Am J Physiol Cell Physiol Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 284: C200-C208, 2003; doi:10.1152/ajpcell.00259.2002
0363-6143/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lang, K. S.
Right arrow Articles by Lang, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lang, K. S.
Right arrow Articles by Lang, F.
Vol. 284, Issue 1, C200-C208, January 2003

Inhibition of interferon-gamma expression by osmotic shrinkage of peripheral blood lymphocytes

K. S. Lang1,2, C. Weigert3, S. Braedel1, S. Fillon2, M. Palmada2, E. Schleicher3, H.-G. Rammensee1, and F. Lang2

1 Departments of Immunology, 2 Physiology, and 3 Endocrinology, University of Tübingen, D72076 Tübingen, Germany


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

A hypertonic environment, as it prevails in renal medulla or in hyperosmolar states such as hyperglycemia of diabetes mellitus, has been shown to impair the immune response, thus facilitating the development of infection. The present experiments were performed to test whether hypertonicity influences activation of T lymphocytes. To this end, peripheral blood lymphocytes (PBL) of cytomegalovirus (CMV)-positive donors were stimulated by human leukocyte antigen (HLA)-A2-restricted CMV epitope NLVPMVATV to produce interferon (IFN)-gamma at varying extracellular osmolarity. As a result, increasing extracellular osmolarity during exposure to the CMV antigen indeed decreased IFN-gamma formation. Addition of NaCl was more effective than urea. A 50% inhibition was observed at 350 mosM by addition of NaCl. The combined application of the Ca2+ ionophore ionomycin (1 µg/ml) and the phorbol ester phorbol 12-myristate 13-acetate (PMA; 5 µg/ml) stimulated IFN-gamma production, an effect again reversed by hyperosmolarity. Moreover, hyperosmolarity abrogated the stimulating effect of ionomycin (1 µg/ml) and PMA (5 µg/ml) on the transcription factors activator protein (AP)-1, nuclear factor of activated T cells (NFAT), and NF-kappa B but not Sp1. In conclusion, osmotic cell shrinkage blunts the stimulatory action of antigen exposure on IFN-gamma production, an effect explained at least partially by suppression of transcription factor activation.

cell volume; activator protein-1; nuclear factor of activated T cells; nuclear factor-kappa B; CD69


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

ANTIGEN EXPOSURE is a strong stimulator of lymphocytes that triggers a variety of events including formation of cytokines such as interferon (IFN)-gamma (7). The signaling linking antigen binding to IFN-gamma expression includes activation of protein kinase C (PKC), increase of intracellular Ca2+ activity (Ca<UP><SUB>i</SUB><SUP>2+</SUP></UP>), and activation of the transcription factors activator (AP)-1, NF-kappa B, and nuclear factor of activated T cells (NFAT) (7, 23, 29, 36, 37). These events are crucial for adequate defense against pathogens (14, 43).

The defense against pathogens is impaired at high ambient osmolarity such as in the hyperosmolar renal medulla (5, 8, 12, 15, 26). The susceptibility of the hyperosmolar kidney medulla to bacterial infection is clearly higher than that of the isosmolar renal cortex (10). Moreover, the immune response was reported to be impaired in diabetes mellitus (9), which typically leads to increase of extracellular osmolarity (9). Information on the cellular mechanisms accounting for defective immune defense in a hypertonic environment is, however, scarce. It was shown that neutrophil O<UP><SUB>2</SUB><SUP>−</SUP></UP> generation and thus bacterial killing is impaired in a hypertonic environment (12). Less is known about lymphocyte function in hypertonic extracellular fluid. Excessive extracellular hyperosmolarity (>500 mosM) is well known to trigger apoptosis (3, 4, 18, 25, 28, 33, 34). However, DNA fragmentation is not enhanced after exposure to hypertonic extracellular fluid up to 500 mosM. In fact, moderate increase of osmolarity was shown rather to protect against CD95-induced apoptotic cell death (38). Nevertheless, moderate increases of extracellular osmolarity could impede the immune response by interference with lymphocyte activation. On the other hand, hypertonic saline was shown to reverse the inhibitory effects of several cytokines (24). The present study was performed to analyze the effect of hyperosmotic environment on antigen-induced IFN-gamma production, as an indicator for lymphocyte activity. The results indeed disclose a profound inhibition of IFN-gamma expression in osmotically shrunken cells. Further experiments were performed to elucidate the cellular mechanisms involved.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cell preparation and culture conditions. Peripheral blood lymphocytes (PBL) were separated from blood by Ficoll gradient. After two washes in PBS, PBL were resuspended in RPMI 1640 supplemented with 10% fetal calf serum (FCS), pH 7.4, 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin. All experiments were performed at 37°C.

Peptide preparation. The immunodominant peptide NLVPMVATV of pp65 protein (41) from cytomegalovirus (CMV) was chosen for cell stimulation. Reaction against the peptide YLLPAIVHI (13) was considered nonspecific. Peptides were synthesized in automated peptide synthesizer 432A (Applied Biosystems, Weiterstadt, Germany) following the Fmoc/tBu strategy. Synthesis products were analyzed by HPLC (System Gold; Beckman Instruments, Munich, Germany) and MALDI-TOF mass spectrometry (G2025A; Hewlett-Packard, Waldbronn, Germany). Peptides of <80% purity were purified by preparative HPLC. Peptides were dissolved in 100% DMSO in a concentration of 10 mg/ml and further diluted to a final concentration of 1 mg/ml peptide with bidistilled H2O.

As stimulator cells, transporter associated with antigen processing (TAP)-deficient human leukocyte antigen (HLA)-A2-positive T2 cells (35) were incubated with 50 µg/ml peptide for 8 h in FCS-free culture medium. The CMV antigen NLVPMVATV is bound on the HLA-A2 molecule of T2 cells. When this major histocompatibility complex (MHC)-peptide complex is recognized by peptide-specific CD8+ T cells, they are activated and produce IFN-gamma . As a control the human peptide YLLPAIVHI was used, which similarly binds to HLA-A2 but does not lead to stimulation of PBL. At the end of peptide incubation, T2 cells were irradiated with 170 Gy (gammacell, 1000 Elite; MDS Nordion, Kanata, ON, Canada) and unbound peptide was removed by washing with RPMI 1640 containing 10% FCS.

Enzyme-linked immunospot analysis. For enzyme-linked immunospot (ELIspot) assay nitrocellulose 96-well plates (MAHA 45; Millipore, Bedford, MA) were coated with 50 µl/well anti-human IFN-gamma antibody (20 µg/ml; Biosource, Camarillo, CA) diluted in coating buffer (in mM: 35 sodium bicarbonate, 15 sodium carbonate, and 3 sodium azide). After incubation for 3 h at 37°C the unbound antibody was removed by four washing steps with PBS. Remaining protein binding sites of the nitrocellulose plates were blocked with culture medium for 1 h at 37°C. T2 cells were incubated with the antigen NLVPMVATV and the control peptide YLLPAIVHI described in Peptide preparation. The peptide-loaded T2 cells (70,000/well) were subsequently cocultured with 50,000 PBL/well in duplicate in 96-well plates under isotonic and hypertonic conditions. In a second series of experiments 20,000 PBL were cocultured in duplicate in 96-well plates under isotonic and hypertonic conditions with 1 µg/ml Ca2+ ionophore and 5 µg/ml phorbol 12-myristate 13-acetate (PMA). After 6-h incubation, the medium was replaced and cells were cultured in coated nitrocellulose plates for 6 h under different conditions. Cells were removed by washing seven times with PBS containing 0.05% Tween 20 (PBS-T). Fifty microliters of biotinylated anti-human IFN-gamma antibody (Biosource), diluted to 2 µg/ml in PBS containing 0.5% bovine serum albumin (BSA) and 0.02% sodium azide, was used for detection of bound IFN-gamma . After 3 h, unbound antibodies were removed by six washes with PBS-T and 50 µl of avidin peroxidase complex (ABC Vectastain-Elite kit; Vector Laboratories, Burlingame, CA) was added. Two hours after addition of avidin peroxidase the plate was washed three times with PBS-T and three times with PBS. In the last washing step the complete plate was submerged in PBS. Subsequently, the reaction was developed with 3-amino-9-ethylcarbazole (Sigma, St. Louis, MO). The color reaction was stopped after 5 min by rinsing with water.

Computer-assisted video image analysis was used to count spots (Carl Zeiss Vision, Hallbergmoos, Germany). Pictures of wells were digitized by the image software. Every difference of contrast was checked for several parameters such as area, saturation, shape, slope, contrast, and color. Only spots corresponding to these parameters were counted.

Intracellular IFN-gamma staining and FACS analysis. For intracellular IFN-gamma staining the Cytofix/Cytoperm kit (PharMingen, San Diego, CA) was used. After Ficoll gradient separation 106 PBL/ml were stimulated in 4.5-ml polysterol tubes (Greiner, Frickenhausen, Germany) with 1 µg/ml Ca2+ ionophore (ionomycin calcium salt; Sigma Aldrich, Taufkirchen, Germany) and 5 µg/ml PMA (Sigma Aldrich) at 37°C. To stop IFN-gamma secretion, monensin (0.7 µl/ml Golgi Stop, Cytofix/Cytoperm kit; PharMingen), an inhibitor of intracellular protein transport (31), was added. After 6-h incubation cells were washed with PBS and stained with anti-human CD3 antibody (Coulter Immunotech, Hamburg, Germany) for 30 min at 4°C. After unbound antibodies were removed, cells were fixed and permeabilized with 300 µl of Cytofix/Cytoperm solution (PharMingen) for 20 min at 4°C. Cells were washed two times with 1 ml of Perm/Wash solution (Cytofix/Cytoperm kit) and stained in 100 µl of Perm/Wash solution with PE-labeled mouse anti-human IFN-gamma antibody (PharMingen) diluted to 1.5 µg/ml. After 30 min of incubation the antibodies were removed by two washes and cells were resuspended in PBS.

For determination of apoptosis Syto16 (Molecular Probes, Leiden, Netherlands) was used, a cell-permeant fluorescent dye binding preferably intact DNA (11, 42); thus Syto16 staining allows discrimination between nonapoptotic cells with intact DNA and apoptotic cells with fragmented DNA. Cells were stained with Syto16 for 30 min at 37°C. Cells were analyzed by flow cytometric analysis (FACS-Calibur; Becton Dickinson) with logarithmic amplification.

Electrophoretic mobility shift assay. Klenow enzyme and poly(dI-dC) were from Boehringer (Mannheim, Germany); [alpha -32P]dATP was from Hartmann (Braunschweig, Germany); and antibodies were from Santa Cruz Technologies (Santa Cruz, CA): c-Jun (Santa Cruz 1694X), JunB (Santa Cruz 73X), JunD (Santa Cruz 74X), and c-Fos (Santa Cruz 253X).

Nuclear proteins were prepared as described previously (1). Synthetic oligonucleotides containing a high-affinity binding site for AP-1 (5'-GATCTGTGACTCAGCGCGAG-3'), NFAT (5'-ATTCGCCCAAAGAGGAAAATTTGTTTC-3'), NF-kappa B (5'-TACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAG-3'), and Sp1 (AGCCGGGGAGCCCGCCCCCTTTCCCCCAGGGCTG-3') were 3'-end-labeled with [alpha -32P]dATP (3,000 Ci/mM) incubating 2 U of Klenow enzyme, 100 ng of the oligonucleotide, and 0.5 mM dCTP, dGTP, and dTTP for 30 min at 37°C. Radiolabeled oligonucleotides were incubated with up to 6 µg of nuclear protein in 20 µl of 7 mM HEPES-KOH pH 7.9, 100 mM KCl, 3.6 mM MgCl2, and 10% glycerol on ice for 20 min. Poly(dI-dC) (0.05 mg/ml) was added as nonspecific competitor. The samples were run on a 5% nondenaturating polyacrylamide gel in a buffer containing (in mM) 25 Tris · HCl (pH 8.0), 190 glycine, and 1 EDTA. Gels were dried and analyzed by autoradiography. In supershift experiments 2 µg of specific antibody were incubated with the binding reaction mixture for 1 h on ice before the radiolabeled DNA fragment was added.

Semiquantitative RT-PCR. To evaluate serum- and glucocorticoid-sensitive kinase (sgk)1 mRNA expression levels, the cells were stimulated at 500 mosM for 2 h. Total RNA was isolated with the RNeasy RNA isolation kit (Qiagen, Germany, Hilders) following the manufacturer's instructions. One microgram of RNA was reverse-transcribed into cDNA with the Advantage RT-for-PCR Kit (Clontech, Palo Alto, CA). The oligonucleotides used for amplification of sgk1 and beta -actin are the following: sgk1, sense (5'GATGGGTCTGAACGACTTTA3'), antisense (5'GATTTGCTGAGAAGGACTTG3'); beta -actin, sense (5'TAAGGAGAAGCTGTGCTACG3'), antisense (5' CCAGACAGCACTGTGTTG3'). Thirteen picomoles of sgk1 primers and five picomoles of beta -actin primers were added to 50 µl of reaction containing 50 mM KCl, 10 mM Tris · HCl pH 8.4, 15 mM MgCl2, 2 mg/ml BSA, and dNTP mix (each 0.2 mM). PCR conditions were optimized so that measurements were done in the linear range of DNA amplification. The mixture was denaturated at 95°C for 2 min, followed by 34 cycles, each consisting of denaturation at 95°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 30 s. After a final extension at 72°C for 5 min, samples were kept at 4°C. PCR products were then resolved by electrophoresis in 2.5% agarose (Boehringer Ingelheim) and recorded by digital camera.

Statistics. All experiments were performed at least in triplicate. Arithmetic means ± SE of independent experiments were calculated, and statistical analysis was made by paired or unpaired t-test, where appropriate.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Osmotic cell shrinkage inhibits antigen-triggered IFN-gamma production in PBL. As reported earlier (30), stimulation of PBL leads to IFN-gamma production within 4-8 h. Therefore, the effect of hyperosmolarity on antigen stimulation and IFN-gamma secretion was tested after a 6-h exposure of PBL to antigen at different osmolarities. PBL of a HLA-A2-positive CMV-seropositive donor were stimulated with the CMV peptide NLVPMVATV of pp65 protein. After the 6-h stimulation the PBL were transferred to an antibody-coated ELIspot plate to determine IFN-gamma secretion for another 6 h. PBL reacted with 64.0 ± 3.7 (n = 4) spots per 50,000 PBL against T2 cells loaded with NLVPMVATV, whereas there was a response of 12.5 ± 8.7 (n = 4) spots per 50,000 PBL against T2 cells loaded with YLLPAIVHI (Fig. 1). PBL without T2 cells and medium alone reacted with less than five spots per well (data not shown). Stimulation at 350 mosM for 6 h decreased the spot frequency to 34.6 ± 4.8 (n = 4) spots per 50,000 PBL, whereas a 6-h stimulation at 500 mosM led to a response of 1.5 ± 0.9 (n = 4) spots against CMV peptide-loaded T2 cells (Fig. 1). Thus cells stimulated in hypertonic buffer secreted significantly less IFN-gamma than cells stimulated in isotonic buffer, even though secretion was determined in isotonic buffer irrespective of the osmolarity during stimulation. PBL stimulated with peptide under isotonic conditions showed no decrease in specific IFN-gamma spots, even when IFN-gamma secretion was determined under hypertonic conditions (Fig. 1). When PBL were stimulated in isotonic buffer, no significant difference of IFN-gamma secretion was observed between cells subsequently exposed to hypertonic buffer and those remaining in isotonic buffer (Fig. 1). Thus hyperosmolarity interfered with stimulation but not with secretion. The blunting effect of hyperosmolarity on stimulation of PBL was not the result of increased NaCl concentration. When PBL were stimulated with CMV peptide at 500 mosM by adding 200 mM raffinose, IFN-gamma production was also blunted (Fig. 1B).


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 1.   Reversal of antigen-stimulated interferon (IFN)-gamma secretion by hyperosmolarity. IFN-gamma release was determined by enzyme-linked immunospot (ELIspot) assay. Fifty thousand peripheral blood lymphocytes (PBL) were stimulated with T2 cells incubated with cytomegalovirus (CMV) peptide NLVPMVATV (closed symbols) or with T2 cells loaded with control peptide YLLPAIVHI of human p72 RNA helicase (nonstimulated; open circle ). y-Axis indicates spot count per 100,000 PBL. A: PBL were exposed to different levels of hyperosmolarity (in mosM) by addition of NaCl either during the first 6 h (stimulation; black-lozenge ) or during the second 6 h (secretion; ). IFN-gamma secretion during the second 6-h period was determined. B: inhibition of antigen-stimulated IFN-gamma secretion by hyperosmolarity (500 mosM) created by addition of raffinose instead of NaCl. Data are means ± SE; n = 4.

Combined stimulation of PKC and increase of Ca<UP><SUB>i</SUB><SUP>2<UP>+</UP></SUP></UP> stimulates IFN-gamma secretion, an effect similarly reversed by osmotic cell shrinkage. The inhibitory effect of hyperosmolarity could have been due to impaired binding of antigen or to inhibition of Ca2+ entry into the cells during activation. To circumvent these mechanisms cells were stimulated with Ca2+ ionophore (1 µg/ml) and PMA (5 µg/ml). As shown in Fig. 2, PMA and ionomycin added together stimulated IFN-gamma expression with 139.8 ± 29.8 spots per 20,000 PBL. PBL alone showed 3.5 ± 2.6 (n = 4) spots per 20,000 PBL. Stimulation at 400 mosM yielded 95.6 ± 6.9 (n = 4) spots per 20,000 cells, whereas during stimulation at 500 mosM IFN-gamma production remained completely suppressed. After stimulation at isotonic conditions and subsequent exposure to hypertonicity, IFN-gamma secretion approached 171.6 ± 7.3 (n = 4) spots per 20,000 PBL at 400 mosM and 154 ± 24.9 (n = 4) spots per 20,000 PBL at 500 mosM, both values not significantly different from those at isotonic conditions. The inhibition of IFN-gamma secretion after stimulation with PMA-ionophore in hypertonic extracellular fluid indicates that osmotic cell shrinkage must exert its inhibitory effect by inhibition of PKC or a signaling element downstream of PKC or Ca2+.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 2.   Reversal by hyperosmolarity of IFN-gamma secretion triggered by phorbol esters and Ca2+ ionophore. IFN-gamma release was determined by ELIspot assay. Twenty thousand PBL were stimulated with 5 µg/ml phorbol ester phorbol 12-myristate 13-acetate (PMA) and 1 µg/ml ionomycin (closed symbols) or left untreated (open circle ). PBL were exposed to different levels of osmolarity (in mosM) by addition of NaCl either during the first 6 h of stimulation (black-lozenge ) or during the second 6 h of secretion (). IFN-gamma secretion during the second 6-h period was determined. Data are means ± SE; n = 4.

High osmolarity also decreases intracellular IFN-gamma . Thirteen percent of all CD3+ cells (T cells) and 18% of all CD3- cells expressed IFN-gamma after stimulation with Ca2+ ionophore (1 µg/ml) and PMA (5 µg/ml) for 90 min. When cells were stimulated at 500 mosM, IFN-gamma production was completely abolished (Fig. 3). After a 3-h stimulation, 22% of CD3+ cells and 32% of CD3- cells produced IFN-gamma , which again was completely abolished at 500 mosM. After a 6-h exposure to Ca2+ ionophore (1 µg/ml) and PMA (5 µg/ml) in isotonic conditions, 94% of all T cells and 90% of CD3- cells produced IFN-gamma . At an osmolarity of 500 mosM only 12% of all T cells and 10% of CD3- cells produced IFN-gamma . As shown in Fig. 4, IFN-gamma production could be inhibited not only by addition of NaCl but also by addition of urea, which, however, was significantly less effective than isosmolar NaCl.


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 3.   Time-dependent IFN-gamma secretion triggered by phorbol esters and Ca2+ ionophore. A: original dot blots. CD3+ cells are seen in the 2 upper quadrants of each blot, and CD3- cells are seen in the 2 lower quadrants. IFN-gamma + cells are seen in the 2 right quadrants, and IFN-gamma - cells are seen in the 2 left quadrants. B: calculated values. IFN-gamma release was determined by FACS analysis. PBL were stimulated with 5 µg/ml PMA and 1 µg/ml ionomycin (closed symbols) or left unstimulated (open circle ). x-Axis indicates % of cells staining for IFN-gamma (IFN-gamma + cells); y-axis gives time after stimulation with PMA + ionomycin. Cells were exposed to PMA and ionomycin at 300 () or 500 (black-triangle) mosM.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 4.   Inhibition of IFN-gamma expression by hypertonic urea. The % of cells staining for IFN-gamma (% IFN-gamma positive) before (open circle ) and after (closed symbols) a 6-h stimulation with 5 µg/ml PMA and 1 µg/ml ionomycin is shown. Osmolarity was 300 mosM (circles) or increased by addition of urea (black-lozenge ), NaCl (), or 300 mM urea and 100 mM NaCl (black-triangle). The number of IFN-gamma + cells was determined by FACS analysis (means ± SE; n = 4).

Inhibition of IFN-gamma expression is paralleled by inhibition of CD69. CD69 is a C-type lectin used as a marker for lymphocyte activation. After a 4-h stimulation with Ca2+ ionophore (1 µg/ml) and PMA (5 µg/ml) at 300 mosM 79.5 ± 1.8% (n = 4) of all PBL expressed CD69, whereas 8.0 ± 1.1% (n = 4) of PBL expressed CD69 without stimulation. After stimulation with PMA and ionomycin at 500 mosM, only 31.3 ± 2.2% (n = 4) of all PBL expressed CD69 (Fig. 5). Similar to IFN-gamma production, CD69 production is blunted by addition of urea as well, even though urea is again significantly less effective than isosmolar NaCl (Fig. 6).


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 5.   Inhibition of CD69 expression by hypertonicity. The % of cells staining for CD69 (CD69+) before (open bars) and after (closed bars) a 6-h stimulation with 5 µg/ml PMA and 1 µg/ml ionomycin at 300 (isotonic) or 500 (hypertonic) mosM is shown. The number of CD69+ cells was determined by FACS analysis (means ± SE; n = 4).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 6.   Inhibition of CD69 expression by hypertonic urea. The % of cells staining for CD69 (% CD69 positive) before (open circle ) and after (closed symbols) a 6-h stimulation with 5 µg/ml PMA and 1 µg/ml ionomycin. Osmolarity was 300 mosM (circles) or increased by addition of urea (black-lozenge ), NaCl (), or 300 mM urea and 100 mM NaCl (black-triangle). The number of CD69+ cells was determined by FACS analysis (means ± SE; n = 4).

Influence of osmolarity on apoptotic cell death. In theory, the increase of osmolarity could have inhibited IFN-gamma production by induction of lymphocyte apoptosis (34). However, as shown in Fig. 7, an increase of extracellular osmolarity up to 500 mosM does not alter Syto16 staining, indicating that DNA fragmentation did not occur up to 500 mosM. However, as reported previously (34), an increase of extracellular osmolarity to 700 mosM induces apoptotic cell death of some 70% of the cells within 6 h (Fig. 7).


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 7.   Influence of osmolarity on apoptotic cell death in phorbol ester- and ionomycin-treated cells. Syto16 staining in FACS analysis reflecting DNA binding is shown. Syto16 staining cells after a 7-h stimulation with 5 µg/ml PMA and 1 µg/ml ionomycin at 300 (red), 500 (green), and 700 (black) mosM. A: histogram plot. B: means ± SE; n = 4.

Hyperosmolarity prevents activation of transcription factors AP-1, NFAT, and NF-kappa B. Because activation of AP-1, NFAT, and NF-kappa B proteins is implicated in the upregulation of IFN-gamma gene expression in T cells (7), we studied the activity of these transcription factors in PMA-ionomycin-stimulated cells in normo- or hyperosmolar conditions with electrophoretic mobility shift assay (EMSA). PMA-ionomycin treatment for 2 h at 300 mosM led to strong increases in DNA binding activities to AP-1, NFAT, and NF-kappa B binding sites (Fig. 8, A-C, Fig. 9, A and B). The activation of AP-1 (Fig. 8, A-C) and of NF-kappa B (Fig. 9A) was completely and the activation of NFAT (Fig. 9B) was partially inhibited by exposure to 500 mosM. Binding activities to a Sp1 binding site were not appreciably affected by PMA-ionomycin or hyperosmolarity (Fig. 9C). The binding to the AP-1 binding site was investigated in more detail. By supershift analysis, c-Fos and JunB proteins were identified as major compounds of this complex whereas antibodies against c-Jun and JunD led only to weak supershifted bands, indicating only a small amount of these proteins in the DNA-binding complex (Fig. 8D). Whereas in isotonic extracellular fluid PMA-ionomycin stimulated AP-1 binding within 1 h and even more so after 2 h, no stimulation was observed in hyperosmolar extracellular fluid (Fig. 8B). Densitometric quantification (n = 3) revealed a sevenfold induction of AP-1 binding activity after PMA-ionomycin treatment (Fig. 8D). Furthermore, the specificity of the bands indicated as AP-1, NFAT, and NF-kappa B were confirmed by competition studies with unlabeled oligonucleotides (Fig. 8D, Fig. 9, A and B). To explore whether the transcription of a gene known to be upregulated by osmotic cell shrinkage is impaired, transcripts for sgk1 (17) were determined. As shown in Fig. 9D, sgk1 transcript levels increased after osmotic cell shrinkage (Fig. 9D).


View larger version (55K):
[in this window]
[in a new window]
 
Fig. 8.   Reversal of activator protein (AP)-1 activation by hyperosmolarity. Electrophoretic mobility shift assay (EMSA) of oligonucleotide binding AP-1 in PBL treated with and without 5 µg/ml PMA and 1 µg/ml ionomycin at 300 or 500 mosM is shown. A: original EMSA of AP-1 in cells treated with PMA-ionomycin (PI) for 2 h at either 300 or 500 mosM. B: original EMSA of AP-1 in cells exposed to PMA-ionomycin for different times and at either 300 or 500 mosM. C: means ± SE (n = 3) of relative optical density of AP-1 in cells exposed to PMA-ionomycin at either 300 or 500 mosM. D: EMSA of AP-1 with 10× and 30× unlabeled oligonucleotides. Supershifts of AP-1 band under incubation with anti-c-fos, anti-Jun, anti-JunB, and anti-JunD are shown.



View larger version (48K):
[in this window]
[in a new window]
 
Fig. 9.   Reversal of NF-kappa B and nuclear factor of activated T cells (NFAT) activation but not SP1 activation or serum- and glucocorticoid-sensitive kinase (sgk)1 transcription by hyperosmolarity. EMSAs of oligonucleotides binding NF-kappa B (A), NFAT (B), and Sp1 (C) in PBL treated with and without 5 µg/ml PMA and 1 µg/ml ionomycin at 300 or 500 mosM are shown. D: RT-PCR of sgk1 and beta -actin RNA of cells exposed for 2 h to 300 or 500 mosM.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The present study reveals an inhibitory action of osmotic cell shrinkage on IFN-gamma production. As the production of CD69 is similarly impaired, an increase of extracellular osmolarity apparently has a broader effect on lymphocyte activation. The effect of hypertonic NaCl is mimicked by hypertonic urea even though the effect of urea is significantly smaller than the effect of NaCl at similar osmolarities. Urea may shrink cells even after rapid entry and dissipation of the gradient across the cell membrane, and it has been suggested that urea alters the set point of cell volume regulation by interference with intracellular protein stability (for review see Ref. 16). Nevertheless, the possibility remains that increase of osmolarity or NaCl or urea concentrations rather than cell volume as such interfere with lymphocyte activation.

In theory, the inhibitory effect of hyperosmolarity could have been secondary to apoptotic cell death (3, 4, 19, 25, 28, 33, 34). However, in agreement with previous reports (38), an increase of osmolarity to 500 mosM did not induce apoptosis but only an increase to 700 mosM led to the expected triggering of apoptotic cell death.

The impaired formation of IFN-gamma could further be due to inhibition of protein synthesis. Osmotic shrinkage of hepatocytes has indeed been shown to inhibit protein synthesis (16). However, increase of osmolarity after exposure to the antigen does not significantly alter IFN-gamma production, indicating that once the cell is triggered the machinery toward IFN-gamma production remains largely insensitive to alterations of osmolarity. Moreover, osmotic cell shrinkage stimulates the expression of TNF-alpha (20). Thus the influence of ambient osmolarity on lymphocyte cytokine expression is not uniform.

The activation of lymphocytes on antigen binding involves PKC (23, 29) and increase of Ca<UP><SUB>i</SUB><SUP>2+</SUP></UP> (7, 22), which in turn are known to be sensitive to alterations of cell volume (16, 27). The stimulation of IFN-gamma production by combined stimulation of PKC by phorbol esters and increase of Ca<UP><SUB>i</SUB><SUP>2+</SUP></UP> by addition of Ca2+ ionophore are similarly blunted by osmotic cell shrinkage. Exposure to hyperosmolarity rather activates PKC (21, 44). Thus the inhibitory action must be due to inhibition of a signaling element downstream of PKC or Ca2+.

Among the downstream events of lymphocyte activation by antigen or Ca2+ are the activation of transcription factors such as AP-1 (7), NF-kappa B (36), and NFAT (22, 36). Therefore, the sensitivity of transcription factor activation has been tested. Indeed, activation of AP-1 and NF-kappa B is completely abolished and activation of NFAT blunted by exposure of the cells to 500 mosM, at least contributing to the inhibition of lymphocyte activation and subsequent IFN-gamma and CD69 production. The constancy of SP1 binding demonstrates that the inhibition of the transcription factors AP-1, NFAT, and NF-kappa B is not a general phenomenon uniformly affecting all transcription factors. Moreover, hyperosmolarity increases the transcript levels of the serum- and glucocorticoid-sensitive kinase sgk1, which was shown previously to be upregulated by cell shrinkage (2, 39, 40). Osmotic cell shrinkage is known to trigger the expression of a variety of further proteins (6, 16). Interestingly, IFN-gamma downregulates Na+/H+ exchanger (NHE)2 and NHE3 (32). Thus the downregulation of IFN-gamma expression during osmotic cell shrinkage may facilitate enhanced Na+/H+ exchanger activity, a major volume-regulating mechanism in shrunken cells.

The impaired activation of AP-1, NFAT, and NF-kappa B leading to blunted formation of IFN-gamma and CD69 should severely impede the immune response against pathogens in kidney medulla. As significant effects are observed even at moderately increased osmolarity, blunted IFN-gamma and CD69 production may contribute to the impaired immune response in hyperosmolar states such as hyperglycemia of diabetes mellitus. Along those lines, evidence for lymphocyte cell shrinkage and subsequently impaired immune response in diabetes mellitus was presented previously (9, 18). Moreover, the cell volume-sensitive (2, 39, 40) kinase sgk1 (17) is upregulated in diabetes mellitus (18).

In conclusion, osmotic cell shrinkage inhibits the activation of the transcription factors AP-1, NFAT, and NF-kappa B, leading to a decrease of antigen-induced IFN-gamma production. These effects may lead to an impaired immune response in renal medulla on the one hand and in hyperosmolar states such as diabetic hyperglycemia on the other.


    ACKNOWLEDGEMENTS

The authors acknowledge the technical assistance of E. Faber and the meticulous preparation of the manuscript by Tanja Loch.


    FOOTNOTES

This study was supported by the Deutsche Forschungsgemeinschaft (La 315/4-3 and La 315/6-1) and the Bundesministerium für Bildung, Wissenschaft, Forschung und Technologie (Center for Interdisciplinary Clinical Research; 01 KS 9602).

Address for reprint requests and other correspondence: F. Lang, Physiologisches Institut der Universität Tübingen, Gmelinstr. 5, D72076 Tübingen, Germany (E-mail: florian.lang{at}uni-tuebingen.de).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

10.1152/ajpcell.00259.2002

Received 3 June 2002; accepted in final form 26 August 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1.   Andrews, NC, and Faller DV. A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells (Abstract). Nucleic Acids Res 19: 2499, 1991[Free Full Text].

2.   Bell, LM, Leong ML, Kim B, Wang E, Park J, Hemmings BA, and Firestone GL. Hyperosmotic stress stimulates promoter activity and regulates cellular utilization of the serum- and glucocorticoid-inducible protein kinase (Sgk) by a p38 MAPK-dependent pathway. J Biol Chem 275: 25262-25272, 2000[Abstract/Free Full Text].

3.   Bortner, CD, and Cidlowski JA. A necessary role for cell shrinkage in apoptosis. Biochem Pharmacol 56: 1549-1559, 1998[Web of Science][Medline].

4.   Bortner, CD, and Cidlowski JA. Caspase independent/dependent regulation of K+, cell shrinkage, and mitochondrial membrane potential during lymphocyte apoptosis. J Biol Chem 274: 21953-21962, 1999[Abstract/Free Full Text].

5.   Bryant, RE, Sutcliffe MC, and McGee ZA. Effect of osmolalities comparable to those of the renal medulla on function of human polymorphonuclear leukocytes. J Infect Dis 126: 1-10, 1972[Web of Science][Medline].

6.   Burg, MB, Kwon ED, and Kultz D. Osmotic regulation of gene expression. FASEB J 10: 1598-1606, 1996[Abstract].

7.   Cantrell, DA. T cell antigen receptor signal transduction pathways. Cancer Surv 27: 165-175, 1996[Web of Science][Medline].

8.   Chernew, I. Depression of phagocytosis by solutes in concentrations found in the kidney and urine. J Clin Invest 41: 1945-1953, 1962[Web of Science][Medline].

9.   Demerdash, TM, Seyrek N, Smogorzewski M, Marcinkowski W, Nasser-Moadelli S, and Massry SG. Pathways through which glucose induces a rise in [Ca2+]i of polymorphonuclear leukocytes of rats. Kidney Int 50: 2032-2040, 1996[Web of Science][Medline].

10.   Freedman, L, and Beeson P. Experimental pyelonephritis. IV. Observation on infection resulting from direct inoculation of bacteria in different zones of the kidney. Yale J Biol Med 30: 406-414, 1958[Medline].

11.   Frey, T. Nucleic acid dyes for detection of apoptosis in live cells. Cytometry 21: 265-274, 1995[Web of Science][Medline].

12.   Hampton, MB, Chambers ST, Vissers MC, and Winterbourn CC. Bacterial killing by neutrophils in hypertonic environments. J Infect Dis 169: 839-846, 1994[Web of Science][Medline].

13.   Hunt, DF, Henderson RA, Shabanowitz J, Sakaguchi K, Michel H, Sevilir N, Cox AL, Appella E, and Engelhard VH. Characterization of peptides bound to the class I MHC molecule HLA-A2.1 by mass spectrometry. Science 255: 1261-1263, 1992[Abstract/Free Full Text].

14.   Lamhamedi, S, Jouanguy E, Altare F, Roesler J, and Casanova JL. Interferon-gamma receptor deficiency: relationship between genotype, environment, and phenotype. Int J Mol Med 1: 415-418, 1998[Web of Science][Medline].

15.   Lancaster, MG, and Allison F, Jr. Studies on the pathogenesis of acute inflammation. VII. The influence of osmolality upon the phagocytic and clumping activity by human leukocytes. Am J Pathol 49: 1185-1200, 1966[Web of Science][Medline].

16.   Lang, F, Busch GL, Ritter M, Volkl H, Waldegger S, Gulbins E, and Haussinger D. Functional significance of cell volume regulatory mechanisms. Physiol Rev 78: 247-306, 1998[Abstract/Free Full Text].

17.   Lang, F, and Cohen P. Regulation and physiological roles of serum- and glucocorticoid-induced protein kinase isoforms. SciSTKE 2001: RE17, 2001.

18.   Lang, F, Klingel K, Wagner CA, Stegen C, Warntges S, Friedrich B, Lanzendorfer M, Melzig J, Moschen I, Steuer S, Waldegger S, Sauter M, Paulmichl M, Gerke V, Risler T, Gamba G, Capasso G, Kandolf R, Hebert SC, Massry SG, and Broer S. Deranged transcriptional regulation of cell-volume-sensitive kinase hSGK in diabetic nephropathy. Proc Natl Acad Sci USA 97: 8157-8162, 2000[Abstract/Free Full Text].

19.   Lang, F, Ritter M, Gamper N, Huber S, Fillon S, Tanneur V, Lepple-Wienhues A, Szabo I, and Gulbins E. Cell volume in the regulation of cell proliferation and apoptotic cell death. Cell Physiol Biochem 10: 417-428, 2000[Web of Science][Medline].

20.   Lang, KS, Fillon S, Schneider D, Rammensee HG, and Lang F. Stimulation of TNF alpha expression by hyperosmotic stress. Pflügers Arch 443: 798-803, 2002[Web of Science][Medline].

21.   Larsen, AK, Jensen BS, and Hoffmann EK. Activation of protein kinase C during cell volume regulation in Ehrlich mouse ascites tumor cells. Biochim Biophys Acta 1222: 477-482, 1994[Medline].

22.   Lepple-Wienhues, A, Belka C, Laun T, Jekle A, Walter B, Wieland U, Welz M, Heil L, Kun J, Busch G, Weller M, Bamberg M, Gulbins E, and Lang F. Stimulation of CD95 (Fas) blocks T lymphocyte calcium channels through sphingomyelinase and sphingolipids. Proc Natl Acad Sci USA 96: 13795-13800, 1999[Abstract/Free Full Text].

23.   Li, YQ, Kobayashi M, Yuan L, Wang J, Matsushita K, Hamada JI, Kimura K, Yagita H, Okumura K, and Hosokawa M. Protein kinase C mediates the signal for interferon-gamma mRNA expression in cytotoxic T cells after their adhesion to laminin. Immunology 93: 455-461, 1998[Web of Science][Medline].

24.   Loomis, WH, Namiki S, Hoyt DB, and Junger WG. Hypertonicity rescues T cells from suppression by trauma-induced anti-inflammatory mediators. Am J Physiol Cell Physiol 281: C840-C848, 2001[Abstract/Free Full Text].

25.   Maeno, E, Ishizaki Y, Kanaseki T, Hazama A, and Okada Y. Normotonic cell shrinkage because of disordered volume regulation is an early prerequisite to apoptosis. Proc Natl Acad Sci USA 97: 9487-9492, 2000[Abstract/Free Full Text].

26.   Matsumoto, T, Kumazawa J, and van der Auwera P. Suppression of leukocyte function and intracellular content of ATP in hyperosmotic condition comparable to the renal medulla. J Urol 142: 399-402, 1989[Web of Science][Medline].

27.   McCarty, NA, and O'Neil RG. Calcium signaling in cell volume regulation. Physiol Rev 72: 1037-1061, 1992[Abstract/Free Full Text].

28.   Michea, L, Ferguson DR, Peters EM, Andrews PM, Kirby MR, and Burg MB. Cell cycle delay and apoptosis are induced by high salt and urea in renal medullary cells. Am J Physiol Renal Physiol 278: F209-F218, 2000[Abstract/Free Full Text].

29.   Pang, Y, Norihisa Y, Benjamin D, Kantor RR, and Young HA. Interferon-gamma gene expression in human B-cell lines: induction by interleukin-2, protein kinase C activators, and possible effect of hypomethylation on gene regulation. Blood 80: 724-732, 1992[Abstract/Free Full Text].

30.   Picker, LJ, Singh MK, Zdraveski Z, Treer JR, Waldrop SL, Bergstresser PR, and Maino VC. Direct demonstration of cytokine synthesis heterogeneity among human memory/effector T cells by flow cytometry. Blood 86: 1408-1419, 1995[Abstract/Free Full Text].

31.   Prussin, C, and Metcalfe DD. Detection of intracytoplasmic cytokine using flow cytometry and directly conjugated anti-cytokine antibodies. J Immunol Methods 188: 117-128, 1995[Web of Science][Medline].

32.   Rocha, F, Musch MW, Lishanskiy L, Bookstein C, Sugi K, Xie Y, and Chang EB. IFN-gamma downregulates expression of Na+/H+ exchangers NHE2 and NHE3 in rat intestine and human Caco-2/bbe cells. Am J Physiol Cell Physiol 280: C1224-C1232, 2001[Abstract/Free Full Text].

33.   Roger, F, Martin PY, Rousselot M, Favre H, and Feraille E. Cell shrinkage triggers the activation of mitogen-activated protein kinases by hypertonicity in the rat kidney medullary thick ascending limb of the Henle's loop. Requirement of p38 kinase for the regulatory volume increase response. J Biol Chem 274: 34103-34110, 1999[Abstract/Free Full Text].

34.   Rosette, C, and Karin M. Ultraviolet light and osmotic stress: activation of the JNK cascade through multiple growth factor and cytokine receptors. Science 274: 1194-1197, 1996[Abstract/Free Full Text].

35.   Salcedo, M, Momburg F, Hammerling GJ, and Ljunggren HG. Resistance to natural killer cell lysis conferred by TAP1/2 genes in human antigen-processing mutant cells. J Immunol 152: 1702-1708, 1994[Abstract].

36.   Sica, A, Dorman L, Viggiano V, Cippitelli M, Ghosh P, Rice N, and Young HA. Interaction of NF-kappaB and NFAT with the interferon-gamma promoter. J Biol Chem 272: 30412-30420, 1997[Abstract/Free Full Text].

37.   Sweetser, MT, Hoey T, Sun YL, Weaver WM, Price GA, and Wilson CB. The roles of nuclear factor of activated T cells and ying-yang 1 in activation-induced expression of the interferon-gamma promoter in T cells. J Biol Chem 273: 34775-34783, 1998[Abstract/Free Full Text].

38.   Uhlemann, AC, Muller C, Madlung J, Gulbins E, and Lang F. Inhibition of CD95/Fas-induced DNA degradation by osmotic cell shrinkage. Cell Physiol Biochem 10: 219-228, 2000[Web of Science][Medline].

39.   Waldegger, S, Barth P, Raber G, and Lang F. Cloning and characterization of a putative human serine/threonine protein kinase transcriptionally modified during anisotonic and isotonic alterations of cell volume. Proc Natl Acad Sci USA 94: 4440-4445, 1997[Abstract/Free Full Text].

40.   Waldegger, S, Gabrysch S, Barth P, Fillon S, and Lang F. h-sgk Serine-threonine protein kinase as transcriptional target of p38/MAP kinase pathway in HepG2 human hepatoma cells. Cell Physiol Biochem 10: 203-208, 2000[Web of Science][Medline].

41.   Wills, MR, Carmichael AJ, Mynard K, Jin X, Weekes MP, Plachter B, and Sissons JG. The human cytotoxic T-lymphocyte (CTL) response to cytomegalovirus is dominated by structural protein pp65: frequency, specificity, and T-cell receptor usage of pp65-specific CTL. J Virol 70: 7569-7579, 1996[Abstract].

42.   Yagi, Y, Shiono H, Kurabayashi N, Yoshihara K, and Chikayama Y. Flow cytometry to evaluate Theileria sergenti parasitemia using the fluorescent nucleic acid stain, SYTO16. Cytometry 41: 223-225, 2000[Web of Science][Medline].

43.   Yang, YG. The role of interleukin-12 and interferon-gamma in GVHD and GVL. Cytokines Cell Mol Ther 6: 41-46, 2000[Web of Science][Medline].

44.   Zhuang, S, Hirai SI, and Ohno S. Hyperosmolality induces activation of cPKC and nPKC, a requirement for ERK1/2 activation in NIH/3T3 cells. Am J Physiol Cell Physiol 278: C102-C109, 2000[Abstract/Free Full Text].


Am J Physiol Cell Physiol 284(1):C200-C208
0363-6143/03 $5.00 Copyright © 2003 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
K. S. Lang, S. Myssina, P. A. Lang, V. Tanneur, D. S. Kempe, A. F. Mack, S. M. Huber, T. Wieder, F. Lang, and C. Duranton
Inhibition of erythrocyte phosphatidylserine exposure by urea and Cl-
Am J Physiol Renal Physiol, June 1, 2004; 286(6): F1046 - F1053.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lang, K. S.
Right arrow Articles by Lang, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lang, K. S.
Right arrow Articles by Lang, F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online