Am J Physiol Cell Physiol Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 283: C1114-C1121, 2002. First published June 13, 2002; doi:10.1152/ajpcell.00542.2001
0363-6143/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
283/4/C1114    most recent
00542.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Claydon, T. W.
Right arrow Articles by Orchard, C. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Claydon, T. W.
Right arrow Articles by Orchard, C. H.
Vol. 283, Issue 4, C1114-C1121, October 2002

Two pore residues mediate acidosis-induced enhancement of C-type inactivation of the Kv1.4 K+ channel

T. W. Claydon, M. R. Boyett, A. Sivaprasadarao, and C. H. Orchard

School of Biomedical Sciences, University of Leeds, Leeds LS2 9JT, United Kingdom


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Acidosis inhibits current through the Kv1.4 K+ channel, perhaps as a result of enhancement of C-type inactivation. The mechanism of action of acidosis on C-type inactivation has been studied. A mutant Kv1.4 channel that lacks N-type inactivation (fKv1.4 Delta 2-146) was expressed in Xenopus oocytes, and currents were recorded using two-microelectrode voltage clamp. Acidosis increased fKv1.4 Delta 2-146 C-type inactivation. Replacement of a pore histidine with cysteine (H508C) abolished the increase. Application of positively charged thiol-specific methanethiosulfonate to fKv1.4 Delta 2-146 H508C increased C-type inactivation, mimicking the effect of acidosis. Replacement of a pore lysine with cysteine (K532C) abolished the acidosis-induced increase of C-type inactivation. A model of the Kv1.4 pore, based on the crystal structure of KcsA, shows that H508 and K532 lie close together. It is suggested that the acidosis-induced increase of C-type inactivation involves the charge on H508 and K532.

acidosis; C-type inactivation; Kv1.4


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

KV1.4 IS A MEMBER of the Shaker subfamily of K+ channels. It is expressed in the heart, in human and ferret subendocardium, and in rat ventricular septum (1, 7, 17) and contributes to the transient outward current that underlies the early repolarization phase of the cardiac action potential. The Kv1.4 channel, like the Shaker channel, shows rapid activation upon depolarization followed by rapid inactivation during continued depolarization. The transient nature of the current is the result of rapid NH2-type inactivation (3, 5, 19) that involves occlusion of the intracellular mouth of the pore by an NH2-terminal domain. Removal of this domain abolishes rapid N-type inactivation and uncovers a slow C-type inactivation that occurs over a period of seconds rather than milliseconds (5, 13, 19). C-type inactivation is not fully understood (see Ref. 18 for review) but is known to involve structural rearrangement of the outer mouth of the pore (8, 9, 14) and to be dependent on the absence of K+ at a modulatory K+-binding site within the selectivity filter and the residues at positions 449 and 463 in Shaker channels (532 and 546 in Kv1.4, respectively). Mutation of these residues may influence the conformational changes associated with C-type inactivation or perhaps alter the K+ occupancy of the C-type inactivation modulatory site (12). Furthermore, Rasmusson et al. (14) demonstrated that, in the Kv1.4 channel, the rate of recovery from C-type inactivation controls the rate of recovery from N-type inactivation and therefore the refractoriness of the channel.

Acidosis alters the transient outward current in ventricular cells (6) and may therefore influence cardiac action potential duration. We have studied the effect of acidosis on the cloned Kv1.4 channel expressed in Xenopus oocytes (2). Acidosis has an inhibitory effect on current flow through the Kv1.4 channel during repetitive pulsing; this is the result of binding of protons to a histidine residue in the extracellular mouth of the pore (H508). Evidence suggests that this enhances C-type inactivation because, when C-type inactivation was abolished, by applying high extracellular K+ or introducing the mutation K532Y, the inhibitory effect of acidosis was also abolished. It is proposed that enhancement of C-type inactivation slows recovery from N-type inactivation, decreasing current amplitude during repetitive pulsing. In the present study, we have confirmed that C-type inactivation is enhanced by acidosis and have investigated the molecular mechanism by which binding of protons to H508 enhances C-type inactivation.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Molecular biology. Experiments were carried out on a truncated form of ferret heart Kv1.4 (fKv1.4 Delta 2-146) that lacks rapid N-type inactivation (14). The mutants fKv1.4 Delta 2-146 H508Q, fKv1.4 Delta 2-146 H508C, fKv1.4 Delta 2-146 H508E, fKv1.4 Delta 2-146 H508K, and fKv1.4 Delta 2-146 K532C were constructed using the Stratagene Quikchange Site-Directed Mutagenesis technique (Stratagene) according to the instructions of the manufacturer. Sense primers were GATGAACCTACTACCCAGTTCCAAAGCATCCC, GGATGAACCTACTACCTGTTTCCAAAGCATCCCG, GATGAACCTACTACCGAGTTCCAAAGCATCCCG, GGATGAACCTACTACCAAGTTCCAAAGCATCCCG, and GGCTATGGGGACATGTGTCCCATCACTGTGGGG, respectively. In all cases, vectors (pBluescript SKII+) containing the cDNA sequences were linearized with the restriction endonuclease Asp 718 (Roche Diagnostics, Lewes, UK), and cRNA was prepared from these templates with T3 RNA polymerase (Stratagene). Transcribed RNA was diluted in nuclease-free water at a final concentration of 50 ng/µl.

Electrophysiology. Xenopus laevis toads were terminally anesthetized by immersion in tricaine methanesulfonate (2 mg/ml; Sigma, Poole, UK) in accordance with the Home Office Animals (Scientific Procedures) Act of 1986. Stage V-VI oocytes were isolated and then defolliculated using a combination of collagenase treatment (1 h in 1 mg/ml collagenase type 1a; Sigma) and manual defolliculation. Defolliculated oocytes were incubated in Barth's medium for 2-24 h at 19°C before injection. Barth's medium contained (in mM) 88 NaCl, 1 KCl, 2.4 NaHCO3, 0.82 MgSO4, 0.33 Ca(NO3)2, 0.41 CaCl2, 20 HEPES, 1.25 sodium pyruvate, and 0.1 mg/ml neomycin (Sigma) with 100 U · 0.1 mg-1 · ml-1 penicillin-streptomycin mix (Sigma), titrated to pH 7.4 using NaOH. Oocytes were injected with 50 nl (2.5 ng) cRNA encoding fKv1.4 Delta 2-146 or one of the mutants using a Drummond digital microdispenser (Broomall). In control experiments, oocytes were injected with 50 nl nuclease-free H2O; in these cases, currents were negligible compared with currents in cells injected with cRNA. Currents were recorded 16-72 h after injection, using the two-microelectrode voltage clamp technique. Microelectrodes with a resistance of 0.6-3 MOmega (tip diameter, 1-5 µm) filled with 3 M KCl were used. Membrane currents were recorded using a Geneclamp 500 amplifier (Axon Instruments, Union City, CA) with computer-driven voltage protocols (Clampex software and Digidata 1200 interface; Axon Instruments). Currents were recorded during 15-s pulses to +60 mV from a holding potential of -80 mV at a pulse interval of 30 s. Experiments were performed at room temperature (20-22°C). During experiments, oocytes were perfused with ND-96 solution (in mM: 96 NaCl, 3 KCl, 1 MgCl2, 2 CaCl2, and 5 HEPES, titrated to pH 6.5-8.5 using NaOH) at a flow rate of 0.5 ml/min (bath volume, 400 µl). Oocytes were perfused with ND-96 solution at pH 7.4, and control recordings were obtained. Acid solution was then applied, and after 3 min recordings were made again. After a control solution wash, alkali solution was applied, and recordings were made after 3 min. Solutions of methanethiosulfonate {1 mM [2-(trimethylethylammonium)ethyl]/methanethiosulfonate bromide (MTSET) and 10 mM sodium (2-sulfonatoethyl)methanethiosulfonate (MTSES); Toronto Research Chemicals} in ND-96 solution were made immediately before use (pH 7.4). H2O2 (0.3%) solution was made from a 30% stock solution (Sigma) using ND-96 solution (pH 7.4). Recordings were made after a 3-min perfusion of MTSET, MTSES, or H2O2.

Analysis and statistics. Data were analyzed using pClamp software (Axon Instruments). Data are shown as means ± SE (number of oocytes). Peak current amplitude was not significantly affected by pH changes in the case of fKv1.4 Delta 2-146, fKv1.4 Delta 2-146 H508Q, fKv1.4 Delta 2-146 H508C, fKv1.4 Delta 2-146 H508E, or fKv1.4 Delta 2-146 K532C. However, some of the reagents used did affect current amplitude. MTSET reduced fKv1.4 Delta 2-146 H508C current by 36.3 ± 2.5% (n = 10; ANOVA, P < 0.05), whereas MTSES increased fKv1.4 Delta 2-146 H508C current by 12.2 ± 1.6% (n = 8; ANOVA, P < 0.05). The percentage reduction of current at 4 s was used to describe C-type inactivation. In addition, current decay was fitted by a single- or double-exponential function using pClamp software (Axon Instruments). Statistical analysis was carried out with one-way ANOVA using SigmaStat (SPSS Science, Chicago, IL). P < 0.05 were regarded as significant.

Modeling. The pore structure of Kv1.4 was modeled using the known crystal structure of the related bacterial K+ channel KcsA as a template using Swiss-Model's "First Approach Mode" (http://expasy.ch.swissmod/SWISS-MODEL.html) and "Swiss-Pdbviewer."


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Acidosis-induced enhancement of C-type inactivation. Truncation of the NH2-terminal domain (e.g., Delta 2-146 in fKv1.4) of rapidly inactivating voltage-gated K+ channels removes rapid N-type inactivation and reveals slow C-type inactivation. To measure C-type inactivation in fKv1.4 Delta 2-146, currents were recorded during 15-s pulses to +60 mV from a holding potential of -80 mV. Figure 1A shows typical fKv1.4 Delta 2-146 current traces recorded during perfusion with ND-96 solution at pH 6.5 (acidosis), 7.4 (control), and 8.5 (alkalosis). At control pH, 46.8 ± 1.4% of the current inactivated in 4 s (n = 6; Fig. 1B). During acidosis, the percentage inactivation at 4 s increased to 66.5 ± 1.5% (n = 6; ANOVA, P < 0.001 compared with pH 7.4; Fig. 1B). In contrast, during alkalosis, the percentage inactivation at 4 s decreased to 41.0 ± 1.6% (n = 6; ANOVA, P < 0.001; Fig. 1B). Thus the data shown in Fig. 1 show that acidosis enhances C-type inactivation with no significant effect on current amplitude; this confirms our prediction (2).


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 1.   Effect of pH on C-type inactivation in fKv1.4 Delta 2-146. A: fKv1.4 Delta 2-146 current at pH 6.5, 7.4, and 8.5 during 15-s pulse to +60 mV from a holding potential of -80 mV. Current amplitude was not significantly affected by pH changes. B: mean ± SE (n = 6) percentage inactivation at 4 s at each pH tested. *Significantly different (P < 0.001) from value at pH 7.4.

Involvement of H508. We have previously shown that H508 is the pH-sensitive site that mediates the effect of acidosis on the recovery from N-type inactivation (2). Figure 2 shows the effect of acidosis on C-type inactivation in mutant forms of fKv1.4 Delta 2-146 in which H508 was substituted by a glutamine (Q; Fig. 2A) or a cysteine (C; Fig. 2C) residue. At pH 7.4, C-type inactivation in both mutant channels was significantly (t-test, P < 0.001) less than that in fKv1.4 Delta 2-146; inactivation at 4 s was 32.6 ± 0.8% (n = 5) and 26.7 ± 0.6% (n = 5) in fKv1.4 Delta 2-146 H508Q and fKv1.4 Delta 2-146 H508C, respectively, compared with 46.8 ± 1.4% in fKv1.4 Delta 2-146. Furthermore, acidosis had no effect on C-type inactivation in either mutant channel. This is shown in Fig. 2, B and D, which shows the percentage inactivation at 4 s at each pH tested. In fKv1.4 Delta 2-146 H508Q, 32.9 ± 0.7, 32.6 ± 0.8, and 32.2 ± 0.5% of current inactivated by 4 s at pH 6.5, 7.4, and 8.5, respectively (n = 5; ANOVA, not significant; Fig. 2B). In fKv1.4 Delta 2-146 H508C, these values were 27.2 ± 0.8, 26.7 ± 0.6, and 24.2 ± 0.2%, respectively (n = 5; ANOVA, not significant; Fig. 2D). This suggests that H508 is also the pH-sensitive site that mediates the effect of acidosis on C-type inactivation.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 2.   Effect of pH on C-type inactivation in H508Q and H508C mutant channels. A and C: fKv1.4 Delta 2-146 H508Q (A) and H508C (C) current at pH 6.5, 7.4, and 8.5 during 15-s pulse to +60 mV from a holding potential of -80 mV. Current amplitude was not significantly affected by pH changes in either mutant channel. B and D: mean ± SE (n = 5) percentage inactivation at 4 s of H508Q (B) and H508C (D) mutant channels at each pH tested. *Significantly different (P < 0.05) from value at pH 7.4.

Charge at position 508 influences C-type inactivation. The imidazole side chain of histidine has a pKa value of ~6.2. The charge on H508 will therefore change with pH over the range used, and this may be important in mediating the effect of acidosis on C-type inactivation in Kv1.4. To test this, we mutated the histidine at 508 to a positively charged lysine (H508K), or we applied the thiol-specific methanesulfonate reagent MTSET to the fKv1.4 Delta 2-146 H508C mutant channel; MTSET will add a positively charged ethyl trimethylammonium group to the thiol group of the engineered cysteine at 508. Introduction of a fixed positive charge (K) at 508 caused channels to be nonfunctional. MTSET (1 mM) reduced peak current amplitude (Fig.3C). In addition, it significantly increased C-type inactivation in the mutant channel fKv1.4 Delta 2-146 H508C (Fig. 3, C and D), mimicking the effect of acidosis on the fKv1.4 Delta 2-146 channel (Fig. 1A). This is clearly shown by the normalized trace (in gray) in Fig. 3C; 51.8 ± 0.8% of current inactivated by 4 s during application of MTSET compared with 23.9 ± 1.4% during control conditions (n = 10; ANOVA, P < 0.001). Wash with ND-96 solution did not reverse the effect of MTSET (data not shown), indicating specific covalent interaction between MTSET and the engineered cysteine. However, breaking the covalent bond between MTSET and the engineered cysteine at 508, by application of dithiothreitol (1 mM), completely reversed the effect on current amplitude and C-type inactivation [21.6 ± 1.7% of current inactivated by 4 s (n = 5; Fig. 3D)]. In contrast, MTSET had little effect on the fKv1.4 Delta 2-146 channel, which lacks this engineered cysteine (Fig. 3, A and B). In the absence of MTSET, 42.1 ± 0.8% of current had inactivated by 4 s compared with 46.3 ± 0.8% during application of MTSET (n = 5). This small effect (ANOVA, P < 0.05) of MTSET was reversed during ND-96 wash (Fig. 3B).


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 3.   Effect of engineering a positive charge at position 508 on C-type inactivation. A and B: fKv1.4 Delta 2-146 current during 15-s pulse to +60 mV from a holding potential of -80 mV (A) and mean ± SE (n = 5) percentage inactivation at 4 s (B) at pH 7.4, during application of the positively charged thiol-specific methanethiosulfonate reagent MTSET, and during pH 7.4 wash. fKv1.4 Delta 2-146 current amplitude was not significantly affected by MTSET application. C and D: fKv1.4 Delta 2-146 H508C current during 15-s pulse to +60 mV from a holding potential of -80 mV (C) and mean ± SE (n = 10) percentage inactivation at 4 s (D) at pH 7.4, during application of MTSET, and during subsequent application of dithiothreitol (DTT). MTSET reduced peak current amplitude by 36.3 ± 2.5%. Gray trace: MTSET current normalized to the peak current at pH 7.4 in the absence of MTSET to highlight the effect on C-type inactivation. *Significantly different (P < 0.001) from value at pH 7.4 in absence of MTSET.

To investigate further the importance of the charge at position 508, we investigated the effect of a negative charge at 508. We mutated the histidine at 508 to a negatively charged glutamate (H508E), or we applied the negatively charged thiol-specific methanethiosulfonate reagent MTSES or the free radical donor H2O2 to the H508C mutant channel. Both MTSES and H2O2 react with the thiol group of the engineered cysteine to create a negative charge. H2O2 oxidizes cysteine to a cysteic acid (9). Figure 4 shows that the presence of a negative charge at position 508 had a small and inconsistent effect on C-type inactivation. 1) Introduction of a fixed negative charge (H508E, Fig. 4A) reduced C-type inactivation; 22.8 ± 1.0% of current inactivated by 4 s at pH 7.4 compared with 46.8 ± 1.4% in the fKv1.4 Delta 2-146 channel (n = 5-6; ANOVA, P < 0.05). This effect was significantly greater than the effect of replacing H508 with a neutral glutamine (H508Q; Fig. 2B) or cysteine (H508C; Fig. 2D) residue (n = 5-6; ANOVA, P < 0.05). Figure 4B shows that this mutation also abolished pH sensitivity: 25.2 ± 0.8, 22.8 ± 1.0, and 19.2 ± 0.4% of current had inactivated by 4 s at pH 6.5, 7.4, and 8.5, respectively (n = 5; ANOVA, not significant). 2) Application of 10 mM MTSES to H508C (Fig. 4, C and D) increased peak current amplitude and C-type inactivation slightly, but significantly; the percentage inactivation was increased from 26.6 ± 1.6% during control conditions to 35.6 ± 1.8% during application of MTSES (n = 8; ANOVA, P < 0.05; Fig. 4D). 3) Application of 0.3% H2O2 to H508C (Fig. 4, E and F) had no effect on C-type inactivation; the percentage inactivation was 23.2 ± 0.9% during control conditions and 25.9 ± 0.8% during application of H2O2 (n = 5; ANOVA, not significant; Fig. 4F). Neither MTSES nor H2O2 had any effect on C-type inactivation in the fKv1.4 Delta 2-146 channel, which lacks the engineered cysteine (data not shown).


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 4.   Effect of engineering a negative charge at position 508 on C-type inactivation. A and B: fKv1.4 Delta 2-146 H508E current at pH 6.5, 7.4, and 8.5 during 15-s pulse to +60 mV from a holding potential of -80 mV (A) and mean ± SE (n = 6) percentage inactivation at 4 s (B) at each pH tested. Current amplitude was not significantly affected by pH changes. C and D: fKv1.4 Delta 2-146 H508C current during 15-s pulse to +60 mV from a holding potential of -80 mV (C) and mean ± SE (n = 8) percentage inactivation at 4 s (D) at pH 7.4, during application of the negatively charged thiol-specific methanethiosulfonate reagent MTSES, and during pH 7.4 wash. MTSES increased current amplitude by 12.2 ± 1.6%. *Significantly different (P < 0.001) from control value at pH 7.4 (in absence of MTSES). E and F: fKv1.4 Delta 2-146 H508C current during 15-s pulse to +60 mV from a holding potential of -80 mV (E) and mean ± SE (n = 5) percentage inactivation at 4 s (F) at pH 7.4, during application of the free radical donor H2O2, and during subsequent application of DTT.

Relationship between charge and inactivation. The observation that application of MTSET to fKv1.4 Delta 2-146 H508C mimicked the acidosis-induced acceleration of C-type inactivation observed in fKv1.4 Delta 2-146 suggests that it is the increased positive charge on H508 that increases C-type inactivation during acidosis. The majority of the data support this conclusion. Figure 5A shows the percentage inactivation at 4 s as a function of the charge at position 508. Because the charge after addition of MTSET is not known (because it is not known how many subunits are modified), data for MTSET are plotted separately as a bar graph. Figure 5A shows a steep increase in inactivation as charge increased over the range -0.4 to +1.1 (calculated assuming the pKa of histidine is 6.1), although the relationship is flat at more negative charges. Greatly enhanced C-type inactivation by four fixed positive charges at position 508 (by the mutation fKv1.4 Delta 2-146 H508K) could explain why this mutation was nonfunctional (this is considered further in DISCUSSION).


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 5.   Effect of charge at position 508 on C-type inactivation. A: mean ± SE percentage inactivation at 4 s plotted against the calculated charge (assuming the pKa of histidine is 6.1) at position 508 for fKv1.4 Delta 2-146 at pH 6.5, 7.4, and 8.5 and for fKv1.4 Delta 2-146 H508E, fKv1.4 Delta 2-146 H508C, and fKv1.4 Delta 2-146 H508Q at pH 7.4 (left), and for fKv1.4 Delta 2-146 H508C at pH 7.4 before and during application of MTSET and after subsequent application of DTT (right). Inset shows the percentage of deprotonation and the charge and point number for each mutant/condition. B: mean ± SE time constants of the fast (tau f; open symbols and bars) and slow (tau s; filled symbols and bars) phases of inactivation plotted against the calculated charge at position 508 for fKv1.4 Delta 2-146 at pH 6.5, 7.4, and 8.5; for fKv1.4 Delta 2-146 H508E, fKv1.4 Delta 2-146 H508C, and fKv1.4 Delta 2-146 H508Q at pH 7.4 (left); and for fKv1.4 Delta 2-146 H508C at pH 7.4 before and during application of MTSET and after subsequent application of DTT (right). Current from fKv1.4 Delta 2-146 at pH 6.5 could be fitted with a single exponential function; therefore, there are no data for tau s under this condition (see text for details). C: means ± SE of the fast (Af; open symbols and bars) and slow (As; filled symbols and bars) percentage amplitudes plotted against the calculated charge at position 508 for fKv1.4 Delta 2-146 at pH 6.5, 7.4, and 8.5; for fKv1.4 Delta 2-146 H508E, fKv1.4 Delta 2-146 H508C, and fKv1.4 Delta 2-146 H508Q at pH 7.4 (left); and for fKv1.4 Delta 2-146 H508C at pH 7.4 before and during application of MTSET and after subsequent application of DTT (right). Current from fKv1.4 Delta 2-146 at pH 6.5 could be fitted with a single exponential function; therefore, As was assumed to equal zero under this condition (see text for details). *Significantly different (P < 0.05) from value at pH 7.4.

The percentage inactivation at 4 s has been used to describe the extent of inactivation. However, fitting an exponential function to the decay of current allows a more detailed analysis of the changes in time course. All data sets apart from fKv1.4 Delta 2-146, pH 6.5, were best fitted by a double-exponential function. Figure 5, B and C, shows how the time constants and amplitudes of the two exponential phases change with the charge at position 508. At pH 6.5, fKv1.4 Delta 2-146 current was well fitted by a single exponential function, and on the basis of the time constant obtained (Fig. 5B, point 6) the exponential decay was assumed to be equivalent to the fast phase under other conditions. The time constant and amplitude of the fast phase of inactivation increased with increasing positive charge at position 508, over the same range of charge as the increase in percentage inactivation at 4 s shown in Fig. 5A. In contrast, the time constant and amplitude of the slow phase of inactivation decreased with increasing positive charge at position 508, again over the same range of charge as the increase in percentage inactivation at 4 s, as shown in Fig. 5A. These effects on the time constant and amplitude of the fast and slow phases of inactivation were mimicked by MTSET (Fig. 5, B and C), as was the increase in the percentage inactivation at 4 s (Fig. 5A). In addition, mutations or conditions that did not alter the charge at position 508 had no significant effect on the kinetics of inactivation (data not shown). These results show that altering the charge at position 508 induces converse changes in the kinetics of the two phases of C-type inactivation, which may underlie the acidosis-induced enhancement of C-type inactivation (see DISCUSSION).

Involvement of a second extracellular residue. Lopez-Barneo et al. (11) identified a single residue in the Shaker channel (T449), close to the selectivity filter, that, when mutated, alters the rate of C-type inactivation. We have previously suggested that the equivalent residue in the Kv1.4 channel (K532) may (with H508) be involved in the acidosis-induced inhibition of the Kv1.4 current (2). Figure 6 shows the effect of acidosis on a mutant form of fKv1.4 Delta 2-146 in which the positively charged lysine residue at position 532 was replaced by a cysteine residue. At pH 7.4, C-type inactivation of the mutant channel (fKv1.4 Delta 2-146 K532C) was reduced compared with that in the fKv1.4 Delta 2-146 channel; the percentage inactivation by 4 s was 32.4 ± 1.8% compared with 46.8 ± 1.4% with the fKv1.4 Delta 2-146 channel (n = 5; t-test, P < 0.001). This substitution also abolished the acidosis-induced increase of C-type inactivation: 32.4 ± 1.8, 34.6 ± 1.7, and 28.6 ± 1.9% of current inactivated by 4 s at pH 6.5, 7.4, and 8.5, respectively (n = 4; ANOVA, not significant; Fig. 6B).


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 6.   Effect of pH on C-type inactivation in K532C mutant channels. A: fKv1.4 Delta 2-146 K532C current at pH 6.5, 7.4, and 8.5 during 15-s pulse to +60 mV from a holding potential of -80 mV. Current amplitude was not significantly affected by pH changes. B: mean ± SE (n = 4) percentage inactivation at 4 s at each pH tested.

Model for the acceleration of C-type inactivation during acidosis. Figure 7 shows the pore sequence of Kv1.4 modeled on the known crystal structure of the related bacterial K+ channel KcsA (4). Figure 7, top, shows a view from the extracellular face looking down on the pore. The S5, P, and S6 regions of each of the four subunits that make up the pore domain of the channel are shown. The H508 residues of the four subunits are shown in red, and the K532 residues are shown in blue. Figure 7, bottom, shows a side view; the S5, P, and S6 regions of only two diagonally placed subunits are shown for clarity. The model shows that both H508 and K532 lie in the extracellular mouth of the pore. The distance from the imidazole ring of the histidine to the positively charged epsilon -amino group of K532 is ~13 Å.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 7.   Model for the acidosis-induced increase of C-type inactivation. Kv1.4 pore modeled on the KcsA crystal structure. Top: view from top looking down on the extracellular mouth of the pore showing all four subunits. Bottom: view from the side showing only two of the four subunits. H508 (red) and K532 (blue) are highlighted.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

In the present study, acidosis enhanced C-type inactivation in the Kv1.4 channel (Fig. 1), confirming our previous hypothesis (2). Replacement of a histidine in the extracellular mouth of the pore in the NH2-terminal deletion mutant fKv1.4 Delta 2-146 with a glutamine (H508Q) or a cysteine (H508C) abolished the acidosis-induced enhancement of C-type inactivation (Fig. 2). This suggests that H508 is the pH-sensitive site that mediates the effect of acidosis on C-type inactivation. The equivalent residue in Shaker (11, 13) and Kv1.5 (16) channels has also been shown to be important in pH sensitivity. Because N- and C-type inactivation are coupled such that enhancement of C-type inactivation slows the recovery from N-type inactivation (14), the enhancement of C-type inactivation during acidosis can explain the slowing of recovery from N-type inactivation and thus the inhibition of current during repetitive pulsing during acidosis (2).

Charge at position H508. Both acidosis and MTSET enhanced C-type inactivation, suggesting that increasing the positive charge at position 508 enhances C-type inactivation (Fig. 5). This conclusion is supported by the observation that the degree of inactivation increased with charge (Fig. 5A; assuming the pKa of histidine is 6.1 and is unaffected by nearby residues) and that this occurred whether the charge was altered by pH or by mutation. It also seems possible that fKv1.4 Delta 2-146 H508K was nonfunctional because the introduction of +4 charges at this position had such a large effect on C-type inactivation that the channel became locked in the inactivated state. These results suggest that C-type inactivation depends on the charge at position 508. The small apparent enhancement of C-type inactivation by the chemical reagents that add a negative charge to fKv1.4 Delta 2-146 H508C could be because of other effects of the reagents and the insensitivity of C-type inactivation to a negative charge at position 508 (Fig. 5).

More detailed analysis of the time course of inactivation using a double-exponential curve fit showed that the enhanced inactivation was a consequence of an effect (over the same range of charge as the effect on percentage inactivation at 4 s) on both the fast and slow phases of inactivation. The fast phase became larger and perhaps slower with increasing positive charge at position 508, whereas the slow phase became smaller and faster (Fig. 5, B and C). This suggests an increased role of the fast phase in determining the overall rate of inactivation. Indeed, during acidosis (+1.1 charges at position 508), fKv1.4 Delta 2-146 current decay could be fitted using a single exponential, suggesting that the fast phase of inactivation had become dominant. The functional significance of the fast and slow phases is unclear, making further speculation difficult. Nevertheless, the present data suggest that acidosis, by changing the charge at position 508, promotes the fast phase of inactivation and hence the degree of C-type inactivation. Possible mechanisms for how charge at position 508 might do this are considered further below.

Involvement of a second extracellular pore residue. The pore residue at position 449 in Shaker channels (K532 in Kv1.4) is important in determining the rate of C-type inactivation. Ogielska and Aldrich (12) suggested that this residue acts as a "sentry" affecting the probability of ion occupancy at the C-type inactivation modulatory site in the selectivity filter. In the present study, mutation of the lysine residue at position 532 in Kv1.4 to a cysteine slowed the rate of C-type inactivation (Fig. 6). These data show that both the histidine at position 508 and the lysine at position 532 mediate the acidosis-induced enhancement of C-type inactivation. Because the charge on K532 is unlikely to change over the pH range used in this study (pKa ~10.3), it is likely that the change of charge at H508 is the cause of the change in C-type inactivation.

Model for the acidosis-induced acceleration of C-type inactivation. The Kv1.4 pore domain model (Fig. 7), which is based on the crystal structure of KcsA, shows that both H508 and K532 lie in the extracellular entryway of the pore separated by a distance of 13 Å. Because of the distance between these residues, it is unlikely that a direct electrostatic interaction (which can occur over a distance of up to 8 Å) occurs during acidosis. However, because the KcsA model may represent the channel in the closed conformation, this distance may be smaller at the onset of inactivation when the channel is open (such a movement may be the trigger for C-type inactivation). Instead, protonation of H508 may result in a structural change that is transmitted through the protein to K532 (allosteric regulation). Alternatively, H508 and K532 may act independently. In the most recent crystal structure of KcsA, Zhou et al. (20) demonstrated two K+ binding sites in the extracellular entryway of the pore (although only one is occupied at any one time). It is possible that protonation of the four histidine residues at position 508 alters K+ coordination at this site (~6-7 Å from H508), perhaps by direct electrostatic interaction with K+ or by electrostatic interaction with the water molecules that stabilize the partially dehydrated K+. This change in K+ occupancy at the extracellular entryway may reduce K+ occupancy at the outer binding site within the selectivity filter and hence enhance C-type inactivation (see Introduction).


    NOTE ADDED IN PROOF

Since the original submission of this manuscript, others (Kehl SJ, Eduljee C, Kwan DCH, Zhang S, and Fedida D. Molecular determinants of the inhibition of human Kv1.5 potassium currents by external protons and Zn2+. J Physiol 541: 9-24, 2002) have demonstrated that protons also enhance inactivation of the Kv1.5 K+ channel and that this effect involves H463 and R487 (equivalent to H508 and K532, respectively).


    FOOTNOTES

Address for reprint requests and other correspondence: M. R. Boyett, School of Biomedical Sciences, Univ. of Leeds, Leeds LS2 9JT, UK (E-mail: m.r.boyett{at}leeds.ac.uk).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

June 13, 2002;10.1152/ajpcell.00542.2001

Received 16 November 2001; accepted in final form 5 June 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Brahmajothi, MV, Campbell DL, Rasmusson RL, Morales MJ, Trimmer JS, Nerbonne JM, and Strauss HC. Distinct transient outward potassium current (ito) phenotypes and distribution of fast-inactivating potassium channel alpha  subunits in ferret left ventricular myocytes. J Gen Physiol 113: 581-600, 1999[Abstract/Free Full Text].

2.   Claydon, TW, Boyett MR, Sivaprasadarao A, Ishii K, Owen JM, O'Beirne HA, Leach R, Komukai K, and Orchard CH. Inhibition of the K+ channel Kv1.4 by acidosis: protonation of an extracellular histidine slows the recovery from N-type inactivation. J Physiol 526: 253-264, 2000[Abstract/Free Full Text].

3.   Comer, MB, Campbell DL, Rasmusson RL, Lamson DR, Morales MJ, Zhang Y, and Strauss HC. Cloning and characterization of an ito-like potassium channel from ferret ventricle. Am J Physiol Heart Circ Physiol 267: H1383-H1395, 1994[Abstract/Free Full Text].

4.   Doyle, DD, Cabral JM, Pfuetzner RA, Kuo A, Gulbis JM, Cohen SL, Chait BT, and MacKinnon R. The structure of the potassium channel: molecular basis of K+ conduction and selectivity. Science 280: 69-77, 1998[Abstract/Free Full Text].

5.   Hoshi, T, Zagotta WN, and Aldrich RW. Biophysical and molecular mechanisms of Shaker potassium channel inactivation. Science 250: 533-538, 1990[Abstract/Free Full Text].

6.   Hulme, JT, and Orchard CH. Effect of acidosis on transient outward potassium current in isolated rat ventricular myocytes. Am J Physiol Heart Circ Physiol 278: H50-H59, 2000[Abstract/Free Full Text].

7.   Kaab, S, Kartmann H, Andrassy J, Hinterseer M, Barth A, and Nabauer M. Presence of Kv4.3 and Kv1.4 potassium channel mRNA in human left ventricular myocardium: transmural mRNA-gradients and correlation with current properties (Abstract). Circ Res 96: I867, 1999.

8.   Kiss, L, and Korn SJ. Modulation of C-type inactivation by K+ at the potassium channel selectivity filter. Biophys J 74: 1840-1849, 1998[Web of Science][Medline].

9.   Larsson, HP, and Elinder F. A conserved glutamate is important for slow inactivation in K+ channels. Neuron 27: 573-583, 2000[Web of Science][Medline].

10.   Liu, Y, Jurman ME, and Yellen G. Dynamic rearrangement of the outer mouth of a K+ channel during gating. Neuron 16: 859-867, 1996[Web of Science][Medline].

11.   Lopez-Barneo, J, Hoshi T, Heinemann SH, and Aldrich RW. Effects of external cations and mutations in the pore region on C-type inactivation of Shaker potassium channels. Receptors Channels 1: 61-71, 1993[Web of Science][Medline].

12.   Ogielska, EM, and Aldrich RW. Functional consequences of a decreased potassium affinity in a potassium pore. Ion interactions and C-type inactivation. J Gen Physiol 113: 347-358, 1999[Abstract/Free Full Text].

13.   Perez-Cornejo, P. H+ modulation of C-type inactivation of Shaker K+ channels. Pflügers Arch 437: 865-870, 1999[Web of Science][Medline].

14.   Rasmusson, RL, Morales MJ, Castellino RC, Zhang Y, Campbell DL, and Strauss HC. C-type inactivation controls recovery in a fast inactivating cardiac K+ channel (Kv1.4) expressed in Xenopus oocytes. J Physiol 489: 709-721, 1995[Abstract/Free Full Text].

15.   Starkus, JG, Kuschel L, Rayner MD, and Heinemann SH. Ion conduction through C-type inactivated Shaker channels. J Gen Physiol 110: 539-550, 1997[Abstract/Free Full Text].

16.   Steidl, JV, and Yool AJ. Differential sensitivity of voltage-gated potassium channels Kv1.5 and Kv12 to acidic pH and molecular identification of pH sensor. Mol Pharmacol 55: 812-820, 1999[Abstract/Free Full Text].

17.   Wickenden, AD, Jegla TJ, Kaprielian R, and Backx PH. Regional contributions of Kv1.4, Kv4.2, and Kv4.3 to transient outward K+ current in rat ventricle. Am J Physiol Heart Circ Physiol 276: H1599-H1607, 1999[Abstract/Free Full Text].

18.   Yellen, G. The moving parts of voltage-gated ion channels. Q Rev Biophys 31: 239-295, 1998[Web of Science][Medline].

19.   Zagotta, WN, Hoshi T, and Aldrich RW. Restoration of inactivation in mutants of Shaker potassium channels by a peptide derived from ShB. Science 250: 568-571, 1990[Abstract/Free Full Text].

20.   Zhou, Y, Morais-Cabral JH, Kaufman A, and MacKinnon R. Chemistry of ion coordination and hydration revealed by a K+ channel-Fab complex at 2.0 Å resolution. Nature 414: 43-48, 2001[Medline].


Am J Physiol Cell Physiol 283(4):C1114-C1121
0363-6143/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
JGPHome page
T. W. Claydon, M. Vaid, S. Rezazadeh, D. C.H. Kwan, S. J. Kehl, and D. Fedida
A Direct Demonstration of Closed-State Inactivation of K+ Channels at Low pH
J. Gen. Physiol., April 30, 2007; 129(5): 437 - 455.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. Somodi, Z. Varga, P. Hajdu, J. G. Starkus, D. I. Levy, R. Gaspar, and G. Panyi
pH-dependent modulation of Kv1.3 inactivation: role of His399
Am J Physiol Cell Physiol, October 1, 2004; 287(4): C1067 - C1076.
[Abstract] [Full Text] [PDF]


Home page
JGPHome page
D. L. Prole, P. A. Lima, and N. V. Marrion
Mechanisms Underlying Modulation of Neuronal KCNQ2/KCNQ3 Potassium Channels by Extracellular Protons
J. Gen. Physiol., November 24, 2003; 122(6): 775 - 793.
[Abstract] [Full Text] [PDF]


Home page
JGPHome page
S. Zhang, H. T. Kurata, S. J. Kehl, and D. Fedida
Rapid Induction of P/C-type Inactivation Is the Mechanism for Acid-induced K+ Current Inhibition
J. Gen. Physiol., February 24, 2003; 121(3): 215 - 225.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
283/4/C1114    most recent
00542.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Claydon, T. W.
Right arrow Articles by Orchard, C. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Claydon, T. W.
Right arrow Articles by Orchard, C. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online