|
|
||||||||
Division of Pulmonary and Critical Care Medicine, Department of Medicine, and Division of Pediatric Cardiology, Department of Pediatrics, University of California, San Diego, California 92103
| |
ABSTRACT |
|---|
|
|
|---|
Capacitative Ca2+ entry (CCE) through store-operated Ca2+ (SOC) channels plays an important role in returning Ca2+ to the sarcoplasmic reticulum (SR) and regulating cytosolic free Ca2+ concentration ([Ca2+]cyt). A rise in [Ca2+]cyt and sufficient Ca2+ in the SR are required for pulmonary artery smooth muscle cell (PASMC) proliferation. We tested the hypothesis that platelet-derived growth factor (PDGF)-mediated PASMC growth involves upregulation of c-Jun and TRPC6, a transient receptor potential cation channel. In rat PASMC, PDGF (10 ng/ml for 0.5-48 h) phosphorylated signal transducer and activator of transcription (STAT3), increased mRNA and protein levels of c-Jun, and stimulated cell proliferation. PDGF treatment also upregulated TRPC6 expression and augmented CCE, elicited by passive depletion of Ca2+ from the SR using cyclopiazonic acid. Furthermore, overexpression of c-Jun stimulated TRPC6 expression and CCE amplitude in PASMC. Downregulation of TRPC6 using an antisense oligonucleotide specifically for human TRPC6 decreased CCE and inhibited PDGF-mediated PASMC proliferation. These results suggest that PDGF-mediated PASMC proliferation is associated with c-Jun/STAT3-induced upregulation of TRPC6 expression. The resultant increase in CCE raises [Ca2+]cyt, facilitates return of Ca2+ to the SR, and enhances PASMC growth.
store-operated cation channels; pulmonary hypertension; vascular remodeling; platelet-derived growth factor
| |
INTRODUCTION |
|---|
|
|
|---|
PLATELET-DERIVED GROWTH FACTOR (PDGF) is an important autocrine and paracrine mitogen for vascular smooth muscle cells, mediating hyperplasia, hypertrophy, endoreduplication, and migration, and for pulmonary vascular remodeling (3, 4, 58, 60, 71). As a tyrosine kinase-coupled receptor agonist, PDGF is not only itself sufficient to initiate DNA synthesis and mitosis, but it is also a stimulus for its own expression (56) and synthesis of other mitogens such as endothelin-1 (ET-1) and heparin-binding epidermal growth factor in vascular smooth muscle cells (4). High levels of PDGF have been implicated in the blood and lung tissues of patients with primary and secondary pulmonary hypertension, suggesting a critical role of PDGF in the elevated pulmonary vascular resistance and pulmonary arterial pressure in these patients. Indeed, the mitogenic effect of PDGF on pulmonary artery smooth muscle cells (PASMC) has been demonstrated to contribute to the progression of pulmonary vascular wall remodeling in patients with pulmonary hypertension (3, 26, 58, 60, 64).
Ionized Ca2+ in the cytoplasm, intracellular organelles, and nucleus is a critical signal transduction element in many cell types (5, 57, 61, 62). An increase in cytoplasmic free Ca2+ concentration ([Ca2+]cyt) is a major trigger for smooth muscle contraction (57, 62) and an important stimulus for smooth muscle cell growth (6-8, 43). Removal (or chelation) of extracellular Ca2+ or depletion of intracellularly stored Ca2+ in the sarcoplasmic/endoplasmic reticulum ([Ca2+]SR) significantly inhibits vascular smooth muscle cell (including PASMC) proliferation in the presence of serum and growth factors (16, 18, 55). These results indicate that a constant influx of extracellular Ca2+, which raises [Ca2+]cyt and nuclear Ca2+ concentration ([Ca2+]n) (1), as well as a sufficient [Ca2+]SR, is essential for PASMC proliferation. Therefore, the Ca2+-permeable channels in the plasma membrane would potentially be an important downstream effector for PDGF to mediate PASMC growth and proliferation.
In PASMC, there are at least three classes of Ca2+-permeable channels: 1) voltage-dependent Ca2+ channels (VDCC), 2) receptor-operated or ligand-gated Ca2+ channels (ROC), and 3) store-operated Ca2+ channels (SOC) (11, 34, 46, 61, 72). Opening of VDCC by membrane depolarization and opening of ROC by ligand-receptor interaction greatly contribute to the increase in [Ca2+]cyt in PASMC stimulated by membrane depolarizing factors (e.g., high K+), vasoconstrictors (e.g., serotonin, ET-1, and phenylephrine), and growth factors (e.g., PDGF) (2, 14, 25, 34, 44, 49, 52-54, 68). Opening of SOC by depletion of Ca2+ from the sarcoplasmic reticulum (SR) leads to capacitative Ca2+ entry (CCE), a mechanism involved in maintaining a sustained elevation of [Ca2+]cyt and returning Ca2+ to the depleted SR (7, 14, 18, 49, 51, 62). The mitogen-mediated rise in [Ca2+]cyt usually consists of two distinguishable components: an initial transient increase in [Ca2+]cyt due to Ca2+ mobilization from the SR followed by a sustained increase in [Ca2+]cyt due to Ca2+ influx through SOC (and other Ca2+ channels, e.g., ROC and VDCC). Indeed, the resting [Ca2+]cyt is much higher in proliferating cells cultured in medium containing serum and growth factors than in growth-arrested cells cultured in medium without serum and growth factors (18). Therefore, stimulating SOC function and upregulating expression of the genes that encode SOC would be very likely involved in the mitogen-mediated increase in [Ca2+]cyt and subsequent cell proliferation.
The SOC responsible for CCE in vascular smooth muscle cells are believed to be encoded by transient receptor potential (TRP) channel genes (7, 18, 27, 45, 66, 70). Overexpression of TRP channel gene(s) in heterologous expression systems (e.g., HEK-293, COS, and Chinese hamster ovary cells and Xenopus oocytes) results in the formation of Ca2+-permeable channels that are activated by depletion of the SR Ca2+ and activation of membrane receptors (7, 12, 35, 40, 63, 76, 77). Inhibition of TRP channel expression using the antisense (AS) oligonucleotides specifically targeting at TRP genes downregulates the mRNA and protein expression of TRP channels, reduces inward Ca2+ currents through SOC, decreases Ca2+ entry, and inhibits many Ca2+-mediated functions (10, 27, 45, 59, 70).
TRPC6, a member of the short TRP channel gene subfamily (11), is abundantly expressed in lung tissues and pulmonary arteries (8, 45, 66). c-Jun, a member of the activating protein-1 (AP-1) gene family (29), is a transcription factor that associates with cell growth and proliferation in PASMC (38, 39). It has been well demonstrated that PDGF increases [Ca2+]cyt by modulating VDCC and ROC (2, 25, 68) in vascular smooth muscle cells; however, it is unclear whether SOC is involved in PDGF-induced PASMC growth. This study was thus designed to test the hypothesis that PDGF-mediated PASMC proliferation is in part caused by upregulation of TRPC6 gene expression. The subsequent augmentation of Ca2+ entry due to CCE and receptor-mediated Ca2+ influx increases [Ca2+]cyt and maintains [Ca2+]SR by returning Ca2+ to the SR and, ultimately, contributes to stimulation of PASMC proliferation.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cell preparation and culture. PASMC from pulmonary arteries were prepared from male Sprague-Dawley rats (125-250 g) (72, 73). The isolated pulmonary arterial branches (3rd-4th division) were incubated in Hanks' balanced salt solution (Biofluids) containing collagenase (1.5 mg/ml; Worthington) for 20 min. After incubation, a thin layer of adventitia was carefully stripped off with a fine forceps, and the endothelium was removed by gentle scratching of the intimal surface with a surgical blade. The remaining smooth muscle was then digested with collagenase (2.0 mg/ml) and elastase (0.5 mg/ml; Sigma) for 35-45 min at 37°C. Cells were plated onto 25-mm coverslips (for patch-clamp and fluorescence microscopy experiments) or 10-cm petri dishes (for molecular biological experiments) in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum (FBS; GIBCO), penicillin (100 U/ml), and streptomycin (100 mg/ml) and cultured in a humidified incubator at 37°C. The cells were passaged by trypsinization with 0.05% trypsin-EDTA (GIBCO) and used for experiments at passages 3-6. Growth of all cells was arrested before experimentation by culture in serum-free DMEM for 24 h.
The purity of PASMC in cultures was confirmed by the specific monoclonal antibody raised against smooth muscle
-actin (Boehringer Mannheim). Cultured cells were first stained with the
membrane-permeable nucleic acid stain 4',6'-diamidino-2-phenylindole (5 µM; Molecular Probes) to estimate total cell numbers in the cultures.
All the 4',6'-diamidino-2-phenylindole-stained cells cross-reacted with the smooth muscle cell
-actin antibody, indicating that the cultures were smooth muscle cells (50). Cell number was determined
using a hemocytometer. Cell count in each of the four 1-mm3
corner squares in the hemocytometer was averaged to calculate total
cell number per milliliter in cell suspension. Cell number, normalized
by the size of the petri dishes (cells/cm2), was used to
compare cell growth rate. Cell viability was determined using 0.45%
trypan blue (Sigma).
DNA synthesis. [3H]thymidine incorporation was determined to evaluate DNA synthesis. Briefly, rat PASMC were seeded in 24-well microplates at ~2 × 104 cells/well and cultured in 10% FBS-DMEM for 24 h, and growth was arrested in DMEM for 24 h. Cells were then incubated in 0.2% FBS-DMEM with or without PDGF (10 ng/ml) for 48 h, with 1 µCi of [3H]thymidine added to the cells for the last 16 h. Incorporation of radioactivity into trichloroacetic acid-insoluble material was measured by a liquid scintillation counter. For EGTA experiments, the growth-arrested cells were treated with PDGF in the absence or presence of 0-1.5 mM EGTA for 24 h before [3H]thymidine incorporation was measured by the liquid scintillation counter.
Bromodeoxyuridine incorporation. The immunofluorescent staining (intensity) of incorporated bromodeoxyuridine (BrdU) was detected by the BrdU flow kit according to a modification of the manufacturer's instructions (BD Pharmingen). Briefly, growth-arrested rat PASMC cells were incubated at 37°C in 0.2% FBS-DMEM with and without PDGF (10 ng/ml) for 24 h, with 10 µM BrdU added to the cells for 2 h. Cells were then harvested, fixed, and permeabilized. To expose incorporated BrdU, cells were treated with DNase at 30 µg/100 µl for 1 h at 37°C. Samples were washed twice with Perm/Wash buffer (BD Pharmingen) and then incubated for 20 min with 50 µl of anti-BrdU-FITC solution. After being washed twice with Perm/Wash buffer, the cells were cultured with 20 µl of 7-amino-actinomycin (BD Pharmingen) solution, resuspended in 200 µl of PBS containing 3% FBS and 0.09% sodium azide, and analyzed by FACSCalibur flow cytometry using Cell Quest software (Becton Dickinson, Mountain View, CA). Results are displayed as bivariate distribution of BrdU content vs. DNA content.
Generation of recombinant adenoviral vector and c-jun infection protocol. An E1 region-deleted recombinant adenoviral vector carrying sense (+c-jun) c-jun cDNA was constructed. A 2.6-kb pair fragment of full-length c-jun cDNA was then subcloned in sense orientation into the pACCMVpLpA shuttle vector to yield the sense construct pSR-sense-c-jun. The pSR-sense-c-jun was then cotransfected with pJM17 into HEK-293 cells by calcium phosphate-DNA coprecipitation. For viral plaque assays, the cotransfected HEK-293 cells were overlaid with 0.65% agarose (prepared with 1× DMEM) every 3-4 days. The growth of the E1-deleted adenovirus is limited to the HEK-293 cells. The PCR assay was used for identification of the recombinant adenoviral vectors.
The adenoviral vector expressing sense c-jun was used to infect PASMC; detailed methods for c-jun infection have been described elsewhere (38, 39). Briefly, the cells were infected with appropriate virus at 50 plaque-forming units/cell in DMEM containing 0.2% FBS and incubated with gentle swirling every 20-30 min for 3 h. After 7 h of infection, the medium was replaced with the growth medium, 10% FBS-DMEM. Cells were used 24-48 h after adenoviral infection for experimentation. The expression of c-Jun was verified by Western blot analysis.Western blot analysis. The cells were gently washed twice in cold PBS, scraped into 0.3 ml of lysis buffer (1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 100 µg/ml phenylmethylsulfonyl fluoride, and 30 µl/ml aprotinin), and incubated for 30 min on ice. The cell lysates were then sonicated and centrifuged at 12,000 rpm for 10 min, and the insoluble fraction was discarded. In some experiments, cell lysates were treated with the peptide N-glycosidase F (20 U; New England Biolabs) overnight at 4°C (74). The protein concentration in the supernatant was determined by the bicinchoninic acid protein assay using bovine serum albumin as a standard. Ten to 25 µg of proteins were mixed and boiled in SDS-PAGE sample buffer for 5 min. The protein samples separated on 10% SDS-PAGE were then transferred to nitrocellulose membranes by electroblotting in a MINI Trans-Blot Cell transfer apparatus according to the manufacturer's instructions (Bio-Rad). After incubation overnight at 4°C in a blocking buffer (0.1% Tween 20 in PBS) containing 5% nonfat dry milk powder, the membranes were incubated with the anti-c-Jun polyclonal antibody (Santa Cruz Biotechnology), anti-TRPC6 polyclonal antibody (Alomone Labs), and antiphosphorylated signal transducer and activator of transcription (STAT3) antibody (Cell Signaling Technology). The membranes were then washed and incubated with anti-rabbit or anti-mouse horseradish peroxidase-conjugated IgG for 90 min at room temperature. The bound antibody was detected using an enhanced chemiluminescence detection system (Amersham).
RT-PCR.
Total RNA (3 µg) was prepared from PASMC by the acid guanidinium
thiocyanate-phenol-chloroform extraction method using TRIzol reagent (GIBCO) and reverse transcribed using the Superscript Preamplification System (GIBCO). The sense and AS primers were specifically designed from the coding regions of c-Jun, TRPC1, TRPC4,
TRPC6, and rat
-actin (Table 1). The
fidelity and specificity of the sense and AS oligonucleotides were
examined using the BLAST program.
|
-actin was used
as an internal control. The net intensity values of cDNA bands measured
by a Kodak electrophoresis documentation system were normalized to the
net intensity values of the
-actin signals, and the ratios are
expressed as arbitrary units for quantitative comparison.
Electrophysiological measurements.
Whole cell currents through SOC (ISOC) were
recorded with an Axopatch-1D amplifier using patch-clamp techniques
(18, 20). Patch pipettes (2-4 M
) were made on a
Sutter electrode puller using borosilicate glass tubes and fire
polished on a Narishige microforge. Voltage stimuli were delivered from
a holding potential of 0 mV using voltage steps from
80 to +20 mV.
Current traces recorded before the activation of SOCs were used as a
template to subtract leak currents. SOCs were activated by passive
depletion of the Ca2+ in the SR using 10 µM cyclopiazonic
acid (CPA). The bath solution for recording optimal
ISOC contained (mM) 120 sodium methane
sulfonate, 20 calcium aspartate, 0.5 3,4-diaminopyridine, 10 glucose,
and 10 HEPES, with pH adjusted to 7.4 with methane sulfonic acid. The
pipette solution contained (mM) 138 cesium aspartate, 1.15 EGTA, 1 Ca(OH)2, 2 Na2-ATP, and 10 HEPES (pH 7.2).
These ionic conditions eliminated the currents through K+
and Cl
channels. In Ca2+-free bath solution,
calcium aspartate was replaced by equimolar sodium aspartate to
maintain osmolarity. CPA was dissolved into DMSO to make a stock
solution of 30 mM. Aliquots of the stock solution were then diluted
1:3,000 into the bath solution or culture medium to make a final
concentration of 10 µM CPA (pH 7.4). Ni2+ (Sigma) was
directly dissolved in the bath solution on the day of use. SK&F-96365
(Sigma) was first dissolved in distilled water to make a stock solution
of 50 mM; aliquots of the stock solution were then diluted into the
bath solution or culture medium to make final concentrations of 5, 10, and 50 µM SK&F-96365. The pH values of all solutions were checked
after addition of the drugs and readjusted to 7.4.
Measurement of
[Ca2+]cyt.
In single PASMC, [Ca2+]cyt was measured using
the Ca2+-sensitive fluorescent indicator fura 2 (19). Cells were loaded with 3 µM fura 2-AM for 30 min
in the dark at room temperature (22-24°C) under an atmosphere of
5% CO2-95% air. The fura 2-loaded cells on coverslips
were then transferred to a recording cell chamber on the microscope
stage and superfused with modified Krebs solution for 30 min to remove
the extracellular fura 2 and to allow cytosolic esterases to cleave
fura 2-AM into active fura 2. Fura 2 fluorescence (510-nm light
emission excited by 340- and 380-nm illuminations) from the cell, as
well as background fluorescence, was collected at 32°C using Nikon
UV-Fluor objectives. The fluorescence signals emitted from the cells
were monitored continuously using an intracellular imaging fluorescence
microscopy system and recorded on an IBM-compatible computer for later
analysis. [Ca2+]cyt was calculated from fura
2 fluorescent emission excited at 340 and 380 nm
(F340/F380) using the ratio method based on the following equation: [Ca2+]cyt = Kd × (Sf2/Sb2) × (R
Rmin)/(Rmax
R), where
Kd (225 nM) is the dissociation constant for
Ca2+, Sf2 and Sb2 are emission
fluorescence values at 380-nm excitation in the presence of EGTA and
Triton X-100, respectively, R is the measured fluorescence ratio, and
Rmin and Rmax are minimal and maximal ratios,
respectively (19).
AS oligonucleotides. Second-generation AS oligonucleotides that contain nine phosphorothioate DNA linkages to activate RNase H were purchased from Sequitur (Natick, MA). The AS oligonucleotides were designed to cleave mRNA of the rat TRPC6 gene (GenBank accession no. AB051212) by activating endogenous RNase H and have a unique combination of specificity, efficacy, and reduced toxicity. The AS oligonucleotides were screened against the GenBank database, and no matches were found to other nontargeted genes. The negatively charged AS oligonucleotide S13730 (TTGGCCCTTGCAAACTTCCACTCCA) from Sequitur was transfected into cells with Lipid 2012-G according to the manufacturer's protocol (Sequitur). The transfection efficiency, determined by measuring uptake of a fluorescent control oligomer in a separate plate, was ~95% using 40 nM oligomer and 2.5 g/ml of Lipid 2012-G (for 12 h) in PASMC (55-60% confluence). RT-PCR and Western blot analyses were used to evaluate oligomer activity. An oligonucleotide with the same base composition as S13730, but with scrambled sequence, was used as a control for nonspecific or toxic effects of the oligomers. The sequence of the AS oligonucleotide for rat TRPC6 was compared with known sequences in GenBank using the National Center for Biotechnology Information web-blasting program to ensure that no homologies to any other human TRP genes were found.
The oligonucleotides were prepared by one investigator who provided stocks that were coded so that the investigators performing electrophysiological and fluorescence microscopy experiments were unaware of treatment allocation until experiments and data analyses were completed. For each treatment, the cells were first rinsed with Opti-MEM (GIBCO-BRL), and then oligonucleotides in 0.2% FBS-DMEM were added to the cells. After 8-10 h of incubation with the oligomers, the medium was aspirated and replaced with 0.2% FBS-DMEM with or without PDGF in the absence of oligomers for 12-24 h before the experiments were performed. The final concentration of the oligonucleotides was 40 nM.Statistical analysis. The composite data are expressed as means ± SE. Statistical analyses were performed using unpaired Student's t-test or one-way ANOVA and Fisher's protected least significant difference tests where appropriate. Differences were considered to be significant when P < 0.05.
| |
RESULTS |
|---|
|
|
|---|
PDGF stimulates PASMC proliferation.
In rat PASMC cultured in medium containing a low
concentration of serum (0.2% FBS), treatment with PDGF (10 ng/ml for
48 h) induced a 2.3-fold increase in cell number, a 1.6-fold
increase in [3H]thymidine uptake, and a 2.9-fold increase
in BrdU uptake (Fig. 1,
A-C). Cell cycle analysis
indicated that 46% of the cells were in the S or G2/M
phase after 24 h of treatment with PDGF. These results suggest
that PDGF significantly increases PASMC proliferation.
|
PDGF upregulates mRNA expression of c-Jun and TRPC6. Among various TRP channel genes, TRPC6 is predominantly expressed in lung tissues (8) and may be an essential subunit that forms native cation channels activated by agonist-receptor interaction and intracellular store depletion in vascular smooth muscle cells (27, 45). TRPC6 is highly expressed in pulmonary artery segments (66), indicating that TRPC6 is a dominant member of the TRP channel family expressed in PASMC.
Treatment of PASMC with PDGF (10 ng/ml) significantly increased mRNA levels of c-Jun (an early responsive gene that associates with PASMC growth) (38, 39) and TRPC6 (Fig. 2). However, the time courses of PDGF-induced mRNA expression of c-Jun and TRPC6 are quite different. The increase in c-Jun mRNA peaked ~1 h after treatment with PDGF, whereas TRPC6 mRNA expression increased 2-4 h after treatment (Fig. 2, B and C). These results indicate that the PDGF-mediated increase in c-Jun expression precedes the increase in TRPC6 mRNA expression.
|
|
Overexpression of c-Jun upregulates mRNA and protein expression of
TRPC6.
c-Jun is a transcription factor that is itself sufficient to stimulate
gene expression (4, 29). c-Jun can also dimerize with
STAT3 and concurrently regulate gene expression (75). The mRNA expression of TRPC6 was significantly increased in PASMC infected
with an adenoviral vector carrying sense c-jun
(+c-jun) compared with control cells infected with an empty
virus (Fig. 4A). Furthermore,
overexpression of c-Jun also upregulated the protein expression of
TRPC6 (Fig. 4B). These results suggest that homomeric or
heterogenous c-Jun dimers (e.g., c-Jun/c-Fos, c-Jun/STAT-3) may serve
as downstream signal transduction elements in PDGF-mediated TRPC6
upregulation.
|
PDGF enhances CCE. Expression of TRP channel genes in mammalian cells and Xenopus oocytes has been demonstrated to increase CCE activated by intracellular store depletion and to increase Ca2+ influx activated by ligand-receptor interaction, suggesting that the channels responsible for CCE and receptor-operated Ca2+ entry are formed, at least in part, by TRP gene products (7, 11, 12, 23, 27, 35, 40, 45, 70, 76-78). To examine whether PDGF-mediated upregulation of TRPC6 is associated with an increase in CCE, using fluorescence microscopy, we measured and compared the changes in [Ca2+]cyt before and after store depletion between control cells and cells treated with PDGF.
In the absence of extracellular Ca2+, application of 10 µM CPA, which inhibits the Ca2+-Mg2+-ATPase (SERCA) in the sarcoplasmic/endoplasmic reticulum (SR), induced a transient increase in [Ca2+]cyt because of leakage of Ca2+ from the SR to the cytosol (Fig. 5A). When the SR was depleted 5-7 min after treatment with CPA, restoration of extracellular Ca2+ induced a sustained increase in [Ca2+]cyt that was apparently due to CCE. The amplitude of CCE was much greater in PASMC treated with PDGF (10 ng/ml for 72 h) than in cells treated with vehicle (Fig. 5A). Treatment of the cells with PDGF also significantly increased the resting [Ca2+]cyt and enhanced the increase in [Ca2+]cyt due to Ca2+ mobilization or leakage (Fig. 5A).
|
Functional inhibition of CCE attenuates PASMC growth.
Whole cell cation current through SOC (ISOC) was
elicited in PASMC held at 0 mV (which inactivates voltage-dependent
Na+ and Ca2+ channels) by a series of test
potentials ranging from
80 to +20 mV. The inward currents at negative
test potentials were mainly generated by Ca2+ influx,
because the ratios of Ca2+ to Na+ permeability
(PCa/PNa) to go through
SOC are usually on the order of 10:1 when extracellular
Ca2+ concentration is in the millimolar range (48,
76). The outward currents at positive potential were putatively
generated by Cs+ efflux, because the permeability of SOC to
Cs+ is equal to that of other monovalent cations (e.g.,
Na+ and K+) (31). Extracellular
application of 0.5 mM Ni2+ reversibly decreased the
Ca2+ currents, potentially through SOC
(ISOC; Fig.
6A), and
attenuated the increase in [Ca2+]cyt due to
CCE (data not shown) (42), suggesting that
Ni2+ is a potent blocker of native SOC that is responsible
for CCE in PASMC (18, 42, 78).
|
-(3-(4-methoxyphenyl)propoxyl)-4-methoxy-phenethyl)-1H-imidazole hydrochloride], a selective blocker of SOC (14, 17), on
whole cell ISOC and cell growth (see below). As
shown in Fig. 6B, extracellular application of 50 µM
SK&F-96365 significantly reduced whole cell ISOC
elicited by test potentials ranging from
100 to +100 mV. The
SK&F-96365-mediated inhibitory effect appeared to be greater on inward
ISOC at negative potentials (70-75%) than
on outward ISOC (~55-60%; Fig. 6,
Bb and Bc).
Functional blockade of the channels responsible for CCE with 0.5 mM
Ni2+ or 50 µM SK&F-96365 significantly attenuated CCE
(data not shown) (18, 42) and inhibited PDGF-mediated
[3H]thymidine incorporation (Fig.
7A) or cell proliferation
(Fig. 7B) in PASMC. These results demonstrate that PDGF
stimulates PASMC proliferation by upregulating TRPC6 expression. The
resultant increase in availability of functional TRPC6-encoded SOC
augments CCE, increases intracellular Ca2+ concentration,
and stimulates PASMC growth.
|
Inhibition of endogenous TRPC6 mRNA and protein expression in PASMC using AS oligonucleotides. It has been demonstrated that native SOC is composed of subunits encoded by TRP channel genes (7, 8, 12, 23, 27, 35, 40, 45, 70, 76-78). Therefore, transcription and expression of TRP channel genes should be involved in the regulation of amplitudes of ISOC and CCE by increasing or decreasing the number of channels available for generating Ca2+ currents. The native SOC or TRP channels are believed to be formed by heteromeric tetramers from different TRPC subunits (7, 11). To investigate whether TRPC6 is involved in forming functional native SOC responsible for CCE, we tested the effect of specific inhibition of TRPC6 gene expression by AS oligonucleotides on ISOC and CCE in PASMC.
The optimal transfection condition for AS oligonucleotides was first determined using a fluorescent control oligonucleotide (provided by Sequitur). As shown in Fig. 8A, the oligonucleotide uptake, determined by fluorescence intensity, in PASMC reached a maximal level ~8-10 h after initial transfection and remained at the maximal level for up to 24 h. Accordingly, the molecular biological, electrophysiological, and fluorescence microscopy experiments were performed in PASMC ~12-24 h after transfection with nonsense (NS) or AS oligonucleotides.
|
Inhibition of endogenous TRPC6 using the AS oligonucleotide
targeting TRPC6 attenuates ISOC in PASMC.
To investigate the inhibitory effects of the TRPC6 AS oligonucleotide
on expression of endogenous TRPC6 and activity of endogenous SOC in
PASMC, we determined the protein level of TRPC6 and measured the
amplitude and current density of whole cell
ISOC. In PASMC cultured in media with PDGF, AS
treatment not only downregulated basal protein expression of TRPC6 but
also attenuated the PDGF-mediated upregulation of TRPC6 (Fig.
9A). Furthermore, the AS
oligonucleotide markedly decreased the amplitude and current density of
whole cell ISOC in PASMC cultured in medium
containing PDGF (Fig. 9B). The inhibitory effect of the
TRPC6 AS oligonucleotide was much greater on inward
ISOC at negative potentials than on outward ISOC at positive potentials. These results
suggest that TRPC6 participate in forming native SOC that are mainly
responsible for inward ISOC in rat PASMC.
|
Inhibition of endogenous TRPC6 using the AS oligonucleotide targeting TRPC6 attenuates CCE in rat PASMC. It has been demonstrated that overexpression of TRPC6 in heterologous transfection systems, such as COS-7 (74) and HEK-293 (8, 27) cells, did not enhance CCE induced by thapsigargin-mediated passive store depletion but significantly enhanced receptor-mediated Ca2+ influx. On the basis of these results, several groups of investigators concluded that homomeric TRPC6 channels are not SOC but, rather, ROC that are activated by ligand-receptor interaction and activation of G protein (8, 23, 27, 28, 74).
The results from this study (Figs. 2-5) show a close association of PDGF-mediated upregulation of TRPC6 and enhancement of CCE in rat PASMC. These observations direct us to speculate that although homomeric TRPC6 may not form store depletion-activated SOC in heterologous transfection systems, TRPC6 may tetramerize heterogeneously with other TRPC channel subunits and form heterogenous SOC that are activated by store depletion in rat PASMC. The next set of experiments was designed to test whether inhibition of endogenous TRPC6 using the TRPC6 AS oligonucleotide decreases the amplitude of CCE in rat PASMC. Rat PASMC were first transfected with the NS oligonucleotide and the TRPC6 AS oligonucleotide for 12 h and then cultured in regular media for 12-24 h before experimentation. As shown in Fig. 10, treatment of rat PASMC with the TRPC6 AS oligonucleotide for 15-24 h significantly reduced the amplitude of CCE triggered by passive store depletion using 5 µM CPA (Fig. 10A). In PASMC treated with the NS oligonucleotide (which contains the same composition of nucleotide as the AS oligonucleotide, but with scrambled sequence), the amplitude of CPA-mediated CCE was ~1.4-fold greater than in cells treated with the TRPC6 AS oligonucleotide (Fig. 10, A and B). CCE amplitude in PASMC treated with the AS oligonucleotide was shifted to the left (by ~100 nM) compared with cells treated with the NS oligonucleotide (Fig. 10C). Taken together with the effects on ISOC (Fig. 9), these results suggest that ISOC and CCE in rat PASMC are, at least partially, generated by Ca2+ influx through the SOC that are formed heterogeneously by TRPC6.
|
Inhibition of endogenous c-Jun using the AS oligonucleotide
targeting c-Jun attenuates PDGF-mediated upregulation of TRPC6.
To investigate whether overexpression of c-Jun was involved in
PDGF-mediated upregulation of TRPC6 in rat PASMC, we examined the
effect of the AS oligonucleotide that specifically targets the rat
c-Jun gene (Biomol Research Laboratories) in cells treated with PDGF.
Inhibition of endogenous c-Jun significantly attenuated the
PDGF-mediated upregulation of TRPC6 (Fig.
11). These results, which are in good
agreement with the finding that overexpression of c-Jun enhanced TRPC6
expression (Fig. 4), suggest that c-Jun is a transcription factor
involved in PDGF-mediated upregulation of TRPC6 in rat PASMC.
|
Inhibition of endogenous TRPC6 using the AS oligonucleotide
targeting TRPC6 attenuates PDGF-mediated PASMC proliferation.
Consistent with its inhibitory effects on TRPC6 expression and CCE, the
TRPC6 AS oligonucleotide significantly inhibited PDGF-mediated PASMC
proliferation. The [3H]thymidine uptake in PASMC
transfected with the TRPC6 AS oligonucleotide was reduced by 60%
compared with cells transfected with the NS oligonucleotide (Fig.
12). These results provide compelling
evidence that endogenous TRPC6 is involved in PDGF-mediated
proliferation in rat PASMC.
|
| |
DISCUSSION |
|---|
|
|
|---|
Elevated PDGF level in the blood plasma and upregulated PDGF expression in the lung tissues have been implicated in patients and animals with pulmonary arterial hypertension (3, 26, 30, 60). The PDGF-mediated PASMC proliferation as well as PDGF-mediated upregulation of other growth factors (e.g., vascular endothelial growth factor and ET-1) may be involved in pulmonary vascular remodeling, a major contributor to the elevated pulmonary vascular resistance and pulmonary arterial pressure in patients with pulmonary hypertension (58, 64). In experiments in vitro shown in this study, PDGF induced PASMC proliferation in media containing low concentration of serum (0.2% FBS); the cell number and [3H]thymidine and BrdU uptake were increased in cells treated with PDGF. Chelation of extracellular Ca2+ from 1.6 to 0.1 mM using 1.5 mM EGTA (15) significantly inhibited the PDGF-mediated PASMC proliferation, suggesting that the proliferative effect of PDGF depends on Ca2+ influx and the activity of plasmalemmal Ca2+ channels.
The TRP channel gene-encoded Ca2+-permeable channels have been implicated in forming the channels responsible for CCE and receptor-mediated Ca2+ entry in vascular smooth muscle cells including PASMC (18, 27, 28, 45, 66, 67, 70). CCE appears to be an important pathway for elevating [Ca2+]cyt and returning Ca2+ to the SR, which are required for PASMC proliferation and pulmonary vasoconstriction (18, 42, 45, 70). Treatment of PASMC with PDGF upregulated mRNA and protein expression of TRPC6, a member of the short TRP channel subfamily, which is preferentially expressed in lung tissues and pulmonary arteries (18, 45, 66). The PDGF-mediated upregulation of TRPC6 was associated with an increase in CCE, induced by passive depletion of intracellular Ca2+ stores with CPA. Pharmacological blockade of the SOC channels inhibited the increase in [Ca2+]cyt due to CCE and attenuated the PDGF-induced PASMC proliferation. These results suggest that PDGF-induced PASMC proliferation is mediated, at least partially, by upregulating TRPC6 gene expression. The subsequent increase in the number of TRPC6-encoded Ca2+ channels enhances CCE (and mitogen-mediated Ca2+ influx) and raises [Ca2+]cyt and [Ca2+]SR, which are required for the progression of the cell cycle when PASMC proliferate (6, 42, 49).
The tyrosine-phosphorylated STAT3 is a downstream signal transduction protein activated by PDGF through its receptor (9). PDGF-mediated activation of STAT3 has been demonstrated to upregulate gene expression of c-Jun, an AP-1 transcription activator involved in PASMC growth (38, 39). Moreover, overexpression of c-Jun upregulated TRPC6 expression and enhanced CCE, whereas downregulation of c-Jun inhibited PDGF-mediated upregulation of TRPC6 in rat PASMC. These results suggest that the PDGF-mediated upregulation of TRPC6 is related to activated STAT3 and upregulated c-Jun. STAT3, by forming homodimers as well as heterodimers (e.g., STAT3/STAT1) with other STAT family members, is a DNA binding protein that mediates transcriptional activation of genes containing STAT binding sites. The PDGF-mediated activation of STAT3 may be an important mechanism in upregulating c-Jun expression. STAT3 and c-Jun may bind with the TRPC6 gene promoter independently to upregulate TRPC6 expression. Interaction of c-Jun with STAT3 has been demonstrated to maximize their enhancer function in genes that contain independent but closely spaced DNA binding sites for STAT3 and c-Jun (75). Therefore, STAT3 and c-Jun may form the heteromeric dimer c-Jun/STAT3 (75), which may in turn regulate TRPC6 gene expression. The precise mechanism involved in the STAT3/c-Jun-mediated transcriptional regulation of TRPC6 remains unclear.
In addition to STATs, activated or dimerized PDGF receptors also
provide docking sites for other signaling molecules and proteins with
SH2- and phosphotyrosine-binding sites, such as Src, p85, Src homology
phosphatase 2, phospholipase C-
, GTPase-activating protein, growth
factor receptor-bound protein 2, Src homology 2 domain containing
2-collagen-related protein, and a novel cytoplasmic protein (13). All these proteins can bind to the tyrosine
phosphates on the intracellular domain of activated PDGF receptors and
activate different downstream signaling pathways. The final outcome,
upregulation or downregulation of the targeting genes, depends on the
intensity (e.g., number of activated receptors and dose of ligands),
duration, and location of the signaling pathways and proteins involved
and varies because of different signaling pathways and their cross talk
(13). Therefore, there are multiple downstream pathways after activation of PDGF receptor that may participate in the transcriptional and translational regulation of TRPC6 genes in PASMC.
A rise in [Ca2+]cyt is a major trigger for smooth muscle contraction and an important stimulus for PASMC proliferation (2, 4-7, 18, 25, 43, 52-54, 62, 67, 68). The mitogen-mediated increase in [Ca2+]cyt usually consists of an initial Ca2+ release from intracellular Ca2+ stores, such as the SR, followed by a sustained Ca2+ influx through plasmalemmal Ca2+ channels (6-8, 34, 52-54, 61). The store depletion-mediated CCE serves as an important mechanism in maintaining elevated [Ca2+]cyt and returning Ca2+ to the emptied SR (7, 46, 76). The ratio of cytosolic free to stored Ca2+ in the SR is between 1:10,000 and 1:50,000 (7), whereas the nuclear membrane is highly permeable to Ca2+ (1). Therefore, a rise in [Ca2+]cyt would rapidly increase [Ca2+]n and [Ca2+]SR, activate cytoplasmic mitogen-activated protein kinase (which is part of the phosphorylation cascade that leads to activation of DNA synthesis-promoting factor), activate nuclear Ca2+-sensitive transcriptional factors, and promote cell proliferation (4-7, 17, 21, 22, 43). Removal (or chelation) of extracellular Ca2+ or depletion of [Ca2+]SR significantly inhibited vascular smooth muscle cell growth in the presence of serum and growth factors (e.g., PDGF) (18, 55, 59). These findings suggest that a constant Ca2+ influx, partially maintained by CCE through a TRPC6-encoded SOC, and a sufficient [Ca2+]SR, which requires Ca2+ for protein and lipid synthesis and sorting, are required for PASMC growth.
Among various TRP channel genes expressed in mammalian and human
tissues (11), TRPC6 is a unique member that is abundantly expressed in lung tissues (8, 27, 45) and pulmonary
arteries (66) on the basis of Northern blot analysis. The
single-channel conductance of TRPC6 has been reported to be 35 pS, and
the ion selectivity of the channel is five times greater for
Ca+ than for Na+
(PCa/PNa = 5)
(65). Overexpression of TRPC6 in mammalian cells enhances
agonist-induced Ca2+ influx (27, 74), whereas
inhibition of TRPC6 using AS oligomers inhibits vascular tone
(67). In rat PASMC, our study demonstrates that PDGF, a
growth factor that is implicated in the development of pulmonary
hypertension (3, 26, 58, 60, 64), mediates cell
proliferation partially by upregulating TRPC6 expression and increasing
the store depletion-activated CCE. The resultant increases in
[Ca2+]cyt, [Ca2+]n,
and [Ca2+]SR would promote cell proliferation
by moving quiescent cells into the cell cycle and by propelling
proliferating cells through mitosis (Fig.
13). The PDGF-induced transient
increase in [Ca2+]cyt by Ca2+
release from intracellular stores and by Ca2+ influx
through VDCC and ROC, well documented by other investigators (2,
25, 68), may also contribute to the upregulation of c-Jun, a
Ca2+-dependent AP-1 transcription factor. The upregulation
of TRPC6 and increase of CCE through SOC induced by chronic exposure to PDGF further enhance the PDGF-mediated increase in
[Ca2+]cyt and PASMC proliferation.
|
Several studies have determined the properties of homomeric channels formed by recombinant TRPC6 expressed in heterologous systems (e.g., COS-7 and HEK-293 cells). Overexpression of TRPC6 enhanced the agonist-mediated increase in [Ca2+]cyt but failed to enhance the thapsigargin-mediated increase in [Ca2+]cyt (8, 23-25, 27, 74), suggesting that TRPC6 is a nonselective cation channel that is directly activated by receptor-coupled G protein and diacylglycerol, but not by intracellular Ca2+ store depletion.
In the present study, PDGF-mediated PASMC proliferation was associated with significant increases in the mRNA and protein expression of TRPC6 and in the amplitude of CCE activated by passive depletion of intracellular Ca2+ stores using CPA. It has not been reported that CPA activates membrane receptors and signal transduction proteins (e.g., diacylglycerol and G proteins). Therefore, the enhanced CPA-induced Ca2+ influx in PASMC treated with PDGF was mainly due to CCE. Furthermore, inhibition of TRPC6 expression using the specific AS oligonucleotide that enhances TRPC6 mRNA degradation decreased amplitudes of ISOC and CCE activated by CPA-induced store depletion. In this study, we have demonstrated that TRPC6 is involved in the mechanisms underlying PDGF-mediated PASMC proliferation by enhancing CCE. This conclusion is mainly based on 1) the correlation of PDGF-mediated upregulation of TRPC6 with the enhancement of store depletion-activated ISOC and CCE and 2) the ability of TRPC6 AS oligomer to inhibit TRPC6 expression, reduce store depletion-activated ISOC and CCE, and attenuate PDGF-mediated cell proliferation.
In HEK-293 cells stably transfected with TRPC6, transient transfection of a dominant-negative TRPC6 mutant almost abolished TRPC6-dependent currents activated by G protein activation. The dominant-negative TRPC6 mutant also efficiently inhibited TRPC3-dependent currents in HEK-293 cells stably transfected with TRPC3 (24). These results suggest that TRPC6 is able to form heterotetrameric channels with TRPC3 (and TRPC7) and that the expression level of TRPC6 affects expression of TRPC3 and TRPC7 (24). TRPC1 can also form heterogenous TRP channels with TRPC3 that are subject to regulation by phospholipase C and Ca2+ (37). These results suggest that PDGF-mediated upregulation of TRPC6 may increase the expression and promote the formation of oligomeric TRP channels that are activated by store depletion. In addition to upregulating TRPC6 expression, PDGF may also increase the TRPC6 channel function (28).
Differential distribution of various TRP channel genes in different types of cells indicates heteromorphism of native SOC in various cell types (11). In rat PASMC, it is possible that TRPC6 is involved in store depletion-mediated CCE by forming heterotetrameric SOC with other TRPC channels (e.g., TRPC1, TRPC3, and TRPC7), which are demonstrated to be store-operated TRPC channels (32, 33, 41, 63, 69, 76). Using RT-PCR, we found that TRPC1, TRPC3, and TRPC7 were expressed in rat PASMC; the mRNA levels of TRPC3 and TRPC7 were much less than the mRNA level of TRPC6 (data not shown). Whether TRPC3/6 or TRPC3/6/7 and TRPC1/3/6 or TRPC1/6/7 heteromeric channels are store operated and functionally involved in the regulation of cytoplasmic and intracellularly stored Ca2+ in PASMC requires further study. Whether TRPC6 forms SOC may also be cell specific. In HEK-293, COS, and rat aortic smooth muscle cells, homotetrameric TRPC6 may not be store operative, whereas in native PASMC, TRPC6 may form heterotetrameric channels that are activated by store depletion and receptor activation.
In summary, the results from the present study indicate that upregulation of TRPC6 is involved in PDGF-mediated PASMC proliferation. The mitogenic effect of PDGF has been demonstrated to associate with pulmonary vascular remodeling in patients with pulmonary hypertension. Developing pharmacological interventions specifically aiming at downregulating gene expression of TRPC6 or at inhibiting function of TRPC6-encoded Ca2+ channels may greatly help in development of new therapeutic approaches for patients with pulmonary vascular diseases.
| |
ACKNOWLEDGEMENTS |
|---|
We thank B. R. Lapp and Y. Zhao for technical assistance.
| |
FOOTNOTES |
|---|
This work was supported in part by National Heart, Lung, and Blood Institute Grants HL-66012, HL-54043, and HL-64945 (to J. X.-J. Yuan).
Address for reprint requests and other correspondence: J. X.-J. Yuan, Div. of Pulmonary and Critical Care Medicine, UCSD Medical Center, MC 8382, 200 W. Arbor Dr., San Diego, CA 92103-8382 (E-mail: xiyuan{at}ucsd.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
10.1152/ajpcell.00125.2002
Received 18 March 2002; accepted in final form 26 September 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Abritton, NL,
Oancea E,
Kuhn MA,
and
Meyer T.
Source of nuclear calcium signals.
Proc Natl Acad Sci USA
91:
12458-12462,
1995.
2.
Ahmed, A,
Kobayashi S,
Shikasho T,
Nishimura J,
and
Kanaide H.
Differential effects of Ca2+ channel blockers on Ca2+ transients and cell cycle progression in vascular smooth muscle cells.
Eur J Pharmacol
344:
323-331,
1998[Web of Science][Medline].
3.
Berg, JT,
Breen EC,
Fu Z,
Mathieu-Costello O,
and
West JB.
Alveolar hypoxia increases gene expression of extracellular matrix proteins and platelet-derived growth factor B in lung parenchyma.
Am J Respir Crit Care Med
158:
1920-1928,
1998
4.
Berk, BC.
Vascular smooth muscle growth: autocrine growth mechanisms.
Physiol Rev
81:
999-1030,
2001
5.
Berridge, MJ.
Inositol trisphosphate and calcium signalling.
Nature
361:
315-325,
1993[Medline].
6.
Berridge, MJ.
Calcium signalling and cell proliferation.
Bioessays
17:
491-500,
1995[Web of Science][Medline].
7.
Birnbaumer, L,
Zhu X,
Jiang M,
Boulay G,
Peyton M,
Vannier B,
Brown D,
Platano D,
Sadeghi H,
Stefani E,
and
Birnbaumer M.
On the molecular basis and regulation of cellular capacitative calcium entry: roles for Trp proteins.
Proc Natl Acad Sci USA
93:
15195-15202,
1996
8.
Boulay, G,
Zhu X,
Peyton M,
Jian M,
Hurst R,
Stefani E,
and
Birnbaumer L.
Cloning and expression of a novel mammalian homolog of Drosophila transient receptor potential (Trp) involved in calcium entry secondary to activation of receptors coupled by the Gq class of G protein.
J Biol Chem
272:
29672-29680,
1997
9.
Bromberg, JF.
Activation of STAT proteins and growth control.
Bioessays
23:
161-169,
2001[Web of Science][Medline].
10.
Brough, GH,
Wu S,
Cioffi D,
Moore TM,
Li M,
Dean N,
and
Stevens T.
Contribution of endogenously expressed Trp1 to a Ca2+-selective, store-operated Ca2+ entry pathway.
FASEB J
15:
1727-1738,
2001
11.
Clapham, DE,
Runnels LW,
and
Strubing C.
The TRP ion channel family.
Nat Rev Neurosci
2:
387-396,
2001[Web of Science][Medline].
12.
Den Dekker, E,
Molin DG,
Breikers G,
van Oerle R,
Akkerman JW,
van Eys GJ,
and
Heemskerk JW.
Expression of transient receptor potential mRNA isoforms and Ca2+ influx in differentiating human stem cells and platelets.
Biochim Biophys Acta
1539:
243-255,
2001[Medline].
13.
Denhardt, DT.
Signal-transducing protein phosphorylation cascades mediated by Ras/Rho protein in the mammalian cell: the potential for multiplex signaling.
Biochem J
318:
729-747,
1996[Web of Science][Medline].
14.
Doi, S,
Damron DS,
Horibe M,
and
Murray PA.
Capacitative Ca2+ entry and tyrosine kinase activation in canine pulmonary arterial smooth muscle cells.
Am J Physiol Lung Cell Mol Physiol
278:
L118-L130,
2000
15.
Fabiato, A,
and
Fabiato F.
Calculator programs for computing the composition of the solutions containing multiple metals and ligands used for experiments in skinned muscle cells.
J Physiol (Paris)
75:
463-505,
1979[Medline].
16.
Gallois, A,
Bueb JL,
and
Tschirhart E.
Effect of SK&F 96365 on extracellular Ca2+-dependent O2 production in neutrophil-like HL-60 cells.
Eur J Pharmacol
361:
293-298,
1998[Web of Science][Medline].
17.
Ginty, DD.
Calcium regulation of gene expression: isn't that spatial?
Neuron
18:
183-186,
1997[Web of Science][Medline].
18.
Golovina, VA,
Platoshyn O,
Bailey CL,
Wang J,
Limsuwan A,
Sweeney M,
Rubin LJ,
and
Yuan JXJ
Upregulated TRP and enhanced capacitative Ca2+ entry in human pulmonary artery myocytes during proliferation.
Am J Physiol Heart Circ Physiol
280:
H746-H755,
2001
19.
Grynkiewicz, G,
Poenie M,
and
Tsien RY.
A new generation of Ca2+ indicators with greatly improved fluorescence properties.
J Biol Chem
260:
3440-3450,
1985
20.
Hamill, OP,
Marty A,
Neher E,
Sakmann B,
and
Sigworth FJ.
Improved patch-clamp techniques for high-resolution current recording from cells and cell-free membrane patches.
Pflügers Arch
391:
85-100,
1981[Web of Science][Medline].
21.
Hardingham, GE,
Chawla S,
Johnson CM,
and
Bading H.
Distinct functions of nuclear and cytoplasmic calcium in the control of gene expression.
Nature
385:
260-265,
1997[Medline].
22.
Hardingham, GE,
Chawla S,
Cruzalegui FH,
and
Bading H.
Control of recruitment and transcription-activating function of CBP determines gene regulation by NMDA receptors and L-type calcium channels.
Neuron
22:
789-798,
1999[Web of Science][Medline].
23.
Hofmann, T,
Obukhov AG,
Schaefer M,
Harteneck C,
Gudermann T,
and
Schultz G.
Direct activation of human TRPC6 and TRPC3 channels by diacylglycerol.
Nature
397:
259-263,
1999[Medline].
24.
Hofmann, T,
Schaefer M,
Schultz G,
and
Gudermann T.
Subunit composition of mammalian transient receptor potential channels in living cells.
Proc Natl Acad Sci USA
99:
7461-7466,
2002
25.
Hu, XQ,
Singh N,
Mukhopadhyay D,
and
Akbarali HI.
Modulation of voltage-dependent Ca2+ channels in rabbit colonic smooth muscle cells by c-Src and focal adhesion kinase.
J Biol Chem
273:
5337-5342,
1998
26.
Humber, M,
Monti G,
Fartoukh M,
Magnan A,
Brenot F,
Rain B,
Capron F,
Galanaud P,
Duroux P,
Simonneau G,
and
Emilie D.
Platelet-derived growth factor expression in primary pulmonary hypertension: comparison of HIV seropositive and HIV seronegative patients.
Eur Respir J
11:
554-559,
1998[Abstract].
27.
Inoue, R,
Okada T,
Onoue H,
Hara Y,
Shimizu S,
Naitoh S,
Ito Y,
and
Mori Y.
The transient receptor potential protein homologue TRP6 is the essential component of vascular
1-adrenoceptor-activated Ca2+-permeable cation channel.
Circ Res
88:
325-332,
2001
28.
Jung, S,
Strotmann R,
Schultz G,
and
Plant TD.
TRPC6 is candidate channel involved in receptor-stimulated cation currents in A7r5 smooth muscle cells.
Am J Physiol Cell Physiol
282:
C347-C359,
2002
29.
Karin, M,
Liu Z,
and
Zandi E.
AP-1 function and regulation.
Curr Opin Cell Biol
9:
240-246,
1997[Web of Science][Medline].
30.
Katayose, D,
Ohe M,
Yamauchi K,
Ogata M,
Shirato K,
Fujita H,
Shibahara S,
and
Takishima T.
Increased expression of PDGF A- and B-chain genes in rat lungs with hypoxic pulmonary hypertension.
Am J Physiol Lung Cell Mol Physiol
264:
L100-L106,
1993
31.
Kerschbaum, HH,
and
Cahalan MD.
Monovalent permeability, rectification, and ionic block of store-operated calcium channels in Jurkat T lymphocytes.
J Gen Physiol
111:
521-537,
1998
32.
Kiselyov, K,
Mignery GA,
Zhu MX,
and
Muallem S.
The N-terminal domain of the IP3 receptor gates store-operated hTrp3 channels.
Mol Cell
4:
423-429,
1999[Web of Science][Medline].
33.
Kiselyov, K,
Xu X,
Mozhayeva G,
Kuo T,
Pessah I,
Mignery G,
Zhu X,
Birnbaumer L,
and
Muallem S.
Functional interaction between InsP3 receptors and store-operated Htrp3 channels.
Nature
396:
478-482,
1998[Medline].
34.
Kotlikoff, MI,
Herrera G,
and
Nelson MT.
Calcium-permeant ion channels in smooth muscle.
Rev Physiol Biochem Pharmacol
134:
147-199,
1999[Medline].
35.
Kunze, DL,
Sinkins WG,
Vaca L,
and
Schilling WP.
Properties of single Drosophila Trpl channels expressed in Sf9 insect cells.
Am J Physiol Cell Physiol
272:
C27-C34,
1997
36.
Lee, JH,
Gomora JC,
Cribbs LL,
and
Perez-Reyes E.
Nickel block of three cloned T-type calcium channels: low concentrations selectively block
1H.
Biophys J
77:
3034-3042,
1999[Web of Science][Medline].
37.
Lintschinger, B,
Balzer-Geldsetzer M,
Baskaran T,
Graier WF,
Romanin C,
Zhu MX,
and
Groschner K.
Coassembly of Trp1 and Trp3 proteins generates diacylglycerol- and Ca2+-sensitive cation channels.
J Biol Chem
275:
27799-27805,
2000
38.
Lu, C,
Giordano FJ,
Bao X,
Morris KC,
and
Rothman A.
Antisense fosB RNA inhibits thrombin-induced hypertrophy in cultured pulmonary arterial smooth muscle cells.
Circulation
98:
596-603,
1998
39.
Lu, CY,
Giordano FJ,
Rogers KC,
and
Rothman A.
Adenovirus-mediated increase of exogenous and inhibition of endogenous fosB gene expression in cultured pulmonary arterial smooth muscle cells.
J Mol Cell Cardiol
28:
1703-1713,
1996[Web of Science][Medline].
40.
Luckhoff, A,
and
Clapham DE.
Calcium channels activated by depletion of internal calcium stores in A431 cells.
Biophys J
67:
177-182,
1994[Medline].
41.
Ma, HT,
Patterson RL,
Van-Rossum DB,
Birnbaumer L,
Mikoshiba K,
and
Gill DL.
Requirement of the inositol trisphosphate receptor for activation of store-operated Ca2+ channels.
Science
287:
1647-1651,
2000
42.
McDaniel, SS,
Platoshyn O,
Wang J,
Yu Y,
Sweeney M,
Krick S,
Rubin LJ,
and
Yuan JXJ
Capacitative Ca2+ entry in agonist-induced pulmonary vasoconstriction.
Am J Physiol Lung Cell Mol Physiol
280:
L870-L880,
2001
43.
Means, AR.
Calcium, calmodulin and cell cycle regulation.
FEBS Lett
347:
1-4,
1994[Web of Science][Medline].
44.
Murray, RK,
and
Kotlikoff MI.
Receptor-activated calcium influx in human airway smooth muscle cells.
J Physiol
435:
123-144,
1991
45.
Ng, LC,
and
Gurney AM.
Store-operated channels mediate Ca2+ influx and contraction in rat pulmonary artery.
Circ Res
89:
923-929,
2001
46.
Parekh, AB,
and
Penner R.
Store depletion and calcium influx.
Physiol Rev
77:
901-930,
1997
47.
Petrov, V,
and
Lijnen P.
Inhibition of proliferation of human peripheral blood mononuclear cells by calcium antagonists: role of interleukin-2.
Methods Find Exp Clin Pharmacol
22:
19-23,
2000[Web of Science][Medline].
48.
Philipp, S,
Cavalie A,
Freichel M,
Wissenbach U,
Zimmer S,
Trost C,
Marquart A,
Murakami M,
and
Flockerzi V.
A mammalian capacitative calcium entry channel homologous to Drosophila TRP and TRPL.
EMBO J
15:
6166-6171,
1996[Web of Science][Medline].
49.
Pitt, BR,
Weng W,
Steve AR,
Blakely RD,
Reynolds I,
and
Davies P.
Serotonin increases DNA synthesis in rat proximal and distal pulmonary vascular smooth muscle cells in culture.
Am J Physiol Lung Cell Mol Physiol
266:
L178-L186,
1994
50.
Platoshyn, O,
Yu Y,
Golovina VA,
McDaniel SS,
Krick S,
Li L,
Wang JY,
Rubin LJ,
and
Yuan JXJ
Chronic hypoxia decreases Kv channel expression and function in pulmonary artery myocytes.
Am J Physiol Lung Cell Mol Physiol
280:
L801-L812,
2001
51.
Putney, JW, Jr,
Broad LM,
Braun FJ,
Lievremont JP,
and
St Bird GJ.
Mechanisms of capacitative calcium entry.
J Cell Sci
114:
2223-2229,
2001[Web of Science][Medline].
52.
Sjolund, M,
Hedin U,
Sejersen T,
Heldin CH,
and
Thyberg J.
Arterial smooth muscle cells express platelet-derived growth factor (PDGF) A-chain mRNA, secrete a PDGF-like mitogen, and bind exogenous PDGF in a phenotype- and growth state-dependent manner.
J Cell Biol
106:
403-413,
1988
53.
Shimoda, LA,
Sylvester JT,
Booth GM,
Shimoda TH,
Meeker S,
Undem BJ,
and
Sham JS.
Inhibition of voltage-gated K+ currents by endothelin-1 in human pulmonary arterial myocytes.
Am J Physiol Lung Cell Mol Physiol
281:
L1115-L1122,
2001
54.
Shimoda, LA,
Sylvester JT,
and
Sham JS.
Inhibition of voltage-gated K+ currents in rat intrapulmonary arterial myocytes by endothelin-1.
Am J Physiol Lung Cell Mol Physiol
274:
L842-L853,
1998
55.
Shimoda, LA,
Sham JS,
Shimoda TH,
and
Sylvester JT.
L-type Ca2+ channels, resting [Ca2+]i, and ET-1-induced responses in chronically hypoxic pulmonary myocytes.
Am J Physiol Lung Cell Mol Physiol
279:
L884-L894,
2000
56.
Short, AD,
Bian J,
Ghosh TK,
Waldron RT,
Rybak SL,
and
Gill DL.
Intracellular Ca2+ pool content is linked to control of cell growth.
Proc Natl Acad Sci USA
90:
4986-4990,
1993
57.
Somlyo, AP,
and
Somlyo AV.
Signal transduction and regulation in smooth muscle.
Nature
372:
231-236,
1994[Medline].
58.
Stenmark, KR,
and
Mecham RP.
Cellular and molecular mechanisms of pulmonary vascular remodeling.
Annu Rev Physiol
59:
89-144,
1997[Web of Science][Medline].
59.
Sweeney, M,
Yu Y,
Platoshyn O,
Zhang S,
McDaniel SS,
and
Yuan JX-J.
Inhibition of endogenous TRP1 decreases capacitative Ca2+ entry and attenuates pulmonary artery smooth muscle cell proliferation.
Am J Physiol Lung Cell Mol Physiol
283:
L144-L155,
2002
60.
Tanabe, Y,
Saito M,
Ueno A,
Nakamura M,
Takeishi K,
and
Nakayama K.
Mechanical stretch augments PDGF receptor-
expression and protein tyrosine phosphorylation in pulmonary artery tissue and smooth muscle cells.
Mol Cell Biochem
215:
103-113,
2000[Web of Science][Medline].
61.
Tsien, RW,
and
Tsien RY.
Calcium channels, stores, and oscillations.
Annu Rev Cell Biol
6:
715-760,
1990[Web of Science][Medline].
62.
Van Breemen, C,
and
Saida K.
Cellular mechanisms regulating [Ca2+]i in smooth muscle.
Annu Rev Physiol
51:
315-329,
1989[Web of Science][Medline].
63.
Vazquez, G,
Lievremont JP,
St Bird JG,
and
Putney JW, Jr.
Human Trp3 forms both inositol trisphosphate receptor-dependent and receptor-independent store-operated cation channels in DT40 avian B lymphocytes.
Proc Natl Acad Sci USA
98:
11777-11782,
2001
64.
Voelkel, NF,
and
Tuder RM.
Cellular and molecular mechanisms in the pathogenesis of severe pulmonary hypertension.
Eur Respir J
8:
2129-2138,
1995[Abstract].
65.
Vennekens, R,
Voets T,
Bindels RJM,
Droogmans G,
and
Nilius B.
Current understanding of mammalian TrP homologues.
Cell Calcium
31:
253-264,
2002[Web of Science][Medline].
66.
Walker, RL,
Hume JR,
and
Horowitz B.
Differential expression and alternative splicing of TRP channel genes in smooth muscles.
Am J Physiol Cell Physiol
280:
C1184-C1192,
2001
67.
Welsh, DG,
Morielli AD,
Nelson MT,
and
Brayden JE.
Transient receptor potential channels regulate myogenic tone of resistance arteries.
Circ Res
90:
248-250,
2002
68.
Wijetunge, S,
and
Hughes AD.
Effect of platelet-derived growth factor on voltage-operated calcium channels in rabbit isolated ear artery cells.
Br J Pharmacol
115:
534-538,
1995[Web of Science][Medline].
69.
Wu, X,
Barnigg G,
and
Villereal ML.
Functional significance of human trp1 and trp3 in store-operated Ca2+ entry in HEK-293 cells.
Am J Physiol Cell Physiol
278:
C526-C536,
2000
70.
Xu, SZ,
and
Beech DJ.
TrpC1 is a membrane-spanning subunit of store-operated Ca2+ channels in native vascular smooth muscle cells.
Circ Res
88:
84-87,
2001
71.
Yamboliev, IA,
and
Gerthoffer WT.
Modulatory role of ERK MAPK-caldesmon pathway in PDGF-stimulated migration of cultured pulmonary artery SMCs.
Am J Physiol Cell Physiol
280:
C1680-C1688,
2001
72.
Yuan, X-J.
Voltage-gated K+ currents regulate resting membrane potential and [Ca2+]i in pulmonary artery myocytes.
Circ Res
77:
370-378,
1995
73.
Yuan, X-J,
Goldman WF,
Tod ML,
Rubin LJ,
and
Blaustein MP.
Ionic currents in rat pulmonary and mesenteric arterial myocytes in primary culture and subculture.
Am J Physiol Lung Cell Mol Physiol
264:
L107-L115,
1993
74.
Zhang, L,
and
Saffen D.
Muscarinic acetylcholine receptor regulation of TRP6 Ca2+ channel isoforms: molecular structures and functional characterization.
J Biol Chem
276:
13331-13339,
2001
75.
Zhang, X,
Wrzeszczynska MH,
Horvath CM,
and
Darnell JE, Jr.
Interacting regions in Stat3 and c-Jun that participate in cooperative transcriptional activation.
Mol Cell Biol
19:
7138-7146,
1999
76.
Zhu, X,
Jiang M,
Peyton M,
Boulay G,
Hurst R,
Stefani E,
and
Birnbaumer L.
trp, a novel mammalian gene family essential for agonist-activated capacitative Ca2+ entry.
Cell
85:
661-671,
1996[Web of Science][Medline].
77.
Zitt, C,
Zobel A,
Obukhov AG,
Harteneck C,
Kalkbrenner F,
Luckhoff A,
and
Schultz G.
Cloning and functional expression of a human Ca2+-permeable cation channel activated by calcium store depletion.
Neuron
16:
1189-1196,
1996[Web of Science][Medline].
78.
Zweifach, A,
and
Lewis RS.
Calcium-dependent potentiation of store-operated calcium channels in T lymphocytes.
J Gen Physiol
107:
597-610,
1996
This article has been cited by other articles:
![]() |
S. G. Baryshnikov, M. V. Pulina, A. Zulian, C. I. Linde, and V. A. Golovina Orai1, a critical component of store-operated Ca2+ entry, is functionally associated with Na+/Ca2+ exchanger and plasma membrane Ca2+ pump in proliferating human arterial myocytes Am J Physiol Cell Physiol, November 1, 2009; 297(5): C1103 - C1112. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ogawa, A. L. Firth, W. Yao, M. M. Madani, K. M. Kerr, W. R. Auger, S. W. Jamieson, P. A. Thistlethwaite, and J. X.-J. Yuan Inhibition of mTOR attenuates store-operated Ca2+ entry in cells from endarterectomized tissues of patients with chronic thromboembolic pulmonary hypertension Am J Physiol Lung Cell Mol Physiol, October 1, 2009; 297(4): L666 - L676. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Syriani, G. Cuesto, E. Abad, T. Pelaez, A. Gual, J. Pintor, M. Morales, and X. Gasull Effects of Platelet-Derived Growth Factor on Aqueous Humor Dynamics Invest. Ophthalmol. Vis. Sci., August 1, 2009; 50(8): 3833 - 3839. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wang, Y. Zhang, W. G. Wier, X. Yu, M. Zhao, H. Hu, L. Sun, X. He, Y. Wang, B. Wang, et al. Role of store-operated Ca2+ entry in adenosine-induced vasodilatation of rat small mesenteric artery Am J Physiol Heart Circ Physiol, July 1, 2009; 297(1): H347 - H354. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Hamid and J. H. Newman Evidence for Inflammatory Signaling in Idiopathic Pulmonary Artery Hypertension: TRPC6 and Nuclear Factor-{kappa}B Circulation, May 5, 2009; 119(17): 2297 - 2298. [Full Text] [PDF] |
||||
![]() |
Y. Yu, S. H. Keller, C. V. Remillard, O. Safrina, A. Nicholson, S. L. Zhang, W. Jiang, N. Vangala, J. W. Landsberg, J.-Y. Wang, et al. A Functional Single-Nucleotide Polymorphism in the TRPC6 Gene Promoter Associated With Idiopathic Pulmonary Arterial Hypertension Circulation, May 5, 2009; 119(17): 2313 - 2322. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Abramowitz and L. Birnbaumer Physiology and pathophysiology of canonical transient receptor potential channels FASEB J, February 1, 2009; 23(2): 297 - 328. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ogawa, A. L. Firth, W. Yao, L. J. Rubin, and J. X.-J. Yuan Prednisolone inhibits PDGF-induced nuclear translocation of NF-{kappa}B in human pulmonary artery smooth muscle cells Am J Physiol Lung Cell Mol Physiol, October 1, 2008; 295(4): L648 - L657. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Berra-Romani, A. Mazzocco-Spezzia, M. V. Pulina, and V. A. Golovina Ca2+ handling is altered when arterial myocytes progress from a contractile to a proliferative phenotype in culture Am J Physiol Cell Physiol, September 1, 2008; 295(3): C779 - C790. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Lu, J. Wang, L. A. Shimoda, and J. T. Sylvester Differences in STIM1 and TRPC expression in proximal and distal pulmonary arterial smooth muscle are associated with differences in Ca2+ responses to hypoxia Am J Physiol Lung Cell Mol Physiol, July 1, 2008; 295(1): L104 - L113. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Zhang, H. Dong, L. J. Rubin, and J. X.-J. Yuan Upregulation of Na+/Ca2+ exchanger contributes to the enhanced Ca2+ entry in pulmonary artery smooth muscle cells from patients with idiopathic pulmonary arterial hypertension Am J Physiol Cell Physiol, June 1, 2007; 292(6): C2297 - C2305. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Zhang, H. H. Patel, F. Murray, C. V. Remillard, C. Schach, P. A. Thistlethwaite, Paul. A. Insel, and J. X.-J. Yuan Pulmonary artery smooth muscle cells from normal subjects and IPAH patients show divergent cAMP-mediated effects on TRPC expression and capacitative Ca2+ entry Am J Physiol Lung Cell Mol Physiol, May 1, 2007; 292(5): L1202 - L1210. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Schach, M. Xu, O. Platoshyn, S. H. Keller, and J. X.-J. Yuan Thiol oxidation causes pulmonary vasodilation by activating K+ channels and inhibiting store-operated Ca2+ channels Am J Physiol Lung Cell Mol Physiol, March 1, 2007; 292(3): L685 - L698. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-Z. Xu, G. Boulay, R. Flemming, and D. J. Beech E3-targeted anti-TRPC5 antibody inhibits store-operated calcium entry in freshly isolated pial arterioles Am J Physiol Heart Circ Physiol, December 1, 2006; 291(6): H2653 - H2659. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Fantozzi, O. Platoshyn, A. H. Wong, S. Zhang, C. V. Remillard, M. R. Furtado, O. V. Petrauskene, and J. X.-J. Yuan Bone morphogenetic protein-2 upregulates expression and function of voltage-gated K+ channels in human pulmonary artery smooth muscle cells Am J Physiol Lung Cell Mol Physiol, November 1, 2006; 291(5): L993 - L1004. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Tharp, B. R. Wamhoff, J. R. Turk, and D. K. Bowles Upregulation of intermediate-conductance Ca2+-activated K+ channel (IKCa1) mediates phenotypic modulation of coronary smooth muscle Am J Physiol Heart Circ Physiol, November 1, 2006; 291(5): H2493 - H2503. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. I. Said Mediators and modulators of pulmonary arterial hypertension Am J Physiol Lung Cell Mol Physiol, October 1, 2006; 291(4): L547 - L558. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. A. Ghofrani, R. Voswinckel, F. Reichenberger, N. Weissmann, R. T. Schermuly, W. Seeger, and F. Grimminger Hypoxia- and non-hypoxia-related pulmonary hypertension - Established and new therapies Cardiovasc Res, October 1, 2006; 72(1): 30 - 40. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. R. Stenmark, K. A. Fagan, and M. G. Frid Hypoxia-Induced Pulmonary Vascular Remodeling: Cellular and Molecular Mechanisms Circ. Res., September 29, 2006; 99(7): 675 - 691. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Inoue, L. J. Jensen, J. Shi, H. Morita, M. Nishida, A. Honda, and Y. Ito Transient Receptor Potential Channels in Cardiovascular Function and Disease Circ. Res., July 21, 2006; 99(2): 119 - 131. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wang, L. Weigand, W. Lu, J.T. Sylvester, G. L. Semenza, and L. A. Shimoda Hypoxia Inducible Factor 1 Mediates Hypoxia-Induced TRPC Expression and Elevated Intracellular Ca2+ in Pulmonary Arterial Smooth Muscle Cells Circ. Res., June 23, 2006; 98(12): 1528 - 1537. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-R. Yang, M.-J. Lin, L. S. McIntosh, and J. S. K. Sham Functional expression of transient receptor potential melastatin- and vanilloid-related channels in pulmonary arterial and aortic smooth muscle Am J Physiol Lung Cell Mol Physiol, June 1, 2006; 290(6): L1267 - L1276. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sours, J. Du, S. Chu, M. Ding, X. J. Zhou, and R. Ma Expression of canonical transient receptor potential (TRPC) proteins in human glomerular mesangial cells Am J Physiol Renal Physiol, June 1, 2006; 290(6): F1507 - F1515. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Estacion, W. G. Sinkins, S. W. Jones, M. A. B. Applegate, and W. P. Schilling Human TRPC6 expressed in HEK 293 cells forms non-selective cation channels with limited Ca2+ permeability J. Physiol., April 15, 2006; 572(2): 359 - 377. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. R. Wamhoff, D. K. Bowles, and G. K. Owens Excitation-Transcription Coupling in Arterial Smooth Muscle Circ. Res., April 14, 2006; 98(7): 868 - 878. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Thebault, M. Flourakis, K. Vanoverberghe, F. Vandermoere, M. Roudbaraki, V. Lehen'kyi, C. Slomianny, B. Beck, P. Mariot, J.-L. Bonnal, et al. Differential Role of Transient Receptor Potential Channels in Ca2+ Entry and Proliferation of Prostate Cancer Epithelial Cells Cancer Res., February 15, 2006; 66(4): 2038 - 2047. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Mignen, C. Brink, A. Enfissi, A. Nadkarni, T. J. Shuttleworth, D. R. Giovannucci, and T. Capiod Carboxyamidotriazole-induced inhibition of mitochondrial calcium import blocks capacitative calcium entry and cell proliferation in HEK-293 cells J. Cell Sci., December 1, 2005; 118(23): 5615 - 5623. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. E. Clapham, D. Julius, C. Montell, and G. Schultz International Union of Pharmacology. XLIX. Nomenclature and Structure-Function Relationships of Transient Receptor Potential Channels Pharmacol. Rev., December 1, 2005; 57(4): 427 - 450. [Full Text] [PDF] |
||||
![]() |
G. G. Kovacs, A. Zsembery, S. J. Anderson, P. Komlosi, G. Y. Gillespie, P. D. Bell, D. J. Benos, and C. M. Fuller Changes in intracellular Ca2+ and pH in response to thapsigargin in human glioblastoma cells and normal astrocytes Am J Physiol Cell Physiol, August 1, 2005; 289(2): C361 - C371. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wang, L. A. Shimoda, L. Weigand, W. Wang, D. Sun, and J. T. Sylvester Acute hypoxia increases intracellular [Ca2+] in pulmonary arterial smooth muscle by enhancing capacitative Ca2+ entry Am J Physiol Lung Cell Mol Physiol, June 1, 2005; 288(6): L1059 - L1069. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bergdahl, M. F. Gomez, A.-K. Wihlborg, D. Erlinge, A. Eyjolfson, S.-Z. Xu, D. J. Beech, K. Dreja, and P. Hellstrand Plasticity of TRPC expression in arterial smooth muscle: correlation with store-operated Ca2+ entry Am J Physiol Cell Physiol, April 1, 2005; 288(4): C872 - C880. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. He, G. Yao, C. Savoia, and R. M. Touyz Transient Receptor Potential Melastatin 7 Ion Channels Regulate Magnesium Homeostasis in Vascular Smooth Muscle Cells: Role of Angiotensin II Circ. Res., February 4, 2005; 96(2): 207 - 215. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Zhang, J. X.-J. Yuan, K. E. Barrett, and H. Dong Role of Na+/Ca2+ exchange in regulating cytosolic Ca2+ in cultured human pulmonary artery smooth muscle cells Am J Physiol Cell Physiol, February 1, 2005; 288(2): C245 - C252. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. H. Mauban, C. V. Remillard, and J. X.-J. Yuan Hypoxic pulmonary vasoconstriction: role of ion channels J Appl Physiol, January 1, 2005; 98(1): 415 - 420. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kunichika, J. W. Landsberg, Y. Yu, H. Kunichika, P. A. Thistlethwaite, L. J. Rubin, and J. X.-J. Yuan Bosentan Inhibits Transient Receptor Potential Channel Expression in Pulmonary Vascular Myocytes Am. J. Respir. Crit. Care Med., November 15, 2004; 170(10): 1101 - 1107. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kunichika, Y. Yu, C. V. Remillard, O. Platoshyn, S. Zhang, and J. X.-J. Yuan Overexpression of TRPC1 enhances pulmonary vasoconstriction induced by capacitative Ca2+ entry Am J Physiol Lung Cell Mol Physiol, November 1, 2004; 287(5): L962 - L969. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Zhang, C. V. Remillard, I. Fantozzi, and J. X.-J. Yuan ATP-induced mitogenesis is mediated by cyclic AMP response element-binding protein-enhanced TRPC4 expression and activity in human pulmonary artery smooth muscle cells Am J Physiol Cell Physiol, November 1, 2004; 287(5): C1192 - C1201. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Beech, K. Muraki, and R. Flemming Non-selective cationic channels of smooth muscle and the mammalian homologues of Drosophila TRP J. Physiol., September 15, 2004; 559(3): 685 - 706. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-J. Lin, G. P.H. Leung, W.-M. Zhang, X.-R. Yang, K.-P. Yip, C.-M. Tse, and J. S.K. Sham Chronic Hypoxia-Induced Upregulation of Store-Operated and Receptor-Operated Ca2+ Channels in Pulmonary Arterial Smooth Muscle Cells: A Novel Mechanism of Hypoxic Pulmonary Hypertension Circ. Res., September 3, 2004; 95(5): 496 - 505. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Landsberg and J. X.-J. Yuan Calcium and TRP Channels in Pulmonary Vascular Smooth Muscle Cell Proliferation Physiology, April 1, 2004; 19(2): 44 - 50. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wang, L. A. Shimoda, and J. T. Sylvester Capacitative calcium entry and TRPC channel proteins are expressed in rat distal pulmonary arterial smooth muscle Am J Physiol Lung Cell Mol Physiol, April 1, 2004; 286(4): L848 - L858. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. G. Babich, C.-Y. Ku, H. W.J. Young, H. Huang, M. R. Blackburn, and B. M. Sanborn Expression of Capacitative Calcium TrpC Proteins in Rat MyometriumDuring Pregnancy Biol Reprod, April 1, 2004; 70(4): 919 - 924. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Chu, Q. Tong, J. Y. Cheung, J. Wozney, K. Conrad, V. Mazack, W. Zhang, R. Stahl, D. L. Barber, and B. A. Miller Interaction of TRPC2 and TRPC6 in Erythropoietin Modulation of Calcium Influx J. Biol. Chem., March 12, 2004; 279(11): 10514 - 10522. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Fantozzi, S. Zhang, O. Platoshyn, C. V. Remillard, R. T. Cowling, and J. X.-J. Yuan Hypoxia increases AP-1 binding activity by enhancing capacitative Ca2+ entry in human pulmonary artery endothelial cells Am J Physiol Lung Cell Mol Physiol, December 1, 2003; 285(6): L1233 - L1245. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Dietrich, M. Mederos y Schnitzler, J. Emmel, H. Kalwa, T. Hofmann, and T. Gudermann N-Linked Protein Glycosylation Is a Major Determinant for Basal TRPC3 and TRPC6 Channel Activity J. Biol. Chem., November 28, 2003; 278(48): 47842 - 47852. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |