|
|
||||||||
1C (CaV1.2) L-type calcium channel
mediates mechanosensitive calcium regulation
Enteric NeuroScience Program and 1 Division of Gastroenterology and Hepatology, 2 Department of Physiology and Biophysics, Mayo Clinic, Rochester, Minnesota 55905
| |
ABSTRACT |
|---|
|
|
|---|
Smooth muscle exhibits
mechanosensitivity independent of neural input, suggesting that
mechanosensitive pathways reside within smooth muscle cells. The native
L-type calcium current recorded from human intestinal smooth muscle is
modulated by stretch. To define mechanosensitive mechanisms involved in
the regulation of smooth muscle calcium entry, we cloned the
1C L-type calcium channel subunit (CaV1.2)
from human intestinal smooth muscle and expressed the channel in a
heterologous system. This channel subunit retained mechanosensitivity
when expressed alone or coexpressed with a
2 calcium
channel subunit in HEK-293 or Chinese hamster ovary cells. The
heterologously expressed human cardiac
1C splice form
also demonstrated mechanosensitivity. Inhibition of kinase signaling
did not affect mechanosensitivity of the native channel. Truncation of the
1C COOH terminus, which contains
an inhibitory domain and a proline-rich domain thought to mediate
mechanosensitive signaling from integrins, did not disrupt
mechanosensitivity of the expressed channel. These data demonstrate
mechanical regulation of calcium entry through molecularly identified
L-type calcium channels in mammalian cells and suggest that the
mechanosensitivity resides within the pore forming
1C-subunit.
smooth muscle; mechanogated; voltage gated
| |
INTRODUCTION |
|---|
|
|
|---|
MECHANOSENSITIVE PROCESSES allow organisms to respond and adapt to their environment. Prokaryotic cells express mechanosensitive ion channels required to maintain intracellular composition (reviewed in Ref. 23). Eukaryotic organisms employ mechanosensitive processes for a wide array of regulatory and sensory tasks. Mechanotransduction is responsible for hearing, touch, balance, blood flow regulation, and cardiac function (29). Mechanical signals are processed by direct cytoskeletal interactions, by triggering of mechanosensitive signaling cascades, or by altering activity of mechanosensitive ion channels. Mechanically gated or sensitive ion channels allow for direct and immediate regulation of excitable cells, such as neurons, sensory receptors, or myocytes. Thereby, mechanical signals can be converted rapidly into a change in cellular activity. Via signaling to the nucleus, these mechanosensitive mechanisms can also direct normal cellular development as well as pathological changes.
Smooth muscle responds to mechanical forces. Stretch of smooth muscle leads to a contractile response (4), and this stretch-induced increase in tone can occur in the absence of extrinsic neural input and, therefore, is thought to be myogenic (5). Smooth muscle stretch results in an increase in intracellular calcium concentration (1, 17). Voltage-gated calcium channels are important in intracellular calcium regulation in this context of mechanical stimulation (18). Smooth muscle phenotype also responds to mechanical stresses during long-term exposures, and these changes, particularly hypertrophy, contribute to human diseases. Cardiac smooth muscle and vascular smooth muscle hypertrophy occur in the setting of hypertension. Hypertrophy of airway smooth muscle occurs in obstructive lung disease and further contributes to its pathogenesis. Urinary and gastrointestinal smooth muscle hypertrophies in the context of distal obstruction (9).
Native L-type calcium current in dissociated human jejunal circular
smooth muscle cells can be modulated by mechanical perturbation (8, 14), but the molecular basis for this effect is
unknown. We report here the cloning and heterologous expression of the human L-type calcium channel
1C-subunit
(CaV1.2) from human jejunal smooth muscle. We demonstrate
that the cloned channel exhibits mechanosensitive behavior similar to
the native channel. The human cardiac
1C-subunit also
exhibits a mechanosensitive increase in peak current when expressed in
a heterologous system, suggesting a more widespread role of this
mechanism. These data demonstrate a mechanosensitive means of
regulating calcium influx via voltage-gated calcium channels.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Cloning.
Use of human tissue was approved by the Mayo Clinic Institutional
Review Board. Jejunal circular smooth muscle was obtained as surgical
waste from gastric bypass procedures and was enzymatically dissociated
(14). Individual smooth muscle cells were collected, and
three separate human jejunum (HJEJ) plasmid cDNA libraries were
prepared from freshly isolated tissue as described (30). The sequences of cardiac and smooth muscle
1 calcium
channel L2 subtype (32) corresponding to GenBank accession
no. M92269 were used to design a 25-nt 5'-biotinylated capturing probe
against the dihydropyridine-binding region (28), and the
HJEJ plasmid cDNA libraries were screened by using the magnetic bead
capture approach (31). PCR primers designed against the
5'- and 3'-ends of
2 calcium channel subunit open
reading frame (ORF) were used to amplify the ORF from the HJEJ cDNA
library by using ThermalAce DNA polymerase (Invitrogen, Carlsbad, CA).
The PCR product was TA cloned into pCR2.1 TOPO (Invitrogen), and both
strands were sequenced. Immunostaining was performed on human jejunum
by using an anti-
1C polyclonal antibody raised in
rabbits (no. ACC-003; Alomone Labs, Jerusalem, Israel) at 1:100
dilution using previously described methods (24). Northern
analysis was performed on RNA isolated from human jejunum by using a
probe generated from a 900-bp PCR product from the 3'-end of the
jejunal
1C ORF according to a previously described
protocol (3).
Expression vector construction.
The human jejunal
1C-subunit was subcloned as an
AgeI/NotI fragment from the cDNA library pSport1
cloning vector (Invitrogen) into the pEGFP-C1 vector (Clontech, Palo
Alto, CA). This vector was previously modified to include a
NotI site in the multicloning site, and the enhanced green
fluorescent protein (EGFP) gene was removed with
AgeI/NotI restriction digestion. To improve
translational efficiency, the 5'-untranslated region (UTR) was removed
and a Kozak sequence inserted by using a PCR primer pair with an
AgeI site and Kozak sequence (bold) in the 5'-primer and an
MfeI site in the 3'-primer (5'-primer,
GGCATAACCGGTCTCGAGCCGCCACCATGGTCAATGAGAATACGAGGATG; 3'-primer,
GCCACACAATGGCAAAAATAGTCAGTAAAATAATTATTTCAAATGG- TTT). Additionally, to improve expression efficiency, the 3'-UTR was reduced
by releasing a 1,735-bp HpaI fragment, leaving only 97 bp of
the 3'-UTR. Restriction digestion and complete sequencing confirmed the
final plasmid. The
2 isolate was released from the
pCR2.1 TOPO vector with EcoRI and ligated into the
EcoRI site of pCMVSport1 (Invitrogen). The COOH-terminal
deletion of amino acids distal to amino acid 1703 was created by
releasing a BclI/SalI restriction fragment and
inserting a PCR fragment generated by using a 5'-primer upstream of the
BclI site and a 3'-primer that included a SalI
site, a stop TAG, and nucleotides corresponding to the codons for amino
acids 1703-1697. The construct was confirmed by restriction
digestion and sequencing.
HEK-293 transfection and patch-clamp recording.
With the use of Lipofectamine 2000 reagent (Invitrogen), the green
fluorescent protein pEGFP-C1 (Clontech) and the calcium channel
subunits were transiently cotransfected into HEK-293 or Chinese hamster
ovary (CHO) cells (American Type Culture Collection, Manassas, VA).
Transfected cells were identified by fluorescent microscopy and
subjected to patch-clamp recording. Whole cell records were obtained by
using Kimble KG-12 glass, and single-channel records were obtained by
using 7760 glass pulled on a P-97 puller (Sutter Instruments, Novato,
CA). Electrodes were coated with R6101 (Dow Corning, Midland, MI) and
fire-polished to a final resistance of 3-5 M
. Currents were
amplified, digitized, and processed with a CyberAmp 320 amplifier, a
Digidata 1200, and pCLAMP 8 software (Axon Instruments, Foster City,
CA). Whole cell records were sampled at 10 kHz and filtered at 4 kHz
with an eight-pole Bessel filter using the pulse protocols indicated.
Three separate methods were used to test for mechanosensitivity. Bath
perfusion at 10 ml/min for 30 s was used to create shear stress
and to activate the mechanosensitive L-type calcium channels according
to a previously established protocol (8). Positive
pressure applied to the pipette in the standard whole cell
configuration was used to increase intracellular pressure. The
cytoskeleton constrains the lipid membrane, and at the pressures used
(+5 to +40 mmHg), no changes in cell size were seen resulting in
increased cell membrane tension. At the single-channel level, negative
pressure (
20 to
40 mmHg) was applied to the pipette to activate the
channels in the on-cell patch configuration. For the single-channel
records, the cells were voltage clamped at
100 mV and stepped to
20
mV for 20-s intervals. A 2-s interval was used between pulses to avoid
channel inactivation. Single-channel records were sampled at 5 kHz and filtered at 2 kHz with an eight-pole Bessel filter. All records were
obtained at room temperature (22°C). The pipette solution contained
(in mM) 145 Cs+, 20 Cl
, 2 EGTA, 5 HEPES, and
125 methanesulfonate for whole cell recording or 80 Ba2+,
160 Cl
, and 5 HEPES for single-channel recording. The
bath solution contained (in mM) 149.2 Na+, 4.7 K+, 159 Cl
, 2.5 Ca2+, and 5 HEPES
(normal Ringer solution) or 80 Ba2+, 160 Cl
,
5 HEPES, and mannitol to reach an osmolarity of 290 mosM (80 mM
Ba2+ bath) for whole cell records. The 80 mM
Ba2+ bath was used for single-channel records to depolarize
the cells. SB-203580, the Rp diastereomer of
8-(4-chlorophenylthio)-guanosine 3',5'-cyclic monophosphothioate
(Rp-CPT-cGMPS), and adenosine 3',5'-cyclic
monophosphothioate (cAMPS) were obtained from Calbiochem (La Jolla,
CA). All other chemicals were obtained from Sigma-Aldrich (St. Louis,
MO). Statistical comparisons were performed with Students t-test (two-tailed and paired), and P < 0.05 was used for statistical significance.
| |
RESULTS |
|---|
|
|
|---|
To determine the molecular identity for this mechanosensitive
current, an 8,374-bp cDNA was cloned from human jejunal smooth muscle.
This clone contained a 265-bp 5'-UTR, a 1,695-bp 3'-UTR, and a 6,414-bp
ORF encoding a 2,138-amino acid
1C protein. Sequence alignment to GenBank accession no. M92269 indicated that exons 22, 31, and 45 were absent from this clone. A silent, single nucleotide polymorphism was present at nt 5626. This sequence was submitted under
GenBank accession no. AF465484. The
2 calcium channel subunit, obtained by PCR, yielded a predicted 1,710-bp ORF encoding a
570-amino acid protein. Alignment with GenBank accession no. U95019
revealed the absence of exon 6 and insertion of 21 nucleotides corresponding to nt 1132-1152 of the genomic sequence (GenBank accession no. AY027898), suggesting the existence of a previously unidentified exon. This sequence was submitted under GenBank accession no. AF465485. Northern analysis of human jejunal RNA revealed a single
band of ~8 kb corresponding to the expected size of the cloned
1C-subunit (Fig.
1A). Immunostaining of human
jejunum revealed
1C-like immunoreactivity along the
borders of jejunal circular smooth muscle cells (Fig. 1B).
|
Mechanosensitivity of heterologously expressed L-type
calcium channel subunits.
We expressed the cloned L-type calcium channel in HEK-293 cells
to determine whether it exhibited mechanosensitivity in a heterologous
system. Expression of the
1C pore-forming subunit alone
showed a maximal peak inward current of 39 ± 7 pA
(n = 10) in 80 mM Ba2+ (Fig.
2A). Membrane shear stress
significantly increased the current by 23% to 48 ± 8 pA
(n = 10, P < 0.05) (Fig. 2,
B and D). Mean maximal peak inward current was at
30 ± 2 mV (due to the charge screening effect of 80 mM
Ba2+) at baseline and was unchanged with perfusion (29 ± 2 mV, P = 0.56) (Fig. 2C). Coexpression
of the
1C and
2 calcium channel subunits
increased the size of the maximal resolvable inward currents so that
they were easily measured in 2.54 mM Ca2+. The maximal peak
inward current was 76 ± 15 pA in normal Ringer solution, and
these currents increased significantly by 50% with bath perfusion to
103 ± 18 pA (n = 15, P < 0.05)
(Fig. 3). Mean current-voltage
(I-V) relationships demonstrate the increase (Fig. 3).
Currents returned to baseline within 130 ± 15 s of
discontinuation of bath perfusion. Whole cell recordings in
untransfected HEK-293 cells revealed no L-type current in either 80 mM
Ba2+ (n = 5) or normal Ringer solution
(n = 5) (data not shown). Both activation and
inactivation kinetics were more rapid with bath perfusion (Fig.
4).
|
|
|
1C and
2 calcium channel
subunits was also used to determine mechanosensitivity of the expressed
subunits. A positive pressure of 5 mmHg resulted in a 17 ± 6%
(n = 6, P < 0.05) increase in peak
inward calcium current that returned to baseline after positive
pressure was discontinued (Fig. 5).
|
40 mmHg) to stretch
the membrane under the recording pipette. Single-channel recordings
from HEK-293 cells cotransfected with jejunal
1C and
2 subunits revealed an immediate increase in open
probability upon change in pressure (n = 8) that was
reversible when pressure returned to atmospheric (Fig.
6). The single-channel open probability for the recording shown in Fig. 6 was 0.02 before and 0.06 during application of negative pressure. Open probability increased 2.8 ± 0.5-fold (mean, n = 8). Single-channel conductance,
measured with 80 mM Ba2+ as the charge carrier, was
measured at +10, +20, and +30 mV. The slope gave a single-channel
conductance of 20 pS, and the conductance did not change with negative
pressure (data not shown). No mechanosensitive calcium channel activity
was observed in untransfected cells (n = 8) (data not
shown).
|
1C splice variants, the cardiac
1C-subunit was coexpressed with a
2
calcium channel subunit. Cotransfection with the cardiac
1C and
2 yielded a maximal inward current
of 128 ± 65 pA, which significantly increased by 27% to 163 ± 77 pA (n = 11, P < 0.05) with bath
perfusion (Fig. 7). Similar results for
both the jejunal and cardiac
1C subunits were obtained
in CHO cells (data not shown). These data strongly suggest that
mechanosensitivity is not restricted to the jejunal splice form of the
1C and that the components necessary for L-type calcium
channel mechanosensitivity are contained within the pore-forming
1C-subunit.
|
1C-subunit is present in
HEK-293 and CHO cells. To test for this possibility, we expressed the voltage-gated potassium channel, KV2.1. Perfusion or
negative pressure had no effect on the size of the potassium current
(data not shown). Many widely expressed protein kinases are
mechanosensitive, and the
1C-subunit contains several
phosphorylation sites. To test for the possibility that
mechanosensitivity of the expressed
1C-subunit is
mediated through mechanosensitive protein kinases, we examined the
effects of cAMPS [500 µM, protein kinase A (PKA) inhibitor,
n = 4], protein kinase C fragment 19-36 (50 µm,
protein kinase C inhibitor, n = 6), and
Rp-CPT-cGMPS (10 µM, protein kinase G inhibitor,
n = 6) on the mechanically induced increase in calcium current in human intestinal smooth muscle cells. Perfusion (10 ml/min)
still produced a significant increase in mean peak current with a range
of 13-46% (P < 0.05 for all drugs compared with
preperfusion currents). Additionally, mechanosensitive current
increases of 25-31% (P < 0.05) were still seen
in the presence of inhibitors of the mechanosensitive
p60src tyrosine (geldanamycin, 5.5 µM, n = 4) and p38 mitogen-activated protein kinases (SB-203580, 25 µM,
n = 3).
The mechanosensitive element for some channels appears to reside in the
COOH terminus (27). The
1C COOH terminus
contains a PKA phosphorylation site (10), an inhibitory
domain (35), and a proline-rich domain (PRD) that
interacts with SH3 domain proteins (11) and has been
suggested to mediate mechanosensitive integrin signaling to the L-type
channel (36). We generated a COOH-terminal deletion
construct that removed all of these regions. When this construct was
coexpressed with the
2-subunit in HEK-293 cells, bath
perfusion still generated a significant increase of 25% in maximal
peak inward current (156 ± 33 to 196 ± 35 pA,
n = 11, P < 0.05) (Fig.
8). These findings again suggest that
mechanosensitivity is an intrinsic property of the
1C-subunit, that the inhibitory domain of the COOH
terminus does not function as a mechanosensitive switch, and that
interactions through the PRD are not crucial for mechanosensitivity.
Removal of the PKA target serine also did not disrupt
mechanosensitivity and therefore corroborated findings with the PKA
inhibitor in the dissociated human jejunal myocytes. Larger deletions
of the COOH terminus result in loss of calcium current (7)
and therefore were not tested.
|
| |
DISCUSSION |
|---|
|
|
|---|
The major finding of the present study is that molecularly
identified
1C calcium channel subunits are
mechanosensitive when expressed in a heterologous system. The human
jejunal
1C calcium channel subunit was mechanosensitive
when expressed by itself in an 80 mM Ba2+ bath and also
when coexpressed with the voltage-dependent calcium channel
2-subunit in more physiological bath conditions.
Mechanosensitivity was determined both at the single-channel level and
at the whole cell current level to circumvent possible artifacts
associated with on-cell patches (25). Single-channel
recordings showed that membrane stretch increased the open probability
of the calcium channel, the operational definition of a
mechanosensitive channel. Mechanosensitivity did not appear to be
peculiar to the intestinal splice variant of
1C, because
the human cardiac
1C also demonstrated an increase in
current with shear stress created by bath perfusion. Mechanosensitivity
of the L-type calcium channel in cardiac and intestinal smooth muscle
provides a mechanism by which calcium entry is regulated at the level
of the muscle ion channel in response to a mechanical stimulus such as
stretch. Mechanoactivation of the L-type calcium channel will result in
increased calcium entry and increased contractile force.
Other mechanically gated ion channels, for which the primary gating mechanism is membrane stretch, have been characterized by electrophysiology and subsequently cloned. In the prokaryotic realm, the MscL protein from Escherichia coli (33) and the MJ0170 channel from the archeon Methanococcus jannashii (19) have both been heterologously expressed and are mechanogated. Vertebrate mechanogated ion channels now include the recently cloned two-pore/four-transmembrane domain potassium channels TREK-1 (27), TREK-2 (2), and TRAAK (20, 21). Like the L-type calcium channel, some ion channels initially characterized as voltage or ligand gated are also mechanosensitive. Among these are the N-methyl-D-aspartate (NMDA) channel (26), a cardiac muscarinic potassium channel (15), a skeletal muscle sodium channel (34), and a Shaker-IR voltage-gated potassium channel (12).
Several hypotheses for ion channel mechanosensitivity have been
proposed (13). Potential mechanisms for ion channel
mechanosensitivity include a direct interaction between the
transmembrane portion of the channel and the lipid bilayer. This
mechanism has been proposed to be the dominant one for some
characterized mechanosensitive channels and has been argued to be an
unavoidable consequence of inserting a channel into the membrane
(12). This mechanism would be common to all
membrane-spanning, pore-forming proteins. Additional mechanisms include
mechanosensitive signaling cascades that could be activated and
regulate channels via phosphorylation or other posttranslational
modification. Blockade with five different kinase inhibitors and
removal of an identified PKA phosphorylation site on the COOH terminus
of the
1C-subunit did not disrupt the mechanosensitivity
of our channel and argues against phosphorylation in mechanoregulation
of the L-type calcium channel. A third potential mechanism is force
transmission via protein-protein interactions between the channel and
the cytoskeleton that alter the channel open probability. The TREK-1
and TREK-2 potassium channels exhibit mechanosensitivity that is
dependent on the carboxyl terminus of the protein, suggesting the role
for specific signaling pathways or protein-protein interactions in the
mechanosensitivity of these channels (2, 22). In contrast,
the NMDA receptor retains its mechanosensitivity when its carboxyl
terminus is removed (6), implying that known interactions
with the cytoskeleton via the carboxyl terminus do not participate in
the mechanical regulation of this channel. Removal of the COOH terminus
from the
1C-subunit did not disrupt mechanosensitivity,
suggesting that potential interactions of the PRD with SH3-containing
proteins such as Src or Lyn (11) are not required for
mechanoregulation and that signaling from integrins to the L-type
calcium channel is not the mechanosensitive mechanism. In addition to
direct protein-protein interactions, the cytoskeleton may modulate
mechanosensitive channels indirectly by constraining forces on the
lipid bilayer.
Whether stretch regulation of these channels is a "designed"
feature or an unavoidable consequence of having a large protein inserted into the lipid bilayer is unknown. Some element of design likely exists as marked differences in mechanosensitivity exist within
the family of two-pore/four-transmembrane domain potassium channels;
notably, TASK-1 and TASK-3 are relatively insensitive to mechanical
manipulation (16). Likewise, among muscarinic potassium
channels, Kir1.1 and Kir2.1 are insensitive to the same manipulations
used to demonstrate mechanosensitivity of Kir3.4 (15). In
our experiments, KV2.1 did not exhibit mechanosensitive behavior under the same conditions as
1C.
Structure-function analysis is needed to illuminate the role of the
lipid bilayer, cytoskeletal interactions, or other signaling pathways
in the mechanosensitivity of individual ion channels.
The mere observation that these channels are mechanosensitive does not make them mechanotransducers. Mechanoregulation of channels, when expressed in a static organ such as the central nervous system, is not as important as when these same channels are expressed in the periphery and exposed to dynamic forces. In our experiments, the L-type calcium channel demonstrated mechanoregulation at pressures of 5-40 mmHg, which are well within the physiological pressure changes to which the channels are exposed in the native smooth muscle during digestive activity. Likewise, these channels, when expressed in the cardiac and vascular smooth muscle, are routinely exposed to higher forces (>100 mmHg) than we assessed in the present study.
We postulate that mechanosensitive regulation of the L-type calcium channels allows for mechanical influence not only of immediate cellular behavior such as contractile activity but also of cellular phenotype. In myocytes, L-type channels are known to provide the signal in excitation-contraction coupling, and thereby mechanosensitive regulation of these channels could provide a greater contractile force under conditions of greater load. Over the long term, increased calcium entry through mechanosensitive L-type channels could direct phenotypic changes, such as smooth muscle hypertrophy, through calmodulin-dependent transcription factor activation (7). Further studies are required to determine the full physiological and pathophysiological role of mechanosensitivity of the L-type calcium channels in cardiac, smooth muscle, and other tissues.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Adrian N. Holm and Inja Lim for assistance with
patch-clamp experiments, Cheryl Bernard for performing cell culture and
transfection, and Kristy Zodrow for secretarial assistance. We thank
Dr. Gyula Varadi for providing the human cardiac
1C expression construct.
| |
FOOTNOTES |
|---|
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-52766 and DK-17238.
Present address of A. Shepard: Alcon Labs, 6201 South Freeway, Forth Worth, TX 76134.
Address for reprint requests and other correspondence: G. Farrugia, 8 Guggenheim Bldg., Mayo Clinic, 200 First St. SW, Rochester, MN 55905 (E-mail: farrugia.gianrico{at}mayo.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
May 29, 2002;10.1152/ajpcell.00140.2002
Received 28 March 2002; accepted in final form 20 May 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
An, SS.
Mechanical signals and mechanosensitive modulation of intracellular [Ca2+] in smooth muscle.
Am J Physiol Cell Physiol
279:
C1375-C1384,
2000
2.
Bang, H,
Kim Y,
and
Kim D.
TREK-2, a new member of the mechanosensitive tandem-pore K+ channel family.
J Biol Chem
275:
17412-17419,
2000
3.
Beilharz, EJ,
Zhukovsky E,
Lanahan AA,
Worley PF,
Nikolich K,
and
Goodman LJ.
Neuronal activity induction of the stathmin-like gene RB3 in the rat hippocampus: possible role in neuronal plasticity.
J Neurosci
18:
9780-9789,
1998
4.
Bulbring, E.
Correlation between membrane potential, spike discharge and tension in smooth muscle.
J Physiol
128:
200-221,
1955
5.
Burnstock, G,
and
Prosser CL.
Responses of smooth muscles to quick stretch; relation of stretch to conduction.
Am J Physiol
198:
921-925,
1960
6.
Casado, M,
and
Ascher P.
Opposite modulation of NMDA receptors by lysophospholipids and arachidonic acid: common features with mechanosensitivity.
J Physiol
513:
317-330,
1998
7.
Dolmetsch, RE,
Pajvani U,
Fife K,
Spotts JM,
and
Greenberg ME.
Signaling to the nucleus by an L-type calcium channel-calmodulin complex through the MAP kinase pathway.
Science
294:
333-339,
2001
8.
Farrugia, G,
Holm AN,
Rich A,
Sarr MG,
Szurszewski JH,
and
Rae JL.
A mechanosensitive calcium channel in human intestinal smooth muscle cells.
Gastroenterology
117:
900-905,
1999[ISI][Medline].
9.
Gabella, G.
Hypertrophy of visceral smooth muscle.
Anat Embryol (Berl)
182:
409-424,
1990[Medline].
10.
Gao, T,
Yatani A,
Dell'Acqua ML,
Sako H,
Green SA,
Dascal N,
Scott JD,
and
Hosey MM.
cAMP-dependent regulation of cardiac L-type Ca2+ channels requires membrane targeting of PKA and phosphorylation of channel subunits.
Neuron
19:
185-196,
1997[ISI][Medline].
11.
Gerhardstein, BL,
Gao T,
Bunemann M,
Puri TS,
Adair A,
Ma H,
and
Hosey MM.
Proteolytic processing of the C terminus of the
1C subunit of L-type calcium channels and the role of a proline-rich domain in membrane tethering of proteolytic fragments.
J Biol Chem
275:
8556-8563,
2000
12.
Gu, CX,
Juranka PF,
and
Morris CE.
Stretch-activation and stretch-inactivation of Shaker-IR, a voltage-gated K+ channel.
Biophys J
80:
2678-93,
2001[Medline].
13.
Hamill, OP,
and
Martinac B.
Molecular basis of mechanotransduction in living cells.
Physiol Rev
81:
685-740,
2001
14.
Holm, AN,
Rich A,
Sarr MG,
and
Farrugia G.
Whole cell current and membrane potential regulation by a human smooth muscle mechanosensitive calcium channel.
Am J Physiol Gastrointest Liver Physiol
279:
G1155-G1161,
2000
15.
Ji, S,
John SA,
Lu Y,
and
Weiss JN.
Mechanosensitivity of the cardiac muscarinic potassium channel. A novel property conferred by Kir3.4 subunit.
J Biol Chem
273:
1324-1328,
1998
16.
Kim, Y.
Synergistic interaction and the role of C-terminus in the activation of TRAAK K+ channels by pressure, free fatty acids and alkali.
Pflügers Arch
442:
64-72,
2001[ISI][Medline].
17.
Kirber, MT.
Stretch-activated ion channels in smooth muscle: a mechanism for the initiation of stretch-induced contraction.
Pflügers Arch
412:
339-345,
1988[ISI][Medline].
18.
Kirber, MT,
Guerrero-Hernandez A,
Bowman DS,
Fogarty KE,
Tuft RA,
Singer JJ,
and
Fay FS.
Multiple pathways responsible for the stretch-induced increase in Ca2+ concentration in toad stomach smooth muscle cells.
J Physiol
524:
3-17,
2000
19.
Kloda, A,
and
Martinac B.
Molecular identification of a mechanosensitive channel in archaea.
Biophys J
80:
229-240,
2001
20.
Lesage, F,
Maingret F,
and
Lazdunski M.
Cloning and expression of human TRAAK, a polyunsaturated fatty acids-activated and mechano-sensitive K+ channel.
FEBS Lett
471:
137-140,
2000[ISI][Medline].
21.
Maingret, F,
Fosset M,
Lesage F,
Lazdunski M,
and
Honore E.
TRAAK is a mammalian neuronal mechano-gated K+ channel.
J Biol Chem
274:
1381-1387,
1999
22.
Maingret, F,
Patel AJ,
Lesage F,
Lazdunski M,
and
Honore E.
Mechano- or acid stimulation, two interactive modes of activation of the TREK-1 potassium channel.
J Biol Chem
274:
26691-26696,
1999
23.
Martinac, B.
Mechanosensitive channels in prokaryotes.
Cell Physiol Biochem
11:
61-76,
2001[ISI][Medline].
24.
Miller, SM,
Reed D,
Sarr MG,
Farrugia G,
and
Szurszewski JH.
Haem oxygenase in enteric nervous system of human stomach and jejunum and co-localization with nitric oxide synthase.
Neurogastroenterol Motil
13:
121-131,
2001[ISI][Medline].
25.
Morris, CE,
and
Horn R.
Failure to elicit neuronal macroscopic mechanosensitive currents anticipated by single-channel studies.
Science
251:
1246-1249,
1991
26.
Paoletti, P,
and
Ascher P.
Mechanosensitivity of NMDA receptors in cultured mouse central neurons.
Neuron
13:
645-655,
1994[ISI][Medline].
27.
Patel, AJ,
Honore E,
Maingret F,
Lesage F,
Fink M,
Duprat F,
and
Lazdunski M.
A mammalian two pore domain mechano-gated S-like K+ channel.
EMBO J
17:
4283-4290,
1998[ISI][Medline].
28.
Regulla, S,
Schneider T,
Nastainczyk W,
Meyer HE,
and
Hofmann F.
Identification of the site of interaction of the dihydropyridine channel blockers nitrendipine and azidopine with the calcium-channel alpha 1 subunit.
EMBO J
10:
45-49,
1991[ISI][Medline].
29.
Sachs, F.
Mechanosensitive ion channels in nonspecialized cells.
Rev Physiol Biochem Pharmacol
132:
1-77,
1998[ISI][Medline].
30.
Shepard, AR,
and
Rae JL.
Ion transporters and receptors in cDNA libraries from lens and cornea epithelia.
Curr Eye Res
17:
708-719,
1998[ISI][Medline].
31.
Shepard, AR,
and
Rae JL.
Magnetic bead capture of cDNAs from double-stranded plasmid cDNA libraries.
Nucleic Acids Res
25:
3183-3185,
1997
32.
Soldatov, NM.
Genomic structure of human L-type Ca2+ channel.
Genomics
22:
77-87,
1994[ISI][Medline].
33.
Sukharev, SI,
Blount P,
Martinac B,
Blattner FR,
and
Kung C.
A large-conductance mechanosensitive channel in E. coli encoded by mscL alone.
Nature
368:
265-268,
1994[Medline].
34.
Tabarean, IV,
Juranka P,
and
Morris CE.
Membrane stretch affects gating modes of a skeletal muscle sodium channel.
Biophys J
77:
758-774,
1999[Medline].
35.
Wei, X,
Neely A,
Lacerda AE,
Olcese R,
Stefani E,
Perez-Reyes E,
and
Birnbaumer L.
Modification of Ca2+ channel activity by deletions at the carboxyl terminus of the cardiac
1 subunit.
J Biol Chem
269:
1635-1640,
1994
36.
Wu, X,
Davis GE,
Meininger GA,
Wilson E,
and
Davis MJ.
Regulation of the L-type calcium channel by
5
1 integrin requires signaling between focal adhesion proteins.
J Biol Chem
276:
30285-30292,
2001
This article has been cited by other articles:
![]() |
S. Lee, J.-C. Kim, Y. Li, M.-J. Son, and S.-H. Woo Fluid pressure modulates L-type Ca2+ channel via enhancement of Ca2+-induced Ca2+ release in rat ventricular myocytes Am J Physiol Cell Physiol, April 1, 2008; 294(4): C966 - C976. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Cheng, J. Liu, M. Asuncion-Chin, E. Blaskova, J. P. Bannister, A. M. Dopico, and J. H. Jaggar A Novel CaV1.2 N Terminus Expressed in Smooth Muscle Cells of Resistance Size Arteries Modifies Channel Regulation by Auxiliary Subunits J. Biol. Chem., October 5, 2007; 282(40): 29211 - 29221. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Magra, S. Hughes, A. J. El Haj, and N. Maffulli VOCCs and TREK-1 ion channel expression in human tenocytes Am J Physiol Cell Physiol, March 1, 2007; 292(3): C1053 - C1060. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ben-Tabou De-Leon, G. Ben-Zeev, and I. Nussinovitch Effects of osmotic shrinkage on voltage-gated Ca2+ channel currents in rat anterior pituitary cells Am J Physiol Cell Physiol, January 1, 2006; 290(1): C222 - C232. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. R. Strege, C. E. Bernard, Y. Ou, S. J. Gibbons, and G. Farrugia Effect of mibefradil on sodium and calcium currents Am J Physiol Gastrointest Liver Physiol, August 1, 2005; 289(2): G249 - G253. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Martinez-Lemus, T. Crow, M. J. Davis, and G. A. Meininger {alpha}v{beta}3- and {alpha}5{beta}1-integrin blockade inhibits myogenic constriction of skeletal muscle resistance arterioles Am J Physiol Heart Circ Physiol, July 1, 2005; 289(1): H322 - H329. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. I. Akbarali Signal-Transduction Pathways that Regulate Smooth Muscle Function II. Receptor-ion channel coupling mechanisms in gastrointestinal smooth muscle Am J Physiol Gastrointest Liver Physiol, April 1, 2005; 288(4): G598 - G602. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Lim, S. J Gibbons, G. L. Lyford, S. M. Miller, P. R. Strege, M. G. Sarr, S. Chatterjee, J. H. Szurszewski, V. H. Shah, and G. Farrugia Carbon monoxide activates human intestinal smooth muscle L-type Ca2+ channels through a nitric oxide-dependent mechanism Am J Physiol Gastrointest Liver Physiol, January 1, 2005; 288(1): G7 - G14. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sukharev and D. P. Corey Mechanosensitive Channels: Multiplicity of Families and Gating Paradigms Sci. Signal., February 10, 2004; 2004(219): re4 - re4. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. R. Strege, Y. Ou, L. Sha, A. Rich, S. J. Gibbons, J. H. Szurszewski, M. G. Sarr, and G. Farrugia Sodium current in human intestinal interstitial cells of Cajal Am J Physiol Gastrointest Liver Physiol, December 1, 2003; 285(6): G1111 - G1121. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ben-Tabou De-Leon, E. Blotnick, and I. Nussinovitch Effects of osmotic swelling on voltage-gated calcium channel currents in rat anterior pituitary cells Am J Physiol Cell Physiol, October 1, 2003; 285(4): C840 - C852. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Ou, P. Strege, S. M. Miller, J. Makielski, M. Ackerman, S. J. Gibbons, and G. Farrugia Syntrophin gamma 2 Regulates SCN5A Gating by a PDZ Domain-mediated Interaction J. Biol. Chem., January 10, 2003; 278(3): 1915 - 1923. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Calabrese, I. V. Tabarean, P. Juranka, and C. E. Morris Mechanosensitivity of N-Type Calcium Channel Currents Biophys. J., November 1, 2002; 83(5): 2560 - 2574. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||