|
|
||||||||
School of Biomedical Sciences, University of Leeds, Leeds LS2 9JT, United Kingdom
| |
ABSTRACT |
|---|
|
|
|---|
Acidosis inhibits
current through the Kv1.4 K+ channel, perhaps as a result
of enhancement of C-type inactivation. The mechanism of action of
acidosis on C-type inactivation has been studied. A mutant Kv1.4
channel that lacks N-type inactivation (fKv1.4
2-146) was
expressed in Xenopus oocytes, and currents were recorded using two-microelectrode voltage clamp. Acidosis increased fKv1.4
2-146 C-type inactivation. Replacement of a pore histidine with cysteine (H508C) abolished the increase. Application of positively charged thiol-specific methanethiosulfonate to fKv1.4
2-146
H508C increased C-type inactivation, mimicking the effect of acidosis. Replacement of a pore lysine with cysteine (K532C) abolished the acidosis-induced increase of C-type inactivation. A model of the Kv1.4
pore, based on the crystal structure of KcsA, shows that H508 and K532
lie close together. It is suggested that the acidosis-induced increase
of C-type inactivation involves the charge on H508 and K532.
acidosis; C-type inactivation; Kv1.4
| |
INTRODUCTION |
|---|
|
|
|---|
KV1.4 IS A MEMBER of the Shaker subfamily of K+ channels. It is expressed in the heart, in human and ferret subendocardium, and in rat ventricular septum (1, 7, 17) and contributes to the transient outward current that underlies the early repolarization phase of the cardiac action potential. The Kv1.4 channel, like the Shaker channel, shows rapid activation upon depolarization followed by rapid inactivation during continued depolarization. The transient nature of the current is the result of rapid NH2-type inactivation (3, 5, 19) that involves occlusion of the intracellular mouth of the pore by an NH2-terminal domain. Removal of this domain abolishes rapid N-type inactivation and uncovers a slow C-type inactivation that occurs over a period of seconds rather than milliseconds (5, 13, 19). C-type inactivation is not fully understood (see Ref. 18 for review) but is known to involve structural rearrangement of the outer mouth of the pore (8, 9, 14) and to be dependent on the absence of K+ at a modulatory K+-binding site within the selectivity filter and the residues at positions 449 and 463 in Shaker channels (532 and 546 in Kv1.4, respectively). Mutation of these residues may influence the conformational changes associated with C-type inactivation or perhaps alter the K+ occupancy of the C-type inactivation modulatory site (12). Furthermore, Rasmusson et al. (14) demonstrated that, in the Kv1.4 channel, the rate of recovery from C-type inactivation controls the rate of recovery from N-type inactivation and therefore the refractoriness of the channel.
Acidosis alters the transient outward current in ventricular cells (6) and may therefore influence cardiac action potential duration. We have studied the effect of acidosis on the cloned Kv1.4 channel expressed in Xenopus oocytes (2). Acidosis has an inhibitory effect on current flow through the Kv1.4 channel during repetitive pulsing; this is the result of binding of protons to a histidine residue in the extracellular mouth of the pore (H508). Evidence suggests that this enhances C-type inactivation because, when C-type inactivation was abolished, by applying high extracellular K+ or introducing the mutation K532Y, the inhibitory effect of acidosis was also abolished. It is proposed that enhancement of C-type inactivation slows recovery from N-type inactivation, decreasing current amplitude during repetitive pulsing. In the present study, we have confirmed that C-type inactivation is enhanced by acidosis and have investigated the molecular mechanism by which binding of protons to H508 enhances C-type inactivation.
| |
METHODS |
|---|
|
|
|---|
Molecular biology.
Experiments were carried out on a truncated form of ferret heart
Kv1.4 (fKv1.4
2-146) that lacks rapid N-type inactivation (14). The mutants fKv1.4
2-146 H508Q, fKv1.4
2-146 H508C, fKv1.4
2-146 H508E, fKv1.4
2-146
H508K, and fKv1.4
2-146 K532C were constructed using the
Stratagene Quikchange Site-Directed Mutagenesis technique (Stratagene)
according to the instructions of the manufacturer.
Sense primers were GATGAACCTACTACCCAGTTCCAAAGCATCCC, GGATGAACCTACTACCTGTTTCCAAAGCATCCCG,
GATGAACCTACTACCGAGTTCCAAAGCATCCCG, GGATGAACCTACTACCAAGTTCCAAAGCATCCCG, and
GGCTATGGGGACATGTGTCCCATCACTGTGGGG, respectively. In all cases, vectors
(pBluescript SKII+) containing the cDNA sequences
were linearized with the restriction endonuclease Asp 718 (Roche Diagnostics, Lewes, UK), and cRNA was prepared from these
templates with T3 RNA polymerase (Stratagene). Transcribed RNA was
diluted in nuclease-free water at a final concentration of 50 ng/µl.
Electrophysiology.
Xenopus laevis toads were terminally anesthetized by
immersion in tricaine methanesulfonate (2 mg/ml; Sigma, Poole, UK) in accordance with the Home Office Animals (Scientific Procedures) Act of
1986. Stage V-VI oocytes were isolated and then defolliculated using a
combination of collagenase treatment (1 h in 1 mg/ml collagenase type
1a; Sigma) and manual defolliculation. Defolliculated oocytes were
incubated in Barth's medium for 2-24 h at 19°C before
injection. Barth's medium contained (in mM) 88 NaCl, 1 KCl, 2.4 NaHCO3, 0.82 MgSO4, 0.33 Ca(NO3)2, 0.41 CaCl2, 20 HEPES,
1.25 sodium pyruvate, and 0.1 mg/ml neomycin (Sigma) with 100 U · 0.1 mg
1 · ml
1
penicillin-streptomycin mix (Sigma), titrated to pH 7.4 using NaOH.
Oocytes were injected with 50 nl (2.5 ng) cRNA encoding fKv1.4
2-146 or one of the mutants using a Drummond digital
microdispenser (Broomall). In control experiments, oocytes were
injected with 50 nl nuclease-free H2O; in these cases,
currents were negligible compared with currents in cells injected with
cRNA. Currents were recorded 16-72 h after injection, using the
two-microelectrode voltage clamp technique. Microelectrodes with a
resistance of 0.6-3 M
(tip diameter, 1-5 µm) filled with
3 M KCl were used. Membrane currents were recorded using a Geneclamp
500 amplifier (Axon Instruments, Union City, CA) with computer-driven
voltage protocols (Clampex software and Digidata 1200 interface; Axon Instruments). Currents were recorded during 15-s pulses to +60 mV from
a holding potential of
80 mV at a pulse interval of 30 s.
Experiments were performed at room temperature (20-22°C). During experiments, oocytes were perfused with ND-96 solution (in mM: 96 NaCl,
3 KCl, 1 MgCl2, 2 CaCl2, and 5 HEPES, titrated
to pH 6.5-8.5 using NaOH) at a flow rate of 0.5 ml/min (bath
volume, 400 µl). Oocytes were perfused with ND-96 solution at pH 7.4, and control recordings were obtained. Acid solution was then applied, and after 3 min recordings were made again. After a control solution wash, alkali solution was applied, and recordings were made after 3 min. Solutions of methanethiosulfonate {1 mM
[2-(trimethylethylammonium)ethyl]/methanethiosulfonate bromide
(MTSET) and 10 mM sodium
(2-sulfonatoethyl)methanethiosulfonate (MTSES); Toronto
Research Chemicals} in ND-96 solution were made immediately before
use (pH 7.4). H2O2 (0.3%) solution was
made from a 30% stock solution (Sigma) using ND-96 solution (pH 7.4). Recordings were made after a 3-min perfusion of MTSET, MTSES, or
H2O2.
Analysis and statistics.
Data were analyzed using pClamp software (Axon Instruments). Data are
shown as means ± SE (number of oocytes). Peak current amplitude
was not significantly affected by pH changes in the case of fKv1.4
2-146, fKv1.4
2-146 H508Q, fKv1.4
2-146 H508C, fKv1.4
2-146 H508E, or fKv1.4
2-146 K532C. However,
some of the reagents used did affect current amplitude. MTSET reduced fKv1.4
2-146 H508C current by 36.3 ± 2.5%
(n = 10; ANOVA, P < 0.05), whereas
MTSES increased fKv1.4
2-146 H508C current by 12.2 ± 1.6% (n = 8; ANOVA, P < 0.05). The
percentage reduction of current at 4 s was used to describe C-type
inactivation. In addition, current decay was fitted by a single- or
double-exponential function using pClamp software (Axon Instruments).
Statistical analysis was carried out with one-way ANOVA using SigmaStat
(SPSS Science, Chicago, IL). P < 0.05 were regarded as significant.
Modeling. The pore structure of Kv1.4 was modeled using the known crystal structure of the related bacterial K+ channel KcsA as a template using Swiss-Model's "First Approach Mode" (http://expasy.ch.swissmod/SWISS-MODEL.html) and "Swiss-Pdbviewer."
| |
RESULTS |
|---|
|
|
|---|
Acidosis-induced enhancement of C-type inactivation.
Truncation of the NH2-terminal domain (e.g.,
2-146
in fKv1.4) of rapidly inactivating voltage-gated K+
channels removes rapid N-type inactivation and reveals slow C-type inactivation. To measure C-type inactivation in fKv1.4
2-146, currents were recorded during 15-s pulses to +60 mV from a holding potential of
80 mV. Figure
1A shows typical fKv1.4
2-146 current traces recorded during perfusion with ND-96
solution at pH 6.5 (acidosis), 7.4 (control), and 8.5 (alkalosis). At
control pH, 46.8 ± 1.4% of the current inactivated in 4 s
(n = 6; Fig. 1B). During acidosis, the
percentage inactivation at 4 s increased to 66.5 ± 1.5%
(n = 6; ANOVA, P < 0.001 compared with
pH 7.4; Fig. 1B). In contrast, during alkalosis, the
percentage inactivation at 4 s decreased to 41.0 ± 1.6%
(n = 6; ANOVA, P < 0.001; Fig. 1B). Thus the data shown in Fig. 1 show that acidosis
enhances C-type inactivation with no significant effect on current
amplitude; this confirms our prediction (2).
|
Involvement of H508.
We have previously shown that H508 is the pH-sensitive site that
mediates the effect of acidosis on the recovery from N-type inactivation (2). Figure 2
shows the effect of acidosis on C-type inactivation in mutant forms of
fKv1.4
2-146 in which H508 was substituted by a glutamine (Q;
Fig. 2A) or a cysteine (C; Fig. 2C) residue. At
pH 7.4, C-type inactivation in both mutant channels was significantly
(t-test, P < 0.001) less than that in
fKv1.4
2-146; inactivation at 4 s was 32.6 ± 0.8%
(n = 5) and 26.7 ± 0.6% (n = 5)
in fKv1.4
2-146 H508Q and fKv1.4
2-146 H508C,
respectively, compared with 46.8 ± 1.4% in fKv1.4
2-146. Furthermore, acidosis had no effect on C-type inactivation in either
mutant channel. This is shown in Fig. 2, B and D,
which shows the percentage inactivation at 4 s at each pH tested.
In fKv1.4
2-146 H508Q, 32.9 ± 0.7, 32.6 ± 0.8, and
32.2 ± 0.5% of current inactivated by 4 s at pH 6.5, 7.4, and 8.5, respectively (n = 5; ANOVA, not significant;
Fig. 2B). In fKv1.4
2-146 H508C, these values were
27.2 ± 0.8, 26.7 ± 0.6, and 24.2 ± 0.2%,
respectively (n = 5; ANOVA, not significant; Fig.
2D). This suggests that H508 is also the pH-sensitive site
that mediates the effect of acidosis on C-type inactivation.
|
Charge at position 508 influences C-type inactivation.
The imidazole side chain of histidine has a pKa
value of ~6.2. The charge on H508 will therefore change with pH over
the range used, and this may be important in mediating the effect of
acidosis on C-type inactivation in Kv1.4. To test this, we mutated the histidine at 508 to a positively charged lysine (H508K), or we applied
the thiol-specific methanesulfonate reagent MTSET to the fKv1.4
2-146 H508C mutant channel; MTSET will add a positively charged
ethyl trimethylammonium group to the thiol group of the engineered
cysteine at 508. Introduction of a fixed positive charge (K) at 508 caused channels to be nonfunctional. MTSET (1 mM) reduced peak current
amplitude (Fig.3C). In
addition, it significantly increased C-type inactivation in the mutant
channel fKv1.4
2-146 H508C (Fig. 3, C and
D), mimicking the effect of acidosis on the fKv1.4
2-146 channel (Fig. 1A). This is clearly shown by
the normalized trace (in gray) in Fig. 3C; 51.8 ± 0.8% of current inactivated by 4 s during application of MTSET
compared with 23.9 ± 1.4% during control conditions
(n = 10; ANOVA, P < 0.001). Wash with
ND-96 solution did not reverse the effect of MTSET (data not shown),
indicating specific covalent interaction between MTSET and the
engineered cysteine. However, breaking the covalent bond between MTSET
and the engineered cysteine at 508, by application of dithiothreitol (1 mM), completely reversed the effect on current amplitude and C-type
inactivation [21.6 ± 1.7% of current inactivated by 4 s
(n = 5; Fig. 3D)]. In contrast, MTSET had
little effect on the fKv1.4
2-146 channel, which lacks this
engineered cysteine (Fig. 3, A and B). In the
absence of MTSET, 42.1 ± 0.8% of current had inactivated by
4 s compared with 46.3 ± 0.8% during application of MTSET
(n = 5). This small effect (ANOVA, P < 0.05) of MTSET was reversed during ND-96 wash (Fig. 3B).
|
2-146 channel (n = 5-6; ANOVA,
P < 0.05). This effect was significantly greater than
the effect of replacing H508 with a neutral glutamine (H508Q; Fig.
2B) or cysteine (H508C; Fig. 2D) residue
(n = 5-6; ANOVA, P < 0.05).
Figure 4B shows that this mutation also abolished pH
sensitivity: 25.2 ± 0.8, 22.8 ± 1.0, and 19.2 ± 0.4%
of current had inactivated by 4 s at pH 6.5, 7.4, and 8.5, respectively (n = 5; ANOVA, not significant). 2) Application of 10 mM MTSES to H508C (Fig. 4, C
and D) increased peak current amplitude and C-type
inactivation slightly, but significantly; the percentage inactivation
was increased from 26.6 ± 1.6% during control conditions to
35.6 ± 1.8% during application of MTSES (n = 8;
ANOVA, P < 0.05; Fig. 4D). 3)
Application of 0.3% H2O2 to H508C (Fig. 4,
E and F) had no effect on C-type inactivation; the percentage inactivation was 23.2 ± 0.9% during control
conditions and 25.9 ± 0.8% during application of
H2O2 (n = 5; ANOVA, not significant; Fig. 4F). Neither MTSES nor
H2O2 had any effect on C-type inactivation in
the fKv1.4
2-146 channel, which lacks the engineered cysteine
(data not shown).
|
Relationship between charge and inactivation.
The observation that application of MTSET to fKv1.4
2-146 H508C
mimicked the acidosis-induced acceleration of C-type inactivation observed in fKv1.4
2-146 suggests that it is the increased
positive charge on H508 that increases C-type inactivation during
acidosis. The majority of the data support this conclusion. Figure
5A shows the percentage
inactivation at 4 s as a function of the charge at position 508. Because the charge after addition of MTSET is not known (because it is
not known how many subunits are modified), data for MTSET are plotted
separately as a bar graph. Figure 5A shows a steep increase
in inactivation as charge increased over the range
0.4 to +1.1
(calculated assuming the pKa of histidine is
6.1), although the relationship is flat at more negative charges. Greatly enhanced C-type inactivation by four fixed positive charges at
position 508 (by the mutation fKv1.4
2-146 H508K) could explain why this mutation was nonfunctional (this is considered further in
DISCUSSION).
|
2-146, pH 6.5, were best fitted by a double-exponential function. Figure 5,
B and C, shows how the time constants and
amplitudes of the two exponential phases change with the charge at
position 508. At pH 6.5, fKv1.4
2-146 current was well fitted
by a single exponential function, and on the basis of the time constant
obtained (Fig. 5B, point 6) the exponential decay
was assumed to be equivalent to the fast phase under other conditions.
The time constant and amplitude of the fast phase of inactivation
increased with increasing positive charge at position 508, over the
same range of charge as the increase in percentage inactivation at
4 s shown in Fig. 5A. In contrast, the time constant
and amplitude of the slow phase of inactivation decreased with
increasing positive charge at position 508, again over the same range
of charge as the increase in percentage inactivation at 4 s, as
shown in Fig. 5A. These effects on the time constant and
amplitude of the fast and slow phases of inactivation were mimicked by
MTSET (Fig. 5, B and C), as was the increase in
the percentage inactivation at 4 s (Fig. 5A). In
addition, mutations or conditions that did not alter the charge at
position 508 had no significant effect on the kinetics of inactivation (data not shown). These results show that altering the charge at
position 508 induces converse changes in the kinetics of the two phases
of C-type inactivation, which may underlie the acidosis-induced enhancement of C-type inactivation (see DISCUSSION).
Involvement of a second extracellular residue.
Lopez-Barneo et al. (11) identified a single residue in
the Shaker channel (T449), close to the selectivity filter,
that, when mutated, alters the rate of C-type inactivation. We have previously suggested that the equivalent residue in the Kv1.4 channel
(K532) may (with H508) be involved in the acidosis-induced inhibition
of the Kv1.4 current (2). Figure
6 shows the effect of acidosis on a
mutant form of fKv1.4
2-146 in which the positively charged
lysine residue at position 532 was replaced by a cysteine residue. At
pH 7.4, C-type inactivation of the mutant channel (fKv1.4
2-146 K532C) was reduced compared with that in the fKv1.4
2-146 channel; the percentage inactivation by 4 s was
32.4 ± 1.8% compared with 46.8 ± 1.4% with the fKv1.4
2-146 channel (n = 5; t-test,
P < 0.001). This substitution also abolished the acidosis-induced increase of C-type inactivation: 32.4 ± 1.8, 34.6 ± 1.7, and 28.6 ± 1.9% of current inactivated by
4 s at pH 6.5, 7.4, and 8.5, respectively (n = 4;
ANOVA, not significant; Fig. 6B).
|
Model for the acceleration of C-type inactivation during acidosis.
Figure 7 shows the pore sequence of Kv1.4
modeled on the known crystal structure of the related bacterial
K+ channel KcsA (4). Figure 7, top,
shows a view from the extracellular face looking down on the pore. The
S5, P, and S6 regions of each of the four subunits that make up the
pore domain of the channel are shown. The H508 residues of the
four subunits are shown in red, and the K532 residues are shown in
blue. Figure 7, bottom, shows a side view; the S5, P, and S6
regions of only two diagonally placed subunits are shown for clarity.
The model shows that both H508 and K532 lie in the extracellular mouth
of the pore. The distance from the imidazole ring of the histidine to
the positively charged
-amino group of K532 is ~13 Å.
|
| |
DISCUSSION |
|---|
|
|
|---|
In the present study, acidosis enhanced C-type inactivation in the
Kv1.4 channel (Fig. 1), confirming our previous hypothesis (2). Replacement of a histidine in the extracellular mouth of the pore in the NH2-terminal deletion mutant fKv1.4
2-146 with a glutamine (H508Q) or a cysteine (H508C) abolished
the acidosis-induced enhancement of C-type inactivation (Fig. 2). This
suggests that H508 is the pH-sensitive site that mediates the effect of
acidosis on C-type inactivation. The equivalent residue in
Shaker (11, 13) and Kv1.5 (16)
channels has also been shown to be important in pH sensitivity. Because
N- and C-type inactivation are coupled such that enhancement of C-type
inactivation slows the recovery from N-type inactivation
(14), the enhancement of C-type inactivation during
acidosis can explain the slowing of recovery from N-type inactivation
and thus the inhibition of current during repetitive pulsing during
acidosis (2).
Charge at position H508.
Both acidosis and MTSET enhanced C-type inactivation, suggesting that
increasing the positive charge at position 508 enhances C-type
inactivation (Fig. 5). This conclusion is supported by the observation
that the degree of inactivation increased with charge (Fig.
5A; assuming the pKa of histidine is
6.1 and is unaffected by nearby residues) and that this occurred
whether the charge was altered by pH or by mutation. It also seems
possible that fKv1.4
2-146 H508K was nonfunctional because the
introduction of +4 charges at this position had such a large effect on
C-type inactivation that the channel became locked in the inactivated state. These results suggest that C-type inactivation depends on the
charge at position 508. The small apparent enhancement of C-type
inactivation by the chemical reagents that add a negative charge to
fKv1.4
2-146 H508C could be because of other effects of the
reagents and the insensitivity of C-type inactivation to a negative
charge at position 508 (Fig. 5).
2-146 current decay could be fitted using a single
exponential, suggesting that the fast phase of inactivation had become
dominant. The functional significance of the fast and slow phases is
unclear, making further speculation difficult. Nevertheless, the
present data suggest that acidosis, by changing the charge at position
508, promotes the fast phase of inactivation and hence the degree of
C-type inactivation. Possible mechanisms for how charge at position 508 might do this are considered further below.
Involvement of a second extracellular pore residue. The pore residue at position 449 in Shaker channels (K532 in Kv1.4) is important in determining the rate of C-type inactivation. Ogielska and Aldrich (12) suggested that this residue acts as a "sentry" affecting the probability of ion occupancy at the C-type inactivation modulatory site in the selectivity filter. In the present study, mutation of the lysine residue at position 532 in Kv1.4 to a cysteine slowed the rate of C-type inactivation (Fig. 6). These data show that both the histidine at position 508 and the lysine at position 532 mediate the acidosis-induced enhancement of C-type inactivation. Because the charge on K532 is unlikely to change over the pH range used in this study (pKa ~10.3), it is likely that the change of charge at H508 is the cause of the change in C-type inactivation.
Model for the acidosis-induced acceleration of C-type inactivation. The Kv1.4 pore domain model (Fig. 7), which is based on the crystal structure of KcsA, shows that both H508 and K532 lie in the extracellular entryway of the pore separated by a distance of 13 Å. Because of the distance between these residues, it is unlikely that a direct electrostatic interaction (which can occur over a distance of up to 8 Å) occurs during acidosis. However, because the KcsA model may represent the channel in the closed conformation, this distance may be smaller at the onset of inactivation when the channel is open (such a movement may be the trigger for C-type inactivation). Instead, protonation of H508 may result in a structural change that is transmitted through the protein to K532 (allosteric regulation). Alternatively, H508 and K532 may act independently. In the most recent crystal structure of KcsA, Zhou et al. (20) demonstrated two K+ binding sites in the extracellular entryway of the pore (although only one is occupied at any one time). It is possible that protonation of the four histidine residues at position 508 alters K+ coordination at this site (~6-7 Å from H508), perhaps by direct electrostatic interaction with K+ or by electrostatic interaction with the water molecules that stabilize the partially dehydrated K+. This change in K+ occupancy at the extracellular entryway may reduce K+ occupancy at the outer binding site within the selectivity filter and hence enhance C-type inactivation (see Introduction).
| |
NOTE ADDED IN PROOF |
|---|
Since the original submission of this manuscript, others (Kehl SJ, Eduljee C, Kwan DCH, Zhang S, and Fedida D. Molecular determinants of the inhibition of human Kv1.5 potassium currents by external protons and Zn2+. J Physiol 541: 9-24, 2002) have demonstrated that protons also enhance inactivation of the Kv1.5 K+ channel and that this effect involves H463 and R487 (equivalent to H508 and K532, respectively).
| |
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: M. R. Boyett, School of Biomedical Sciences, Univ. of Leeds, Leeds LS2 9JT, UK (E-mail: m.r.boyett{at}leeds.ac.uk).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
June 13, 2002;10.1152/ajpcell.00542.2001
Received 16 November 2001; accepted in final form 5 June 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Brahmajothi, MV,
Campbell DL,
Rasmusson RL,
Morales MJ,
Trimmer JS,
Nerbonne JM,
and
Strauss HC.
Distinct transient outward potassium current (ito) phenotypes and distribution of fast-inactivating potassium channel
subunits in ferret left ventricular myocytes.
J Gen Physiol
113:
581-600,
1999
2.
Claydon, TW,
Boyett MR,
Sivaprasadarao A,
Ishii K,
Owen JM,
O'Beirne HA,
Leach R,
Komukai K,
and
Orchard CH.
Inhibition of the K+ channel Kv1.4 by acidosis: protonation of an extracellular histidine slows the recovery from N-type inactivation.
J Physiol
526:
253-264,
2000
3.
Comer, MB,
Campbell DL,
Rasmusson RL,
Lamson DR,
Morales MJ,
Zhang Y,
and
Strauss HC.
Cloning and characterization of an ito-like potassium channel from ferret ventricle.
Am J Physiol Heart Circ Physiol
267:
H1383-H1395,
1994
4.
Doyle, DD,
Cabral JM,
Pfuetzner RA,
Kuo A,
Gulbis JM,
Cohen SL,
Chait BT,
and
MacKinnon R.
The structure of the potassium channel: molecular basis of K+ conduction and selectivity.
Science
280:
69-77,
1998
5.
Hoshi, T,
Zagotta WN,
and
Aldrich RW.
Biophysical and molecular mechanisms of Shaker potassium channel inactivation.
Science
250:
533-538,
1990
6.
Hulme, JT,
and
Orchard CH.
Effect of acidosis on transient outward potassium current in isolated rat ventricular myocytes.
Am J Physiol Heart Circ Physiol
278:
H50-H59,
2000
7.
Kaab, S,
Kartmann H,
Andrassy J,
Hinterseer M,
Barth A,
and
Nabauer M.
Presence of Kv4.3 and Kv1.4 potassium channel mRNA in human left ventricular myocardium: transmural mRNA-gradients and correlation with current properties (Abstract).
Circ Res
96:
I867,
1999.
8.
Kiss, L,
and
Korn SJ.
Modulation of C-type inactivation by K+ at the potassium channel selectivity filter.
Biophys J
74:
1840-1849,
1998[Web of Science][Medline].
9.
Larsson, HP,
and
Elinder F.
A conserved glutamate is important for slow inactivation in K+ channels.
Neuron
27:
573-583,
2000[Web of Science][Medline].
10.
Liu, Y,
Jurman ME,
and
Yellen G.
Dynamic rearrangement of the outer mouth of a K+ channel during gating.
Neuron
16:
859-867,
1996[Web of Science][Medline].
11.
Lopez-Barneo, J,
Hoshi T,
Heinemann SH,
and
Aldrich RW.
Effects of external cations and mutations in the pore region on C-type inactivation of Shaker potassium channels.
Receptors Channels
1:
61-71,
1993[Web of Science][Medline].
12.
Ogielska, EM,
and
Aldrich RW.
Functional consequences of a decreased potassium affinity in a potassium pore. Ion interactions and C-type inactivation.
J Gen Physiol
113:
347-358,
1999
13.
Perez-Cornejo, P.
H+ modulation of C-type inactivation of Shaker K+ channels.
Pflügers Arch
437:
865-870,
1999[Web of Science][Medline].
14.
Rasmusson, RL,
Morales MJ,
Castellino RC,
Zhang Y,
Campbell DL,
and
Strauss HC.
C-type inactivation controls recovery in a fast inactivating cardiac K+ channel (Kv1.4) expressed in Xenopus oocytes.
J Physiol
489:
709-721,
1995
15.
Starkus, JG,
Kuschel L,
Rayner MD,
and
Heinemann SH.
Ion conduction through C-type inactivated Shaker channels.
J Gen Physiol
110:
539-550,
1997
16.
Steidl, JV,
and
Yool AJ.
Differential sensitivity of voltage-gated potassium channels Kv1.5 and Kv12 to acidic pH and molecular identification of pH sensor.
Mol Pharmacol
55:
812-820,
1999
17.
Wickenden, AD,
Jegla TJ,
Kaprielian R,
and
Backx PH.
Regional contributions of Kv1.4, Kv4.2, and Kv4.3 to transient outward K+ current in rat ventricle.
Am J Physiol Heart Circ Physiol
276:
H1599-H1607,
1999
18.
Yellen, G.
The moving parts of voltage-gated ion channels.
Q Rev Biophys
31:
239-295,
1998[Web of Science][Medline].
19.
Zagotta, WN,
Hoshi T,
and
Aldrich RW.
Restoration of inactivation in mutants of Shaker potassium channels by a peptide derived from ShB.
Science
250:
568-571,
1990
20.
Zhou, Y,
Morais-Cabral JH,
Kaufman A,
and
MacKinnon R.
Chemistry of ion coordination and hydration revealed by a K+ channel-Fab complex at 2.0 Å resolution.
Nature
414:
43-48,
2001[Medline].
This article has been cited by other articles:
![]() |
T. W. Claydon, M. Vaid, S. Rezazadeh, D. C.H. Kwan, S. J. Kehl, and D. Fedida A Direct Demonstration of Closed-State Inactivation of K+ Channels at Low pH J. Gen. Physiol., April 30, 2007; 129(5): 437 - 455. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Somodi, Z. Varga, P. Hajdu, J. G. Starkus, D. I. Levy, R. Gaspar, and G. Panyi pH-dependent modulation of Kv1.3 inactivation: role of His399 Am J Physiol Cell Physiol, October 1, 2004; 287(4): C1067 - C1076. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Prole, P. A. Lima, and N. V. Marrion Mechanisms Underlying Modulation of Neuronal KCNQ2/KCNQ3 Potassium Channels by Extracellular Protons J. Gen. Physiol., November 24, 2003; 122(6): 775 - 793. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Zhang, H. T. Kurata, S. J. Kehl, and D. Fedida Rapid Induction of P/C-type Inactivation Is the Mechanism for Acid-induced K+ Current Inhibition J. Gen. Physiol., February 24, 2003; 121(3): 215 - 225. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |