|
|
||||||||
Departments of 1 Physiology and Biophysics and 2 Orthopaedics, College of Medicine, University of California, Irvine, California 92697
| |
ABSTRACT |
|---|
|
|
|---|
Irradiation of rat skeletal muscles before increased loading has been shown to prevent compensatory hypertrophy for periods of up to 4 wk, possibly by preventing satellite cells from proliferating and providing new myonuclei. Recent work suggested that stem cell populations exist that might allow irradiated muscles to eventually hypertrophy over time. We report that irradiation essentially prevented hypertrophy in rat muscles subjected to 3 mo of functional overload (OL-Ir). The time course and magnitude of changes in cellular and molecular markers of anabolic and myogenic responses were similar in the OL-Ir and the contralateral nonirradiated, overloaded (OL) muscles for the first 3-7 days. These markers then returned to control levels in OL-Ir muscles while remaining elevated in OL muscles. The number of myonuclei and amount of DNA were increased markedly in OL but not OL-Ir muscles. Thus it appears that stem cells were not added to the irradiated muscles in this time period. These data are consistent with the theory that the addition of new myonuclei may be required for compensatory hypertrophy in the rat.
myonuclei; satellite cell
| |
INTRODUCTION |
|---|
|
|
|---|
MATURE MAMMALIAN SKELETAL muscle cells are multinucleated myofibers that are formed via the fusion of individual myoblast cells during development. Evidence suggests that these multinucleated myofibers are permanently differentiated and therefore incapable of mitotic activity (8, 21, 54). During muscle regeneration after injury, myofibers can be repaired and/or replaced via the fusion of muscle stem cells (satellite cells) either with existing damaged myofibers or with each other to form new myofibers (43, 48, 49).
The impetus for much of the current interest in the role of satellite cells in muscle adaptation has its roots in the muscle regeneration literature. The results from a number of studies using muscle injury models indicated that relatively modest doses of radiation, well below the threshold of those required to induce overt cellular injury in vivo, interfered with the regeneration of skeletal muscle (see, e.g., Refs. 15, 25, 32). Because there is an absence of overt cellular damage, it was postulated that the failure of myofibers to regenerate resulted from damage to DNA that prevents satellite cell proliferation. It would follow then that mature, permanently differentiated mammalian myofibers would not appear to be the locus of the radiation-induced mitotic failure (8, 54). Thus the inhibitory effects of radiation on muscle regeneration were proposed to be a result of the incapacitation of satellite cell mitotic activity.
The theory that radiation-induced inhibition of cellular proliferation can inhibit mammalian muscle adaptation and repair has recently been extended to include the prevention of compensatory muscle hypertrophy after increased loading. In support of this theory, a number of studies have demonstrated that the muscle hypertrophy process appears to involve the addition of nuclei to existing myofibers (see, e.g., Refs. 44-46, 51) and that prior irradiation can prevent this adaptation (35, 38-41). For example, a series of papers published by Rosenblatt et al. (39-41) showed that, in response to functional overload, irradiated myofibers do not hypertrophy or increase their myonuclear number but do alter their myosin heavy chain (MHC) isoform profile from a faster to a slower phenotype. These results suggest that the irradiated myofibers adapt in a manner similar to that of nonirradiated myofibers with regard to the qualitative expression of contractile protein isoforms but are unable to increase the quantity of protein accumulated in the myofibers. Similarly, Phelan and Gonyea (35) found that after 4 wk of overload, muscle hypertrophy was absent and cell proliferation was significantly less in irradiated vs. control muscles. In addition to the inhibition of either regeneration or hypertrophy, it has also been reported that irradiation prevents the recovery of muscle mass from unloading-induced atrophy in mice (27). In avian muscles, irradiation appears to prevent stretch-induced cellular proliferation, but only a relatively small proportion of the hypertrophy response is affected (26).
Recent reports indicated that there are stem cell populations within skeletal muscle that appear to be resistant to radiation-induced damage (20). In addition, there are data to indicate that stem cells from extramuscular tissues can be incorporated into skeletal muscles, and once there they function as muscle stem cells (12). These results suggest that a pool of mitotically competent stem cells could be available for the eventual restoration of the compensatory hypertrophy response in muscles that have been previously irradiated.
The finding that hypertrophy of mammalian skeletal muscle may require the incorporation of stem cells gives rise to some important hypotheses: 1) the number of myonuclei present in a muscle fiber is a limiting factor for protein production, indicating that there is not a significant reserve capacity for growth processes dependent on nuclear functions; and 2) over the time periods studied to date (i.e., up to 4 wk), muscles do not have a source of stem cells other than that which is present in the muscle domain at the time of irradiation.
Therefore, the current study was designed to address portions of these two hypotheses. First we hypothesized that it should be possible to detect and evaluate adaptive responses that involve nuclear function, such as increased RNA levels, generated within myofibers in overloaded-irradiated muscles. Second, we postulated that previous studies may not have allowed sufficient time for either an intrinsic radiation-resistant population of satellite cells or an extramuscular stem cell source to contribute to the development of compensatory hypertrophy. Accordingly, a study was performed with the functional overload model, in which the plantaris muscles were bilaterally overloaded and one leg was then exposed to irradiation while the rest of the animal was protected from the radiation dose. The muscles from subgroups of these rats were studied at specific time points spanning a period of 90 days after treatment.
| |
METHODS |
|---|
|
|
|---|
Forty-eight female Sprague-Dawley rats (212 ± 3 g
body wt) were randomly assigned to one of eight groups
(n = 6 per group) for the primary experiments in this
study. All procedures were approved by the University of California,
Irvine, Institutional Animal Care and Use Committee. In six of these
groups one leg was exposed to
-radiation as follows.
Treatment. In the six groups chosen for treatment, the left hindlimb of the animals was exposed to 25-Gy (2.5 Gy/min) ionizing irradiation with a Mark I irradiator (model 68, J. L. Shepard and Associates, Glendale, CA). The exact dose of irradiation was determined with Fricke dosimetry solution. Irradiation was focused onto the hindlimb of each animal with a collimator, thus allowing the irradiation to be focused onto the hindlimb musculature without exposing the rest of the body. After induction of anesthesia (40 mg/kg ketamine-2 mg/kg acepromazine), the animal was positioned such that the left hindlimb was aligned with the slit of the collimator. Immediately after the irradiation procedure, rats had the plantaris muscles of both legs overloaded via the removal of the gastrocnemius and soleus muscles as described previously (6).
Tissue collection. Groups of rats were killed by injection of Pentosol (Med-Pharmex) at 6 and 24 h and at 3, 7, 15, and 90 days after the irradiation procedure. Two groups of untreated rats were used as controls and were killed at the beginning of the study (t = 0) and the end of the 90-day period. On the basis of the results seen in the primary study, additional groups of six rats each were used in a follow-up study to determine whether measurable hypertrophy developed after 4 mo of functional overload.
At the appropriate time point the plantaris muscles of the irradiated and contralateral legs were dissected free of connective tissue, weighed, and snap frozen. Muscles were stored at
80°C for
subsequent analysis.
Biochemical and molecular analyses. Tissue samples were analyzed for total DNA and protein content as described previously (1). Myofibrillar protein content was determined via modification of the method described by Solaro et al. (52; see Ref. 57).
Total RNA isolation.
Measurements of total RNA content provide insights on the translational
capacity of tissue. Total RNA was extracted from preweighed frozen
muscle samples with the TRI reagent (Molecular Research Center,
Cincinnati, OH) according to the company's protocol, which is based on
the method described by Chomczynski and Sacchi (9). Extracted RNA was precipitated from the aqueous phase with isopropanol and, after washing with ethanol, dried and suspended in a known volume
of nuclease-free water. The RNA concentration was determined by optical
density at 260 nm (using an OD260 unit equivalent to 40 µg/ml). The muscle total RNA concentration was calculated based on
total RNA yield and the weight of the analyzed sample. The RNA samples
were stored frozen at
80°C to be used subsequently in determining
both total mRNA (poly A) and specific mRNA expression with slot
blotting and relative reverse transcription (RT)-polymerase chain
reaction (PCR) procedures.
RNA slot blotting.
RNA slot blotting techniques were used to elucidate the contribution of
various fractions of RNA to the changes seen in response to treatments.
In the current study this analysis was aimed at measuring the total
amount of mRNA as well as two markers of contractile protein message.
One microgram of total RNA was denatured in twenty microliters of
denaturing buffer (18% formaldehyde, 10× SSC) at 60°C for 15 min.
Samples were brought up to 100-µl volume with 6× SSC and were
applied onto a positively charged nylon membrane (GeneScreen plus; NEN)
with a slot blot apparatus (Schleicher and Schuell). Two blot series
were performed for each sample. After UV fixation, each membrane was
hybridized consecutively with 1) either an antisense
-skeletal actin mRNA probe to determine
-skeletal actin mRNA
expression or an antisense MHC mRNA probe common to all MHC;
2) an oligo dT probe (12- to 18-mer; Life Technology) that
was used to detect poly A RNA (total mRNA population); and 3) an antisense 18S ribosomal RNA probe. The signal of this
probe is directly proportional to the amount of total RNA and thus was used to normalize for possible variability in the amount of loaded RNA
per slot. Probes were 5' end-labeled with 32P with
-ATP
and T4 polynucleotide kinase. Hybridization and washing procedures were
carried out as described previously (17). Hybridization signals were detected and analyzed with a phosphorimager and Image Quant analysis software (Molecular Dynamics). The slot blot
hybridization signal for these probes was strongly correlated with the
amount of loaded total RNA, ranging from 0.25 to 2 µg per slot. For
each sample, the MHC mRNA, actin mRNA, and dT (poly A) signals were normalized to the corresponding 18S signal. The mRNA per muscle as
reported for MHC and
-skeletal actin mRNA was based on the total RNA
content per muscle and the mRNA ratio to 18S.
-skeletal actin antisense probe: GGCTGGCTTTAATGCTTCAAGT (based on reported actin mRNA sequence; GenBank accession no. V01224);
MHC antisense probe (common to all rat MHC): TGGTGTCCTGCTCCTTCTT (based
on type I MHC mRNA sequence position 5306-5324; GenBank accession
no. NM017239; complementary to coding region ~500 nt upstream from
stop codon and 100% identical in all MHC isoforms including adult and
developmental; signal obtained with this common MHC probe is indicative
of total population of MHC mRNA expressed in muscle); 18S rRNA
antisense probe: GTGCAGCCCCGGACATCTAAG (based on rat ribosomal RNA
sequence; GenBank accession no. M11188).
Reverse transcription.
One microgram of total RNA was reverse transcribed for each muscle
sample with SuperScript II RT from GIBCO-BRL and a mix of oligo dT (100 ng/reaction) and random primers (200 ng/reaction) in a 20-µl total
reaction volume at 45°C for 50 min, according to the provided
protocol. At the end of the RT reaction, the tubes were heated at
90°C for 5 min to stop the reaction and then were stored at
80°C
until used in the PCR for specific mRNA analyses.
Polymerase chain reaction.
A relative RT-PCR method using 18S as an internal standard (Ambion,
Austin, TX) was applied to study the expression of specific mRNAs for
IGF-I, IGF-I receptor, IGF binding proteins (BP-4 and BP-5), myogenin,
cyclin D1, and p21. The sequences for the various primers used for the
specific target mRNAs are shown in Table 1. These primers were designed with the
Primer Select computer program (DNA Star), purchased from Life
Technology GIBCO, and were tested for their compatibility with the
alternate 18S primers. It should be noted that for IGF BP-4, the
primers' sequence is based on the mouse X76066 sequence. These mouse
primers were selected on the basis of regions that are highly similar
to the human IGF BP-4 cDNA, and they proved to be effective with rat
mRNA. In each PCR reaction, 18S ribosomal RNA was coamplified with the
target cDNA (mRNA) to serve as an internal standard and to allow
correction for differences in starting amounts of total RNA.
|
Phosphorylation state of intracellular signaling proteins.
The phosphorylation states of the p70-S6 kinase (S6K1) and
extracellular signal-regulated kinases 1 and 2 (ERK1/2) were examined by immunoblotting with phosphospecific antibodies (Cell Signaling Technology, Beverly, MA). The antibodies used detected changes in
phosphorylation at sites critical for increased activity in vivo
(22, 60). Muscle samples were extracted by homogenization in 7 vols of ice-cold buffer A [50 mM Tris · HCl,
pH 7.8, 2 mM potassium phosphate, 2 mM EDTA, 2 mM EGTA, 50 mM
-glycerophosphate, 10% glycerol, 1% Triton X-100, 1 mM DTT, 3 mM
benzamidine, 1 mM sodium orthovanadate, 10 µM leupeptin, 5 µg/ml
aprotinin, 200 µg/ml soybean trypsin inhibitor, and 1 mM
4-(2-aminoethyl)benzenesulfonyl fluoride (AEBSF)] with a
motor-driven glass pestle. The homogenate was immediately centrifuged
at 12,000 g for 30 min at 4°C. The supernatant was
immediately saved in aliquots at
80°C for subsequent use in
immunoblotting. The supernatant protein concentration was determined by
using the Bio-Rad protein assay with BSA as the standard. Approximately
50 µg of supernatant proteins were subjected to sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE; 12.5% T),
according to a standard protocol (24), and then
electrophoretically transferred to a polyvinylidene difluoride (PVDF)
membrane (Immobilon-P) with 10% methanol, 1 mM orthovanadate, 25 mM
Tris, and 193 mM glycine, pH 8.3. Phospho-ERK1/2 and phospho-S6K1 were
detected with phosphorylation state-specific antibodies (Cell Signaling Technology) and an enhanced chemiluminescence (ECL) method of detection
(Amersham). Signal intensity was determined by laser scanning
densitometry (Image Quant; Molecular Dynamics). For each specific
antibody, all the samples were run under identical (previously optimized) conditions, including the transfer on the membrane, the
reaction with the first and secondary antibodies, washing conditions,
ECL detection, and the film exposure. To ensure the consistency of this
analysis, at least one representative sample from each group was
included in each gel run and Western blot analysis. In addition, a
positive control, provided by the antibody supplier, was run on each
gel to allow for normalization. For each set of Western blotting and
detection conditions, the detected signal was directly proportional to
the amount of protein loaded on the gel over a 20- to 150-µg range
(data not shown).
Confocal microscopy for determination of cell volumes and
myonuclei number.
At the time of death, an ~5-mm segment was taken from the midbelly of
each muscle and frozen in isopentane that was cooled by liquid
nitrogen. Subsequently, the muscle sample was thawed as described by
Allen et al. (4), and single fibers segments (n
10 fiber segments/muscle) were isolated by placing the muscle sample in
a small dissection chamber containing a glycerol-relaxing solution
(50% glycerol, 2 mM EGTA, 1 mM MgCl2, 4 mM ATP, 10 mM imidazole, 100 mM KCl, pH 7.0). Dissection was performed with a
microscope (Technival 2, Jena, Germany) with back lighting and microsurgical forceps (super fine Dumont tweezers; Biomedical Research
Instruments, Rockville, MD). Isolated fiber segments were placed into a
PBS solution containing Hoechst 33258, a DNA binding agent that
acquires specific excitation/emission spectrum properties on DNA
binding and thus can be used to image the nuclei with fluorescence
microscopy (Molecular Probes, Eugene, OR). The fiber segment was then
washed several times in PBS and then placed into a PBS solution
containing BODIPY-labeled phallicidin (Biomolecular Probes).
Phallicidin binds selectively to actin and serves as a tool for
identifying the dimensions of the fiber. After these labeling
procedures, the fiber segment was washed in PBS and mounted on a glass
slide with glycerol. The coverslip had struts to prevent compression of
the muscle fiber segment when it was mounted. The volume of a muscle
fiber segment, its length, and the corresponding number of myonuclei
were determined with a MRC 600 Bio-Rad laser scanning confocal
microscope and a magnification of ×400. The images were then
reconstructed and rendered with Advanced Visualization Software version
6.0 (AVS; Waltham, MA). By using the volume integration module of AVS,
it was possible to determine the volume of the single-fiber segment.
This approach allows the expression of myonuclei distribution relative
to length (nuclei/mm) and volume (µm3/nuclei). All
measurements of muscle fiber segment length and volume were normalized
to a sarcomere length of 2.5 µm. This sarcomere length was chosen
because this was the value observed by us in other studies in our
laboratories examining the architecture of the plantaris muscle
(unpublished observations; n
24,000 measurements of
sarcomere length).
MHC isoform analysis.
A portion of each muscle sample was homogenized in a solution that
contained (in mM) 250 sucrose, 100 KCl, 5 EDTA, and 10 Tris-base. The
homogenate protein was diluted to 1 mg/ml in a storage buffer
containing 50% glycerol, 100 mM
Na4P207, 5 mM EDTA, and 2 mM
2-mercaptoethanol (pH 8.8) and stored at
20°C until subsequent
analyses for MHC protein content.
-mercaptoethanol, 100 mM Tris-base, 5% glycerol, 4% SDS,
and bromophenol blue. The gels were run at 275 V for ~22 h under
refrigeration. The gels were stained with Brilliant Blue G 250 (Sigma)
and destained, and then they were scanned and quantified with a
Molecular Dynamics densitometer (Sunnyvale, CA). The peaks of interest
representing the distinct MHC isoforms were identified in the digitized
densitometric data sets. The area of each peak was determined by
integration and was indicative of the relative expression of the
corresponding MHC isoform.
Statistical analysis. All values are reported as means ± SE. For each time point, treatment effects were determined by ANOVA with post hoc testing [Student-Newman-Keuls (SNK)] with the Prism software package (Graphpad). Pearson correlation analysis was used to assess the relationship between myofibrillar protein and DNA and between p21 and myogenin with the Prism package. For all statistical tests the 0.05 level of confidence was accepted for statistical significance.
| |
RESULTS |
|---|
|
|
|---|
At the end of 3 mo after irradiation, the body weight of the
-radiation-treated rats was not different from that of the untreated control group [305 ± 5 and 318 ± 6 g, respectively
(synergist ablation removes ~4 g of muscle)]. This result indicates
that the localized irradiation did not have any adverse effects on the
generalized growth of the treated animals (initial body wt 212 ± 3 g). In addition, pilot data indicated that the myofibrillar yield, cross-sectional area (CSA), and force production of irradiated muscles were not altered relative to controls 4 wk after this irradiation protocol was imposed (data not shown).
Muscle hypertrophy.
Fifteen days of overload resulted in significant muscle hypertrophy in
non-irradiated overloaded (OL) muscles as evidenced by increased muscle
mass (Fig. 1A). Ninety days of
overload resulted in further hypertrophy (Fig. 1). In the overloaded
muscles that were irradiated (OL-Ir), there was a small increase in
mass at both 15 and 90 days after treatment relative to the
t = 0 normal control muscles. When normalized to body
mass, the observed changes in mass in the OL-Ir group at 90 days were
no longer significant (Fig. 1B). In addition, the 90-day
values for the OL-Ir muscles were not different from those of the
90-day untreated controls (Fig. 1). Similar results were seen for the
total muscle protein content (data not shown).
|
|
Cell proliferation.
The DNA content of both OL and OL-Ir muscles was increased at 15 and 90 days after treatment compared with the t = 0 control group (Fig. 3). However, the increase in
DNA content seen in the OL-Ir muscles was smaller than that in the OL
group. The DNA content of the OL-Ir group was not different from that
seen in the 90-day controls. In both OL and OL-Ir muscles, the
concentration of DNA (e.g., in mg/g) was unchanged over time (data not
shown). This finding demonstrates the apparent coordination of DNA and
cell size in both growing and hypertrophying muscles.
|
|
Myonuclear analysis.
CSA and myonuclear number were determined in single fibers from
t = 0 and 90-day plantaris muscles. CSA of myofibers
from the OL muscles was significantly increased (46%) at 90 days after overload (Fig. 5A). There was
no change in the CSA of myofibers from OL-Ir muscles. The number of
myonuclei per millimeter of myofiber length was significantly increased
in myofibers from the OL (44%) but not the OL-Ir plantaris
muscles (Fig. 5B). As a result of the increase in
myonuclei in the OL muscles, the myofiber volume-to-myonucleus ratio
remained unchanged (Fig. 5C).
|
Cellular signaling response to increased loading.
The phosphorylation state of both S6K1 and 4E binding protein 1 (4E-BP1) was markedly increased at very early time points after the
imposition of increased loading in both OL and OL-Ir muscles (Fig.
6). In the OL muscles, phosphorylation of
4E-BP1 and S6K1 remained elevated through the 15-day time point and
returned to control levels by 90 days. In the OL-Ir muscles, the
increase in phosphorylation of these proteins appeared to be resolved
by the 7 day time point (Fig. 6).
|
|
Molecular marker responses to increased loading.
The amount of total RNA per muscle increased in both OL and OL-Ir
muscles through 7 days of increased loading (Fig.
8A). This value remained
elevated in the OL muscles through 90 days, whereas in the OL-Ir
muscles it returned to baseline between the 7 and 15 day time points.
|
|
|
|
|
|
MHC isoforms.
Increased mechanical loading of the plantaris resulted in the classic
fast-to-slow shift in MHC protein expression in both OL and OL-Ir
muscles (Fig. 14). This pattern of
adaptation appeared to be accentuated in the OL-Ir muscles. For
example, the type I MHC isoform, representing the slowest phenotype,
represented <5% of the total MHC pool in control rat plantaris
muscles. In the OL-Ir muscles, this isoform was increased more than
eightfold to 20% of the total MHC present. Similarly, the IIb MHC
expression declined by 62% in OL muscles and 80% in OL-Ir muscles. As
a result of the exaggerated adaptation of the OL-Ir muscles, ~50% of
the MHC present was either type I or IIa, whereas these isoforms
represented only ~25% of the MHC in the OL muscles.
|
| |
DISCUSSION |
|---|
|
|
|---|
Irradiation has been used for some time in studies of skeletal muscle regeneration and compensatory growth. Originally, this modality was used to block skeletal muscle regeneration after injury. The interpretation of the results of these various studies has been predicated on the notion that the lasting effects of the radiation treatment were those associated with chromosomal damage (e.g., double strand breaks, cross-linking, base pair loss, etc). It is commonly assumed that the primary outcome of this treatment involves the prevention of mitotic activity within the affected muscles.
More recently, a number of studies have demonstrated that irradiation also appears to prevent skeletal muscle hypertrophy in rats (21, 35, 39-41). However, these studies were conducted before reports that 1) identified a population of stem cells that are apparently resistant to radiation-induced damage (20) and 2) found that stem cells from extramuscular tissues can be incorporated into skeletal muscles (12). Because the cited irradiation studies were carried out over a relatively short time span (4 wk), they did not rule out the possibility that extramuscular and/or radiation-resistant stem cells might eventually contribute to the development of compensatory hypertrophy given a longer overload stimulus. The results of the current study extend the period for postirradiation overloading to 3 mo. In that extended period, the hypertrophy response was negligible in the OL-Ir muscles.
Prevention of hypertrophy is not absolute. At the 15 day time point there was a small but significant increase in the mass and myofibrillar protein content of the OL-Ir plantaris muscles (Figs. 1 and 2). During this time period, the DNA content of the OL-Ir muscles also increased by a small but significant amount (Fig. 3). This suggests the possibility that a small number of satellite cells or myogenic precursor cells (MPC) within the irradiated muscles may have been able to complete mitosis. These cells may have been undamaged by the irradiation treatment or have been able to affect repairs to their DNA (29). Alternatively, there may have been a small population of unfused satellite cells or MPCs that responded to the overload stimulus via differentiation and fusion with myofibers. In support of this second alternative, in a study with finer temporal resolution, we found (2) that the increase in expression of p21 and myogenin mRNA precedes that of cyclin D1 in response to increased loading and thus may signal the presence of such a cell population. Over the remainder of the 3-mo course of this study, the myofibrillar protein content of the OL-Ir muscles remained essentially constant, e.g., they did not experience the large increase in myofibrillar protein accumulation seen in the OL muscles (Fig. 2). Assuming that normal cycles of protein turnover continued, these results suggest that the housekeeping mode of transcription and translation was unimpaired by the irradiation treatment. The small increase in myofibrillar protein seen in the early stages of the OL-Ir treatment also suggests that the myofibers had the capacity not only to renew components of the contractile machinery but also to implement a growth and/or limited hypertrophy program. In addition, the current data would suggest that the inhibition of the hypertrophy response was not related to the production of muscle-specific mRNAs, such as that for MHC, because the conversion from fast to slow MHC expression was robust in the irradiated muscles. In contrast to the OL-Ir muscles, the contralateral OL muscles demonstrated a continuous compensatory hypertrophy response detectable from 7 days onward (Fig. 2).
Differential responses to overload. Examination of the data from the first 3-7 days of overload in this study suggests that the responses of the OL and OL-Ir muscles were not different. The first significant divergence in response between these two treatments can be seen in what arguably might be the most temporally sensitive measurements, the increased phosphorylation of S6K1 and 4E-BP1. Increases in the phosphorylation of S6K1 and 4E-BP1 have been reported to be associated with an increase in translation and are known to occur in response to 1) increased muscle loading and/or 2) IGF-I receptor ligation (10, 11, 13, 23, 34, 62). The activation of S6K1 has a relatively modest positive impact on translation in general, but, more importantly, it increases the translation of specific mRNAs that encode components of the translational apparatus itself (19, 56). Phosphorylation of 4E-BP1 results in its dissociation from the eukaryotic initiation factor (eIF)4G binding site on eIF4E, allowing for the formation of the translation initiation complex and thereby increasing translation (53). At 3 days after treatment the phosphorylation of S6K1 was increased more than sixfold in both OL and OL-Ir muscles. However, at 7 days, when phospho-S6K1 was increased fivefold in the OL muscles, it was not different from control in OL-Ir muscles. Subsequent to this response, other parameters demonstrated similarly dramatic divergence. For example, at 7 days after treatment total RNA was increased approximately twofold in both OL and OL-Ir muscles. At 15 days, the RNA of the OL muscles was still increased more than twofold, whereas the RNA content of the OL-Ir muscles had essentially returned to baseline. The total RNA pool primarily reflects the amount of ribosomal RNA present and thus is indicative of the translational capacity of the tissue. Similar to the total RNA pool, the total mRNA present in both sets of muscles was increased at early time points and then diverged between 7 and 15 days. Interestingly, the changes in specific mRNA expression did not demonstrate this pattern of abrupt divergence. In each case there was no difference (e.g., MGF and myogenin), a greater excursion (e.g., cyclin D1 and p21), or a lack of response (e.g., actin and MHC) in the OL-Ir muscles.
The observation of correlations between increased myogenin and p21 expression suggests that the process of satellite cell differentiation is underway in overloaded skeletal muscles (2). In the current study the increase in expression of myogenin was similar in OL and OL-Ir muscles. However, the increase in p21 mRNA levels was much greater in the OL-Ir muscles and did not correlate with the changes in myogenin. In general, the CKI p21 is thought to participate in the initiation of the differentiation process. Because it did not appear that the OL-Ir muscles were increasing their complement of DNA (and therefore cell number), the increase in differentiation signaling appears to be a paradox. However, in this instance the greatly increased p21 expression may be unrelated to the overloading stimulus. For example, there is evidence that cellular responses to radiation-induced DNA damage include withdrawal from the cell cycle to institute repair processes (see, e.g., Ref. 31). This process is mediated by p53, which is upstream from p21. Therefore, the increase in p21 expression seen in the OL-Ir muscles may reflect periods during which mechanisms involved in attempts at chromosomal repair are active rather than processes involved in muscle hypertrophy. An additional point of divergence in the response to increased loading is evident in the expression of MHC proteins (Fig. 14). The exaggerated shift to slower MHC expression in the OL-Ir muscles represents a compensatory adaptation most likely stimulated by the inability of these muscles to increase their mass or CSA. This shift would provide for greater energetic economy as the overloaded muscles cope with the demands of increased loading. The data from this study suggest several mechanistically important conclusions. First, the initial ability of the OL-Ir muscles to respond appropriately to the increase in loading state indicates that the cellular systems associated with anabolic processes (e.g., increased translation and transcription) were probably not damaged by the irradiation treatment. Second, the myonuclei of the OL-Ir muscles continued to participate in the adaptation process via the shift in MHC protein expression. Unfortunately, the methods used in this study do not allow for the differentiation of responses that would be purely anabolic from those that were promoting attempts at cellular proliferation. For example, increased protein production within myofibers is probably reflected by the increase in total RNA as more ribosomes are produced to meet the demand for translation. However, ribosomal synthesis would also be expected to increase markedly in cells that are becoming mitotically active (see, e.g., Ref. 61). Similarly, activation of the pathways including S6K1 activation would also be critical for both anabolic processes and cellular proliferation (19, 23). As a result, it is difficult to speculate on the mechanisms underlying the observed divergence responses in the OL vs. OL-Ir muscles. However, it seems clear that some regulatory processes acted to downregulate cellular responses in the OL-Ir muscles in the 3- to 15-day time frame. It is possible that this is simply a result of the aborted mitotic processes in the incapacitated stem cell populations. However, the magnitude of the changes (e.g., doubling of the RNA content; a 6- to 7-fold increase in phospho-S6K1) suggests that a significant portion of this activity was occurring in the myofibers because these cells represent the majority of the tissue mass. This conclusion is supported by the cyclin D1 and p21 mRNA data (Figs. 11 and 12), which indicate that stem cells within the OL-Ir muscles were continually attempting to enter the cell cycle throughout the study period. These cells would be expected to have elevated levels of growth-promoting signals and components; however, the OL-Ir data do not reflect a substantial contribution from this cell population (e.g., mostly baseline values). This lack of contribution from muscle stem cells agrees with results of previous studies such as that published by Phelan and Gonyea (35) in which the incorporation of bromodeoxyuridine, a marker of mitotic activity, was greatly increased in OL but not OL-Ir muscles.Role of muscle stem cells. The premise that the failure of stem cells to provide nuclei to myofibers is the primary lesion imposed by the irradiation treatment implies that some processes related to myonuclear function are limiting for the development of hypertrophy. In the case of injury-regeneration studies, the necessity for mitotic activity is relatively clear; muscle cells are destroyed by toxins or mechanical damage and therefore must be replaced by the de novo development of myotubes via the proliferation, differentiation, and fusion of muscle stem cells (satellite cells and/or MPCs). However, in the context of skeletal muscle compensatory hypertrophy, the requirement for mitotic activity is less obvious. If, in fact, the fusion of newly made myoblasts with existing myofibers is required for the hypertrophy response, then this would suggest that a number of nuclear processes were already functioning at or near maximal capacity in the existing myofibers before the increase in loading. This raises a number of intriguing questions. The most obvious of these questions is what specific processes, mediated by myonuclei, actually limit the development of myofiber hypertrophy. Second, why does a lack of newly formed myonuclei more or less permanently prevent hypertrophy rather than just slowing the process? For example, in the rat synergist ablation model, the absolute stimulus for the hypertrophic response is essentially continuous, whereas the relative stimulus declines as the muscle enlarges. Logic would suggest that in response to this stimulus, the existing mechanisms for fiber hypertrophy would remain activated until the stimulus for adaptation declines. However, in irradiated muscles, this does not appear to be the case. The various markers of anabolism, such as enhanced translation initiation (e.g., S6K1 and 4E-BP1) or increased translational capacity (e.g., total RNA) initially respond appropriately but then return to baseline levels even though the overload stimulus apparently continues.
Nuclear function and hypertrophy. The results of this study appear to support the hypothesis that the irradiation protocol inhibits compensatory hypertrophy via the prevention of cell proliferation, ultimately depriving the myofibers of their needed reserve for expansion of the myonuclear pool. If this is the case, then an examination of potential mechanisms for this result is warranted.
One of the primary limitations imposed by the bulk amount of DNA present in a given myofiber is the ability to produce the apparatus for mRNA translation (28). Although protein production via mRNA is subject to potential amplification via multiple translations by ribosomes, rRNA and tRNA are the final gene products; thus mass production requires many DNA templates (14, 28). As reviewed by Booth et al. (7), there is evidence that a general increase in translational efficiency occurs at the onset of muscle hypertrophy. However, sustained increases in protein production appear to require substantial increases in the translational machinery. For example, in the hypertrophying heart, early adaptations include an increase in translational efficiency and an acceleration of the synthesis of new ribosomes (30, 50). In multinucleated myofibers, current dogma suggests that the number of copies of rRNA and tRNA genes can only be manipulated via changes in the number of nuclei present. There is evidence that higher volumes of transcriptional activity will require an increase in space within the nucleus (14). Thus it is possible that the physical spacing within the myonuclei may become a limiting factor during times of high transcriptional activity. If the dense packing of macromolecules within myofibers restricts the expansion of nuclear volume, then it is possible that the addition of satellite cells and their nuclei to myofibers might allow for the distribution of transcriptional loads, thus surmounting this obstacle. However, a number of reports indicate that the RNA produced by a myonucleus may have a fairly limited range of distribution within a myofiber (33, 37, 36). This would suggest that differential transcription requiring mRNA translocation to other myonuclear domains might not be an option for dealing with nuclear space restrictions. As a general rule, slow myofibers are thought to have a greater number of myonuclei per millimeter and a lower cytoplasm volume-to-myonucleus ratio than fast myofibers (21, 47). In particular, the difference in cytoplasm volume-to-myonucleus ratio between fast and slow fibers in mixed fast muscles, such as the rat plantaris, is fairly pronounced (42, 58). It would therefore follow that the OL-Ir muscles from the current study might have been expected to have a decreased cytoplasm volume-to-myonucleus ratio compared with the controls. However, despite a substantial shift toward slower MHC expression, the whole muscle DNA concentration and single-fiber cytoplasmic volume-to-myonucleus ratio of the OL-Ir muscles were unchanged from controls. This suggests that the lower cytoplasmic volume-to-myonucleus ratio seen in slow fibers may not be a necessary condition for the expression of the type I MHC isoform.Potential for adaptation after 3 mo. The data from the OL-Ir muscles indicated a tendency toward an upswing at 90 days for a number of measurements (Figs. 4A, 6B, 7, and 11-13). In the case of myogenin and cyclin D1 mRNA, these increases were significant compared with the t = 0 control values. This suggested that these muscles might be entering a new phase of potentially anabolic activity that could lead to a much delayed hypertrophy response. Accordingly, an additional cohort of rats was subjected to OL-Ir protocol to allow for an additional month (i.e., total of 4 mo) for the development of muscle hypertrophy. At 4 mo we observed no indication of a hypertrophic response (e.g., no increase in muscle mass) in the OL-Ir muscles of these rats. Although these 4-mo observations demonstrate that the increases in some cellular and molecular markers at 3 mo did not herald the delayed onset of a compensatory hypertrophy response, they did not shed any light on the reason for these increases.
In summary, the results of this study demonstrate that irradiation essentially prevents the development of compensatory hypertrophy in rodent skeletal muscles for up to 4 mo. This would suggest that neither endogenous or extramuscular stem cells contribute significantly to the stem cell population of overloaded muscles, at least in this time frame. Localized irradiation protocols do not appear to induce significant damage to myofibers or the intrinsic mechanisms necessary for them to adapt to increased loading. The results of this study tend to support the hypothesis that the mechanisms by which myofibers adapt to increased loading appear to include an obligatory "myogenic" component involving the proliferation, differentiation, and fusion of muscle stem cells with the existing myofibers.| |
ACKNOWLEDGEMENTS |
|---|
The authors thank Anqi Qin, Ming Zeng, Sam McCue, and Mike Baker for invaluable technical assistance.
| |
FOOTNOTES |
|---|
This work was supported by National Space Biomedical Research Institute Grant NCC9-58 (K. M. Baldwin) and National Institute of Arthritis and Musculoskeletal and Skin Diseases Grants AR-45594 (G. R. Adams) and AR-46856 (V. J. Caiozzo).
Address for reprint requests and other correspondence: G. R. Adams, Dept. of Physiology and Biophysics, Medical Sciences I C308, Univ. of California, Irvine, CA 92697 (E-mail: gradams{at}UCI.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
June 26, 2002;10.1152/ajpcell.00173.2002
Received 16 April 2002; accepted in final form 15 June 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Adams, GR,
and
Haddad F.
The relationships between IGF-1, DNA content, and protein accumulation during skeletal muscle hypertrophy.
J Appl Physiol
81:
2509-2516,
1996
2.
Adams, GR,
Haddad F,
and
Baldwin KM.
Time course of changes in markers of myogenesis in overloaded rat skeletal muscles.
J Appl Physiol
87:
1705-1712,
1999
3.
Adams, GR,
Haddad F,
McCue SA,
Bodell PW,
Zeng M,
Qin A,
Qin X,
and
Baldwin KM.
Effects of spaceflight and thyroid deficiency on rat hindlimb development. II. Expression of MHC isoforms.
J Appl Physiol
88:
904-916,
2000
4.
Allen, DL,
Monke SR,
Talmadge RJ,
Roy RR,
and
Edgerton VR.
Plasticity of myonuclear number in hypertrophied and atrophied mammalian skeletal muscle fibers.
J Appl Physiol
78:
1969-1976,
1995
5.
Armstrong, RB,
Marum P,
Tullson P,
and
Saubert CW.
Acute hypertrophic response of skeletal muscle to removal of synergists.
J Appl Physiol
46:
835-842,
1979
6.
Baldwin, KM,
Valdez V,
Herrick RE,
MacIntosh AM,
and
Roy RR.
Biochemical properties of overloaded fast twitch skeletal muscle.
J Appl Physiol
52:
467-472,
1982
7.
Booth, FW,
Tseng BS,
Fluck M,
and
Carson JA.
Molecular and cellular adaptation of muscle in response to physical training.
Acta Physiol Scand
162:
343-350,
1998[Web of Science][Medline].
8.
Chambers, RL,
and
McDermott JC.
Molecular basis of skeletal muscle regeneration.
Can J Appl Physiol
21:
155-184,
1996[Medline].
9.
Chomczynski, P,
and
Sacchi N.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:
156-159,
1987[Web of Science][Medline].
10.
Dufner, A,
and
Thomas G.
Ribosomal S6 kinase signaling and the control of translation.
Exp Cell Res
253:
100-109,
1999[Web of Science][Medline].
11.
Farrell, PA,
Hernandez JM,
Fedele MJ,
Vary TC,
Kimball SR,
and
Jefferson LS.
Eukaryotic initiation factors and protein synthesis after resistance exercise in rats.
J Appl Physiol
88:
1036-1042,
2000
12.
Ferrari, G,
Cusells-De Angelis G,
Coletta M,
Paolucci E,
Stornaiuolo A,
Cossu G,
and
Mavilio F.
Muscle regeneration by bone marrow-derived myogenic progenitors.
Science
279:
1528-1530,
1998
13.
Gingras, AC,
Kennedy SG,
O'Leary MA,
Sonenberg N,
and
Hay N.
4E-BP1, a repressor of mRNA translation, is phosphorylated and inactivated by the Akt(PKB) signaling pathway.
Genes Dev
12:
502-513,
1998
14.
Gregory, TR.
Coincidence, coevolution, or causation? DNA content, cell size, and the C-value enigma.
Biol Rev Camb Philos Soc
76:
65-101,
2001[Medline].
15.
Gulati, AK.
The effect of X-irradiation on skeletal muscle regeneration in the adult rat.
J Neurol Sci
78:
111-120,
1987[Web of Science][Medline].
16.
Haddad, F,
and
Adams GR.
Acute cellular and molecular responses to resistance exercise.
J Appl Physiol
93:
394-403,
2002
17.
Haddad, F,
Herrick RE,
Adams GR,
and
Baldwin KM.
Myosin heavy chain expression in rodent skeletal muscle: effects of zero gravity.
J Appl Physiol
75:
2471-2477,
1993
18.
Hameed, M,
Harridge SDR,
and
Goldspink G.
Sarcopenia and hypertrophy: a role for insulin-like growth factor-1 in aged muscle?
Exerc Sport Sci Rev
30:
15-19,
2002[Web of Science][Medline].
19.
Hashemolhosseini, S,
Nagamine Y,
Morley SJ,
Desrivières S,
Mercep L,
and
Ferrari S.
Rapamycin inhibition of the G1 to S transition is mediated by effects on cyclin D1 mRNA and protein stability.
J Biol Chem
273:
14424-14429,
1998
20.
Heslop, L,
Morgan JE,
and
Partridge TA.
Evidence for a myogenic stem cell that is exhausted in dystrophic muscle.
J Cell Sci
113:
2299-2308,
2000[Abstract].
21.
Hughes, SM,
and
Schiaffino S.
Control of muscle fiber size: a crucial factor in ageing.
Acta Physiol Scand
167:
307-312,
1999[Web of Science][Medline].
22.
Karin, M.
The regulation of AP-1 activity by mitogen-activated protein kinases.
Philos Trans R Soc Lond B Biol Sci
351:
127-134,
1996[Web of Science][Medline].
23.
Kawasome, H,
Papst P,
Webb S,
Keller GM,
Johnson GL,
and
Gelfand EW.
Targeted disruption of p70s6k defines its role in protein synthesis and rapamycin sensitivity.
Proc Natl Acad Sci USA
95:
5033-5038,
1998
24.
Laemmli, UK.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:
680-685,
1970[Medline].
25.
Lewis, RB.
Changes in striated muscle following single intense doses of X-rays.
Lab Invest
3:
48-55,
1954[Web of Science][Medline].
26.
Lowe, DA,
and
Alway SE.
Stretch-induced myogenin, MyoD, and MRF4 expression and acute hypertrophy in quail slow-tonic muscle are not dependent upon satellite cell proliferation.
Cell Tissue Res
296:
531-539,
1999[Web of Science][Medline].
27.
Mitchell, PO,
and
Pavlath GK.
A muscle precursor cell-dependent pathway contributes to muscle growth after atrophy.
Am J Physiol Cell Physiol
281:
C1706-C1715,
2001
28.
Montagne, J.
Genetic and molecular mechanisms of cell size control.
Mol Cell Biol Res Commun
4:
195-202,
2000[Medline].
29.
Mozdziak, PE,
Schultz E,
and
Cassens RG.
The effect of in vivo and in vitro irradiation (25 Gy) on the subsequent in vitro growth of satellite cells.
Cell Tissue Res
283:
203-208,
1996[Web of Science][Medline].
30.
Nagatomo, Y,
Carabello BA,
Hamawaki M,
Nemoto S,
Matsuo T,
and
McDermott PJ.
Translational mechanisms accelerate the rate of protein synthesis during canine pressure-overload hypertrophy.
Am J Physiol Heart Circ Physiol
277:
H2176-H2184,
1999
31.
Niibe, Y,
Nakano T,
Ohno T,
Tsujii H,
and
Oka K.
Relationship between p21/WAF-1/CIP-1 and apoptosis in cervical cancer during radiation therapy.
Int J Radiat Oncol Biol Phys
44:
297-303,
1999[Web of Science][Medline].
32.
Pagel, CN,
and
Partridge TA.
Covert persistence of mdx mouse myopathy is revealed by acute and chronic effects of irradiation.
J Neurol Sci
164:
103-116,
1999[Web of Science][Medline].
33.
Pavlath, GK,
Rich K,
Webster SG,
and
Blau HM.
Localization of muscle gene products in nuclear domains.
Nature
337:
570-573,
1989[Medline].
34.
Petley, T,
Graff K,
Jiang W,
and
Florini J.
Variation among cell types in the signaling pathways by which IGF-I stimulates specific cellular responses.
Horm Metab Res
31:
70-76,
1999[Web of Science][Medline].
35.
Phelan, JN,
and
Gonyea WJ.
Effect of radiation on satellite cell activity and protein expression in overloaded mammalian skeletal muscle.
Anat Rec
247:
179-188,
1997[Medline].
36.
Ralston, E,
and
Hall ZW.
Restricted distribution of mRNA produced from a single nucleus in hybrid myotubes.
J Cell Biol
119:
1063-1068,
1992
37.
Ralston, E,
McLaren RS,
and
Horowitz JA.
Nuclear domains in skeletal myotubes: the localization of transferrin receptor mRNA is independent of its half-life and restricted by binding to ribosomes.
Exp Cell Res
236:
453-462,
1997[Web of Science][Medline].
38.
Robertson, TA,
Grounds MD,
and
Papadimitriou JM.
Elucidation of aspects of murine skeletal muscle regeneration using local and whole body irradiation.
J Anat
181:
265-276,
1992[Medline].
39.
Rosenblatt, DJ,
and
Parry DJ.
Gamma irradiation prevents compensatory hypertrophy of overloaded mouse extensor digitorum longus muscle.
J Appl Physiol
73:
2538-2543,
1992
40.
Rosenblatt, JD,
and
Parry DJ.
Adaptation of rat extensor digitorum longus muscle to gamma irradiation and overload.
Pflügers Arch
423:
255-264,
1993[Web of Science][Medline].
41.
Rosenblatt, JD,
Yong D,
and
Parry DJ.
Satellite cell activity is required for hypertrophy of overloaded adult rat skeletal muscle.
Muscle Nerve
17:
608-613,
1994[Web of Science][Medline].
42.
Roy, RR,
Monke SR,
Allen DL,
and
Edgerton VR.
Modulation of myonuclear number in functionally overloaded and exercised rat plantaris fibers.
J Appl Physiol
87:
634-642,
1999
43.
Sabourin, LA,
and
Rudnicki MA.
The molecular regulation of myogenesis.
Clin Genet
57:
16-25,
2000[Web of Science][Medline].
44.
Salleo, A,
LaSpada G,
Falzea G,
Denaro MG,
and
Cicciarello R.
Response of satellite cells and muscle fibers to long-term compensatory hypertrophy.
J Submicrosc Cytol Pathol
15:
929-940,
1983.
45.
Schiaffino, S,
Bormioli SP,
and
Aloisi M.
Cell proliferation in rat skeletal muscle during early stages of compensatory hypertrophy.
Virchows Arch B Cell Pathol
11:
268-273,
1972[Medline].
46.
Schiaffino, S,
Bormioli SP,
and
Aloisi M.
The fate of newly formed satellite cells during compensatory muscle hypertrophy.
Virchows Arch B Cell Pathol
21:
113-118,
1976[Web of Science][Medline].
47.
Schmalbruch, H,
and
Lewis DM.
Dynamics of nuclei of muscle fibers and connective tissue cells in normal and denervated rat muscles.
Muscle Nerve
23:
617-626,
2000[Web of Science][Medline].
48.
Schultz, E.
Satellite cell behavior during skeletal muscle growth and regeneration.
Med Sci Sports Exerc
21:
S181-S186,
1989.
49.
Schultz, E,
and
McCormick KM.
Skeletal muscle satellite cells.
Rev Physiol Biochem Pharmacol
123:
213-257,
1994[Web of Science][Medline].
50.
Siehl, D,
Chua BH,
Lautensack-Belser N,
and
Morgan HE.
Faster protein and ribosome synthesis in thyroxine-induced hypertrophy of rat heart.
Am J Physiol Cell Physiol
248:
C309-C319,
1985
51.
Snow, MH.
Satellite cell response in rat soleus muscle undergoing hypertrophy due to surgical ablation of synergists.
Anat Rec
227:
437-446,
1990[Medline].
52.
Solaro, RJ,
Pang DC,
and
Briggs FN.
The purification of cardiac myofibrils with Triton X-100.
Biochim Biophys Acta
245:
259-262,
1971[Medline].
53.
Sonnenberg, N,
and
Ginggras AC.
The mRNA 5' cap-binding protein eIF4E and control of cell growth.
Curr Opin Cell Biol
10:
268-275,
1998[Web of Science][Medline].
54.
Stockdale, FE,
and
Holtzer H.
DNA synthesis and myogenesis.
Exp Cell Res
24:
508-520,
1961[Web of Science][Medline].
55.
Talmadge, RJ,
and
Roy RR.
Electrophoretic separation of rat skeletal muscle myosin heavy-chain isoforms.
J Appl Physiol
75:
2337-2340,
1993
56.
Thomas, G,
and
Hall MN.
TOR signaling and control of cell growth.
Curr Opin Cell Biol
9:
782-787,
1997[Web of Science][Medline].
57.
Thomason, DB,
Herrick RE,
and
Baldwin KM.
Activity influences on soleus muscle myosin during rodent hindlimb suspension.
J Appl Physiol
63:
138-144,
1987
58.
Tseng, BS,
Kasper CE,
and
Edgerton VR.
Cytoplasm to myonucleus ratios and succinate dehydrogenase activities in adult rat slow and fast muscle fibers.
Cell Tissue Res
275:
39-49,
1994[Web of Science][Medline].
59.
Wright, C,
Haddad F,
Qin A,
and
Baldwin KM.
Analysis of myosin heavy chain mRNA expression by RT-PCR.
J Appl Physiol
83:
1389-1396,
1997
60.
Yau, L,
Lukes H,
McDiarmid H,
Werner J,
and
Zahradka P.
Insulin-like growth factor-I (IGF-I)-dependent activation of pp42/44 mitogen-activated protein kinase occurs independently of IGF-I receptor kinase activation and IRS-1 tyrosine phosphorylation.
Eur J Biochem
266:
1147-1157,
1999[Web of Science][Medline].
61.
Zahradka, P,
Larson DE,
and
Sells BH.
Regulation of ribosome biogenesis in differentiated rat myotubes.
Mol Cell Biochem
104:
189-194,
1991[Web of Science][Medline].
62.
Zheng, Z,
Messi ML,
and
Delbono O.
Age-dependent IGF-1 regulation of gene transcription of Ca2+ channels in skeletal muscle.
Mech Ageing Dev
122:
373-384,
2001[Web of Science][Medline].
This article has been cited by other articles:
![]() |
B. Blaauw, M. Canato, L. Agatea, L. Toniolo, C. Mammucari, E. Masiero, R. Abraham, M. Sandri, S. Schiaffino, and C. Reggiani Inducible activation of Akt increases skeletal muscle mass and force without satellite cell activation FASEB J, November 1, 2009; 23(11): 3896 - 3905. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L Novak, W. Billich, S. M. Smith, K. B. Sukhija, T. J. McLoughlin, T. A. Hornberger, and T. J. Koh COX-2 inhibitor reduces skeletal muscle hypertrophy in mice Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2009; 296(4): R1132 - R1139. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Drummond-Barbosa Stem Cells, Their Niches and the Systemic Environment: An Aging Network Genetics, December 1, 2008; 180(4): 1787 - 1797. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Lees, T. E. Childs, and F. W. Booth Age-dependent FOXO regulation of p27Kip1 expression via a conserved binding motif in rat muscle precursor cells Am J Physiol Cell Physiol, November 1, 2008; 295(5): C1238 - C1246. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Kim, R. R. Roy, J. A. Kim, H. Zhong, F. Haddad, K. M. Baldwin, and V. R. Edgerton Gene expression during inactivity-induced muscle atrophy: effects of brief bouts of a forceful contraction countermeasure J Appl Physiol, October 1, 2008; 105(4): 1246 - 1254. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Marino, B. J. Tausch, C. L. Dearth, M. V. Manacci, T. J. McLoughlin, S. J. Rakyta, M. P. Linsenmayer, and F. X. Pizza {beta}2-Integrins contribute to skeletal muscle hypertrophy in mice Am J Physiol Cell Physiol, October 1, 2008; 295(4): C1026 - C1036. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. B. Mantilla, R. V. Sill, B. Aravamudan, W.-Z. Zhan, and G. C. Sieck Developmental effects on myonuclear domain size of rat diaphragm fibers J Appl Physiol, March 1, 2008; 104(3): 787 - 794. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. R. Adams, F. Haddad, P. W. Bodell, P. D. Tran, and K. M. Baldwin Combined isometric, concentric, and eccentric resistance exercise prevents unloading-induced muscle atrophy in rats J Appl Physiol, November 1, 2007; 103(5): 1644 - 1654. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Rehfeldt, C. B. Mantilla, G. C. Sieck, R. S. Hikida, F. W. Booth, F. Kadi, S. C. Bodine, and D. A. Lowe In response to Point:Counterpoint: "Satellite cell addition is/is not obligatory for skeletal muscle hypertrophy". J Appl Physiol, September 1, 2007; 103(3): 1104 - 1105. [Full Text] [PDF] |
||||
![]() |
R. S. O'Connor and G. K. Pavlath Point:Counterpoint: Satellite cell addition is/is not obligatory for skeletal muscle hypertrophy J Appl Physiol, September 1, 2007; 103(3): 1099 - 1100. [Full Text] [PDF] |
||||
![]() |
J. L. J. van der Velden, R. C. J. Langen, M. C. J. M. Kelders, J. Willems, E. F. M. Wouters, Y. M. W. Janssen-Heininger, and A. M. W. J. Schols Myogenic differentiation during regrowth of atrophied skeletal muscle is associated with inactivation of GSK-3beta Am J Physiol Cell Physiol, May 1, 2007; 292(5): C1636 - C1644. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Garma, C. Kobayashi, F. Haddad, G. R. Adams, P. W. Bodell, and K. M. Baldwin Similar acute molecular responses to equivalent volumes of isometric, lengthening, or shortening mode resistance exercise J Appl Physiol, January 1, 2007; 102(1): 135 - 143. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Petrella, J.-s. Kim, J. M. Cross, D. J. Kosek, and M. M. Bamman Efficacy of myonuclear addition may explain differential myofiber growth among resistance-trained young and older men and women Am J Physiol Endocrinol Metab, November 1, 2006; 291(5): E937 - E946. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Kosek, J.-s. Kim, J. K. Petrella, J. M. Cross, and M. M. Bamman Efficacy of 3 days/wk resistance training on myofiber hypertrophy and myogenic mechanisms in young vs. older adults J Appl Physiol, August 1, 2006; 101(2): 531 - 544. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Bruusgaard, K. Liestol, and K. Gundersen Distribution of myonuclei and microtubules in live muscle fibers of young, middle-aged, and old mice J Appl Physiol, June 1, 2006; 100(6): 2024 - 2030. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Li, T. Akimoto, M. Zhang, R. S. Williams, and Z. Yan Resident stem cells are not required for exercise-induced fiber-type switching and angiogenesis but are necessary for activity-dependent muscle growth Am J Physiol Cell Physiol, June 1, 2006; 290(6): C1461 - C1468. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Haddad and G. R. Adams Aging-sensitive cellular and molecular mechanisms associated with skeletal muscle hypertrophy J Appl Physiol, April 1, 2006; 100(4): 1188 - 1203. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. B. Martins, T. Gordon, D. Pette, W. T. Dixon, G. R. Foxcroft, I. M. MacLean, and C. T. Putman Effect of satellite cell ablation on low-frequency-stimulated fast-to-slow fibre-type transitions in rat skeletal muscle J. Physiol., April 1, 2006; 572(1): 281 - 294. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Lees, C. R. Rathbone, and F. W. Booth Age-associated decrease in muscle precursor cell differentiation Am J Physiol Cell Physiol, February 1, 2006; 290(2): C609 - C615. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-s. Kim, D. J. Kosek, J. K. Petrella, J. M. Cross, and M. M. Bamman Resting and load-induced levels of myogenic gene transcripts differ between older adults with demonstrable sarcopenia and young men and women J Appl Physiol, December 1, 2005; 99(6): 2149 - 2158. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. D. Armstrong and K. A. Esser Wnt/{beta}-catenin signaling activates growth-control genes during overload-induced skeletal muscle hypertrophy Am J Physiol Cell Physiol, October 1, 2005; 289(4): C853 - C859. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Westerkamp and S. E. Gordon Angiotensin-converting enzyme inhibition attenuates myonuclear addition in overloaded slow-twitch skeletal muscle Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2005; 289(4): R1223 - R1231. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. McClung, K. A. Mehl, R. W. Thompson, L. L. Lowe, and J. A. Carson Nandrolone decanoate modulates cell cycle regulation in functionally overloaded rat soleus muscle Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2005; 288(6): R1543 - R1552. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-s. Kim, J. M. Cross, and M. M. Bamman Impact of resistance loading on myostatin expression and cell cycle regulation in young and older men and women Am J Physiol Endocrinol Metab, June 1, 2005; 288(6): E1110 - E1119. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Haddad, F. Zaldivar, D. M. Cooper, and G. R. Adams IL-6-induced skeletal muscle atrophy J Appl Physiol, March 1, 2005; 98(3): 911 - 917. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Bickel, J. Slade, E. Mahoney, F. Haddad, G. A. Dudley, and G. R. Adams Time course of molecular responses of human skeletal muscle to acute bouts of resistance exercise J Appl Physiol, February 1, 2005; 98(2): 482 - 488. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Haddad, K. M. Baldwin, and P. A. Tesch Pretranslational markers of contractile protein expression in human skeletal muscle: effect of limb unloading plus resistance exercise J Appl Physiol, January 1, 2005; 98(1): 46 - 52. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Washington, J. M. Reecy, R. W. Thompson, L. L. Lowe, J. M. McClung, and J. A. Carson Lactate dehydrogenase expression at the onset of altered loading in rat soleus muscle J Appl Physiol, October 1, 2004; 97(4): 1424 - 1430. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. J. Caiozzo, Y. Z. Wu, M. J. Baker, and R. Crumley Effects of Denervation on Cell Cycle Control in Laryngeal Muscle Arch Otolaryngol Head Neck Surg, September 1, 2004; 130(9): 1056 - 1068. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Sartorelli and M. Fulco Molecular and Cellular Determinants of Skeletal Muscle Atrophy and Hypertrophy Sci. Signal., August 3, 2004; 2004(244): re11 - re11. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Parsons, D. P. Millay, B. J. Wilkins, O. F. Bueno, G. L. Tsika, J. R. Neilson, C. M. Liberatore, K. E. Yutzey, G. R. Crabtree, R. W. Tsika, et al. Genetic Loss of Calcineurin Blocks Mechanical Overload-induced Skeletal Muscle Fiber Type Switching but Not Hypertrophy J. Biol. Chem., June 18, 2004; 279(25): 26192 - 26200. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Haddad and G. R. Adams Inhibition of MAP/ERK kinase prevents IGF-I-induced hypertrophy in rat muscles J Appl Physiol, January 1, 2004; 96(1): 203 - 210. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R. Rathbone, J. C. Wenke, G. L. Warren, and R. B. Armstrong Importance of satellite cells in the strength recovery after eccentric contraction-induced muscle injury Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2003; 285(6): R1490 - R1495. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Haddad, R. R. Roy, H. Zhong, V. R. Edgerton, and K. M. Baldwin Atrophy responses to muscle inactivity. I. Cellular markers of protein deficits J Appl Physiol, August 1, 2003; 95(2): 781 - 790. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Haddad, R. R. Roy, H. Zhong, V. R. Edgerton, and K. M. Baldwin Atrophy responses to muscle inactivity. II. Molecular markers of protein deficits J Appl Physiol, August 1, 2003; 95(2): 791 - 802. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Sinha-Hikim, S. M. Roth, M. I. Lee, and S. Bhasin Testosterone-induced muscle hypertrophy is associated with an increase in satellite cell number in healthy, young men Am J Physiol Endocrinol Metab, July 1, 2003; 285(1): E197 - E205. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Bickel, J. M. Slade, F. Haddad, G. R. Adams, and G. A. Dudley Acute molecular responses of skeletal muscle to resistance exercise in able-bodied and spinal cord-injured subjects J Appl Physiol, June 1, 2003; 94(6): 2255 - 2262. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |