Irradiation of rat skeletal muscles before
increased loading has been shown to prevent compensatory hypertrophy
for periods of up to 4 wk, possibly by preventing satellite cells from
proliferating and providing new myonuclei. Recent work suggested that
stem cell populations exist that might allow irradiated muscles to
eventually hypertrophy over time. We report that irradiation
essentially prevented hypertrophy in rat muscles subjected to 3 mo of
functional overload (OL-Ir). The time course and magnitude of changes
in cellular and molecular markers of anabolic and myogenic responses were similar in the OL-Ir and the contralateral nonirradiated, overloaded (OL) muscles for the first 3-7 days. These markers then
returned to control levels in OL-Ir muscles while remaining elevated in
OL muscles. The number of myonuclei and amount of DNA were increased
markedly in OL but not OL-Ir muscles. Thus it appears that stem cells
were not added to the irradiated muscles in this time period. These
data are consistent with the theory that the addition of new myonuclei
may be required for compensatory hypertrophy in the rat.
 |
INTRODUCTION |
MATURE MAMMALIAN
SKELETAL muscle cells are multinucleated myofibers that are
formed via the fusion of individual myoblast cells during development.
Evidence suggests that these multinucleated myofibers are permanently
differentiated and therefore incapable of mitotic activity (8,
21, 54). During muscle regeneration after injury, myofibers can
be repaired and/or replaced via the fusion of muscle stem cells
(satellite cells) either with existing damaged myofibers or with each
other to form new myofibers (43, 48, 49).
The impetus for much of the current interest in the role of satellite
cells in muscle adaptation has its roots in the muscle regeneration
literature. The results from a number of studies using muscle injury
models indicated that relatively modest doses of radiation, well below
the threshold of those required to induce overt cellular injury in
vivo, interfered with the regeneration of skeletal muscle (see, e.g.,
Refs. 15, 25, 32). Because there
is an absence of overt cellular damage, it was postulated that the
failure of myofibers to regenerate resulted from damage to DNA that
prevents satellite cell proliferation. It would follow then that
mature, permanently differentiated mammalian myofibers would not appear
to be the locus of the radiation-induced mitotic failure (8,
54). Thus the inhibitory effects of radiation on muscle
regeneration were proposed to be a result of the incapacitation of
satellite cell mitotic activity.
The theory that radiation-induced inhibition of cellular proliferation
can inhibit mammalian muscle adaptation and repair has recently been
extended to include the prevention of compensatory muscle hypertrophy
after increased loading. In support of this theory, a number of studies
have demonstrated that the muscle hypertrophy process appears to
involve the addition of nuclei to existing myofibers (see, e.g., Refs.
44-46, 51) and that prior irradiation
can prevent this adaptation (35, 38-41). For example, a series of papers published by Rosenblatt et al.
(39-41) showed that, in response to functional
overload, irradiated myofibers do not hypertrophy or increase their
myonuclear number but do alter their myosin heavy chain (MHC) isoform
profile from a faster to a slower phenotype. These results suggest that
the irradiated myofibers adapt in a manner similar to that of
nonirradiated myofibers with regard to the qualitative expression of
contractile protein isoforms but are unable to increase the quantity of
protein accumulated in the myofibers. Similarly, Phelan and Gonyea
(35) found that after 4 wk of overload, muscle hypertrophy
was absent and cell proliferation was significantly less in irradiated
vs. control muscles. In addition to the inhibition of either
regeneration or hypertrophy, it has also been reported that irradiation
prevents the recovery of muscle mass from unloading-induced atrophy in mice (27). In avian muscles, irradiation appears to
prevent stretch-induced cellular proliferation, but only a relatively small proportion of the hypertrophy response is affected
(26).
Recent reports indicated that there are stem cell populations within
skeletal muscle that appear to be resistant to radiation-induced damage
(20). In addition, there are data to indicate that stem cells from extramuscular tissues can be incorporated into skeletal muscles, and once there they function as muscle stem cells
(12). These results suggest that a pool of mitotically
competent stem cells could be available for the eventual restoration of
the compensatory hypertrophy response in muscles that have been
previously irradiated.
The finding that hypertrophy of mammalian skeletal muscle may require
the incorporation of stem cells gives rise to some important hypotheses: 1) the number of myonuclei present in a muscle
fiber is a limiting factor for protein production, indicating that
there is not a significant reserve capacity for growth processes
dependent on nuclear functions; and 2) over the time
periods studied to date (i.e., up to 4 wk), muscles do not have a
source of stem cells other than that which is present in the muscle
domain at the time of irradiation.
Therefore, the current study was designed to address portions of these
two hypotheses. First we hypothesized that it should be possible to
detect and evaluate adaptive responses that involve nuclear function,
such as increased RNA levels, generated within myofibers in
overloaded-irradiated muscles. Second, we postulated that previous
studies may not have allowed sufficient time for either an intrinsic
radiation-resistant population of satellite cells or an extramuscular
stem cell source to contribute to the development of compensatory
hypertrophy. Accordingly, a study was performed with the functional
overload model, in which the plantaris muscles were bilaterally
overloaded and one leg was then exposed to irradiation while the rest
of the animal was protected from the radiation dose. The muscles from
subgroups of these rats were studied at specific time points spanning a
period of 90 days after treatment.
 |
METHODS |
Forty-eight female Sprague-Dawley rats (212 ± 3 g
body wt) were randomly assigned to one of eight groups
(n = 6 per group) for the primary experiments in this
study. All procedures were approved by the University of California,
Irvine, Institutional Animal Care and Use Committee. In six of these
groups one leg was exposed to
-radiation as follows.
Treatment.
In the six groups chosen for treatment, the left hindlimb of the
animals was exposed to 25-Gy (2.5 Gy/min) ionizing irradiation with a
Mark I irradiator (model 68, J. L. Shepard and Associates, Glendale, CA). The exact dose of irradiation was determined with Fricke
dosimetry solution. Irradiation was focused onto the hindlimb of each
animal with a collimator, thus allowing the irradiation to be focused
onto the hindlimb musculature without exposing the rest of the body.
After induction of anesthesia (40 mg/kg ketamine-2 mg/kg acepromazine),
the animal was positioned such that the left hindlimb was aligned with
the slit of the collimator. Immediately after the irradiation
procedure, rats had the plantaris muscles of both legs overloaded via
the removal of the gastrocnemius and soleus muscles as described
previously (6).
Tissue collection.
Groups of rats were killed by injection of Pentosol (Med-Pharmex) at 6 and 24 h and at 3, 7, 15, and 90 days after the irradiation procedure. Two groups of untreated rats were used as controls and were
killed at the beginning of the study (t = 0) and the end of the 90-day period. On the basis of the results seen in the
primary study, additional groups of six rats each were used in a
follow-up study to determine whether measurable hypertrophy developed
after 4 mo of functional overload.
At the appropriate time point the plantaris muscles of the irradiated
and contralateral legs were dissected free of connective tissue,
weighed, and snap frozen. Muscles were stored at
80°C for
subsequent analysis.
Biochemical and molecular analyses.
Tissue samples were analyzed for total DNA and protein content as
described previously (1). Myofibrillar protein
content was determined via modification of the method described by
Solaro et al. (52; see Ref. 57).
Total RNA isolation.
Measurements of total RNA content provide insights on the translational
capacity of tissue. Total RNA was extracted from preweighed frozen
muscle samples with the TRI reagent (Molecular Research Center,
Cincinnati, OH) according to the company's protocol, which is based on
the method described by Chomczynski and Sacchi (9). Extracted RNA was precipitated from the aqueous phase with isopropanol and, after washing with ethanol, dried and suspended in a known volume
of nuclease-free water. The RNA concentration was determined by optical
density at 260 nm (using an OD260 unit equivalent to 40 µg/ml). The muscle total RNA concentration was calculated based on
total RNA yield and the weight of the analyzed sample. The RNA samples
were stored frozen at
80°C to be used subsequently in determining
both total mRNA (poly A) and specific mRNA expression with slot
blotting and relative reverse transcription (RT)-polymerase chain
reaction (PCR) procedures.
RNA slot blotting.
RNA slot blotting techniques were used to elucidate the contribution of
various fractions of RNA to the changes seen in response to treatments.
In the current study this analysis was aimed at measuring the total
amount of mRNA as well as two markers of contractile protein message.
One microgram of total RNA was denatured in twenty microliters of
denaturing buffer (18% formaldehyde, 10× SSC) at 60°C for 15 min.
Samples were brought up to 100-µl volume with 6× SSC and were
applied onto a positively charged nylon membrane (GeneScreen plus; NEN)
with a slot blot apparatus (Schleicher and Schuell). Two blot series
were performed for each sample. After UV fixation, each membrane was
hybridized consecutively with 1) either an antisense
-skeletal actin mRNA probe to determine
-skeletal actin mRNA
expression or an antisense MHC mRNA probe common to all MHC;
2) an oligo dT probe (12- to 18-mer; Life Technology) that
was used to detect poly A RNA (total mRNA population); and 3) an antisense 18S ribosomal RNA probe. The signal of this
probe is directly proportional to the amount of total RNA and thus was used to normalize for possible variability in the amount of loaded RNA
per slot. Probes were 5' end-labeled with 32P with
-ATP
and T4 polynucleotide kinase. Hybridization and washing procedures were
carried out as described previously (17). Hybridization signals were detected and analyzed with a phosphorimager and Image Quant analysis software (Molecular Dynamics). The slot blot
hybridization signal for these probes was strongly correlated with the
amount of loaded total RNA, ranging from 0.25 to 2 µg per slot. For
each sample, the MHC mRNA, actin mRNA, and dT (poly A) signals were normalized to the corresponding 18S signal. The mRNA per muscle as
reported for MHC and
-skeletal actin mRNA was based on the total RNA
content per muscle and the mRNA ratio to 18S.
The sequences of the oligonucleotide probes used for hybridization were
as follows:
-skeletal actin antisense probe: GGCTGGCTTTAATGCTTCAAGT (based on reported actin mRNA sequence; GenBank accession no. V01224);
MHC antisense probe (common to all rat MHC): TGGTGTCCTGCTCCTTCTT (based
on type I MHC mRNA sequence position 5306-5324; GenBank accession
no. NM017239; complementary to coding region ~500 nt upstream from
stop codon and 100% identical in all MHC isoforms including adult and
developmental; signal obtained with this common MHC probe is indicative
of total population of MHC mRNA expressed in muscle); 18S rRNA
antisense probe: GTGCAGCCCCGGACATCTAAG (based on rat ribosomal RNA
sequence; GenBank accession no. M11188).
Reverse transcription.
One microgram of total RNA was reverse transcribed for each muscle
sample with SuperScript II RT from GIBCO-BRL and a mix of oligo dT (100 ng/reaction) and random primers (200 ng/reaction) in a 20-µl total
reaction volume at 45°C for 50 min, according to the provided
protocol. At the end of the RT reaction, the tubes were heated at
90°C for 5 min to stop the reaction and then were stored at
80°C
until used in the PCR for specific mRNA analyses.
Polymerase chain reaction.
A relative RT-PCR method using 18S as an internal standard (Ambion,
Austin, TX) was applied to study the expression of specific mRNAs for
IGF-I, IGF-I receptor, IGF binding proteins (BP-4 and BP-5), myogenin,
cyclin D1, and p21. The sequences for the various primers used for the
specific target mRNAs are shown in Table 1. These primers were designed with the
Primer Select computer program (DNA Star), purchased from Life
Technology GIBCO, and were tested for their compatibility with the
alternate 18S primers. It should be noted that for IGF BP-4, the
primers' sequence is based on the mouse X76066 sequence. These mouse
primers were selected on the basis of regions that are highly similar
to the human IGF BP-4 cDNA, and they proved to be effective with rat
mRNA. In each PCR reaction, 18S ribosomal RNA was coamplified with the
target cDNA (mRNA) to serve as an internal standard and to allow
correction for differences in starting amounts of total RNA.
For the 18S amplification we used the alternate 18S internal standards
(Ambion), which yield a 324-bp product. The 18S primers were mixed with
competimers at an optimized ratio that could range from 1:4 to 1:10,
depending on the abundance of the target mRNA. Inclusion of 18S
competimers was necessary to bring down the 18S signal, which allows
its linear amplification to the same range as the coamplified target
mRNA (relative RT-PCR kit protocol; Ambion).
For each specific target mRNA, RT and PCR were carried under identical
conditions with the same reagent premix for all the samples to be
compared in the study. To validate the consistency of the analysis
procedures, at least one representative from each group was included in
each RT-PCR run.
One microliter of each RT reaction (0- to 10-fold dilution
depending on target mRNA abundance) was used for the PCR amplification. PCR was carried out in the presence of 2 mM MgCl2 with
standard PCR buffer (GIBCO), 0.2 mM dNTP, 1 µM specific primer set,
0.5 µM 18S primer-competimer mix, and 0.75 U of DNA Taq
polymerase (GIBCO) in a total volume of 25 µl. Amplifications were
carried out in a Stratagene Robocycler with an initial denaturing step of 3 min at 96°C, followed by 25 cycles of 1 min at 96°C, 1 min at
55°C (55-60°C depending on primers), 1 min at 72°C, and a
final step of 3 min at 72°C. PCR products were separated on a
2-2.5% agarose gel by electrophoresis and stained with ethidium
bromide, and signal quantification was conducted by laser scanning
densitometry, as reported previously (59). In this
approach, each specific mRNA signal is normalized to its corresponding
18S. For each primer set, PCR conditions (cDNA dilutions, 18S
competimer-primer mix, MgCl2 concentration, and annealing
temperature) were set to optimal conditions, so that both the target
mRNA and 18S product yields were in the linear range of the semilog
plot when the yield is expressed as a function of the number of cycles.
Phosphorylation state of intracellular signaling proteins.
The phosphorylation states of the p70-S6 kinase (S6K1) and
extracellular signal-regulated kinases 1 and 2 (ERK1/2) were examined by immunoblotting with phosphospecific antibodies (Cell Signaling Technology, Beverly, MA). The antibodies used detected changes in
phosphorylation at sites critical for increased activity in vivo
(22, 60). Muscle samples were extracted by homogenization in 7 vols of ice-cold buffer A [50 mM Tris · HCl,
pH 7.8, 2 mM potassium phosphate, 2 mM EDTA, 2 mM EGTA, 50 mM
-glycerophosphate, 10% glycerol, 1% Triton X-100, 1 mM DTT, 3 mM
benzamidine, 1 mM sodium orthovanadate, 10 µM leupeptin, 5 µg/ml
aprotinin, 200 µg/ml soybean trypsin inhibitor, and 1 mM
4-(2-aminoethyl)benzenesulfonyl fluoride (AEBSF)] with a
motor-driven glass pestle. The homogenate was immediately centrifuged
at 12,000 g for 30 min at 4°C. The supernatant was
immediately saved in aliquots at
80°C for subsequent use in
immunoblotting. The supernatant protein concentration was determined by
using the Bio-Rad protein assay with BSA as the standard. Approximately
50 µg of supernatant proteins were subjected to sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE; 12.5% T),
according to a standard protocol (24), and then
electrophoretically transferred to a polyvinylidene difluoride (PVDF)
membrane (Immobilon-P) with 10% methanol, 1 mM orthovanadate, 25 mM
Tris, and 193 mM glycine, pH 8.3. Phospho-ERK1/2 and phospho-S6K1 were
detected with phosphorylation state-specific antibodies (Cell Signaling Technology) and an enhanced chemiluminescence (ECL) method of detection
(Amersham). Signal intensity was determined by laser scanning
densitometry (Image Quant; Molecular Dynamics). For each specific
antibody, all the samples were run under identical (previously optimized) conditions, including the transfer on the membrane, the
reaction with the first and secondary antibodies, washing conditions,
ECL detection, and the film exposure. To ensure the consistency of this
analysis, at least one representative sample from each group was
included in each gel run and Western blot analysis. In addition, a
positive control, provided by the antibody supplier, was run on each
gel to allow for normalization. For each set of Western blotting and
detection conditions, the detected signal was directly proportional to
the amount of protein loaded on the gel over a 20- to 150-µg range
(data not shown).
Confocal microscopy for determination of cell volumes and
myonuclei number.
At the time of death, an ~5-mm segment was taken from the midbelly of
each muscle and frozen in isopentane that was cooled by liquid
nitrogen. Subsequently, the muscle sample was thawed as described by
Allen et al. (4), and single fibers segments (n
10 fiber segments/muscle) were isolated by placing the muscle sample in
a small dissection chamber containing a glycerol-relaxing solution
(50% glycerol, 2 mM EGTA, 1 mM MgCl2, 4 mM ATP, 10 mM imidazole, 100 mM KCl, pH 7.0). Dissection was performed with a
microscope (Technival 2, Jena, Germany) with back lighting and microsurgical forceps (super fine Dumont tweezers; Biomedical Research
Instruments, Rockville, MD). Isolated fiber segments were placed into a
PBS solution containing Hoechst 33258, a DNA binding agent that
acquires specific excitation/emission spectrum properties on DNA
binding and thus can be used to image the nuclei with fluorescence
microscopy (Molecular Probes, Eugene, OR). The fiber segment was then
washed several times in PBS and then placed into a PBS solution
containing BODIPY-labeled phallicidin (Biomolecular Probes).
Phallicidin binds selectively to actin and serves as a tool for
identifying the dimensions of the fiber. After these labeling
procedures, the fiber segment was washed in PBS and mounted on a glass
slide with glycerol. The coverslip had struts to prevent compression of
the muscle fiber segment when it was mounted. The volume of a muscle
fiber segment, its length, and the corresponding number of myonuclei
were determined with a MRC 600 Bio-Rad laser scanning confocal
microscope and a magnification of ×400. The images were then
reconstructed and rendered with Advanced Visualization Software version
6.0 (AVS; Waltham, MA). By using the volume integration module of AVS,
it was possible to determine the volume of the single-fiber segment.
This approach allows the expression of myonuclei distribution relative
to length (nuclei/mm) and volume (µm3/nuclei). All
measurements of muscle fiber segment length and volume were normalized
to a sarcomere length of 2.5 µm. This sarcomere length was chosen
because this was the value observed by us in other studies in our
laboratories examining the architecture of the plantaris muscle
(unpublished observations; n
24,000 measurements of
sarcomere length).
MHC isoform analysis.
A portion of each muscle sample was homogenized in a solution that
contained (in mM) 250 sucrose, 100 KCl, 5 EDTA, and 10 Tris-base. The
homogenate protein was diluted to 1 mg/ml in a storage buffer
containing 50% glycerol, 100 mM
Na4P207, 5 mM EDTA, and 2 mM
2-mercaptoethanol (pH 8.8) and stored at
20°C until subsequent
analyses for MHC protein content.
Skeletal MHCs were separated with a SDS-PAGE technique. The method used
is a modification of that published by Talmadge and Roy
(55), which allows for the detection of all six rat MHC isoforms (3). The separating gel contained 30% glycerol,
8% acrylamide, 1.5 M Tris-base, 1 M glycine, and 10% SDS. The
stacking gel contained 4% acrylamide, 30% glycerol, 0.5 M
Tris · HCl, 100 mM EDTA, and 0.4% SDS. Protein samples were
denatured by placing 5 µg of sample in 35 µl of sample buffer and
heating the solution for 2 min at 100°C. The sample buffer consisted
of 5%
-mercaptoethanol, 100 mM Tris-base, 5% glycerol, 4% SDS,
and bromophenol blue. The gels were run at 275 V for ~22 h under
refrigeration. The gels were stained with Brilliant Blue G 250 (Sigma)
and destained, and then they were scanned and quantified with a
Molecular Dynamics densitometer (Sunnyvale, CA). The peaks of interest
representing the distinct MHC isoforms were identified in the digitized
densitometric data sets. The area of each peak was determined by
integration and was indicative of the relative expression of the
corresponding MHC isoform.
Statistical analysis.
All values are reported as means ± SE. For each time point,
treatment effects were determined by ANOVA with post hoc testing [Student-Newman-Keuls (SNK)] with the Prism software package
(Graphpad). Pearson correlation analysis was used to assess the
relationship between myofibrillar protein and DNA and between p21 and
myogenin with the Prism package. For all statistical tests the 0.05 level of confidence was accepted for statistical significance.
 |
RESULTS |
At the end of 3 mo after irradiation, the body weight of the
-radiation-treated rats was not different from that of the untreated control group [305 ± 5 and 318 ± 6 g, respectively
(synergist ablation removes ~4 g of muscle)]. This result indicates
that the localized irradiation did not have any adverse effects on the
generalized growth of the treated animals (initial body wt 212 ± 3 g). In addition, pilot data indicated that the myofibrillar yield, cross-sectional area (CSA), and force production of irradiated muscles were not altered relative to controls 4 wk after this irradiation protocol was imposed (data not shown).
Muscle hypertrophy.
Fifteen days of overload resulted in significant muscle hypertrophy in
non-irradiated overloaded (OL) muscles as evidenced by increased muscle
mass (Fig. 1A). Ninety days of
overload resulted in further hypertrophy (Fig. 1). In the overloaded
muscles that were irradiated (OL-Ir), there was a small increase in
mass at both 15 and 90 days after treatment relative to the
t = 0 normal control muscles. When normalized to body
mass, the observed changes in mass in the OL-Ir group at 90 days were
no longer significant (Fig. 1B). In addition, the 90-day
values for the OL-Ir muscles were not different from those of the
90-day untreated controls (Fig. 1). Similar results were seen for the
total muscle protein content (data not shown).

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 1.
A: removal of synergists results in a
substantial increase in plantaris muscle wet weight in nonirradiated
(OL) muscles. A small but significant hypertrophy response was detected
in the overloaded-irradiated (OL-Ir) muscles at 15 days, with no
further increase in mass over 90 days of overload treatment. The mass
of the plantaris muscles from control rats increased as a result of
growth such that the absolute weight of the muscles of the 90-day
control group was significantly larger than that from the rats killed
at the beginning of the study (time t = 0).
B: when normalized for body weight increases, the plantaris
wet weight of the 90-day OL-Ir muscles and the 90-day control muscles
was not different than that of the t = 0 control rats.
*P < 0.05 vs. t = 0;
#P < 0.05 vs. OL (contralateral muscle).
|
|
Myofibrillar protein was used as a conservative marker of hypertrophic
adaptation to avoid the potential complications of acute inflammatory
response that may occur with this treatment during the first 3-5
days (5). The myofibrillar protein content of the OL
plantaris muscles was significantly increased at 7 (27%), 15 (57%)
and 90 (2.6-fold) days after surgery compared with the zero time point
control muscles (Fig. 2). In contrast,
the OL-Ir muscles demonstrated only a transient increase at the 24 h time point (Fig. 2). The young adult female rats used in this study continued to increase body mass (+50%) over the 3-mo period of this
study. As a result, some portion of the observed myofibrillar protein
increase was most likely related to this generalized growth process.
For example, compared with the 90-day control, the increase in 90-day
OL muscle myofibrillar protein was 1.8-fold as opposed to a 2.6-fold
increase compared with the t = 0 controls (Fig. 2).

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 2.
Myofibrillar protein content of the OL muscles was
progressively increased by 7, 15, and 90 days of overload treatment. A
small increase in myofibrillar protein in the OL-Ir muscles was evident
after 1 day of increased loading. The myofibrillar protein content of
the 90-day control rats was higher than that of the t = 0 controls. *P < 0.05 vs. t = 0.
|
|
The myofibrillar protein content of the OL-Ir muscles at 90 days was
not different from that of untreated muscles of animals in the 90-day
control group. However, the myofibrillar protein content of the 90-day
control muscles had increased ~40% compared with the t =
0 controls (Fig. 2). This suggests that the myofibrillar protein
content of the OL-Ir muscles remained proportional to the amount of
body growth seen over the 90 days.
Cell proliferation.
The DNA content of both OL and OL-Ir muscles was increased at 15 and 90 days after treatment compared with the t = 0 control group (Fig. 3). However, the increase in
DNA content seen in the OL-Ir muscles was smaller than that in the OL
group. The DNA content of the OL-Ir group was not different from that
seen in the 90-day controls. In both OL and OL-Ir muscles, the
concentration of DNA (e.g., in mg/g) was unchanged over time (data not
shown). This finding demonstrates the apparent coordination of DNA and
cell size in both growing and hypertrophying muscles.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 3.
Overload stimulus resulted in a significant increase in
DNA content in the OL muscles. A small but significant increase in DNA
content was also seen in OL-Ir muscles at 15 days, with no further
increase in DNA detected over the remainder of the 90-day overload
treatment. DNA content of the plantaris muscles from control rats was
increased at 90 days. There were no changes in DNA concentration in any
muscles (data not shown). *P < 0.05 vs.
t = 0; #P < 0.05 vs.
OL.
|
|
Over the course of this study, the relationship between DNA and
myofibrillar protein content followed a similar pattern in the OL and
OL-Ir groups (Fig. 4A).
Consistent with the possibility of an early inflammatory response
(5), there was a small increase in DNA at the early time
points after the ablation surgery in both groups. Despite this early
complication, the overall relationship between DNA and myofibrillar
protein resulted in a strong correlation in the OL muscles (Fig.
4B). In contrast, the early increases in DNA in the OL-Ir
muscles were not paralleled by increased myofibrillar protein and hence
did not show a significant correlation (data not shown). Figure
4A is essentially a combination of the data presented in
Figs. 2 and 3. Thus it is particularly striking to note that the large
increase in DNA content (Fig. 3) seen in the OL muscles is associated
with an increase in myofibrillar protein (Fig. 2) such that the ratio
of these two variables is the same as that seen for the control groups
at 90 days (Fig. 4A).

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 4.
A: ratio of DNA to myofibrillar content
changed with a similar pattern in both OL and OL-Ir plantaris muscles.
There was no change in this ratio in the muscles from control rats.
B: there was a significant correlation between myofibrillar
protein and DNA content in the OL but not the OL-Ir plantaris muscles.
*P < 0.05 vs. t = 0.
|
|
Myonuclear analysis.
CSA and myonuclear number were determined in single fibers from
t = 0 and 90-day plantaris muscles. CSA of myofibers
from the OL muscles was significantly increased (46%) at 90 days after overload (Fig. 5A). There was
no change in the CSA of myofibers from OL-Ir muscles. The number of
myonuclei per millimeter of myofiber length was significantly increased
in myofibers from the OL (44%) but not the OL-Ir plantaris
muscles (Fig. 5B). As a result of the increase in
myonuclei in the OL muscles, the myofiber volume-to-myonucleus ratio
remained unchanged (Fig. 5C).

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 5.
A: overload resulted in a significant increase
in the cross-sectional area of OL but not OL-Ir plantaris muscle
fibers. B: there was an increase in no. of myonuclei per
millimeter of myofiber in the OL but not OL-Ir myofibers. C:
ratio of the myofiber volume per myonucleus was unchanged in both the
treatment and control groups. *P < 0.05 vs.
t = 0; #P < 0.05 vs.
contralateral OL-Ir.
|
|
Cellular signaling response to increased loading.
The phosphorylation state of both S6K1 and 4E binding protein 1 (4E-BP1) was markedly increased at very early time points after the
imposition of increased loading in both OL and OL-Ir muscles (Fig.
6). In the OL muscles, phosphorylation of
4E-BP1 and S6K1 remained elevated through the 15-day time point and
returned to control levels by 90 days. In the OL-Ir muscles, the
increase in phosphorylation of these proteins appeared to be resolved
by the 7 day time point (Fig. 6).

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 6.
Phosphorylation state of the inhibitory eukaryotic
initiation factor 4E binding protein (4E-BP1; A and
B) and of p70 S6 kinase (S6K1; C and
D) was increased in both OL and OL-Ir plantaris muscles at
early time points. Phosphorylation state of 4E-BP1 and of S6K1 in the
OL and OL-Ir muscles diverged after 3 days. There was no change in
4E-BP1 or S6K1 phosphorylation state in the muscles from control rats
( ). A and C are representative
Western blot images for 4E-BP1 and phospho-S6K1, respectively.
Phosphorylation state for 4E-BP1 represents the ratio between
slow-migrating isoforms ( and ) and faster-migrating forms ( and ) (13). NC, normal control; a, OL; b, OL-Ir.
*P < 0.05 vs. t = 0.
|
|
The phosphorylation of both ERK1 and -2 was increased at very early
time points after the initiation of overloading in both OL and OL-Ir
muscles (Fig. 7). By 7 days after
treatment, the phosphorylation levels of the ERKs had returned to or
below the baseline values.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 7.
A: representative Western blot image for
phospho-extracellular signal-regulated kinase (ERK)1/2 detection. Both
ERK1 (p44) and ERK2 (p42) are detected with the same phosphospecific
antibody. Phosphorylation state of ERK1 (B) and -2 (C) was increased in both OL and OL-Ir plantaris muscles at
very early time points, then declined in parallel. There was no change
in ERK1 and -2 phosphorylation state in the muscles from control rats.
*P < 0.05 vs. t = 0.
|
|
Molecular marker responses to increased loading.
The amount of total RNA per muscle increased in both OL and OL-Ir
muscles through 7 days of increased loading (Fig.
8A). This value remained
elevated in the OL muscles through 90 days, whereas in the OL-Ir
muscles it returned to baseline between the 7 and 15 day time points.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 8.
Total RNA (A) and total mRNA (B)
per muscle were significantly increased in both OL and OL-Ir plantaris
muscles until the 7 day time point. Both RNA and mRNA remained
significantly elevated through 90 days in OL but not OL-Ir muscles.
There was a significant increase in total mRNA but not total RNA at 90 days in the muscles from control rats. *P < 0.05 vs.
t = 0. x-Axes in arbitrary scan units.
|
|
A similar pattern was seen for total mRNA, which remained elevated
through 90 days in the OL muscles but declined to control levels by 15 days in the OL-Ir muscles (Fig. 8B). The proportion of mRNA
to total RNA as determined by dT-to-18S ratio was essentially unchanged
during the course of the study (data not shown).
The expression of the mRNA for the mechanosensitive isoform of IGF-I
(MGF; Ref. 18) was significantly upregulated at 1 and 3 days after treatment and then declined toward baseline values in both
OL and OL-Ir muscles (Fig. 9). Other
components of IGF-I-related systems also changed in a similar pattern
in both OL and OL-IR muscles. Similar to our previous reports (2,
16), overloading significantly increased the expression of IGF-I
mRNA by 24 h of treatment, returning to baseline values between
the 15 and 90 day time points (data not shown). The increase in IGF-I
mRNA was similar for OL and OL-Ir muscles. The mRNA for the type 1 IGF-I receptor was significantly increased only at the 1 day time point in both OL and OL-Ir muscles (data not shown). The mRNA for IGF BP-5
was unchanged, whereas that for IGF BP-4 was increased similarly in OL
and OL-Ir muscles at 3 and 7 days of increased loading (data not
shown).

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 9.
mRNA for mechanosensitive growth factor (MGF) was
significantly increased in both OL and OL-Ir plantaris muscles until
the 3 day time point, then declined toward baseline. There was no
change in MGF mRNA in the muscles from control rats. *P < 0.05 vs. t = 0.
|
|
The expression of the mRNA for the myogenic regulatory factor myogenin
was significantly elevated to a very similar degree at 24 and 72 h
after the overloading surgery in OL and OL-Ir muscles (Fig.
10). The expression of this mRNA
declined to baseline in both muscles at 15 days but was again
significantly increased at 90 days in the OL-Ir muscles but not the OL
muscles. The pattern of changes seen in the expression of MGF and
myogenin appeared to be quite similar.

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 10.
mRNA for the myogenic regulatory factor myogenin was
significantly increased in both OL and OL-Ir plantaris muscles until
the 3 day time point, then declined toward baseline. Myogenin mRNA was
significantly increased at 90 days in the OL-Ir muscles. There was no
change in myogenin mRNA in the muscles from control rats.
*P < 0.05 vs. t = 0.
|
|
Increased expression of cyclin D1 and the cyclin-dependent kinase
inhibitor (CKI) p21 are indicative of cells either entering into the
cell cycle (cyclin D1) or exiting from the cell cycle (p21). The
expression of cyclin D1 mRNA increased significantly in both OL and
OL-Ir muscles, indicating that a population of cells within the muscles
was preparing to become mitotically active (Fig.
11). The increase in cyclin D1 was much
greater in the OL-Ir muscles than in the OL muscles at all time points.
For example, at 3 days the cyclin D1 mRNA was increased approximately
threefold and fivefold in OL and OL-Ir muscles, respectively. Cyclin D1 mRNA remained elevated in the OL-Ir muscles throughout the 90 days of
the study. In the OL muscles, cyclin D1 mRNA tended to be increased,
but this change (vs. t = 0) was significant only at 1 and 3 days after treatment (Fig. 11).

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 11.
mRNA for the cell cycle regulator cyclin D1 was
significantly and similarly increased in both OL and OL-Ir plantaris
muscles until the 3 day time point. Cyclin D1 mRNA remained elevated
throughout the 90-day overload period in the OL-Ir but not the OL
muscles. There was no change in cyclin D1 mRNA in the muscles from
control rats. *P < 0.05 vs. t = 0;
#P < 0.05 vs. OL.
|
|
The expression of p21 mRNA was increased at very early time points in
both OL and OL-Ir muscles (Fig. 12).
However, there was a much greater increase in p21 mRNA expression in
OL-Ir than in OL muscles. As we previously reported (2,
16) there was a significant correlation (r = 0.77, P = 0.04) between the increased expression of p21
mRNA and myogenin mRNA in OL but not OL-Ir muscles.

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 12.
mRNA for the cyclin-dependent kinase inhibitor p21 was
significantly increased through 3 and 7 days in OL and OL-Ir plantaris
muscles, respectively. Increase in p21 D1 mRNA in the OL-Ir muscles was
greater than that seen in OL muscles at most time points. There was no
change in cyclin D1 mRNA in the muscles from control rats.
*P < 0.05 vs. t = 0.
|
|
The expression of actin and MHC mRNA were used to assess contractile
protein-specific molecular responses to increased loading. The amount
of MHC mRNA in the OL-Ir muscles did not increase relative to
t = 0 values and was significantly lower at 90 days
compared with the 90-day control muscles. The amount of MHC mRNA per OL muscle was significantly increased after the 15 day time point (Fig.
13A). In contrast, the
amount of actin mRNA present in muscles increased at earlier time
points and remained elevated over the 90-day course of this study in OL
but not OL-Ir muscles (Fig. 13B).

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 13.
A: mRNA for myosin heavy chain (MHC) (probe
common to all rat isoforms) was significantly increased in OL plantaris
muscles at both 15 and 90 days. There were no significant changes in
MHC mRNA in the muscles from OL-Ir or control rats. B: mRNA
for -skeletal actin was significantly increased in OL plantaris
muscles at 7, 15, and 90 days. There were no significant changes in
-actin mRNA in the muscles from OL-Ir or control rats.
*P < 0.05 vs. t = 0. x-Axes
in arbitrary scan units.
|
|
MHC isoforms.
Increased mechanical loading of the plantaris resulted in the classic
fast-to-slow shift in MHC protein expression in both OL and OL-Ir
muscles (Fig. 14). This pattern of
adaptation appeared to be accentuated in the OL-Ir muscles. For
example, the type I MHC isoform, representing the slowest phenotype,
represented <5% of the total MHC pool in control rat plantaris
muscles. In the OL-Ir muscles, this isoform was increased more than
eightfold to 20% of the total MHC present. Similarly, the IIb MHC
expression declined by 62% in OL muscles and 80% in OL-Ir muscles. As
a result of the exaggerated adaptation of the OL-Ir muscles, ~50% of
the MHC present was either type I or IIa, whereas these isoforms
represented only ~25% of the MHC in the OL muscles.

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 14.
A: representative gel image for MHC isoform separation.
Proportion (% of total) of MHC protein isoforms present in OL and
OL-Ir plantaris muscles changed significantly over the 90-day treatment
period. B: type IIa MHC increased significantly in both OL
and OL-Ir muscles. C: type I MHC increased significantly in
OL-Ir but not OL muscles. D: decrease in expression of MHC
IIb in both OL and OL-Ir muscles was significant at both the 15 and 90 day time points. E: type IIx MHC increased in both muscle
treatment groups and was significant at both 15 and 90 days. In the
muscles from control rats, the only significant change was an increase
in type IIx MHC at 90 days. *P < 0.05 vs.
t = 0; #P < 0.05 vs. OL.
|
|
 |
DISCUSSION |
Irradiation has been used for some time in studies of
skeletal muscle regeneration and compensatory growth. Originally, this modality was used to block skeletal muscle regeneration after injury.
The interpretation of the results of these various studies has been
predicated on the notion that the lasting effects of the radiation
treatment were those associated with chromosomal damage (e.g., double
strand breaks, cross-linking, base pair loss, etc). It is commonly
assumed that the primary outcome of this treatment involves the
prevention of mitotic activity within the affected muscles.
More recently, a number of studies have demonstrated that irradiation
also appears to prevent skeletal muscle hypertrophy in rats (21,
35, 39-41). However, these studies were conducted before
reports that 1) identified a population of stem cells that are apparently resistant to radiation-induced damage (20)
and 2) found that stem cells from extramuscular tissues can
be incorporated into skeletal muscles (12). Because the
cited irradiation studies were carried out over a relatively short time
span (4 wk), they did not rule out the possibility that extramuscular
and/or radiation-resistant stem cells might eventually contribute to
the development of compensatory hypertrophy given a longer overload
stimulus. The results of the current study extend the period for
postirradiation overloading to 3 mo. In that extended period, the
hypertrophy response was negligible in the OL-Ir muscles.
Prevention of hypertrophy is not absolute.
At the 15 day time point there was a small but significant increase in
the mass and myofibrillar protein content of the OL-Ir plantaris
muscles (Figs. 1 and 2). During this time period, the DNA content of
the OL-Ir muscles also increased by a small but significant amount
(Fig. 3). This suggests the possibility that a small number of
satellite cells or myogenic precursor cells (MPC) within the irradiated
muscles may have been able to complete mitosis. These cells may have
been undamaged by the irradiation treatment or have been able to affect
repairs to their DNA (29). Alternatively, there may have
been a small population of unfused satellite cells or MPCs that
responded to the overload stimulus via differentiation and fusion with
myofibers. In support of this second alternative, in a study with finer
temporal resolution, we found (2) that the increase in
expression of p21 and myogenin mRNA precedes that of cyclin D1 in
response to increased loading and thus may signal the presence of such
a cell population. Over the remainder of the 3-mo course of this study,
the myofibrillar protein content of the OL-Ir muscles remained
essentially constant, e.g., they did not experience the large increase
in myofibrillar protein accumulation seen in the OL muscles (Fig. 2).
Assuming that normal cycles of protein turnover continued, these
results suggest that the housekeeping mode of transcription and
translation was unimpaired by the irradiation treatment. The small
increase in myofibrillar protein seen in the early stages of the OL-Ir treatment also suggests that the myofibers had the capacity not only to
renew components of the contractile machinery but also to implement a
growth and/or limited hypertrophy program. In addition, the current
data would suggest that the inhibition of the hypertrophy response was
not related to the production of muscle-specific mRNAs, such as that
for MHC, because the conversion from fast to slow MHC expression was
robust in the irradiated muscles. In contrast to the OL-Ir muscles, the
contralateral OL muscles demonstrated a continuous compensatory
hypertrophy response detectable from 7 days onward (Fig. 2).
Differential responses to overload.
Examination of the data from the first 3-7 days of overload in
this study suggests that the responses of the OL and OL-Ir muscles were
not different. The first significant divergence in response between
these two treatments can be seen in what arguably might be the most
temporally sensitive measurements, the increased phosphorylation of
S6K1 and 4E-BP1. Increases in the phosphorylation of S6K1 and 4E-BP1
have been reported to be associated with an increase in translation and
are known to occur in response to 1) increased muscle
loading and/or 2) IGF-I receptor ligation (10, 11, 13,
23, 34, 62). The activation of S6K1 has a relatively modest
positive impact on translation in general, but, more importantly, it
increases the translation of specific mRNAs that encode components of
the translational apparatus itself (19, 56).
Phosphorylation of 4E-BP1 results in its dissociation from the
eukaryotic initiation factor (eIF)4G binding site on eIF4E, allowing
for the formation of the translation initiation complex and thereby
increasing translation (53). At 3 days after treatment the
phosphorylation of S6K1 was increased more than sixfold in both OL and
OL-Ir muscles. However, at 7 days, when phospho-S6K1 was increased
fivefold in the OL muscles, it was not different from control in OL-Ir
muscles. Subsequent to this response, other parameters demonstrated
similarly dramatic divergence. For example, at 7 days after treatment
total RNA was increased approximately twofold in both OL and OL-Ir
muscles. At 15 days, the RNA of the OL muscles was still increased more
than twofold, whereas the RNA content of the OL-Ir muscles had
essentially returned to baseline. The total RNA pool primarily reflects
the amount of ribosomal RNA present and thus is indicative of the
translational capacity of the tissue. Similar to the total RNA pool,
the total mRNA present in both sets of muscles was increased at early
time points and then diverged between 7 and 15 days. Interestingly, the
changes in specific mRNA expression did not demonstrate this pattern of
abrupt divergence. In each case there was no difference (e.g., MGF and
myogenin), a greater excursion (e.g., cyclin D1 and p21), or a lack of
response (e.g., actin and MHC) in the OL-Ir muscles.
The observation of correlations between increased myogenin and p21
expression suggests that the process of satellite cell differentiation
is underway in overloaded skeletal muscles (2). In the
current study the increase in expression of myogenin was similar in OL
and OL-Ir muscles. However, the increase in p21 mRNA levels was much
greater in the OL-Ir muscles and did not correlate with the changes in
myogenin. In general, the CKI p21 is thought to participate in the
initiation of the differentiation process. Because it did not appear
that the OL-Ir muscles were increasing their complement of DNA (and
therefore cell number), the increase in differentiation signaling
appears to be a paradox. However, in this instance the greatly
increased p21 expression may be unrelated to the overloading stimulus.
For example, there is evidence that cellular responses to
radiation-induced DNA damage include withdrawal from the cell cycle to
institute repair processes (see, e.g., Ref. 31). This
process is mediated by p53, which is upstream from p21. Therefore, the
increase in p21 expression seen in the OL-Ir muscles may reflect
periods during which mechanisms involved in attempts at chromosomal
repair are active rather than processes involved in muscle hypertrophy.
An additional point of divergence in the response to increased loading
is evident in the expression of MHC proteins (Fig. 14). The exaggerated
shift to slower MHC expression in the OL-Ir muscles represents a
compensatory adaptation most likely stimulated by the inability of
these muscles to increase their mass or CSA. This shift would provide
for greater energetic economy as the overloaded muscles cope with the
demands of increased loading.
The data from this study suggest several mechanistically important
conclusions. First, the initial ability of the OL-Ir muscles to respond
appropriately to the increase in loading state indicates that the
cellular systems associated with anabolic processes (e.g., increased
translation and transcription) were probably not damaged by the
irradiation treatment. Second, the myonuclei of the OL-Ir muscles
continued to participate in the adaptation process via the shift in MHC
protein expression.
Unfortunately, the methods used in this study do not allow for the
differentiation of responses that would be purely anabolic from those
that were promoting attempts at cellular proliferation. For example,
increased protein production within myofibers is probably reflected by
the increase in total RNA as more ribosomes are produced to meet the
demand for translation. However, ribosomal synthesis would also be
expected to increase markedly in cells that are becoming mitotically
active (see, e.g., Ref. 61). Similarly, activation of the
pathways including S6K1 activation would also be critical for both
anabolic processes and cellular proliferation (19, 23). As
a result, it is difficult to speculate on the mechanisms underlying the
observed divergence responses in the OL vs. OL-Ir muscles. However, it
seems clear that some regulatory processes acted to downregulate
cellular responses in the OL-Ir muscles in the 3- to 15-day time frame.
It is possible that this is simply a result of the aborted mitotic
processes in the incapacitated stem cell populations. However, the
magnitude of the changes (e.g., doubling of the RNA content; a 6- to
7-fold increase in phospho-S6K1) suggests that a significant portion of
this activity was occurring in the myofibers because these cells
represent the majority of the tissue mass. This conclusion is supported
by the cyclin D1 and p21 mRNA data (Figs. 11 and 12), which indicate
that stem cells within the OL-Ir muscles were continually attempting to
enter the cell cycle throughout the study period. These cells would be
expected to have elevated levels of growth-promoting signals and
components; however, the OL-Ir data do not reflect a substantial contribution from this cell population (e.g., mostly baseline values).
This lack of contribution from muscle stem cells agrees with results of
previous studies such as that published by Phelan and Gonyea
(35) in which the incorporation of bromodeoxyuridine, a
marker of mitotic activity, was greatly increased in OL but not OL-Ir muscles.
Role of muscle stem cells.
The premise that the failure of stem cells to provide nuclei to
myofibers is the primary lesion imposed by the irradiation treatment
implies that some processes related to myonuclear function are limiting
for the development of hypertrophy. In the case of injury-regeneration
studies, the necessity for mitotic activity is relatively clear; muscle
cells are destroyed by toxins or mechanical damage and therefore must
be replaced by the de novo development of myotubes via the
proliferation, differentiation, and fusion of muscle stem cells
(satellite cells and/or MPCs). However, in the context of skeletal
muscle compensatory hypertrophy, the requirement for mitotic activity
is less obvious. If, in fact, the fusion of newly made myoblasts with
existing myofibers is required for the hypertrophy response, then this
would suggest that a number of nuclear processes were already
functioning at or near maximal capacity in the existing myofibers
before the increase in loading. This raises a number of intriguing
questions. The most obvious of these questions is what specific
processes, mediated by myonuclei, actually limit the development of
myofiber hypertrophy. Second, why does a lack of newly formed myonuclei
more or less permanently prevent hypertrophy rather than just slowing
the process? For example, in the rat synergist ablation model, the
absolute stimulus for the hypertrophic response is essentially
continuous, whereas the relative stimulus declines as the muscle
enlarges. Logic would suggest that in response to this stimulus, the
existing mechanisms for fiber hypertrophy would remain activated until
the stimulus for adaptation declines. However, in irradiated muscles,
this does not appear to be the case. The various markers of anabolism, such as enhanced translation initiation (e.g., S6K1 and 4E-BP1) or
increased translational capacity (e.g., total RNA) initially respond appropriately but then return to baseline levels even though
the overload stimulus apparently continues.
Nuclear function and hypertrophy.
The results of this study appear to support the hypothesis that the
irradiation protocol inhibits compensatory hypertrophy via the
prevention of cell proliferation, ultimately depriving the myofibers of
their needed reserve for expansion of the myonuclear pool. If this is
the case, then an examination of potential mechanisms for this result
is warranted.
One of the primary limitations imposed by the bulk amount of DNA
present in a given myofiber is the ability to produce the apparatus for
mRNA translation (28). Although protein production via
mRNA is subject to potential amplification via multiple translations by
ribosomes, rRNA and tRNA are the final gene products; thus mass
production requires many DNA templates (14, 28). As
reviewed by Booth et al. (7), there is evidence that a
general increase in translational efficiency occurs at the onset of
muscle hypertrophy. However, sustained increases in protein production
appear to require substantial increases in the translational machinery.
For example, in the hypertrophying heart, early adaptations include an
increase in translational efficiency and an acceleration of the
synthesis of new ribosomes (30, 50). In multinucleated
myofibers, current dogma suggests that the number of copies of rRNA and
tRNA genes can only be manipulated via changes in the number of nuclei present.
There is evidence that higher volumes of transcriptional activity will
require an increase in space within the nucleus (14). Thus
it is possible that the physical spacing within the myonuclei may
become a limiting factor during times of high transcriptional activity.
If the dense packing of macromolecules within myofibers restricts the
expansion of nuclear volume, then it is possible that the addition of
satellite cells and their nuclei to myofibers might allow for the
distribution of transcriptional loads, thus surmounting this obstacle.
However, a number of reports indicate that the RNA produced by a
myonucleus may have a fairly limited range of distribution within a
myofiber (33, 37, 36). This would suggest that
differential transcription requiring mRNA translocation to other
myonuclear domains might not be an option for dealing with nuclear
space restrictions.
As a general rule, slow myofibers are thought to have a greater number
of myonuclei per millimeter and a lower cytoplasm volume-to-myonucleus ratio than fast myofibers (21, 47). In particular, the
difference in cytoplasm volume-to-myonucleus ratio between fast and
slow fibers in mixed fast muscles, such as the rat plantaris, is fairly pronounced (42, 58). It would therefore follow that the
OL-Ir muscles from the current study might have been expected to have a
decreased cytoplasm volume-to-myonucleus ratio compared with the
controls. However, despite a substantial shift toward slower MHC
expression, the whole muscle DNA concentration and single-fiber cytoplasmic volume-to-myonucleus ratio of the OL-Ir muscles were unchanged from controls. This suggests that the lower cytoplasmic volume-to-myonucleus ratio seen in slow fibers may not be a necessary condition for the expression of the type I MHC isoform.
Potential for adaptation after 3 mo.
The data from the OL-Ir muscles indicated a tendency toward an upswing
at 90 days for a number of measurements (Figs. 4A, 6B, 7, and 11-13). In the case of myogenin and cyclin
D1 mRNA, these increases were significant compared with the
t = 0 control values. This suggested that these muscles
might be entering a new phase of potentially anabolic activity that
could lead to a much delayed hypertrophy response. Accordingly, an
additional cohort of rats was subjected to OL-Ir protocol to allow for
an additional month (i.e., total of 4 mo) for the development of muscle
hypertrophy. At 4 mo we observed no indication of a hypertrophic
response (e.g., no increase in muscle mass) in the OL-Ir muscles of
these rats. Although these 4-mo observations demonstrate that the
increases in some cellular and molecular markers at 3 mo did not herald the delayed onset of a compensatory hypertrophy response, they did not
shed any light on the reason for these increases.
In summary, the results of this study demonstrate that irradiation
essentially prevents the development of compensatory hypertrophy in
rodent skeletal muscles for up to 4 mo. This would suggest that
neither endogenous or extramuscular stem cells contribute significantly
to the stem cell population of overloaded muscles, at least in this
time frame. Localized irradiation protocols do not appear to induce
significant damage to myofibers or the intrinsic mechanisms necessary
for them to adapt to increased loading. The results of this study tend
to support the hypothesis that the mechanisms by which myofibers adapt
to increased loading appear to include an obligatory "myogenic"
component involving the proliferation, differentiation, and fusion of
muscle stem cells with the existing myofibers.
The authors thank Anqi Qin, Ming Zeng, Sam McCue, and Mike Baker
for invaluable technical assistance.
This work was supported by National Space Biomedical Research Institute
Grant NCC9-58 (K. M. Baldwin) and National Institute of Arthritis
and Musculoskeletal and Skin Diseases Grants AR-45594 (G. R. Adams) and AR-46856 (V. J. Caiozzo).
Address for reprint requests and other correspondence:
G. R. Adams, Dept. of Physiology and Biophysics, Medical
Sciences I C308, Univ. of California, Irvine, CA 92697 (E-mail:
gradams{at}UCI.edu).
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 16 April 2002; accepted in final form 15 June 2002.