.
The gap junction protein connexin43 interacts with the second PDZ domain of the zona occludens-1 protein.
Curr Biol
8:
931-934,
1998[ISI][Medline].
17.
Guan, X,
Wilson S,
Schlender KK,
and
Ruch RJ.
Gap-junction disassembly and connexin 43 dephosphorylation induced by 18
-glycyrrhetinic acid.
Mol Carcinog
16:
157-164,
1996[ISI][Medline].
18.
Hillsley, MV,
and
Frangos JA.
Bone tissue engineering: the role of interstitial fluid flow.
Biotechnol Bioeng
43:
573-581,
1994[ISI][Medline].
19.
Howarth, AG,
Hughes MR,
and
Stevenson BR.
Detection of the tight junction-associated protein ZO-1 in astrocytes and other nonepithelial cell types.
Am J Physiol Cell Physiol
262:
C461-C469,
1992
20.
Hung, CT,
Allen FD,
Pollack SR,
and
Brighton CT.
Intracellular Ca2+ stores and extracellular Ca2+ are required in the real-time Ca2+ response of bone cells experiencing fluid flow.
J Biomech
29:
1411-1417,
1996[ISI][Medline].
21.
Itoh, M,
Nagafuchi A,
Yonemura S,
Kitani-Yasuda T,
Tsukita S,
and
Tsukita S.
The 220-kD protein colocalizing with cadherins in non-epithelial cells is identical to ZO-1, a tight junction-associated protein in epithelial cells: cDNA cloning and immunoelectron microscopy.
J Cell Biol
121:
491-502,
1993
22.
Jeansonne, BG,
Feagin FF,
McMinn RW,
Shoemaker RL,
and
Rehm WS.
Cell-to-cell communication of osteoblasts.
J Dent Res
58:
1415-1423,
1979
23.
Kato, Y,
Windle JJ,
Koop BA,
Mundy GR,
and
Bonewald LF.
Establishment of an osteocyte-like cell line, MLO-Y4.
J Bone Miner Res
12:
2014-2023,
1997[ISI][Medline].
24.
Klein-Nulend, J,
Semeins CM,
Ajubi NE,
Nijweide PJ,
and
Burger EH.
Pulsating fluid flow increases nitric oxide (NO) synthesis by osteocytes but not periosteal fibroblasts
correlation with prostaglandin upregulation.
Biochem Biophys Res Commun
217:
640-648,
1995[ISI][Medline].
25.
Klein-Nulend, J,
van der Plas PA,
Semeins CM,
Ajubi NE,
Frangos JA,
Nijweide PJ,
and
Burger EH.
Sensitivity of osteocytes to biomechanical stress in vitro.
FASEB J
9:
441-445,
1995
26.
Kojima, T,
Sawada N,
Chiba H,
Kokai Y,
Yamamoto M,
Urban M,
Lee GH,
Hertzberg EL,
Mochizuki Y,
and
Spray DC.
Induction of tight junctions in human connexin 32 (hCx32)-transfected mouse hepatocytes: connexin 32 interacts with occludin.
Biochem Biophys Res Commun
266:
222-229,
1999[ISI][Medline].
27.
Krutovskikh, VA,
Mesnil M,
Mazzoleni G,
and
Yamasaki H.
Inhibition of rat liver gap junction intercellular communication by tumor-promoting agents in vivo. Association with aberrant localization of connexin proteins.
Lab Invest
72:
571-577,
1995[ISI][Medline].
28.
Laing, JG,
Manley-Markowski RN,
Koval M,
Civitelli R,
and
Steinberg TH.
Connexin45 interacts with zonula occludens-1 and connexin43 in osteoblastic cells.
J Biol Chem
276:
23051-23055,
2001
29.
Lecanda, F,
Towler DA,
Ziambaras K,
Cheng SL,
Koval M,
Steinberg TH,
and
Civitelli R.
Gap junctional communication modulates gene expression in osteoblastic cells.
Mol Biol Cell
9:
2249-2258,
1998
30.
Lecanda, F,
Warlow PM,
Sheikh S,
Furlan F,
Steinberg TH,
and
Civitelli R.
Connexin43 deficiency causes delayed ossification, craniofacial abnormalities, and osteoblast dysfunction.
J Cell Biol
151:
931-944,
2000
31.
Li, Z,
Zhou Z,
Yellowley CE,
and
Donahue HJ.
Inhibiting gap junctional intercellular communication alters expression of differentiation markers in osteoblastic cells.
Bone
25:
661-666,
1999[Medline].
32.
Marzioni, D,
Banita M,
Felici A,
Paradinas FJ,
Newlands E,
De Nictolis M,
Muhlhauser J,
and
Castellucci M.
Expression of ZO-1 and occludin in normal human placenta and in hydatidiform moles.
Mol Hum Reprod
7:
279-285,
2001
33.
Minkoff, R,
Bales ES,
Kerr CA,
and
Struss WE.
Antisense oligonucleotide blockade of connexin expression during embryonic bone formation: evidence of functional compensation within a multigene family.
Dev Genet
24:
43-56,
1999[ISI][Medline].
34.
Minkoff, R,
Rundus VR,
Parker SB,
Hertzberg EL,
Laing JG,
and
Beyer EC.
Gap junction proteins exhibit early and specific expression during intramembranous bone formation in the developing chick mandible.
Anat Embryol (Berl)
190:
231-241,
1994[Medline].
35.
Musil, LS,
Cunningham BA,
Edelman GM,
and
Goodenough DA.
Differential phosphorylation of the gap junction protein connexin43 in junctional communication-competent and -deficient cell lines.
J Cell Biol
111:
2077-2088,
1990
36.
Musil, LS,
and
Goodenough DA.
Biochemical analysis of connexin43 intracellular transport, phosphorylation, and assembly into gap junctional plaques.
J Cell Biol
115:
1357-1374,
1991
37.
Nusrat, A,
Chen JA,
Foley CS,
Liang TW,
Tom J,
Cromwell M,
Quan C,
and
Mrsny RJ.
The coiled-coil domain of occludin can act to organize structural and functional elements of the epithelial tight junction.
J Biol Chem
275:
29816-29822,
2000
38.
Owan, I,
Burr DB,
Turner CH,
Qiu J,
Tu Y,
Onyia JE,
and
Duncan RL.
Mechanotransduction in bone: osteoblasts are more responsive to fluid forces than mechanical strain.
Am J Physiol Cell Physiol
273:
C810-C815,
1997
39.
Pavalko, FM,
Chen NX,
Turner CH,
Burr DB,
Atkinson S,
Hsieh YF,
Qiu J,
and
Duncan RL.
Fluid shear-induced mechanical signaling in MC3T3-E1 osteoblasts requires cytoskeleton-integrin interactions.
Am J Physiol Cell Physiol
275:
C1591-C1601,
1998
40.
Pina-Benabou, MH,
Srinivas M,
Spray DC,
and
Scemes E.
Calmodulin kinase pathway mediates the K+-induced increase in gap junctional communication between mouse spinal cord astrocytes.
J Neurosci
21:
6635-6643,
2001
41.
Reich, KM,
Gay CV,
and
Frangos JA.
Fluid shear stress as a mediator of osteoblast cyclic adenosine monophosphate production.
J Cell Physiol
143:
100-104,
1990[ISI][Medline].
42.
Romanello, M,
Moro L,
Pirulli D,
Crovella S,
and
D'Andrea P.
Effects of cAMP on intercellular coupling and osteoblast differentiation.
Biochem Biophys Res Commun
282:
1138-1144,
2001[ISI][Medline].
43.
Ryeom, SW,
Paul D,
and
Goodenough DA.
Truncation mutants of the tight junction protein ZO-1 disrupt corneal epithelial cell morphology.
Mol Biol Cell
11:
1687-1696,
2000
44.
Schiller, PC,
Roos BA,
and
Howard GA.
Parathyroid hormone up-regulation of connexin 43 gene expression in osteoblasts depends on cell phenotype.
J Bone Miner Res
12:
2005-2013,
1997[ISI][Medline].
45.
Smalt, R,
Mitchell FT,
Howard RL,
and
Chambers TJ.
Induction of NO and prostaglandin E2 in osteoblasts by wall-shear stress but not mechanical strain.
Am J Physiol Endocrinol Metab
273:
E751-E758,
1997
46.
Spray, DC.
Molecular physiology of gap junction channels.
Clin Exp Pharmacol Physiol
23:
1038-1040,
1996[ISI][Medline].
47.
Spray, DC,
Duffy HS,
and
Scemes E.
Gap junctions in glia. Types, roles, and plasticity.
Adv Exp Med Biol
468:
339-359,
1999[ISI][Medline].
48.
Steinberg, TH,
Civitelli R,
Geist ST,
Robertson AJ,
Hick E,
Veenstra RD,
Wang HZ,
Warlow PM,
Westphale EM,
and
Laing JG.
Connexin43 and connexin45 form gap junctions with different molecular permeabilities in osteoblastic cells.
EMBO J
13:
744-750,
1994[ISI][Medline].
49.
Toyofuku, T,
Akamatsu Y,
Zhang H,
Kuzuya T,
Tada M,
and
Hori M.
c-Src regulates the interaction between connexin-43 and ZO-1 in cardiac myocytes.
J Biol Chem
276:
1780-1788,
2001
50.
Toyofuku, T,
Yabuki M,
Otsu K,
Kuzuya T,
Hori M,
and
Tada M.
Direct association of the gap junction protein connexin-43 with ZO-1 in cardiac myocytes.
J Biol Chem
273:
12725-12731,
1998
51.
Turner, CH,
Forwood MR,
and
Otter MW.
Mechanotransduction in bone: do bone cells act as sensors of fluid flow?
FASEB J
8:
875-878,
1994[Abstract].
52.
Urban, M,
Rozental R,
and
Spray DC.
A simple RT-PCR-based strategy for screening connexin identity.
Braz J Med Biol Res
32:
1029-1037,
1999[ISI][Medline].
53.
Vander Molen, MA,
Rubin CT,
McLeod KJ,
McCauley LK,
and
Donahue HJ.
Gap junctional intercellular communication contributes to hormonal responsiveness in osteoblastic networks.
J Biol Chem
271:
12165-12171,
1996
54.
Weinbaum, S,
Cowin SC,
and
Zeng Y.
A model for the excitation of osteocytes by mechanical loading-induced bone fluid shear stresses.
J Biomech
27:
339-360,
1994[ISI][Medline].
55.
Weinbaum, S,
Guo P,
and
You L.
A new view of mechanotransduction and strain amplification in cells with microvilli and cell processes.
Biorheology
38:
119-142,
2001[ISI][Medline].
56.
Willecke, K,
Eiberger J,
Degen J,
Eckardt D,
Romualdi A,
Guldenage M,
Deutsch U,
and
Sohl G.
Structural and functional diversity of connexin genes in the mouse and human genome.
Biol Chem
383:
725-737,
2002[ISI][Medline].
57.
Yamaguchi, DT,
Ma D,
Lee A,
Huang J,
and
Gru