Am J Physiol Cell Physiol Information on EB 2010
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 283: C1001-C1008, 2002. First published May 29, 2002; doi:10.1152/ajpcell.00140.2002
0363-6143/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
283/3/C1001    most recent
00140.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (28)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lyford, G. L.
Right arrow Articles by Farrugia, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lyford, G. L.
Right arrow Articles by Farrugia, G.
Vol. 283, Issue 3, C1001-C1008, September 2002

alpha 1C (CaV1.2) L-type calcium channel mediates mechanosensitive calcium regulation

Greg L. Lyford1,2, Peter R. Strege1,2, Allan Shepard2, Yijun Ou1,2, Leonid Ermilov1,2, Steven M. Miller1,2, Simon J. Gibbons1,2, James L. Rae2, Joseph H. Szurszewski1,2, and Gianrico Farrugia1,2

Enteric NeuroScience Program and 1 Division of Gastroenterology and Hepatology, 2 Department of Physiology and Biophysics, Mayo Clinic, Rochester, Minnesota 55905


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Smooth muscle exhibits mechanosensitivity independent of neural input, suggesting that mechanosensitive pathways reside within smooth muscle cells. The native L-type calcium current recorded from human intestinal smooth muscle is modulated by stretch. To define mechanosensitive mechanisms involved in the regulation of smooth muscle calcium entry, we cloned the alpha 1C L-type calcium channel subunit (CaV1.2) from human intestinal smooth muscle and expressed the channel in a heterologous system. This channel subunit retained mechanosensitivity when expressed alone or coexpressed with a beta 2 calcium channel subunit in HEK-293 or Chinese hamster ovary cells. The heterologously expressed human cardiac alpha 1C splice form also demonstrated mechanosensitivity. Inhibition of kinase signaling did not affect mechanosensitivity of the native channel. Truncation of the alpha 1C COOH terminus, which contains an inhibitory domain and a proline-rich domain thought to mediate mechanosensitive signaling from integrins, did not disrupt mechanosensitivity of the expressed channel. These data demonstrate mechanical regulation of calcium entry through molecularly identified L-type calcium channels in mammalian cells and suggest that the mechanosensitivity resides within the pore forming alpha 1C-subunit.

smooth muscle; mechanogated; voltage gated


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

MECHANOSENSITIVE PROCESSES allow organisms to respond and adapt to their environment. Prokaryotic cells express mechanosensitive ion channels required to maintain intracellular composition (reviewed in Ref. 23). Eukaryotic organisms employ mechanosensitive processes for a wide array of regulatory and sensory tasks. Mechanotransduction is responsible for hearing, touch, balance, blood flow regulation, and cardiac function (29). Mechanical signals are processed by direct cytoskeletal interactions, by triggering of mechanosensitive signaling cascades, or by altering activity of mechanosensitive ion channels. Mechanically gated or sensitive ion channels allow for direct and immediate regulation of excitable cells, such as neurons, sensory receptors, or myocytes. Thereby, mechanical signals can be converted rapidly into a change in cellular activity. Via signaling to the nucleus, these mechanosensitive mechanisms can also direct normal cellular development as well as pathological changes.

Smooth muscle responds to mechanical forces. Stretch of smooth muscle leads to a contractile response (4), and this stretch-induced increase in tone can occur in the absence of extrinsic neural input and, therefore, is thought to be myogenic (5). Smooth muscle stretch results in an increase in intracellular calcium concentration (1, 17). Voltage-gated calcium channels are important in intracellular calcium regulation in this context of mechanical stimulation (18). Smooth muscle phenotype also responds to mechanical stresses during long-term exposures, and these changes, particularly hypertrophy, contribute to human diseases. Cardiac smooth muscle and vascular smooth muscle hypertrophy occur in the setting of hypertension. Hypertrophy of airway smooth muscle occurs in obstructive lung disease and further contributes to its pathogenesis. Urinary and gastrointestinal smooth muscle hypertrophies in the context of distal obstruction (9).

Native L-type calcium current in dissociated human jejunal circular smooth muscle cells can be modulated by mechanical perturbation (8, 14), but the molecular basis for this effect is unknown. We report here the cloning and heterologous expression of the human L-type calcium channel alpha 1C-subunit (CaV1.2) from human jejunal smooth muscle. We demonstrate that the cloned channel exhibits mechanosensitive behavior similar to the native channel. The human cardiac alpha 1C-subunit also exhibits a mechanosensitive increase in peak current when expressed in a heterologous system, suggesting a more widespread role of this mechanism. These data demonstrate a mechanosensitive means of regulating calcium influx via voltage-gated calcium channels.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cloning. Use of human tissue was approved by the Mayo Clinic Institutional Review Board. Jejunal circular smooth muscle was obtained as surgical waste from gastric bypass procedures and was enzymatically dissociated (14). Individual smooth muscle cells were collected, and three separate human jejunum (HJEJ) plasmid cDNA libraries were prepared from freshly isolated tissue as described (30). The sequences of cardiac and smooth muscle alpha 1 calcium channel L2 subtype (32) corresponding to GenBank accession no. M92269 were used to design a 25-nt 5'-biotinylated capturing probe against the dihydropyridine-binding region (28), and the HJEJ plasmid cDNA libraries were screened by using the magnetic bead capture approach (31). PCR primers designed against the 5'- and 3'-ends of beta 2 calcium channel subunit open reading frame (ORF) were used to amplify the ORF from the HJEJ cDNA library by using ThermalAce DNA polymerase (Invitrogen, Carlsbad, CA). The PCR product was TA cloned into pCR2.1 TOPO (Invitrogen), and both strands were sequenced. Immunostaining was performed on human jejunum by using an anti-alpha 1C polyclonal antibody raised in rabbits (no. ACC-003; Alomone Labs, Jerusalem, Israel) at 1:100 dilution using previously described methods (24). Northern analysis was performed on RNA isolated from human jejunum by using a probe generated from a 900-bp PCR product from the 3'-end of the jejunal alpha 1C ORF according to a previously described protocol (3).

Expression vector construction. The human jejunal alpha 1C-subunit was subcloned as an AgeI/NotI fragment from the cDNA library pSport1 cloning vector (Invitrogen) into the pEGFP-C1 vector (Clontech, Palo Alto, CA). This vector was previously modified to include a NotI site in the multicloning site, and the enhanced green fluorescent protein (EGFP) gene was removed with AgeI/NotI restriction digestion. To improve translational efficiency, the 5'-untranslated region (UTR) was removed and a Kozak sequence inserted by using a PCR primer pair with an AgeI site and Kozak sequence (bold) in the 5'-primer and an MfeI site in the 3'-primer (5'-primer, GGCATAACCGGTCTCGAGCCGCCACCATGGTCAATGAGAATACGAGGATG; 3'-primer, GCCACACAATGGCAAAAATAGTCAGTAAAATAATTATTTCAAATGG- TTT). Additionally, to improve expression efficiency, the 3'-UTR was reduced by releasing a 1,735-bp HpaI fragment, leaving only 97 bp of the 3'-UTR. Restriction digestion and complete sequencing confirmed the final plasmid. The beta 2 isolate was released from the pCR2.1 TOPO vector with EcoRI and ligated into the EcoRI site of pCMVSport1 (Invitrogen). The COOH-terminal deletion of amino acids distal to amino acid 1703 was created by releasing a BclI/SalI restriction fragment and inserting a PCR fragment generated by using a 5'-primer upstream of the BclI site and a 3'-primer that included a SalI site, a stop TAG, and nucleotides corresponding to the codons for amino acids 1703-1697. The construct was confirmed by restriction digestion and sequencing.

HEK-293 transfection and patch-clamp recording. With the use of Lipofectamine 2000 reagent (Invitrogen), the green fluorescent protein pEGFP-C1 (Clontech) and the calcium channel subunits were transiently cotransfected into HEK-293 or Chinese hamster ovary (CHO) cells (American Type Culture Collection, Manassas, VA). Transfected cells were identified by fluorescent microscopy and subjected to patch-clamp recording. Whole cell records were obtained by using Kimble KG-12 glass, and single-channel records were obtained by using 7760 glass pulled on a P-97 puller (Sutter Instruments, Novato, CA). Electrodes were coated with R6101 (Dow Corning, Midland, MI) and fire-polished to a final resistance of 3-5 MOmega . Currents were amplified, digitized, and processed with a CyberAmp 320 amplifier, a Digidata 1200, and pCLAMP 8 software (Axon Instruments, Foster City, CA). Whole cell records were sampled at 10 kHz and filtered at 4 kHz with an eight-pole Bessel filter using the pulse protocols indicated. Three separate methods were used to test for mechanosensitivity. Bath perfusion at 10 ml/min for 30 s was used to create shear stress and to activate the mechanosensitive L-type calcium channels according to a previously established protocol (8). Positive pressure applied to the pipette in the standard whole cell configuration was used to increase intracellular pressure. The cytoskeleton constrains the lipid membrane, and at the pressures used (+5 to +40 mmHg), no changes in cell size were seen resulting in increased cell membrane tension. At the single-channel level, negative pressure (-20 to -40 mmHg) was applied to the pipette to activate the channels in the on-cell patch configuration. For the single-channel records, the cells were voltage clamped at -100 mV and stepped to -20 mV for 20-s intervals. A 2-s interval was used between pulses to avoid channel inactivation. Single-channel records were sampled at 5 kHz and filtered at 2 kHz with an eight-pole Bessel filter. All records were obtained at room temperature (22°C). The pipette solution contained (in mM) 145 Cs+, 20 Cl-, 2 EGTA, 5 HEPES, and 125 methanesulfonate for whole cell recording or 80 Ba2+, 160 Cl-, and 5 HEPES for single-channel recording. The bath solution contained (in mM) 149.2 Na+, 4.7 K+, 159 Cl-, 2.5 Ca2+, and 5 HEPES (normal Ringer solution) or 80 Ba2+, 160 Cl-, 5 HEPES, and mannitol to reach an osmolarity of 290 mosM (80 mM Ba2+ bath) for whole cell records. The 80 mM Ba2+ bath was used for single-channel records to depolarize the cells. SB-203580, the Rp diastereomer of 8-(4-chlorophenylthio)-guanosine 3',5'-cyclic monophosphothioate (Rp-CPT-cGMPS), and adenosine 3',5'-cyclic monophosphothioate (cAMPS) were obtained from Calbiochem (La Jolla, CA). All other chemicals were obtained from Sigma-Aldrich (St. Louis, MO). Statistical comparisons were performed with Students t-test (two-tailed and paired), and P < 0.05 was used for statistical significance.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

To determine the molecular identity for this mechanosensitive current, an 8,374-bp cDNA was cloned from human jejunal smooth muscle. This clone contained a 265-bp 5'-UTR, a 1,695-bp 3'-UTR, and a 6,414-bp ORF encoding a 2,138-amino acid alpha 1C protein. Sequence alignment to GenBank accession no. M92269 indicated that exons 22, 31, and 45 were absent from this clone. A silent, single nucleotide polymorphism was present at nt 5626. This sequence was submitted under GenBank accession no. AF465484. The beta 2 calcium channel subunit, obtained by PCR, yielded a predicted 1,710-bp ORF encoding a 570-amino acid protein. Alignment with GenBank accession no. U95019 revealed the absence of exon 6 and insertion of 21 nucleotides corresponding to nt 1132-1152 of the genomic sequence (GenBank accession no. AY027898), suggesting the existence of a previously unidentified exon. This sequence was submitted under GenBank accession no. AF465485. Northern analysis of human jejunal RNA revealed a single band of ~8 kb corresponding to the expected size of the cloned alpha 1C-subunit (Fig. 1A). Immunostaining of human jejunum revealed alpha 1C-like immunoreactivity along the borders of jejunal circular smooth muscle cells (Fig. 1B).


View larger version (53K):
[in this window]
[in a new window]
 
Fig. 1.   Expression of alpha 1C in human jejunum. A: Northern analysis of alpha 1C from human jejunum with beta -tubulin to show relative abundance. B: alpha 1C-like immunoreactivity at the periphery of smooth muscle cells. Scale bar = 10 µm.

Mechanosensitivity of heterologously expressed L-type calcium channel subunits. We expressed the cloned L-type calcium channel in HEK-293 cells to determine whether it exhibited mechanosensitivity in a heterologous system. Expression of the alpha 1C pore-forming subunit alone showed a maximal peak inward current of 39 ± 7 pA (n = 10) in 80 mM Ba2+ (Fig. 2A). Membrane shear stress significantly increased the current by 23% to 48 ± 8 pA (n = 10, P < 0.05) (Fig. 2, B and D). Mean maximal peak inward current was at 30 ± 2 mV (due to the charge screening effect of 80 mM Ba2+) at baseline and was unchanged with perfusion (29 ± 2 mV, P = 0.56) (Fig. 2C). Coexpression of the alpha 1C and beta 2 calcium channel subunits increased the size of the maximal resolvable inward currents so that they were easily measured in 2.54 mM Ca2+. The maximal peak inward current was 76 ± 15 pA in normal Ringer solution, and these currents increased significantly by 50% with bath perfusion to 103 ± 18 pA (n = 15, P < 0.05) (Fig. 3). Mean current-voltage (I-V) relationships demonstrate the increase (Fig. 3). Currents returned to baseline within 130 ± 15 s of discontinuation of bath perfusion. Whole cell recordings in untransfected HEK-293 cells revealed no L-type current in either 80 mM Ba2+ (n = 5) or normal Ringer solution (n = 5) (data not shown). Both activation and inactivation kinetics were more rapid with bath perfusion (Fig. 4).


View larger version (45K):
[in this window]
[in a new window]
 
Fig. 2.   Shear stress increases the current of heterologously expressed human jejunal alpha 1C. A: representative whole cell recording of an HEK-293 cell expressing the human jejunal alpha 1C in 80 mM Ba2+. B: the same cell during shear stress generated by increased bath perfusion. C: mean current-voltage (I-V) relationships. D: normalized mean maximal peak inward Ba2+ currents before, during, and after bath perfusion (n = 10, * P < 0.05).



View larger version (43K):
[in this window]
[in a new window]
 
Fig. 3.   Shear stress increases the Ca2+ current of coexpressed human jejunal alpha 1C- and beta 2-subunits. A: whole cell recording of an HEK-293 cell coexpressing the human jejunal alpha 1C- and beta 2-subunits in normal Ringer solution. B: the same cell during shear stress generated by bath perfusion at 10 ml/min. C: mean I-V relationships. D: normalized mean maximal peak inward Ca2+ currents for the same cells before, during, and after bath perfusion (n = 15, * P < 0.05).



View larger version (43K):
[in this window]
[in a new window]
 
Fig. 4.   Shear stress effects on activation and inactivation. A: representative whole cell recording of an HEK-293 cell coexpressing the human jejunal alpha 1C- and beta 2-subunits nonperfused (NaCl Ringer) and during shear stress generated by bath perfusion (10 ml/min), as well as the difference current. B: activation kinetics reported as time to peak. Time to peak for perfusion () is faster than control () from -25 to +25 mV, and time to peak for difference current (down-triangle) is faster than control from -25 to +30 mV (n = 15, P < 0.05). C: time constant (tau) of inactivation is significantly smaller for perfusion () than control () from -20 to +5 mV, and that for the difference current (down-triangle) is smaller than control from -20 to +15 mV (n = 15, P < 0.05).

Pipette positive pressure in the whole cell configuration with the coexpressed alpha 1C and beta 2 calcium channel subunits was also used to determine mechanosensitivity of the expressed subunits. A positive pressure of 5 mmHg resulted in a 17 ± 6% (n = 6, P < 0.05) increase in peak inward calcium current that returned to baseline after positive pressure was discontinued (Fig. 5).


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 5.   Positive pressure increases the current of heterologously coexpressed human jejunal alpha 1C- and beta 2-subunits. A: whole cell recording of an HEK-293 cell coexpressing the human jejunal alpha 1C- and beta 2-subunits. B: the same cell during increased membrane tension as a result of 5 mmHg pipette positive pressure. C: mean I-V relationships. D: normalized mean maximal peak inward Ca2+ currents for the same cells before, during, and after bath perfusion (n = 6, * P < 0.05).

To demonstrate mechanosensitivity at a single-channel level, we used on-cell patches and negative pipette pressure (-40 mmHg) to stretch the membrane under the recording pipette. Single-channel recordings from HEK-293 cells cotransfected with jejunal alpha 1C and beta 2 subunits revealed an immediate increase in open probability upon change in pressure (n = 8) that was reversible when pressure returned to atmospheric (Fig. 6). The single-channel open probability for the recording shown in Fig. 6 was 0.02 before and 0.06 during application of negative pressure. Open probability increased 2.8 ± 0.5-fold (mean, n = 8). Single-channel conductance, measured with 80 mM Ba2+ as the charge carrier, was measured at +10, +20, and +30 mV. The slope gave a single-channel conductance of 20 pS, and the conductance did not change with negative pressure (data not shown). No mechanosensitive calcium channel activity was observed in untransfected cells (n = 8) (data not shown).


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 6.   Negative pressure increases single-channel opening of alpha 1C. Representative single-channel recording of an HEK-293 cell coexpressing the human jejunal alpha 1C- and beta 2-subunits at baseline (control, pre and post) and with -40 mmHg of negative pressure (C, closed; O, open). Eight cells showed similar opening characteristics.

To determine whether the mechanosensitivity was a conserved property of alpha 1C splice variants, the cardiac alpha 1C-subunit was coexpressed with a beta 2 calcium channel subunit. Cotransfection with the cardiac alpha 1C and beta 2 yielded a maximal inward current of 128 ± 65 pA, which significantly increased by 27% to 163 ± 77 pA (n = 11, P < 0.05) with bath perfusion (Fig. 7). Similar results for both the jejunal and cardiac alpha 1C subunits were obtained in CHO cells (data not shown). These data strongly suggest that mechanosensitivity is not restricted to the jejunal splice form of the alpha 1C and that the components necessary for L-type calcium channel mechanosensitivity are contained within the pore-forming alpha 1C-subunit.


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 7.   Human cardiac alpha 1C is mechanosensitive. A: whole cell recording of an HEK-293 cell cotransfected with the human cardiac alpha 1C- and human jejunal beta 2-subunits. B: the same cell during shear stress generated by 10 ml/min bath perfusion. C: mean I-V relationships. D: normalized mean maximal peak inward Ca2+ currents for the same cells before, during, and after bath perfusion (n = 11, * P < 0.05).

Although unlikely, it is possible that a ubiquitous mechanosensory element separate from the alpha 1C-subunit is present in HEK-293 and CHO cells. To test for this possibility, we expressed the voltage-gated potassium channel, KV2.1. Perfusion or negative pressure had no effect on the size of the potassium current (data not shown). Many widely expressed protein kinases are mechanosensitive, and the alpha 1C-subunit contains several phosphorylation sites. To test for the possibility that mechanosensitivity of the expressed alpha 1C-subunit is mediated through mechanosensitive protein kinases, we examined the effects of cAMPS [500 µM, protein kinase A (PKA) inhibitor, n = 4], protein kinase C fragment 19-36 (50 µm, protein kinase C inhibitor, n = 6), and Rp-CPT-cGMPS (10 µM, protein kinase G inhibitor, n = 6) on the mechanically induced increase in calcium current in human intestinal smooth muscle cells. Perfusion (10 ml/min) still produced a significant increase in mean peak current with a range of 13-46% (P < 0.05 for all drugs compared with preperfusion currents). Additionally, mechanosensitive current increases of 25-31% (P < 0.05) were still seen in the presence of inhibitors of the mechanosensitive p60src tyrosine (geldanamycin, 5.5 µM, n = 4) and p38 mitogen-activated protein kinases (SB-203580, 25 µM, n = 3).

The mechanosensitive element for some channels appears to reside in the COOH terminus (27). The alpha 1C COOH terminus contains a PKA phosphorylation site (10), an inhibitory domain (35), and a proline-rich domain (PRD) that interacts with SH3 domain proteins (11) and has been suggested to mediate mechanosensitive integrin signaling to the L-type channel (36). We generated a COOH-terminal deletion construct that removed all of these regions. When this construct was coexpressed with the beta 2-subunit in HEK-293 cells, bath perfusion still generated a significant increase of 25% in maximal peak inward current (156 ± 33 to 196 ± 35 pA, n = 11, P < 0.05) (Fig. 8). These findings again suggest that mechanosensitivity is an intrinsic property of the alpha 1C-subunit, that the inhibitory domain of the COOH terminus does not function as a mechanosensitive switch, and that interactions through the PRD are not crucial for mechanosensitivity. Removal of the PKA target serine also did not disrupt mechanosensitivity and therefore corroborated findings with the PKA inhibitor in the dissociated human jejunal myocytes. Larger deletions of the COOH terminus result in loss of calcium current (7) and therefore were not tested.


View larger version (39K):
[in this window]
[in a new window]
 
Fig. 8.   alpha 1C mechanosensitivity is not mediated by the COOH terminus. A: representative whole cell recording of an HEK-293 cell cotransfected with the 1,703-amino acid COOH-terminal truncated alpha 1C- and beta 2-subunits. B: the same cell during shear stress (10 ml/min). C: mean I-V relationships. D: normalized mean maximal peak inward Ca2+ currents for the same cells before, during, and after bath perfusion (n = 11, * P < 0.05).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The major finding of the present study is that molecularly identified alpha 1C calcium channel subunits are mechanosensitive when expressed in a heterologous system. The human jejunal alpha 1C calcium channel subunit was mechanosensitive when expressed by itself in an 80 mM Ba2+ bath and also when coexpressed with the voltage-dependent calcium channel beta 2-subunit in more physiological bath conditions. Mechanosensitivity was determined both at the single-channel level and at the whole cell current level to circumvent possible artifacts associated with on-cell patches (25). Single-channel recordings showed that membrane stretch increased the open probability of the calcium channel, the operational definition of a mechanosensitive channel. Mechanosensitivity did not appear to be peculiar to the intestinal splice variant of alpha 1C, because the human cardiac alpha 1C also demonstrated an increase in current with shear stress created by bath perfusion. Mechanosensitivity of the L-type calcium channel in cardiac and intestinal smooth muscle provides a mechanism by which calcium entry is regulated at the level of the muscle ion channel in response to a mechanical stimulus such as stretch. Mechanoactivation of the L-type calcium channel will result in increased calcium entry and increased contractile force.

Other mechanically gated ion channels, for which the primary gating mechanism is membrane stretch, have been characterized by electrophysiology and subsequently cloned. In the prokaryotic realm, the MscL protein from Escherichia coli (33) and the MJ0170 channel from the archeon Methanococcus jannashii (19) have both been heterologously expressed and are mechanogated. Vertebrate mechanogated ion channels now include the recently cloned two-pore/four-transmembrane domain potassium channels TREK-1 (27), TREK-2 (2), and TRAAK (20, 21). Like the L-type calcium channel, some ion channels initially characterized as voltage or ligand gated are also mechanosensitive. Among these are the N-methyl-D-aspartate (NMDA) channel (26), a cardiac muscarinic potassium channel (15), a skeletal muscle sodium channel (34), and a Shaker-IR voltage-gated potassium channel (12).

Several hypotheses for ion channel mechanosensitivity have been proposed (13). Potential mechanisms for ion channel mechanosensitivity include a direct interaction between the transmembrane portion of the channel and the lipid bilayer. This mechanism has been proposed to be the dominant one for some characterized mechanosensitive channels and has been argued to be an unavoidable consequence of inserting a channel into the membrane (12). This mechanism would be common to all membrane-spanning, pore-forming proteins. Additional mechanisms include mechanosensitive signaling cascades that could be activated and regulate channels via phosphorylation or other posttranslational modification. Blockade with five different kinase inhibitors and removal of an identified PKA phosphorylation site on the COOH terminus of the alpha 1C-subunit did not disrupt the mechanosensitivity of our channel and argues against phosphorylation in mechanoregulation of the L-type calcium channel. A third potential mechanism is force transmission via protein-protein interactions between the channel and the cytoskeleton that alter the channel open probability. The TREK-1 and TREK-2 potassium channels exhibit mechanosensitivity that is dependent on the carboxyl terminus of the protein, suggesting the role for specific signaling pathways or protein-protein interactions in the mechanosensitivity of these channels (2, 22). In contrast, the NMDA receptor retains its mechanosensitivity when its carboxyl terminus is removed (6), implying that known interactions with the cytoskeleton via the carboxyl terminus do not participate in the mechanical regulation of this channel. Removal of the COOH terminus from the alpha 1C-subunit did not disrupt mechanosensitivity, suggesting that potential interactions of the PRD with SH3-containing proteins such as Src or Lyn (11) are not required for mechanoregulation and that signaling from integrins to the L-type calcium channel is not the mechanosensitive mechanism. In addition to direct protein-protein interactions, the cytoskeleton may modulate mechanosensitive channels indirectly by constraining forces on the lipid bilayer.

Whether stretch regulation of these channels is a "designed" feature or an unavoidable consequence of having a large protein inserted into the lipid bilayer is unknown. Some element of design likely exists as marked differences in mechanosensitivity exist within the family of two-pore/four-transmembrane domain potassium channels; notably, TASK-1 and TASK-3 are relatively insensitive to mechanical manipulation (16). Likewise, among muscarinic potassium channels, Kir1.1 and Kir2.1 are insensitive to the same manipulations used to demonstrate mechanosensitivity of Kir3.4 (15). In our experiments, KV2.1 did not exhibit mechanosensitive behavior under the same conditions as alpha 1C. Structure-function analysis is needed to illuminate the role of the lipid bilayer, cytoskeletal interactions, or other signaling pathways in the mechanosensitivity of individual ion channels.

The mere observation that these channels are mechanosensitive does not make them mechanotransducers. Mechanoregulation of channels, when expressed in a static organ such as the central nervous system, is not as important as when these same channels are expressed in the periphery and exposed to dynamic forces. In our experiments, the L-type calcium channel demonstrated mechanoregulation at pressures of 5-40 mmHg, which are well within the physiological pressure changes to which the channels are exposed in the native smooth muscle during digestive activity. Likewise, these channels, when expressed in the cardiac and vascular smooth muscle, are routinely exposed to higher forces (>100 mmHg) than we assessed in the present study.

We postulate that mechanosensitive regulation of the L-type calcium channels allows for mechanical influence not only of immediate cellular behavior such as contractile activity but also of cellular phenotype. In myocytes, L-type channels are known to provide the signal in excitation-contraction coupling, and thereby mechanosensitive regulation of these channels could provide a greater contractile force under conditions of greater load. Over the long term, increased calcium entry through mechanosensitive L-type channels could direct phenotypic changes, such as smooth muscle hypertrophy, through calmodulin-dependent transcription factor activation (7). Further studies are required to determine the full physiological and pathophysiological role of mechanosensitivity of the L-type calcium channels in cardiac, smooth muscle, and other tissues.


    ACKNOWLEDGEMENTS

We thank Adrian N. Holm and Inja Lim for assistance with patch-clamp experiments, Cheryl Bernard for performing cell culture and transfection, and Kristy Zodrow for secretarial assistance. We thank Dr. Gyula Varadi for providing the human cardiac alpha 1C expression construct.


    FOOTNOTES

This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-52766 and DK-17238.

Present address of A. Shepard: Alcon Labs, 6201 South Freeway, Forth Worth, TX 76134.

Address for reprint requests and other correspondence: G. Farrugia, 8 Guggenheim Bldg., Mayo Clinic, 200 First St. SW, Rochester, MN 55905 (E-mail: farrugia.gianrico{at}mayo.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

May 29, 2002;10.1152/ajpcell.00140.2002

Received 28 March 2002; accepted in final form 20 May 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1.   An, SS. Mechanical signals and mechanosensitive modulation of intracellular [Ca2+] in smooth muscle. Am J Physiol Cell Physiol 279: C1375-C1384, 2000[Abstract/Free Full Text].

2.   Bang, H, Kim Y, and Kim D. TREK-2, a new member of the mechanosensitive tandem-pore K+ channel family. J Biol Chem 275: 17412-17419, 2000[Abstract/Free Full Text].

3.   Beilharz, EJ, Zhukovsky E, Lanahan AA, Worley PF, Nikolich K, and Goodman LJ. Neuronal activity induction of the stathmin-like gene RB3 in the rat hippocampus: possible role in neuronal plasticity. J Neurosci 18: 9780-9789, 1998[Abstract/Free Full Text].

4.   Bulbring, E. Correlation between membrane potential, spike discharge and tension in smooth muscle. J Physiol 128: 200-221, 1955[Free Full Text].

5.   Burnstock, G, and Prosser CL. Responses of smooth muscles to quick stretch; relation of stretch to conduction. Am J Physiol 198: 921-925, 1960[Abstract/Free Full Text].

6.   Casado, M, and Ascher P. Opposite modulation of NMDA receptors by lysophospholipids and arachidonic acid: common features with mechanosensitivity. J Physiol 513: 317-330, 1998[Abstract/Free Full Text].

7.   Dolmetsch, RE, Pajvani U, Fife K, Spotts JM, and Greenberg ME. Signaling to the nucleus by an L-type calcium channel-calmodulin complex through the MAP kinase pathway. Science 294: 333-339, 2001[Abstract/Free Full Text].

8.   Farrugia, G, Holm AN, Rich A, Sarr MG, Szurszewski JH, and Rae JL. A mechanosensitive calcium channel in human intestinal smooth muscle cells. Gastroenterology 117: 900-905, 1999[Web of Science][Medline].

9.   Gabella, G. Hypertrophy of visceral smooth muscle. Anat Embryol (Berl) 182: 409-424, 1990[Medline].

10.   Gao, T, Yatani A, Dell'Acqua ML, Sako H, Green SA, Dascal N, Scott JD, and Hosey MM. cAMP-dependent regulation of cardiac L-type Ca2+ channels requires membrane targeting of PKA and phosphorylation of channel subunits. Neuron 19: 185-196, 1997[Web of Science][Medline].

11.   Gerhardstein, BL, Gao T, Bunemann M, Puri TS, Adair A, Ma H, and Hosey MM. Proteolytic processing of the C terminus of the alpha 1C subunit of L-type calcium channels and the role of a proline-rich domain in membrane tethering of proteolytic fragments. J Biol Chem 275: 8556-8563, 2000[Abstract/Free Full Text].

12.   Gu, CX, Juranka PF, and Morris CE. Stretch-activation and stretch-inactivation of Shaker-IR, a voltage-gated K+ channel. Biophys J 80: 2678-93, 2001[Medline].

13.   Hamill, OP, and Martinac B. Molecular basis of mechanotransduction in living cells. Physiol Rev 81: 685-740, 2001[Abstract/Free Full Text].

14.   Holm, AN, Rich A, Sarr MG, and Farrugia G. Whole cell current and membrane potential regulation by a human smooth muscle mechanosensitive calcium channel. Am J Physiol Gastrointest Liver Physiol 279: G1155-G1161, 2000[Abstract/Free Full Text].

15.   Ji, S, John SA, Lu Y, and Weiss JN. Mechanosensitivity of the cardiac muscarinic potassium channel. A novel property conferred by Kir3.4 subunit. J Biol Chem 273: 1324-1328, 1998[Abstract/Free Full Text].

16.   Kim, Y. Synergistic interaction and the role of C-terminus in the activation of TRAAK K+ channels by pressure, free fatty acids and alkali. Pflügers Arch 442: 64-72, 2001[Web of Science][Medline].

17.   Kirber, MT. Stretch-activated ion channels in smooth muscle: a mechanism for the initiation of stretch-induced contraction. Pflügers Arch 412: 339-345, 1988[Web of Science][Medline].

18.   Kirber, MT, Guerrero-Hernandez A, Bowman DS, Fogarty KE, Tuft RA, Singer JJ, and Fay FS. Multiple pathways responsible for the stretch-induced increase in Ca2+ concentration in toad stomach smooth muscle cells. J Physiol 524: 3-17, 2000[Abstract/Free Full Text].

19.   Kloda, A, and Martinac B. Molecular identification of a mechanosensitive channel in archaea. Biophys J 80: 229-240, 2001[Web of Science][Medline].

20.   Lesage, F, Maingret F, and Lazdunski M. Cloning and expression of human TRAAK, a polyunsaturated fatty acids-activated and mechano-sensitive K+ channel. FEBS Lett 471: 137-140, 2000[Web of Science][Medline].

21.   Maingret, F, Fosset M, Lesage F, Lazdunski M, and Honore E. TRAAK is a mammalian neuronal mechano-gated K+ channel. J Biol Chem 274: 1381-1387, 1999[Abstract/Free Full Text].

22.   Maingret, F, Patel AJ, Lesage F, Lazdunski M, and Honore E. Mechano- or acid stimulation, two interactive modes of activation of the TREK-1 potassium channel. J Biol Chem 274: 26691-26696, 1999[Abstract/Free Full Text].

23.   Martinac, B. Mechanosensitive channels in prokaryotes. Cell Physiol Biochem 11: 61-76, 2001[Web of Science][Medline].

24.   Miller, SM, Reed D, Sarr MG, Farrugia G, and Szurszewski JH. Haem oxygenase in enteric nervous system of human stomach and jejunum and co-localization with nitric oxide synthase. Neurogastroenterol Motil 13: 121-131, 2001[Web of Science][Medline].

25.   Morris, CE, and Horn R. Failure to elicit neuronal macroscopic mechanosensitive currents anticipated by single-channel studies. Science 251: 1246-1249, 1991[Abstract/Free Full Text].

26.   Paoletti, P, and Ascher P. Mechanosensitivity of NMDA receptors in cultured mouse central neurons. Neuron 13: 645-655, 1994[Web of Science][Medline].

27.   Patel, AJ, Honore E, Maingret F, Lesage F, Fink M, Duprat F, and Lazdunski M. A mammalian two pore domain mechano-gated S-like K+ channel. EMBO J 17: 4283-4290, 1998[Web of Science][Medline].

28.   Regulla, S, Schneider T, Nastainczyk W, Meyer HE, and Hofmann F. Identification of the site of interaction of the dihydropyridine channel blockers nitrendipine and azidopine with the calcium-channel alpha 1 subunit. EMBO J 10: 45-49, 1991[Web of Science][Medline].

29.   Sachs, F. Mechanosensitive ion channels in nonspecialized cells. Rev Physiol Biochem Pharmacol 132: 1-77, 1998[Web of Science][Medline].

30.   Shepard, AR, and Rae JL. Ion transporters and receptors in cDNA libraries from lens and cornea epithelia. Curr Eye Res 17: 708-719, 1998[Web of Science][Medline].

31.   Shepard, AR, and Rae JL. Magnetic bead capture of cDNAs from double-stranded plasmid cDNA libraries. Nucleic Acids Res 25: 3183-3185, 1997[Abstract/Free Full Text].

32.   Soldatov, NM. Genomic structure of human L-type Ca2+ channel. Genomics 22: 77-87, 1994[Web of Science][Medline].

33.   Sukharev, SI, Blount P, Martinac B, Blattner FR, and Kung C. A large-conductance mechanosensitive channel in E. coli encoded by mscL alone. Nature 368: 265-268, 1994[Medline].

34.   Tabarean, IV, Juranka P, and Morris CE. Membrane stretch affects gating modes of a skeletal muscle sodium channel. Biophys J 77: 758-774, 1999[Medline].

35.   Wei, X, Neely A, Lacerda AE, Olcese R, Stefani E, Perez-Reyes E, and Birnbaumer L. Modification of Ca2+ channel activity by deletions at the carboxyl terminus of the cardiac alpha 1 subunit. J Biol Chem 269: 1635-1640, 1994[Abstract/Free Full Text].

36.   Wu, X, Davis GE, Meininger GA, Wilson E, and Davis MJ. Regulation of the L-type calcium channel by alpha 5beta 1 integrin requires signaling between focal adhesion proteins. J Biol Chem 276: 30285-30292, 2001[Abstract/Free Full Text].


Am J Physiol Cell Physiol 283(3):C1001-C1008
0363-6143/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
R. E. Kraichely, P. R. Strege, M. G. Sarr, M. L. Kendrick, and G. Farrugia
Lysophosphatidyl choline modulates mechanosensitive L-type Ca2+ current in circular smooth muscle cells from human jejunum
Am J Physiol Gastrointest Liver Physiol, April 1, 2009; 296(4): G833 - G839.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. Lee, J.-C. Kim, Y. Li, M.-J. Son, and S.-H. Woo
Fluid pressure modulates L-type Ca2+ channel via enhancement of Ca2+-induced Ca2+ release in rat ventricular myocytes
Am J Physiol Cell Physiol, April 1, 2008; 294(4): C966 - C976.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Cheng, J. Liu, M. Asuncion-Chin, E. Blaskova, J. P. Bannister, A. M. Dopico, and J. H. Jaggar
A Novel CaV1.2 N Terminus Expressed in Smooth Muscle Cells of Resistance Size Arteries Modifies Channel Regulation by Auxiliary Subunits
J. Biol. Chem., October 5, 2007; 282(40): 29211 - 29221.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
M. Magra, S. Hughes, A. J. El Haj, and N. Maffulli
VOCCs and TREK-1 ion channel expression in human tenocytes
Am J Physiol Cell Physiol, March 1, 2007; 292(3): C1053 - C1060.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. Ben-Tabou De-Leon, G. Ben-Zeev, and I. Nussinovitch
Effects of osmotic shrinkage on voltage-gated Ca2+ channel currents in rat anterior pituitary cells
Am J Physiol Cell Physiol, January 1, 2006; 290(1): C222 - C232.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
P. R. Strege, C. E. Bernard, Y. Ou, S. J. Gibbons, and G. Farrugia
Effect of mibefradil on sodium and calcium currents
Am J Physiol Gastrointest Liver Physiol, August 1, 2005; 289(2): G249 - G253.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
L. A. Martinez-Lemus, T. Crow, M. J. Davis, and G. A. Meininger
{alpha}v{beta}3- and {alpha}5{beta}1-integrin blockade inhibits myogenic constriction of skeletal muscle resistance arterioles
Am J Physiol Heart Circ Physiol, July 1, 2005; 289(1): H322 - H329.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
H. I. Akbarali
Signal-Transduction Pathways that Regulate Smooth Muscle Function II. Receptor-ion channel coupling mechanisms in gastrointestinal smooth muscle
Am J Physiol Gastrointest Liver Physiol, April 1, 2005; 288(4): G598 - G602.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
I. Lim, S. J Gibbons, G. L. Lyford, S. M. Miller, P. R. Strege, M. G. Sarr, S. Chatterjee, J. H. Szurszewski, V. H. Shah, and G. Farrugia
Carbon monoxide activates human intestinal smooth muscle L-type Ca2+ channels through a nitric oxide-dependent mechanism
Am J Physiol Gastrointest Liver Physiol, January 1, 2005; 288(1): G7 - G14.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
S. Sukharev and D. P. Corey
Mechanosensitive Channels: Multiplicity of Families and Gating Paradigms
Sci. Signal., February 10, 2004; 2004(219): re4 - re4.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
P. R. Strege, Y. Ou, L. Sha, A. Rich, S. J. Gibbons, J. H. Szurszewski, M. G. Sarr, and G. Farrugia
Sodium current in human intestinal interstitial cells of Cajal
Am J Physiol Gastrointest Liver Physiol, December 1, 2003; 285(6): G1111 - G1121.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. Ben-Tabou De-Leon, E. Blotnick, and I. Nussinovitch
Effects of osmotic swelling on voltage-gated calcium channel currents in rat anterior pituitary cells
Am J Physiol Cell Physiol, October 1, 2003; 285(4): C840 - C852.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Ou, P. Strege, S. M. Miller, J. Makielski, M. Ackerman, S. J. Gibbons, and G. Farrugia
Syntrophin gamma 2 Regulates SCN5A Gating by a PDZ Domain-mediated Interaction
J. Biol. Chem., January 10, 2003; 278(3): 1915 - 1923.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
283/3/C1001    most recent
00140.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (28)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lyford, G. L.
Right arrow Articles by Farrugia, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lyford, G. L.
Right arrow Articles by Farrugia, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online