| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1 Department of Physiology and Biophysics, University of Texas Medical Branch, Galveston 77555; 2 The Retina Foundation of the Southwest, Dallas 75231; 3 Department of Ophthalmology, University of Texas Southwestern, Dallas 75231; 4 Department of Ophthalmology and Visual Sciences, University of Texas Medical Branch, Galveston, Texas 77555; Departments of 5 Anatomy and 6 Physiology, Indiana University School of Medicine, Gary, Indiana 46408; and 7 Renal Division, Brigham and Women's Hospital, Harvard Institutes of Medicine, Boston, Massachusetts 02115
 |
ABSTRACT |
|---|
 TOP
 ABSTRACT
 INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
Retinal pigment epithelium (RPE) possesses regulated chloride channels that are crucial for transepithelial fluid and ion transport. At present, little is known about the molecular nature of chloride channels in human adult RPE (haRPE) or the effects of oxidative stress on membrane conductance properties. In the present study, we assessed ClC channel and cystic fibrosis transmembrane conductance regulator (CFTR) expression and membrane chloride conductance properties in haRPE cells. ClC-5, ClC-3, ClC-2, and CFTR mRNA expression was confirmed with RT-PCR analysis, and protein expression was detected with Western blot analysis and immunofluorescence microscopy. Whole cell recordings of primary cultures of haRPE showed an outwardly rectifying chloride current that was inhibited by the oxidant H2O2. The inhibitory effects of H2O2 were reduced in cultured human RPE cells that were incubated with precursors of glutathione synthesis or that were stably transfected to overexpress glutathione S-transferase. These findings indicate a possible role for ClC channels in haRPE cells and suggest possible redox modulation of human RPE chloride conductances.
immunocytochemistry; patch clamp; glutathione; glutathione S-transferase
| |
INTRODUCTION |
|---|
|
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
RETINAL PIGMENT EPITHELIUM (RPE) comprises part of the blood-retina barrier and functions in several processes that are vital for the preservation of sight. Among the crucial roles of this epithelium is the regulation of the volume and electrolyte composition of the subretinal space. This function is achieved largely by regulated transepithelial transport of chloride from the subretinal space to the choroid with the obligatory movement of water. Disruption of RPE chloride transport can result in the accumulation of fluid in the subretinal space and subsequent retinal detachment (3, 26).
Chloride transport across the RPE is mediated in part by chloride channels that are stimulated by calcium and cAMP (Ref. 28; cf. Refs. 13, 14). In recent whole cell patch-clamp recordings in SV40-transformed cultured human fetal RPE (hfRPE) cells, we (39) identified an outwardly rectifying chloride current that was stimulated by cAMP but was inhibited by the chloride channel blocker DIDS, acidic bathing solutions, or low concentrations of the oxidative agent H2O2. The molecular identity of the chloride channel(s) responsible for this current was not determined. However, these cells expressed several candidate chloride channels including cystic fibrosis transmembrane conductance receptor (CFTR) and members of the ClC chloride channel family (ClC-2, ClC-3, and ClC-5; Ref. 39). At present, little is known about the expression of ClC chloride channels in the intact human RPE.
Recent evidence suggests that the ClC family of voltage-gated chloride channels may be crucial for retinal function. At least three members of this family are associated with retinal degenerations in mice. Specifically, transgenic mice that were deficient for ClC-3 (34), ClC-2 (6), or ClC-7 (17) were found to develop retinal degenerations and blindness within weeks after birth. The basis of these degenerations is not presently understood.
The finding of ClC channel expression in human fetal cells and the consequences of their deletion in mice indicate a possible functional role for these channels in the developing human RPE. To date, there have been no studies of ClC channel expression in the intact human adult RPE (haRPE). In addition, it is unclear whether regulation of RPE cell membrane conductances is similar in human fetal and adult cells.
In the present study, RT-PCR and immunocytochemical analysis methods were used to assess CFTR and ClC channel expression in haRPE cells. In addition, we determined whether an oxidant-regulated chloride conductance was present in primary cultures of haRPE cells and compared this conductance with those previously assessed in cultured hfRPE cells. Finally, we assessed whether antioxidants can protect RPE cell chloride conductances from the inhibitory effects of oxidative agents.
| |
METHODS |
|---|
|
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
Immunocytochemistry. Post mortem eyes were obtained from the National Disease Research Interchange under local Institutional Review Board approval for the use of human tissue. For the present immunocytochemistry study, a donor eye from a 66-year-old Caucasian man was fixed in 4% formaldehyde in phosphate-buffered saline at ~11 h post mortem. RPE-choroid patches were dissected, and 6-µm-thick sections were obtained by cryostat. Before antibody incubation, sections were permeabilized with 1% SDS and then treated with 0.025% potassium permanganate (cf. Ref. 16) to reduce the significant autofluorescence of lipofuscin and Bruch's membrane that is characteristic of native human RPE tissue (10). Sections were incubated in commercially available polyclonal primary antibody raised against rat ClC-3 (Alomone Labs, Jerusalem, Israel), ClC-5 (C1 antibody raised against residues 570-677 of rat ClC-5; Ref. 21) or CFTR monoclonal antibody (formerly Genzyme; now MAB25031, R&D Systems, Minneapolis, MN). The secondary fluorescent antibodies were Alexa 488-conjugated goat anti-rabbit IgG or goat anti-mouse IgG (Molecular Probes). Sections were mounted in Vectashield containing DAPI (Vector Labs) to stain cell nuclei (blue emission). Antibody localization was visualized with an inverted microscope equipped for epifluorescence (Zeiss Axiovert 100M) and analyzed with deconvolution data analysis software (Slidebook; Intelligent Imaging Innovations, Denver, CO). To distinguish residual autofluorescence from specific immunoreactivity, images were obtained with sequential excitation with narrow-bandwidth fluorescence filters for FITC (green emission) and CY3 (red emission). The autofluorescent materials have broad spectral properties (24) and were visible with both filters, whereas the Alexa-488 fluorescence was visible only with the FITC excitation filter. By this method, autofluorescent materials appeared yellow or red-orange whereas Alexa-488-labeled components appeared green. Digital images were further processed with Photoshop 5.5 (Adobe Systems, Seattle, WA).
Primary RPE cell culture (haRPE). Human donor eyes were obtained from the Oregon Eye Bank within 24 h of death and stored in a moist chamber at 4°C. The RPE was removed under sterile conditions and dissociated by treatment with EDTA at 37°C for ~20 min, and the suspended cells were then subjected to centrifugation (3,000 g) in growth medium consisting of DMEM containing 20% fetal bovine serum. Cells were plated on plastic or poly-D-lysine-coated glass coverslips at a subconfluent density and placed in a humidified incubator maintained at 37°C with an atmosphere of 95% air-5% CO2. Cells were fed two or three times a week with Eagle's minimum essential medium (MEM; Sigma Aldrich, St. Louis, MO) supplemented with 1% penicillin and streptomycin and 10% fetal bovine serum (FBS; Hyclone Laboratories, Logan, UT). The cells were passaged between two and four times and grown for 2-5 days before whole cell patch-clamp investigations.
Cultured hfRPE cells. SV40-transformed hfRPE cells (RPE 28 SV4; Coriell Institute, Camden, NJ) were grown in MEM (Sigma-Aldrich) supplemented with 1% penicillin and streptomycin and 10% FBS (Hyclone Laboratories) as previously described (39). The cells were plated at subconfluent density on glass coverslips coated with poly-D-lysine. The cells were incubated in a humidified incubator at 37°C in 95% air and 5% CO2 overnight or were grown to confluence for a period of 3-7 days.
Stably transfected cells that overexpress human glutathione S-transferase (GST) A1.1 and control cells stably transfected with expression vector alone were produced by exposing 80-90% confluent hfRPE cells to plasmid DNA and Transfast transfection reagent (Promega, Madison, WI) in DMEM at 37°C in a CO2 incubator for 1 h. Cells were subsequently overlaid with 4 ml of 10% FBS in DMEM and incubated another 48 h. Positive cells were then selected by using G418 antibiotic (600 µg/ml) for a period of 2 wk. The culture medium was replaced three times per week. Individual clones were trypsinized, and single cells were transferred to a 96-well plate. Colonies grown from single cells were transferred to flasks and grown to confluence for subsequent use. In experiments investigating the effects of glutathione precursors, nontransfected SV40-transformed hfRPE cells were incubated in fresh culture medium containing (in mM) 0.5 glutamate, 0.5 glycine, and 0.1 cysteine for 1 h before whole cell current measurements.Whole cell patch-clamp recording.
Membrane ionic currents were recorded with conventional tight-seal
whole cell patch-clamp techniques (12) under conditions of
symmetrical chloride concentrations in the absence of potassium ions.
The composition of the solutions were as follows (in mM): bath, 130 tetramethylammonium chloride (TMA-Cl), 2 NaH2PO4, 2 calcium cyclamate, 1 MgSO4, 5 glucose, and 10 HEPES; pipette, 130 TMA-Cl, 0.2 calcium cyclamate, 3 MgSO4, 2 EGTA, 10 HEPES, and 3 Na-ATP.
The pH of the solutions was 7.4, and the osmolalities were 300 and 270 mosmol/kgH2O, respectively. Borosilicate glass (cat. no. 18150F-3; WPI, Sarasota, FL) pipettes were pulled (model P-87; Sutter Instrument, Novato, CA) and fire-polished to a tip diameter of 1-2 µm (tip resistance = 3-6 M
). The
pipette was connected to the head stage of a patch-clamp amplifier
(Axopatch 200B; Axon Instruments, Foster City, CA), and the bath was
connected to ground with a 3 M KCl agar bridge. For recordings, the
pipette was positioned next to the cell with a low-drift
micromanipulator (Burleigh PCS-5200) under observation with an inverted
phase-contrast microscope (Zeiss model IM). Membrane voltages were
corrected for liquid junction potentials.
Drugs and antibodies. Glutathione, H2O2, glutamate, glycine and cysteine were obtained from Sigma-Aldrich. Unless otherwise noted, polyclonal antibody for ClC-3 was from Alomone Labs and for ClC-5 was antiserum C1 raised against the COOH-terminal region of rat ClC-5 (21). Monoclonal CFTR antibody was from Genzyme (cat no.2503-01, now MAB25031, R&D Systems).
Western blot analysis. Human RPE was first homogenized then lysed in nonreducing Laemmli sample buffer following the methods of Marmorstein et al. (23). Cell lysates were electrophoresed on a precast 10% SDS-polyacrylamide gel (pager Gold; Cambrex, Rutherford, NJ) and transferred onto a polyvinylidene fluoride membrane (Millipore, Bedford, MA). Alkaline-phosphatase-conjugated secondary antibodies and nitro blue tetrazolium/5-bromo-4-chloro-3-indoylyl phosphate (Western Blue Stabilized Substrate; Promega) were used for signal detection.
RT-PCR. Total RNA was isolated from primary cultures of human adult RPE cells with TRIzol (GIBCO) following the methods of Mangini et al. (22). For single-strand cDNA synthesis, 5 µg of total RNA from each sample was reverse transcribed with Superscript II reverse transcriptase (GIBCO, Gaithersburg MD) and oligo-dT priming. Amplification was performed with 2-µl aliquots of cDNA, High-Fidelity PCR Master (Roche Diagnostics, Indianapolis, IN), and specific primer sets for ClC-2, ClC-3, ClC-5, and CFTR. Primer sets were based on published sequences that spanned at least one intron-exon junction as follows: human ClC-2 primer set (accession no. NM004366) designed to amplify a segment from 104 to 515 (sense, 5'-aagaggaagctgctcggatt-3'; antisense, 5'-cgcaagatggtcttcatctc-3'); human ClC-3 primer set (accession no. NM001829) to amplify a segment from 375 to 1205 [sense 5'untranslated region (UTR), 5'-gctccgagggtagctaggtt-3'; antisense ClC-3, 5'-agagccacaggcatatggag-3']; human ClC-5 primer set (Ref. 11; accession no. X91906) to amplify segment 686 to 1006 (sense, 5'-gagcctttgcctacatagtcaat-3'; antisense ClC-5 5'-gcttggcttcattcttcctgta-3'). Two CFTR primer sets (accession no. XM004980) were used. The CFTR1 primer set was designed to amplify a segment from 50 to 499 (sense, gcaggcacccagagtagtaggtc; antisense, gataaatcgcgatagagcgttcct). The CFTR2 primer set was designed to amplify a segment from 2467 to 3170 (sense, caaggtcagaacattcaccg; antisense, gttgtaaaactgcgacaact). The expected lengths of the PCR products for ClC-2, ClC-3, ClC-5, CFTR1, and CFTR2 are 411, 830, 320, 449, and 703 bp, respectively. PCR reactions were carried out in a GeneAmp 2700 thermocycler (Applied Biosystems, Foster City, CA) under the following conditions: initial denaturation at 94°C for 3 min; 30 cycles of 94°C 30 s, 60°C 30 s, 72°C 1 min, and then 72°C 10 min (final extension). PCR products (5 µl) were electrophoresed with 2% agarose-1× TAE gels containing 0.5 µg/ml ethidium bromide. PCR DNAs were purified for direct sequencing with the Wizard PCR DNA purification system (Promega).
Data analysis and statistics. Steady-state currents were used to calculate the current-voltage (I-V) relationships. To calculate mean ± SE values, the raw data (contained in Axon binary files or and Axon XYM files) were exported to Excel spreadsheets. Paired t-tests or nonparametric tests were used to evaluate statistical significance, as appropriate (Instat; GraphPad Software, San Diego, CA). Graphs and further analysis were generated with SigmaPlot5 software (Aurora, CO).
| |
RESULTS |
|---|
|
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
Rationale for choice of experimental preparations. The following experiments used three different human RPE preparations. For haRPE, intact native epithelium was used to assess ClC chloride channel expression in Western blot analysis and in immunofluorescence microscopy experiments. Primary cultures of these cells were used to achieve whole cell patch-clamp recordings and for RT-PCR analysis to minimize contamination from other subretinal cell types. Finally, a continuous hfRPE cell line (39) was used to enable genetic or environmental manipulation of antioxidative agents.
PCR and Western blot analysis.
To obtain evidence for the presence of ClC and CFTR gene products in
haRPE cells, RT-PCR analysis was performed with mRNA obtained from
primary cultures of haRPE cells. As shown in Fig. 1, RT-PCR performed with specific primer
sets for human ClC-2, ClC-3, and ClC-5 resulted in amplification of
fragments of the predicted size and sequence for these channels.
Similar experiments with CFTR-specific primers sets resulted in the
amplification of cDNAs with the appropriate predicted sizes and
sequences for CFTR (see Fig. 2). In
addition, as shown in Fig. 3, Western
blots of membrane proteins from intact haRPE (a gift of Dr. Alan
Marmorstein) probed with antibodies raised against the NH2
terminus of ClC-5 (a gift of Dr. O. Devuyst; see Ref. 36)
and ClC-3 (antibody 3A4, a gift of Dr. Thomas Jentsch; see Ref.
34) resulted in stained bands of the expected sizes for
ClC-3 and ClC-5.
|
|
|
Immunocytochemistry studies.
Figures 4-6 present images of cross-sections of native
haRPE-choroid, oriented with the RPE cell layer at the top and the
choroid below. Figure 4 presents a
typical example of a differential interference contrast image. Bruch's
membrane is indicated by the triangle and the RPE apical microvillus
membrane is at the top of the section. Figure
5 shows fluorescence images of two
adjacent sections from the same eye that were processed using a
deconvolution algorithm. The inverted white triangles indicate the
apical surface of the RPE cells. (Cell nuclei were stained with DAPI
and appear blue. Autofluorescence of the RPE cells and Bruch's
membrane appears red-orange.) In Fig. 5A, the cells were
stained with primary antibody for ClC-5. Staining was most prominent in
the RPE near the apical membrane. Some faint staining is also evident
in the choroid and capillary endothelial cells. In Fig. 5B,
the section was treated identically except that primary antibody was
incubated with ClC-5 peptide before incubation with the tissue. Note
that a marked reduction of specific ClC-5 staining occurred.
|
|
|
Whole cell membrane properties.
To assess membrane chloride conductances, whole cell currents were
recorded in primary cultures of haRPE cells using symmetrical chloride
solutions with the absence of potassium and low sodium (see
METHODS). Currents were stable within 2 min of obtaining a
whole-cell configuration. Figure 7
compares membrane chloride current measurements recorded from primary
cultured haRPE cells and SV40 transformed hfRPE cells
(39). Figure 7, A and B, presents representative current recordings from haRPE and hfRPE cells, respectively, showing the response to voltage steps ranging from 
100
to +100 mV in 20-mV increments. In both cases, the currents showed
moderate outward rectification and little time dependence. The outward
rectification is also evident in Fig. 7C, which presents average I-V relationships calculated from steady-state
current values for both cell types (haRPE cells, n = 11; hfRPE cells, n = 8).
|
|
|
Membrane conductance regulation.
To test for possible modulation of the membrane chloride conductances
in the primary cultured haRPE cells, several agents were used. Because
CFTR is activated by cAMP and chloride conductances in hfRPE cells and
RPE cells from other species have been shown to be increased by this
agent, we assessed the effects of a cAMP cocktail that contained 250 µM 8-bromo-cAMP (8-BrcAMP), 100 µM IBMX, and 25 µM forskolin. As
shown in Fig. 10, the current was increased by 39 ± 9% and the conductance was increased by
43 ± 17% mV (n = 4) within 3 min of the
application of the cAMP cocktail.
|
60 mV and by
32% ± 11% for the slope conductance between 60 and 100 mV. The
inhibitory effect typically occurred within 1 min of exposure and
usually could be reversed by washing the cells with bath solution.
|
Effects of antioxidative agents. Glutathione, or GSH, is a naturally occurring substance that protects cells, tissues, and organs from toxic free radicals and disease and has been implicated in the modulation of the activity of several enzymes (2,32). Glutathione is a tripeptide consisting of three amino acids, glycine, glutamate, and cysteine, and each of these three precursors is necessary for the manufacture of glutathione within cells. Most intracellular glutathione is normally in the reduced state (GSH), where it plays a protective role by scavenging free radicals or by serving as a substrate for conjugation by enzymes that detoxify harmful substances such as lipid peroxides.
In preliminary experiments, we sought to test whether exogenous application of extracellular glutathione abolished the inhibitory effects of H2O2 on membrane currents. Although we initially observed that glutathione abolished the inhibitory effects of H2O2 on the membrane chloride conductance, this experiment proved to be confounded. Measurements of H2O2 concentrations revealed that glutathione addition directly decreased the quantity of H2O2 in the extracellular bathing solution. Therefore, we decided to test the effects of antioxidants by altering intracellular glutathione levels or by genetically manipulating the expression levels of antioxidant enzymes. Because a continuous RPE cell line was needed for the genetic manipulation experiments, these studies were carried out on the cultured hfRPE cell line used in our previous study (39). To alter intracellular glutathione levels, cells were exposed to precursors of glutathione production (in mM: 0.5 glutamate, 0.5 glycine, and 0.1 cysteine) for 1 h before the experiments. As previously shown by Sternberg and coworkers (7, 33), these supplements significantly increase glutathione production and protect against oxidant-induced cell death. As shown in Fig. 12A, when the SV40-transformed hfRPE cells were previously exposed to culture medium supplemented with glutathione synthesis precursors, membrane currents were not significantly affected by subsequent H2O2 exposure [
I = 11 ± 4% at +100 mV; not significant (n.s.); n = 4]. However, paired cells from the same batch that were bathed in
normal culture medium (without supplementation) did show significantly decreased currents (I = 38 ± 8%; n = 3) in agreement with results from our previous study
(39). Figure 12B presents conductance data from the supplement-treated cells summarized in Fig.
12A. As in the case of the whole cell currents, the membrane
conductance in the treated cells was not significantly altered by
H2O2 treatment (12% ± 4%; n.s.). In
contrast, the conductance decreased by 45 ± 11%
(P < 0.05; t-test = 2.86) in cells
that were not exposed to supplements.
|
I = 4 ± 2%; n.s.; n = 4). The effect of H2O2 on the membrane
conductance was also abolished as summarized in Fig. 13C.
The change in conductance for the GST-transfected RPE cells was
3 ± 1% (n.s.; n = 4) compared with a decrease
of 38 ± 12% for the vector-transfected RPE cells
(P < 0.05; n = 4).
|
| |
DISCUSSION |
|---|
|
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
The results of these experiments provide new evidence for ClC channel expression in the intact haRPE. In addition, an outward chloride conductance was detected in primary cultures of these cells that was stimulated by cAMP and inhibited by H2O2. These data confirm and extend our previous results for cultured SV40-transformed hfRPE cells (39). In addition, the present results provide the first demonstration that the actions of oxidative agents on membrane currents and conductance properties of RPE cells can be prevented by antioxidants. Exposure of human RPE cells to glutathione precursors or overexpression of the antioxidant enzyme GST in these cells diminished the inhibitory effects of H2O2 on membrane chloride conductances. These results suggest that the membrane chloride conductance in human RPE cells is modulated by reactive oxygen species and can be protected by antioxidative agents.
Chloride channel expression. In the present study, RT-PCR analysis of primary cultures of haRPE cells resulted in the amplification of cDNA fragments with the predicted size and sequence for several known ClC channels, specifically ClC-2, ClC-3, and ClC-5. These findings are similar to our previous reports of ClC-5 and ClC-3 mRNA expression in cultured hfRPE cells (39). Similar evidence for CFTR mRNA expression was obtained in the same cells. These results agree with previous preliminary reports of CFTR mRNA expression in human RPE cells by others (4, 30).
The results of Western blot analysis and immunocytochemical experiments revealed positive reactivity with ClC channel antibodies that was blocked by antigenic peptides. These findings indicate the expression of ClC channel proteins in addition to mRNA expression. We previously reported (39) ClC-2, ClC-3, and ClC-5 protein expression in subconfluent fetal RPE cells. However, unlike the diffuse intracellular staining noted in fetal cultured cells, the staining of ClC-3 and ClC-5 in intact haRPE was predominantly located near the region of the apical membrane. Recent studies in other organs such as the kidney and liver indicate that ClC-5 channels are mainly expressed in intracellular compartments (for review see Ref. 38). Although the channels were found in the apical region of the RPE cells in the present study, we cannot rule out an intracellular location. It is conceivable that channels could be contained both in the apical membrane and in a subcellular compartment below the apical surface. Schwake et al. (31) recently reported that ClC-5 can be inserted into surface membranes and is retrieved from the surface membranes via a mechanism that involves protein-protein interactions. These interactions are mediated by a PY motif that, when mutated, abolishes retrieval of this channel from cell surface membranes. Further work is needed to determine whether these channels are trafficked to the apical membranes of RPE cells or are involved in phagocytosis or endocytosis. ClC-2 and ClC-3 are widely expressed in most epithelial cells (38). Although strong staining was obtained for ClC-3 antibody, in preliminary experiments, ClC-2 immunoreactivity in haRPE was weak. Nonetheless, ClC-2 expression was recently confirmed in mouse RPE (6). Although ClC-3 is generally believed to be an intracellular ion channel (34), positive staining for ClC-3 was observed in the apical membrane region of haRPE cells and this staining was blocked by antigenic peptide. Recently, controversy has arisen concerning the specificity of ClC-3 antibodies. Stobrawa et al. (34) reported that ClC-3 antibody from Alomone Laboratories demonstrated positive reactivity against an unidentified peptide in ClC-3 knockout mice. We cannot rule out the possibility that an unrelated peptide may have reacted with the ClC-3 antibody used in the present study. However, in Western blot studies, a positive reaction was obtained at the appropriate size for ClC-3. In addition, as noted above, PCR analysis provides evidence for mRNA expression for ClC-3. We note also that ClC-3 has been cloned from human fetal cells (39) and intact human adult retina (5). As discussed above, CFTR expression in haRPE has been previously reported in preliminary studies by Quong and Miller (30). Peterson et al. (26) reported bright staining of CFTR predominantly near the basolateral membrane. In the present study, staining near both membranes was detected. Further experiments are needed to resolve this discrepancy and localize this channel. Nonetheless, the results of the present study are consistent with CFTR protein expression in haRPE cells and extend our previous findings of CFTR protein expression in cultured fetal RPE cells (39).Chloride channel function. Previous functional studies of human RPE have identified two functionally distinct chloride channels located in the basolateral membrane, a cAMP-regulated channel and a calcium-regulated channel (28). In the present study, whole cell patch-clamp measurements in primary cultures of haRPE cells demonstrated an outwardly rectifying current that was reduced by replacement of chloride in the bathing solution with iodide or gluconate. In addition, the current was decreased by the chloride channel blockers chlorotoxin and DIDS. The effects of calcium stimulation were not evaluated; however, the current was increased by cAMP. These properties are nearly identical to those previously reported for cultured SV40-transformed hfRPE cells (39).
At present, the relationship between regulated membrane chloride conductances in subconfluent RPE cells and specific ClC channels or CFTR channels expressed in RPE cells is unclear. Unfortunately, it was not possible to study the conductance properties of intact sheets of haRPE in the present study. In the case of CFTR, it is generally believed that this channel is exclusively expressed on the apical membrane in CF-affected airway epithelia (26). However, previous reports of a cAMP-stimulated conductance (28) and the presence of CFTR near or in the basolateral membrane in RPE cells (26) raise the possibility that CFTR may at least partly mediate the basolateral membrane chloride conductance. The putative apical and/or intracellular location of ClC-5 makes the participation of these channels in the basolateral membrane conductance unlikely. In other epithelial tissues such as the renal proximal tubule and hepatocytes, these channels are located in endosomes beneath the apical surface (8, 21, 31). In mice genetically engineered to be deficient in this channel, apical membrane endocytosis is impaired in proximal tubule cells but not for the sinusoidal membranes of hepatic cells (27). However, the function of these channels in endosomes is not well understood. Because the apical membrane of RPE undergoes a substantial amount of remodeling and endocytosis during phagocytosis, it would be interesting to determine whether the RPE shows defective endocytosis in ClC-5-deficient mice. ClC-3-deficient mice show normal retinas at birth, but a striking photoreceptor degeneration occurs within the first 2 wk of life (34). The reasons for this loss are not understood. Previous investigators have suggested that ClC-3 may be a swelling-activated channel (9); however, no defects in swelling activated conductances were found in ClC-3-deficient mice (34). Moreover, Li et al. (20) demonstrated that the properties of ClC-3 currents expressed in heterologous systems were distinct from swelling activated currents. Therefore, ClC-3 channels may play a different, but presently unknown, role in the maintenance of photoreceptor viability.Oxidative stress and antioxidants. Oxidative stress may play a role in RPE aging and in retinal degenerative diseases (2); however, the mechanisms by which oxidants cause damage to RPE and other epithelial cell membranes remain unclear (25). Addition of 100 µM H2O2 resulted in reversible inhibition of the membrane chloride conductance in primary cultures of haRPE cells. We recently demonstrated (37) that similar concentrations of H2O2 inhibit ClC-5 currents expressed in mammalian somatic cells or Xenopus oocytes and membrane chloride conductances in SV40-transformed hfRPE cells. CFTR is also known to be affected by oxidative agents (18, 35). These findings raise the possibility that membrane chloride channels, possibly including CFTR and ClC-5, may be modulated in RPE cells by redox-sensitive mechanism(s).
Role of antioxidants. Antioxidants are known to protect cells from the deleterious effects of oxidative stress. In previous studies, exposure of RPE cells to H2O2 was found to induce mitochondrial DNA damage (1) and apoptosis (15) and to produce an increase in the activity of the antioxidant enzyme GST (32). Preliminary studies using hfRPE cells transfected to overexpress GST A1.1 showed protection from oxidant-induced DNA damage and loss of cell viability (B. F. Godley, unpublished observations). Using the same stably transfected cell line, we observed that GST overexpression protects against the immediate inhibitory effects of H2O2 on the membrane chloride conductances. Moreover, untransfected SV40-transformed hfRPE cells in the present study were also protected against the inhibitory effects of H2O2 on membrane chloride currents and conductances when they were grown in media supplemented with precursors of glutathione synthesis according to the protocol of Sternberg et al. (33). It will be interesting to determine whether other oxidizing agents have similar inhibitory effects on membrane properties and, if so, whether other antioxidant mechanisms can protect against this inhibition.
In summary, haRPE cells express ClC and CFTR chloride channels, suggesting that the role of these channels is not limited to fetal development. In addition, these cells demonstrate a membrane chloride conductance that is sensitive to cAMP and inhibited by the oxidant H2O2. Overproduction of the antioxidant enzyme GST or exposure to amino acids that are precursors to glutathione production protected against the effects of H2O2. The deleterious effects of oxidants on the membrane chloride conductance and the protective effects of antioxidant systems raise the possibility that chloride channel function in RPE cells may be altered in diseases or conditions that increase oxidative damage such as diabetic retinopathy (19) or macular degeneration (2). Such disruptions in RPE chloride channel functions could provide one means by which oxidative stress contributes to pathophysiologies associated with the retinal-RPE interface.| |
ACKNOWLEDGEMENTS |
|---|
We are indebted to Drs. O. Devuyst and T. Jentsch for their donation of ClC-5 and ClC-3 antibodies, to Dr. Alan Marmorstein for donation of haRPE protein and help with the Western blot analyses, and to S. Blaug for helpful suggestions regarding CFTR primers.
| |
FOOTNOTES |
|---|
This work was supported by National Institutes of Health Grants DK-53352, EY-12850, EY-11308, and EY-1792, a RPB Sybil B. Harrington Scholar Award (B. F. Godley), and the John Sealy Memorial Endowment for Biomedical Sciences (N. K. Wills).
Address for reprint requests and other correspondence:
N. K. Wills, Depts. of Physiology and Biophysics and
Ophthalmology and Visual Sciences, Univ. of Texas Medical Branch,
Galveston, TX 775550641 (E-mail:
nkwills{at}utmb.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
June 13, 2002;10.1152/ajpcell.00445.2001
Received 17 September 2001; accepted in final form 1 May 2002.
| |
REFERENCES |
|---|
|
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
1.
Ballinger, SW,
Van Houten B,
Jin GF,
Conklin CA,
and
Godley BF.
Hydrogen peroxide causes significant mitochondrial DNA damage in human RPE cells.
Exp Eye Res
68:
765-772,
1999.
2.
Beatty, S,
Koh H,
Phil M,
Henson D,
and
Boulton M.
The role of oxidative stress in the pathogenesis of age-related macular degeneration.
Surv Ophthalmol
45:
115-134,
2000.
3.
Bird, A.
Pathogenesis of serous detachment of the retina and pigment epithelium.
Retina
2:
1019-1026,
1994.
4.
Blaug, SA,
Quong JN,
Schafer JA,
Flannery JG,
and
Miller SS.
CFTR in native human fetal RPE (Abstract).
Invest Ophthalmol Vis Sci
39:
S188,
1998.
5.
Borsani, G,
Rugarli EI,
Taglialatela M,
Wong C,
and
Ballabio A.
Characterization of a human and murine gene (CLCN3) sharing similarities to voltage-gated chloride channels and to a yeast integral membrane protein.
Genomics
27:
131-141,
1995.
6.
Bosl, MR,
Stein V,
Hubner C,
Zdebik AA,
Jordt SE,
Mukhopadhyay AK,
Davidoff MS,
Holstein AF,
and
Jentsch TJ.
Male germ cells and photoreceptors, both dependent on close cell-cell interactions, degenerate upon ClC-2 Cl
channel disruption.
EMBO J
20:
1289-1299,
2001.
7.
Davidson, PC,
Sternberg P,
Jones DP,
and
Reed RL.
Synthesis and transport of glutathione by cultured human retinal pigment epithelial cells.
Invest Ophthalmol Vis Sci
35:
2843-2849,
1994.
8.
Devuyst, O,
Christie OP,
Courtoy PJ,
Beauwens R,
and
Thakker RV.
Intra-renal and subcellular distribution of the human chloride channel ClC-5 reveals a pathophysiological basis for Dent's disease.
Hum Mol Genet
8:
247-257,
1999.
9.
Duan, D,
Winter C,
Cowley S,
Hume JR,
and
Horowitz B.
Molecular identification of a volume-regulated chloride channel.
Nature
390:
417-421,
1997.
10.
Feeney, L.
Lipofuscin and melanin of human retinal pigment epithelium. Fluorescence, enzyme, cytochemical, and ultrastructural studies.
Invest Ophthalmol Vis Sci
17:
583-600,
1978.
11.
Fisher, SE,
van Bakel I,
Lloyd SE,
Pearce SH,
Thakker RV,
and
Craig IW.
Cloning and characterization of CLCN5, the human kidney chloride channel gene implicated in Dent's disease (an X-linked hereditary nephrolithiasis).
Genomics
29:
598-606,
1995.
12.
Hamill, OP,
Marty A,
Neher E,
Sakmann B,
and
Sigworth FJ.
Improved patch-clamp techniques for high-resolution current recording from cells and cell-free membrane patches.
Pflügers Arch
391:
85-100,
1981.
13.
Hughes, BA,
Gallemore RP,
and
Miller SA.
Transport mechanisms in the retinal pigment epithelium.
In: The Retinal Pigment Epithelium, edited by Marmor MF,
and Wolfensberger TJ.. New York: Oxford Univ. Press, 1998, p. 103-134.
14.
Hu, JG,
Gallemore RP,
Bok D,
and
Frambach DA.
Chloride transport in cultured fetal human retinal pigment epithelium.
Exp Eye Res
62:
443-448,
1996.
15.
Jin, GF,
Hurst JS,
and
Godley BF.
Hydrogen peroxide stimulates apoptosis in cultured human retinal pigment epithelial cells.
Curr Eye Res
22:
165-173,
2001.
16.
Kennedy, BG,
Haley BE,
and
Mangini NJ.
Creatine kinase in human retinal pigment epithelium.
Exp Eye Res
70:
183-190,
2000.
17.
Kornak, U,
Kasper D,
Bosl MR,
Kaiser E,
Schweizer M,
Schulz A,
Friedrich W,
Delling G,
and
Jentsch TJ.
Loss of the ClC-7 chloride channel leads to osteopetrosis in mice and man.
Cell
104:
205-215,
2001.
18.
Kourie, JI.
Interaction of reactive oxygen species with ion transport mechanisms.
Am J Physiol Cell Physiol
275:
C1-C24,
1998.
19.
Larkins, RG,
Dunlop ME,
and
Johnson EI.
Norman MacAlister Gregg Lecture. The pathogenesis of diabetic retinopathy.
Aust NZ J Ophthalmol
24:
97-104,
1996.
20.
Li, X,
Shimada K,
Showalter LA,
and
Weinman SA.
Biophysical properties of ClC-3 differentiate it from swelling-activated chloride channels in Chinese hamster ovary-K1 cells.
J Biol Chem
275:
35994-35998,
2000.
21.
Luyckx, VA,
Goda FO,
Mount DB,
Nishio T,
Hall A,
Hebert SC,
Hammond TG,
and
Yu AS.
Intrarenal and subcellular localization of rat CLC5.
Am J Physiol Renal Physiol
275:
F761-F769,
1998.
22.
Mangini, NJ,
Haugh-Scheidt L,
Valle JE,
Cragoe EJ, Jr,
Ripps H,
and
Kennedy BG.
Sodium-calcium exchanger in cultured human retinal pigment epithelium.
Exp Eye Res
65:
821-834,
1997.
23.
Marmorstein, AD,
Marmorstein LY,
Rayborn M,
Wang X,
Hollyfield JG,
and
Petrukin K.
Bestrophin, the product of the Best vitelliform macular dystrophy gene (VMD2), localizes to the basolateral plasma membrane of the retinal pigment epithelium.
Proc Natl Acad Sci USA
97:
12758-12763,
2000.
24.
Marmorstein, AD,
Marmorstein LY,
Skakaguchi JG,
and
Hollyfield JG.
Spectral profiling of drusen, lipofuscin, and Bruch's membrane associated autofluorescence in normal and AMD eyes (Abstract).
Invest Ophthalmol Vis Sci
42:
S222,
2001.
25.
Meng, X,
and
Reeves WB.
Effects of chloride channel inhibitors on H2O2-induced renal epithelial cell injury.
Am J Physiol Renal Physiol
278:
F83-F90,
2000.
26.
Peterson, WM,
Quong JN,
and
Miller SS.
Manipulations of fluid transport in retinal pigment epithelium.
In: The Third Great Basin Visual Science Symposium on Retinal Research. Salt Lake City, UT: Moran Eye Center and University of Utah, 1998, vol. III, p. 34-42.
27.
Piwon, N,
Gunther W,
Schwake M,
Bosl MR,
and
Jentsch TJ.
CIC-5 Cl-channel disruption impairs endocytosis in a mouse model for Dent's disease.
Nature
408:
369-373,
2000.
28.
Quinn, RH,
and
Miller SS.
Ion transport mechanisms in native human retinal pigment epithelium.
Invest Ophthalmol Vis Sci
33:
3513-3527,
1992.
29.
Quinn, RH,
Quong JN,
and
Miller SS.
Adrenergic receptor activated ion transport in human fetal retinal pigment epithelium.
Invest Ophthalmol Vis Sci
42:
255-264,
2001.
30.
Quong, JN,
and
Miller SS.
Genetic alteration of retinal pigment epithelium function (Abstract).
Invest Ophthalmol Vis Sci
38:
S258,
1997.
31.
Schwake, M,
Friedrich T,
and
Jentsch TJ.
An internalization signal in ClC-5, an endosomal Clchannel mutated in Dent's disease.
J Biol Chem
276:
12049-12054,
2001.
32.
Singhal, SS,
Godley BF,
Chandra A,
Pandya U,
Jin GF,
Saini MK,
Awasthi S,
and
Awasthi YC.
Induction of 4-hydroxynonenal metabolizing glutathione S-transferase hGST 5.8 is an early adaptive response to oxidative stress in RPE cells.
Invest Ophthalmol Vis Sci
40:
2652-2659,
1999.
33.
Sternberg, P, Jr,
Davidson PC,
Jones DP,
Hagen TM,
Reed RL,
and
Drews-Botsch C
Protection of retinal pigment epithelium from oxidative injury by glutathione and precursors.
Invest Ophthalmol Vis Sci
34:
3661-3668,
1993.
34.
Stobrawa, SM,
Breiderhoff T,
Takamori S,
Engel D,
Schweizer M,
Zdebik AA,
Bosl MR,
Ruether K,
Jahn H,
Draguhn A,
Jahn R,
and
Jentsch TJ.
Disruption of ClC-3, a chloride channel expressed on synaptic vesicles, leads to a loss of the hippocampus.
Neuron
29:
185-196,
2001.
35.
Stutts, MJ,
Gabriel SE,
Price EM,
Sarkadi B,
Olsen JC,
and
Boucher RC.
Pyridine nucleotide redox potential modulates cystic fibrosis transmembrane conductance regulator Cl conductance.
J Biol Chem
269:
8667-8674,
1994.
36.
Wang, SS,
Devuyst O,
Courtoy PJ,
Wang XT,
Wang H,
Wang Y,
Thakker RV,
Guggino S,
and
Guggino WB.
Mice lacking renal chloride channel, ClC-5, are a model for Dent's disease, a nephrolithiasis disorder associated with defective receptor mediated endocytosis.
Hum Mol Genet
9:
2937-2945,
2000.
37.
Weng, TX,
Mo L,
Hellmich HL,
Yu ASL,
Wood T,
and
Wills NK.
Expression and regulation of ClC-5 chloride channels.
Am J Physiol Cell Physiol
280:
C1511-C1520,
2001.
38.
Wills, NK,
and
Fong P.
ClC chloride channels in epithelia: recent progress and remaining puzzles.
News Physiol Sci
16:
161-166,
2001.
39.
Wills, NK,
Weng TX,
Mo L,
Hellmich HL,
Yu ASL,
Wang T,
Bucheit S,
and
Godley BF.
Chloride channel expression in cultured human fetal RPE cells.
Invest Ophthalmol Vis Sci
41:
4247-4255,
2000.
This article has been cited by other articles:
|
|
 |
|
  H. C. Hartzell, Z. Qu, K. Yu, Q. Xiao, and L.-T. Chien Molecular Physiology of Bestrophins: Multifunctional Membrane Proteins Linked to Best Disease and Other Retinopathies Physiol Rev, April 1, 2008; 88(2): 639 - 672. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. J. Matsuda, M. S. Filali, K. A. Volk, M. M. Collins, J. G. Moreland, and F. S. Lamb Overexpression of CLC-3 in HEK293T cells yields novel currents that are pH dependent Am J Physiol Cell Physiol, January 1, 2008; 294(1): C251 - C262. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Jin, J. Yaung, R. Kannan, S. He, S. J. Ryan, and D. R. Hinton Hepatocyte Growth Factor Protects RPE Cells from Apoptosis Induced by Glutathione Depletion Invest. Ophthalmol. Vis. Sci., November 1, 2005; 46(11): 4311 - 4319. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Hartzell, Z. Qu, I. Putzier, L. Artinian, L.-T. Chien, and Y. Cui Looking Chloride Channels Straight in the Eye: Bestrophins, Lipofuscinosis, and Retinal Degeneration Physiology, October 1, 2005; 20(5): 292 - 302. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Strauss The Retinal Pigment Epithelium in Visual Function Physiol Rev, July 1, 2005; 85(3): 845 - 881. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Reigada and C. H. Mitchell Release of ATP from retinal pigment epithelial cells involves both CFTR and vesicular transport Am J Physiol Cell Physiol, January 1, 2005; 288(1): C132 - C140. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. M. Browe and C. M. Baumgarten Angiotensin II (AT1) Receptors and NADPH Oxidase Regulate Cl- Current Elicited by {beta}1 Integrin Stretch in Rabbit Ventricular Myocytes J. Gen. Physiol., August 30, 2004; 124(3): 273 - 287. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |
, haRPE cells;
, hfRPE cells).
) or by cyclamate (
)
(n = 4). Note that no difference in the currents was
apparent between the control solution [tetramethylammonium (TMA),
