|
|
||||||||
Departments of Physiology and Pharmacology, University of Arizona, Health Sciences Center, Tucson, Arizona 85718
| |
ABSTRACT |
|---|
|
|
|---|
Luminal acidification is important for the maturation of secretory granules, yet little is known regarding the regulation of pH within them. A pH-sensitive green fluorescent protein (EGFP) was targeted to secretory granules in RIN1046-38 insulinoma cells by using a construct in which the EGFP gene was preceded by the nucleotide sequence for human growth hormone. Stimulatory levels of glucose doubled EGFP secretion from cell cultures, and potentiators of glucose-induced insulin secretion enhanced EGFP release. Thus this targeted EGFP is useful for population measurements of secretion. However, less than ~4% of total cell EGFP was released after 1.5 h of stimulation. Consequently, when analyzed in single cells, fluorescence of the targeted EGFP acts as an indicator of pH within secretory granules. Glucose elicited a decrease in granule pH, whereas inhibitors of the V-type H+-ATPase increased pH and blocked the glucose effect. Granule pH also was modified by effectors of the protein kinase A pathway, with activation eliciting granule alkalinization, suggesting that potentiation of peptide release by cAMP may involve regulated changes in secretory granule pH.
insulin secretion; cAMP; protein kinase A; V-type H+ ATPase; green fluorescent protein
| |
INTRODUCTION |
|---|
|
|
|---|
THE REGULATION OF
PH within subcellular compartments is crucial
for maintaining macromolecular trafficking from one intracellular compartment to another (20). In the endocytic pathway,
receptor-bound ligands and dissolved substances in the extracellular
fluid are taken up at the plasma membrane by specialized structures
that form "early" endosomes (31). The endosomal lumen
rapidly acidifies, inducing the dissociation of endocytosed
receptor-ligand complexes. The endosomal contents may be recycled back
to the plasma membrane, as in the transferrin system (10),
or undergo further degradation in "late" endosomes and lysosomes
(31). In the regulated exocytic pathway of hormone
secreting cells, the acidic environment of the secretory vesicle
regulates the proteolytic processing of prohormones into the mature
form of the secreted peptide (2). In the pancreatic
-cell, cleavage of the proinsulin B and C chains by a specific
endopeptidase requires an acidic environment within the secretory
granule (7). Moreover, it has been suggested that
"priming" of insulin containing secretory granules involves further
acidification of the granule lumen (4). Conversely, it has
been proposed that alkalinization of the secretory granule lumen upon
activation of secretion should occur to promote solubility of the
stored and condensed insulin, thereby enhancing its release from the
granule upon fusion with the plasma membrane (3).
Although it is appreciated that changes in the pH of secretory granules
must occur for normal protein processing, the regulation of pH in these
compartments has not been studied in detail. Seminal studies monitored
accumulation of the fluorescent base acridine orange to evaluate
granule pH in isolated
-cells (26). More recently, Barg
et al. (4) utilized a lysosensor probe (Molecular Probes, Eugene, OR) to monitor pH within acidic compartments during activation of secretion in isolated mouse
-cells. However, both acridine orange and lysosensor distribute into all acidic compartments, including endosomes. Therefore, any global measure of vesicular pH with
these probes must be influenced by the low pH of the endocytic pathway
such that changes in their fluorescence may equally reflect changes in
endosomal pH and pH within the secretory pathway. Knowledge of the
mechanisms by which proteins are sorted within cells has provided an
approach to target ion-sensitive fluorescent proteins to specific
subcellular compartments. Several probes that have shown great utility
include the Ca2+ indictor protein aqueorin and the
pH-sensitive variants of green fluorescent protein (GFP)
(23).
Because GFP is encoded by DNA, targeting the GFP protein product to a specific subcellular site can be achieved with a few strategic genetic manipulations. These properties have allowed GFP to be used to localize fusion proteins within specific subcellular compartments (13, 15, 32) and to investigate vesicular trafficking in the regulated and constitutive secretory pathways (12, 28). With the development of red-shifted GFP mutants having enhanced pH sensitivity, it has become possible to monitor pH regulation within a variety of subcellular compartments to which the GFP has been targeted (13, 15). With respect to secretory granules, GFP targeting has been used to study activation-induced changes in synaptic vesicle pH within PC-12 cells (9) and to monitor synaptic vesicle exocytosis in hippocampal neurons (21).
To monitor pH within vesicles of the regulated secretory pathway in endocrine cells, Pouli et al. (28) developed a preproinsulin-GFP construct and expressed it in insulin-secreting INS-1 cells. In most transfected cells, the GFP chimera was localized to the endoplasmic reticulum, whereas in ~12% of cells GFP appeared to target to both the Golgi and punctate secretory granules. No release of GFP was observed even in the presence of maximally stimulating concentrations of glucose (30 mM). We made similar observations with a preproinsulin-targeted construct (33), in which only a small population of insulin-containing secretory granules also contained GFP. In an attempt to improve on the targeting procedure, the NH2-terminal leader sequence of human growth hormone (24) was inserted in frame with the GFP sequence (EGFP; F64L/S65T) such that, upon expression, EGFP was targeted to the regulated secretory pathway in rat insulinoma cells (RIN1046-38 parental). The specific localization of the human growth hormone (hGH)-EGFP fusion protein (hGH-EGFP) was characterized by colocalization with antibodies to insulin. The ability to utilize this targeted probe for analysis of cell secretion and changes in pH within secretory granules was then evaluated.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cell culture and gene transfection. The insulin-secreting rat insulinoma RINr1046-38 cell line was obtained from Dr. Sam Clark (BetaGene, Dallas, TX) and cultured as previously described (6). Briefly, the cells were cultured in RPMI 1640 (Sigma Chemical, St. Louis, MO) supplemented with 5 mM glucose and 5% fetal bovine serum and maintained in a 95% air-5% CO2 humidified atmosphere at 37°C. RIN-38 cells (passage 1-8) were electroporated with plasmid (0.5 mg/ml DNA plasmid per 106 cells). The hGH-EGFP-transfected cells were kept under selection with 0.25 mg/ml active G-418. For secretion experiments, cells were plated at 2 × 104 cells/cm2 into six-well culture dishes, and for imaging experiments the wells contained 25 mm of round glass (no. 1) coverslips.
Construction of hGH-EGFP expression vectors. The plasmid pBJ001 containing the hGH gene (a gift from Dr. Sam Clark) was cut with Tsp509I and BsrBI at bases 376 and 1996, respectively, of GenBank accession no. M13438. The resulting 1.6-kb fragment contains the hGH translation start site as well as the 26-amino acid NH2-terminal signal sequence that directs the fusion protein to the regulated secretory pathway. Transcription of the full-length hGH-EGFP (F64L/S65T) plasmid is directed by the cytomegalovirus immediate early promoter. The stop codon and SV40 polyadenylation sites are from the GFP plasmid. This plasmid contains the coding region for expression of resistance against the antibiotic G-418. The Tsp509I/BsrBI fragment was inserted into the SmaI site of pEGFP-N2 (Clontech Laboratories, Palo Alto, CA). Proper insertion of the full-length hGH fragment was confirmed by PCR with pEGFP-N2-specific primers by using the forward primer 5' TCTGCAGTCGACGGTACCGCGGGC 3' (bases 633-656; GenBank accession no. U57608) and reverse primer 5' TTTACTTGTACAGCTCGTCCTTGCCGAGAGTGATCC 3' (bases 1403-1370; GenBank accession no. U57608), and the 2.4-kb fragment of the hGH-EGFP construct was subsequently sequenced (ARL Labs, Division of Biotechnology, Tucson, AZ).
EGFP secretion from cell populations. Cells were grown to ~75-80% confluence in six-well plates. For analysis of EGFP secretion, the culture media from individual wells were replaced with 1 ml of Hanks' buffered saline (HBS) without substrates. HBS contained (in mM/l) 138 NaCl, 0.2 NaHCO3, 0.3 Na2HPO4, 5 KCl, 0.3 KH2PO4, 1.3 CaCl2, 0.4 MgSO4, and 10 HEPES. Each well was rinsed three times with fresh HBS and then incubated in 1 ml of HBS containing 0.05 mM glucose and no other substrates for 1.5 h in a 37°C incubator. These media were replaced by either 1 ml of the same medium (low glucose) or medium containing 5 mM glucose with or without potentiators of glucose-stimulated insulin secretion. After another 1.5-h incubation period, the media were again collected; these media samples were centrifuged at 3,000 g for 2 min, to pellet particulates including cells that were released into the media, before analysis of medium EGFP fluorescence. The cells from each six-well chamber were removed by incubation in trypsin (500 U/ml) EDTA (0.02%) buffer, and cell density was determined by using a Neubauer hemocytometer. Cells released to the medium (analyzed from the pellets) amounted to <1% of attached cells and did not vary significantly for any experimental condition. Fluorescence of EGFP released to the medium was determined by using a Hitachi F2000 fluorimeter with excitation set at 480 nm and emission at 530 nm. The 1.5-h incubation periods were required to allow for sufficient secretion of EGFP to be measurable in the 1-ml volume. To allow comparison between different experiments, secretion rate data for cells incubated under activated conditions (5 mM glucose) are presented as a percentage of the rate measured for the same cells incubated with low glucose (0.05 mM glucose, control). Cell counts were performed for all control experiments to normalize secretion data for differences in constitutive secretion due to differences in passage number (number of cells expressing EGFP) and cell density between experiments. Absolute secretion rates were estimated by constructing a calibration curve with pure EGFP (Clontech).
Antibodies and immunocytochemistry. Primary and secondary antibodies were guinea pig antiporcine insulin (ICN Biological, Costa Mesa, CA), rabbit anti-GFP (Clontech), goat anti-guinea pig IgG, Texas red, and goat anti-rabbit IgG fluorescein isothiocyanate. Cells grown on no. 1 glass coverslips were fixed in 4% paraformaldehyde at room temperature and then permeabilized for 15 min in 0.5% Triton X-100 in 150 mM NaCl buffered with sodium citrate (15 mM). The coverslips were sequentially exposed to primary and secondary antibodies for 45 min each at room temperature with 10-min washes in antibody-free buffer in between incubations with antibodies (16).
Digital imaging microscope and optics. An Olympus IMT-2 microscope equipped for epifluorescence was used to image live cells and immunochemically labeled samples. The excitation path included a 200-W mercury lamp coupled with a 10-nm band-pass excitation filter centered at 480 nm and a long-pass dichroic mirror transmitting wavelengths of 500 nm and longer. EGFP fluorescence was imaged through a 30-nm band-pass emission filter centered at 525 nm. For all live-cell EGFP imaging experiments, coverslips containing subconfluent cells were placed into a perfusion chamber on the microscope containing HBS held at 37°C.
To image Texas red fluorescence from immunochemically stained cell preparations, a 10-nm band-pass excitation filter centered at 570 nm and an appropriate dichroic mirror coupled with a 10-nm band-pass emission filter centered at 610 nm were employed (all mirrors from Chroma, Brattleboro, VT). Fluorescence images were captured with a liquid cooled charge-coupled device (CCD) camera using a Techtronics 512 × 512-pixel imaging chip (Photometrics, Tucson, AZ). The light emitted from cell samples was collected by an Olympus S Plan Apo ×60 oil-immersion objective (NA 1.4), and a ×6.7 imaging eyepiece was used to focus the light emerging from the microscope onto the CCD chip. Photometrics Imaging Software was used to acquire and store images.Simultaneous measurement of cytosolic and secretory granule pH.
To measure emission intensity from vesicular EGFP and cytosolic
carboxyseminapthorhodofluor (SNARF)-1 simultaneously, we utilized a
spectral imaging microscope system as previously described
(18). Briefly, a 10-nm band-pass filter centered at 490 nm
coupled with a dichroic mirror passing light above 505 nm (Chroma) was
used to direct monochromatic excitation light to the sample. The
emitted light from the sample was focused with a ×6.7 eyepiece onto a high-resolution diffraction grating (300 grooves/mm; Aries 250/IS spectrograph; Chromex, Albuquerque, NM). First-order emission spectra
(500-700 nm) were focused onto the chip of the CCD camera. For
these experiments, coverslips containing subconfluent cells were placed
into HBS in the 37°C chamber on the microscope stage. A group of
cells expressing high levels of EGFP were selected, and then the medium
was replaced with HBS containing 5-15 µM SNARF-1 acetomethoxyester (AM). When the peak intensity at 570 nm (SNARF-1 acidic peak) reached approximately equal intensity to that of EGFP, the
coverslips were washed for >20 min in HBS before initiation of an
experiment. SNARF-1-AM (Molecular Probes) was solubilized in anhydrous
dimethyl sulfoxide (Aldrich, Milwaukee, WI) and stored desiccated at
80°C.
In situ calibrations. In situ pH calibration of hGH-EGFP was performed as described previously (15, 19). The calibrations were initiated after stable resting intensity values (530-nm emission) from hGH-EGFP-expressing cells were obtained. The cells were then equilibrated in pH 5.5 calibration buffer. The calibration buffer contained (in mM) 110 KCl, 20 NaCl, 0.5 CaCl2, 0.5 MgCl2, 10 bicine, 10 piperazine-N,N'-bis(2-ethanesulfonic acid) (PIPES), and the K+/H+ ionophore nigericin (2 µM) and K+ ionophore valinomycin (5 µM) to allow equilibration of intracellular and extracellular pH. For most calibrations, pH was increased stepwise from a pH of 4 or 5 to a pH of ~8.0 in six to eight steps. The cells were allowed to equilibrate at each pH change for 3 min before data acquisition. Alternatively, the cells were equilibrated in pH calibration buffer at a pH of 8.0 and sequentially exposed to increasing [H+]. Because EGFP fluorescence intensity is sensitive to pH but no spectral shift in emission frequency is observed, a method for normalizing the signal is required to compare the signal response between individual cells where total EGFP concentration might differ. To standardize the effect of pH on hGH-EGFP in each cell, the fluorescence intensity of hGH-EGFP (I530) measured throughout the experiment was normalized to the maximal hGH-EGFP intensity observed at a pH >8.0 (I530max). For all experiments, this value (I530max) was determined at the termination of the experiment by incubating cells with ionophores (nigericin and valinomycin) at high pH (~8.0). For the calibrations, the hGH-EGFP I530/I530max values were plotted against pH. Data were fit to a four-parameter sigmoidal relation by using SigmaPlot to estimate pKa values.
Cytosolic pH was evaluated by loading cells with the pH-sensitive fluorophore SNARF-1. The SNARF-1 fluorescence emission spectrum is sensitive to pH, with protons eliciting a shift in peak fluorescence from 640 to 570 nm. To analyze the SNARF-1 and EGFP signal responses simultaneously, spectral imaging microscopy was used to monitor fluorescence emission intensity from 500 through 700 nm. Cytosolic pH was calculated by fitting the ratio of fluorescence intensities (I) measured at the ion-sensitive wavelengths of SNARF-1 (570 and 640 nm) into the following equation: pH = pK + log[(R
Rmin)/(Rmax
R)], where
R = I640nm/I570nm, Rmin is the
fully protonated form of SNARF-1, Rmax is the fully
deprotonated form of SNARF-1, and pK is the apparent
Kd of SNARF-1 for protons (18, 19).
Conversely, fluorescence emission of SNARF-1 at 600 nm is relatively
insensitive to pH, providing a measure of pH-independent (artifactual)
changes in fluorescence. By taking advantage of this property, the
intensity of fluorescence at 530 nm (EGFP) was compared with that at
600 nm to correct for pH-independent changes in fluorescence. This approach for the normalization of a "single emission wavelength probe" has been previously validated (18). The
I530/I530max ratio was compared with the
I530/I600 ratio to evaluate the reliability of
the "single wavelength" EGFP signal normalization approach during
in situ calibrations. SNARF-1 also has a lower affinity for protons
(pKa ~7.5), providing a good comparison to the EGFP signal response.
Cell permeabilization with digitonin. To gain access to the cytosolic space, the cell plasma membrane was permeabilized by incubation with 0.1% digitonin in buffer that mimics cytosolic ionic contents. The digitonin was then removed, and the cells were incubated in digitonin-free cytosolic buffer. The cytosolic buffer contained (in mM/l) 110 KCl, 0.5 MgCl2, 20 HEPES, and 20 NaCl. After stabilization of the fluorescence signal, Mg2+-ATP in a small volume of HEPES-buffered solution (pH 9) was added to provide a final ATP concentration of 5 mM, with medium pH and ionic strength not appreciably altered. Addition of digitonin causes a significant increase in nonspecific fluorescence, making calculation of pH values using the standard calibration curve impossible. Therefore, data from these experiments are presented as I530/ I530max values.
Statistical analysis. Data are presented as means ± SE unless otherwise noted. Statistical differences between group means were determined with the use of a two-tailed unpaired Students t-test. A value of P < 0.05 was taken as indicative of a statistically significant difference between group means.
| |
RESULTS |
|---|
|
|
|---|
Expression of targeted EGFP and its subcellular distribution.
Transfection of the hGH-EGFP construct was accomplished by
electroporation of the rat insulinoma cell line RINr1046-38 with the
hGH-EGFP plasmid. Cells that survived selection with G-418 were
propagated, and clonal lines were imaged for EGFP fluorescence. A range
of distributions of EGFP were observed for different clones, with most
exhibiting punctate fluorescence with very little to no apparent
cytosolic fluorescence. Figure 1 is a
widefield image showing the distribution of EGFP in the clonal line
selected for the experiments described herein (RIN-3M21). Individual
cells exhibit different levels of expression. However, most cells in the population express EGFP that is localized to punctate structures with diameters of <1 µm. To determine the subcellular origin of the
fluorescence, an image of live cells exhibiting high levels of punctate
EGFP was acquired. Cells were then fixed with paraformaldehyde on the
microscope stage, and another fluorescent image of the same cells was
captured. There was little or no change when comparing the distribution
of EGFP fluorescence in live or fixed preparations (data not shown).
Fixed cells were labeled with rabbit anti-EGFP antibody, followed with
anti-rabbit Texas red. The anti-EGFP (TR) antibody coincided with
punctate EGFP fluorescence, confirming that the fluorescence originates
from EGFP, rather than cellular autofluorescence (not shown).
Colocalization of hGH-EGFP with insulin-specific antibodies was
investigated to determine whether the hGH-EGFP was properly targeted to
secretory vesicles. A typical image pair is shown in Fig.
2. The image in Fig. 2B
represents EGFP fluorescence, and Fig. 2A represents
anti-insulin. Clearly, EGFP is colocalized with insulin within
secretory granules in these cells, as it is in most cells in this
population. Although the absolute level of EGFP in the cytosol cannot
be determined relative to the compartmentalized EGFP in these images,
the cytosolic component must be relatively small on the basis of the
imaging results.
|
|
Effect of cell activation on EGFP secretion from RIN-3M21 cells.
Release of EGFP from cells into the culture medium was analyzed under
nonstimulatory conditions (0.05 mM glucose) and compared with EGFP
release in the presence of stimulatory glucose (5 mM) and in the
presence of a potentiator of the secretory response (3-isobutyl-1-methylxanthine, IBMX). Over the course of a 1.5-h incubation period, nonstimulated constitutive secretion was
significant. On the basis of calibration curves constructed from
purified EGFP, the rate of secretion was ~0.5 (±0.1) nmol
EGFP · 106
cells
1 · h
1 (n = 16). The effects of activators and potentiators of insulin secretion
on EGFP release are shown in Table 1.
When incubated in the presence of stimulatory levels of glucose,
secretion more than doubled (222 ± 29%, n = 12).
This rate of EGFP secretion is about one-third the rate of
glucose-stimulated insulin secretion measured in the parental line
(6). Potentiators of glucose-induced insulin secretion
enhanced the release of EGFP. IBMX, which elevates cAMP and potentiates
insulin secretion, increased EGFP secretion nearly threefold (Table 1).
This effect of IBMX was reduced to levels observed in the presence of
glucose alone when the cells were preincubated for 1 h with 10 µM of the protein kinase inhibitor 1-(5-isoquinoline-sulfonyl)-2-1-(5-isoquinoline-sulfonyl)-2-methylpiperizine dihydrochloride (H-7; Ref. 1).
|
In situ pH calibration of hGH-EGFP.
The fluorescence emission of secretory granule-targeted hGH-EGFP was
analyzed as the cells were sequentially incubated in buffers of varying
pH containing nigericin and valinomycin to abolish pH gradients
(19). As expected, the fluorescence of hGH-EGFP in
secretory vesicles was most sensitive to changes in pH below 7.0 (Fig.
3). To correct for differences in
absolute EGFP fluorescence between individual cells, the signal
measured at each pH was normalized to the maximal signal response
elicited at pH ~8.0 in the presence of nigericin and valinomycin.
This was the approach used to calculate pH for all experiments. The fluorescence of hGH-EGFP analyzed in situ at 37°C has an apparent pKa of 6.24, which is similar to published
values for EGFP in vitro and in situ [pKa = 6.15 (15); pKa = 5.98 (13); both measured at 22°C].
|
Effect of glucose on secretory granule pH measured in single cells.
Approximately 40% of individual RIN-3M21 cells within the cell
population are insensitive to glucose, i.e., no change in pH is
observed (passages 14-17). On the other hand, in
~58% of all cells (n = 236), elevation of glucose
from low levels (0.05 mM) to stimulatory levels (5 mM) initiated a
decrease in single-cell EGFP fluorescence, which is consistent with
release of the EGFP protein from the cells,. i.e., secretion and loss
of cellular EGFP (Fig. 4). However, in
cells in which stimulatory levels of glucose were replaced with
equimolar mannitol, a recovery of EGFP fluorescence toward baseline was
observed. As seen in Fig. 4, pH does not fully recover to control
levels after the washout of activating glucose. When analyzed as a
decrease in total EGFP signal per cell, a decrease of 4% (±0.02,
n = 16) is calculated. This decrease in signal,
measured from individual cells, is similar in magnitude to the amount
of total cellular EGFP content released after cell activation
(2-5% of total cell EGFP/h based on cell population
measurements). Because only a small amount of EGFP is released and EGFP
fluorescence is sensitive to changes in pH below 7.5 (Fig. 3), the
ability to reverse the glucose-induced decrease in EGFP fluorescence
indicates that changes in single-cell EGFP fluorescence intensity are
primarily due to the pH sensitivity of the EGFP within the secretory
pathway. Consistent with this proposition, resting vesicular pH is
significantly more acidic in cells incubated in 5 mM glucose (6.06 ± 0.05; n = 42) than in cells incubated with
nonstimulatory glucose (6.22 ± 0.03; n = 62).
Because imaging data demonstrate localization of EGFP within insulin
secretory granules (Fig. 2), these changes in EGFP fluorescence at the
single-cell level are indicative of changes in pH within immature
insulin secretory granules that are not released immediately upon cell
stimulation.
|
|
|
Regulation of secretory granule pH by protein kinase A.
A primary mechanism for potentiating glucose-activated insulin
secretion is a concomitant elevation in cAMP (29). Little is known regarding the influence of cAMP and the subsequent activation of protein kinase A (PKA) at the level of the secretory granule. As
described above, glucose-induced secretion of insulin, and in these
cells EGFP secretion, is potentiated by treatment with IBMX, which
allows cAMP levels to accumulate by inhibiting phosphodiesterase activity. IBMX also elicited a significant alkalinization of the vesicle lumen in both the presence (Fig.
7) and absence of stimulatory levels of
glucose (Fig. 8). This alkalinization was
reversed upon removal of the IBMX (Fig. 7). Forskolin directly
activates adenylate cyclase, thereby substantially elevating cAMP
levels. Similar to findings with IBMX, forskolin elicited an
alkalinization of secretory granules independent of activation by
glucose (Figs. 7 and 8). In the absence of stimulatory glucose,
secretory granules continued to alkalinize for >30 min, with forskolin
treatment reaching a steady- state pH of 6.9 (±0.06; n = 11). The presence of glucose did not have a significant effect on the
change in secretory granule pH elicited by either IBMX or forskolin
(measured 7 min after treatment), even though resting granule pH was
significantly lower in the presence of 5.0 mM glucose. When cells were
treated with the kinase inhibitor H-7 before challenge with forskolin, the effect of forskolin on vesicle pH was largely ameliorated (Fig. 8);
in 7 of 20 cells analyzed, pretreatment with H-7 completely blocked the
effect of forskolin. On the other hand, 10 µM H-7 by itself did not
significantly alter secretory granule pH. The PKA-induced
alkalinization of secretory granules could be mediated through either
modification of H+ movements [leak or pumping, or by
altering counter-ion conductance (Cl
; Ref.
35)]. To determine whether a change in Cl
conductance was involved in the forskolin-mediated alkalinization, cells were incubated with 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid (DIDS) before treatment with forskolin. DIDS by itself had no
effect on either resting vesicle pH or the forskolin-mediated response
(Fig. 8), indicating that alterations in counter-ion conductance are
not involved.
|
|
| |
DISCUSSION |
|---|
|
|
|---|
The analysis of ionic changes within subcellular compartments has
been augmented by the development of ion-sensitive fluorescent probes
that can be targeted to specific organelles (15, 23, 34).
Here we describe the targeting of a pH-sensitive form of GFP
(EGFP-F64L/S65T) to the secretory pathway of insulin-secreting cells
(Fig. 2). At the population level, this targeting provides a measure of
cell secretory activity by monitoring appearance of EGFP fluorescence
in the culture medium. Gene knockin or knockout in insulin-secreting
cell lines has provided a powerful approach to study the mechanisms by
which these
-cells sense changes in glucose concentration (5,
11). The ability to determine how alterations in expression of
specific components of the glucose-sensing mechanism modify secretion,
by simply monitoring release of a fluorescent tag from a cell
population, may facilitate such studies. On the other hand, little
total signal is lost after activation of secretion (2-5% of total
EGFP/h). Therefore, most EGFP must be within immature secretory
granules that are not immediately released upon stimulation. Thus, at
the single-cell level, observed changes in EGFP fluorescence that occur
on the order of minutes are primarily indicative of pH responses within
the targeted compartments, rather than a direct measure of cell
activation or secretion.
EGFP in the secretory compartments can be reasonably calibrated (Fig. 3), although the pKa appears to be elevated by ~0.1-0.4 pH units relative to that monitored free in solution (13, 27). The reason for the difference between in situ and in vitro calibration curves is not obvious. However, the milieu within the granules themselves must be quite different from that used for in vitro calibration, particularly with respect to protein (insulin) and ion concentrations and fixed charge characteristics (14), which may explain the shift in sensitivity to the right. On the other hand, in the previously reported in vitro and in situ calibrations, where EGFP was targeted to a range of subcellular compartments, a range of affinities for protons (~5.8-6.17) was also observed (13, 15, and 27). Moreover, these previous calibrations were carried out between 20 and 22°C, whereas our calibrations were carried out at 37°C. Thus a variety of factors could explain the differences in absolute calibration of EGFP. Because of this uncertainty in probe calibration, absolute pH values must be viewed with some care. Nevertheless, the relative changes in EGFP fluorescence in response to physiological perturbations in our studies were both robust and reproducible.
Another issue relevant to the interpretation of the measured absolute pH values is that the signal is averaged over many vesicles that are likely to exhibit a range of resting pH and unique responses relative to their general state of maturation (2, 20). Because the probe is specifically targeted to the regulated secretory pathway, the signal responses are not associated with changes in pH occurring in other subcellular organelles, which is a difficulty when using many vital dyes (4, 26). Moreover, the imaging results indicate that the contribution of signal from probe retained in the Golgi, endoplasmic reticulum, or cytosol is small (Figs. 1 and 2). Thus the targeted EGFP provides an excellent measure of changes in pH specifically within the total population of insulin-containing secretory granules.
Agents that activate or potentiate insulin secretion were found to
regulate secretory granule pH. Elevating glucose to stimulatory concentrations elicited an acidification of granule pH. Elevations in
glucose also have been observed to induce changes in ion transport (Ca2+, K+) in
-cells (30) and
other cell types (17, 18, and references therein), suggesting a general
effect of glucose on cellular ion transport. However, the acidification
in response to increased glucose in the RIN-3M21 cells was not a
general phenomenon because it did not occur in a significant number of
EGFP-expressing cells within the population. These cells have likely
lost some component of the required glucose-sensing apparatus. In
glucose-responsive cells, the observed decrease in secretory granule pH
may be best explained by an increased H+ transport into
secretory granules or decreased H+ leak (34)
after activation of glycolysis. This acidification was reversible and
dependent on an active V-type H+-ATPase (Figs.
4-6). However, it was difficult to evaluate the underlying mechanism due to the absence of response to glucose in a large number
of cells. Therefore, we addressed this issue under conditions where
changes in secretory granule pH were consistently observed (e.g.,
forskolin, see below). Clearly, the mechanism by which increased
glucose metabolism regulates secretory granule pH, and the role this
plays in the glucose-induced secretory response in
-cells, warrants
further investigation.
A potentially important observation in our studies was the consistent
alkalinization of secretory granules elicited by activators of PKA.
Increases in cAMP are related to enhanced glucose-stimulated insulin
release from
-cells (22, 29) and
-cell lines
(8). Here we show that factors known to work through
cAMP-mediated pathways not only potentiate EGFP release from RIN-3M21
cells (Table 1) but also consistently alkalinize the lumen of secretory granules whether or not stimulatory glucose was present (Figs. 7 and
8). Mechanistically, this alkalinization could be caused by an
inhibition of the V-type H+ pump, an increase in
H+ leak, or a decrease in the conductance of a counter-ion
such as Cl
. Previous studies using clatherin-coated
vesicles (primarily endosomes) indicated that Cl
channel
activity is required in parallel with proton pumping by the V-type
H+-ATPase to maintain electroneutrality and thereby
allow protons to accumulate in the vesicle lumen (35). In
addition, PKA was shown to activate this channel activity in
reconstituted membranes (25). However, this finding
predicts that activation of PKA would lead to further acidification of
the secretory granules. Moreover, we show that inhibiting
Cl
channels with DIDS did not significantly inhibit the
forskolin-induced alkalinization (Fig. 8) or influence resting granule
pH. Therefore, a role for Cl
conductance in regulating
secretory granule pH is unlikely to be found in these
-cells.
Consistent with our observations of PKA-induced alkalinization of
secretory granules, Zen et al. (36) demonstrated that PKA
activation inhibits the normal acidification of endosomal compartments
in 3T3 Swiss fibroblasts. Although the molecular mechanism by which PKA
modulates secretory granule pH remains to be fully elucidated, there
may be an important physiological role for PKA in regulating secretory
granule pH.
Because insulin is stored as an array within the granule lumen, it has been proposed that insulin must be "decondensed" from its stored form in order for optimal release to occur (3). Moreover, alkalinization of the granule environment is known to facilitate insulin decondensation (3). The decondensation has been thought to occur after the secretory granules fuse with the plasma membrane, exposing the stored insulin to the extracellular fluid that is near neutral pH. However, alkalinization of the granule lumen before insertion into the membrane may be an important step in priming insulin for release (3). Thus our findings support the notion that elevation of vesicular pH occurs in response to potentiators and may shed light on a mechanism through which cAMP and activation of PKA may act in potentiating glucose-induced insulin release.
In summary, the use of the hGH signal sequence for targeting the fluorescent pH indicator EGFP to the secretory pathway in insulin-secreting cells was a clear improvement on previous efforts to target these compartments. At the cell population level, activation of secretion from the population of cells can be monitored by measuring the appearance of EGFP in the culture medium. However, at the single-cell level, changes in EGFP fluorescence are related to changes in pH within the targeted compartments. The regulation of secretory granule pH by activators of PKA is consistent with a role for secretory granule alkalinization in promoting insulin decondensation before granule insertion into the plasma membrane and, thereby, in the potentiation of insulin release.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. Sam Clark for supplying several reagents and for help in developing electroporation strategies for the RIN1046-38 cell line and Debra A. Gordon for work on the construction of the hGH-EGFP vector.
| |
FOOTNOTES |
|---|
This work was supported in part by the American Diabetes Association and the Arizona Disease Control Research Commission. L. S. Tompkins was supported by National Heart, Lung, and Blood Institute Training Grant HL-07249.
Address for reprint requests and other correspondence: R. M. Lynch, Dept. of Physiology, Univ. of Arizona, Arizona Health Sciences Center, Tucson, AZ 85718 (E-mail: rlynch{at}u.arizona.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
10.1152/ajpcell.01066.2000
Received 21 June 2000; accepted in final form 19 March 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Anthony, TL,
Brooks HL,
Boassa D,
Leonov S,
Yanochko GM,
Regan JW,
and
Yool AJ.
Cloned human aquaporin-1 is a cyclic GMP-gated ion channel.
Mol Pharmacol
57:
576-588,
2000
2.
Arvan, P,
and
Castle D.
Sorting and storage during secretory granule biogenesis: looking backward and looking forward.
Biochem J
332:
593-610,
1998.
3.
Aspinwall, CA,
Brooks SA,
Kennedy RT,
and
Lakey JRT
Effect of intravesicular H+ and Zn+ on insulin secretion in pancreatic
-cells.
J Biol Chem
272:
31308-31314,
1997
4.
Barg, S,
Huang P,
Eliasson L,
Nelson DJ,
Obermuller S,
Rorsman P,
Thevenod F,
and
Renstrom E.
Priming of insulin granules for exocytosis by granular Cl
uptake and acidification.
J Cell Sci
114:
2145-2154,
2001
5.
Becker, TC,
Noel RJ,
Lynch RM,
Johnson JH,
Takeda J,
Bell GI,
and
Newgard CB.
Adenovirus mediated over expression of glucokinase isoforms in islets: minimal secretory and metabolic effects relative to hexokinase over expression.
J Biol Chem
271:
390-394,
1996
6.
Clark, S,
Burnham B,
and
Chick W.
Modulation of glucose-induced insulin secretion from a rat clonal
-cell line.
Endocrinology
127:
2779-2788,
1990
7.
Davidson, H,
Rhodes CJ,
and
Hutton JC.
Intraorganellar calcium and pH control proinsulin cleavage in the pancreatic
-cell via two distinct site-specific endopeptidases.
Nature
333:
93-96,
1988[Medline].
8.
Drucker, DJ,
Philippe J,
Mojsov S,
Chick WL,
and
Habener JF.
Glucagon-like pepetide I stimulates insulin gene expression and increases cyclic AMP levels in rat islet cell line.
Proc Natl Acad Sci USA
84:
3434-3488,
1987
9.
Han, W,
Li D,
Stout AK,
Takimoto K,
and
Levitan ES.
Ca2+-induced deprotonation of peptide hormones inside secretory vesicles in preparation for release.
J Neurol Sci
19:
900-905,
1999.
10.
Hopkins, CR,
and
Trowbridge IS.
Movement of internalized ligand-receptor complexes along a continuous endosomal reticulum.
J Cell Biol
97:
508-521,
1983
11.
Hughes, SD,
Johnson JH,
Quaade C,
and
Newgard C.
Engineering glucose-stimulated insulin secretion and biosynthesis in non-islet cells.
Proc Natl Acad Sci USA
89:
688-692,
1992
12.
Kaether, C,
and
Gerdes HH.
Visualization of protein transport along the secretory pathway using green fluorescent protein.
FEBS Lett
369:
267-271,
1995[Web of Science][Medline].
13.
Kneen, M,
Farinas J,
Li Y,
and
Verkman A.
Green fluorescent protein as a noninvasive intracellular pH indicator.
Biophys J
74:
1591-1599,
1998[Web of Science][Medline].
14.
Langrindge-Smith, JE,
and
Dubinsky WP.
Donnan equilibrium and pH gradients in isolated tracheal apical membrane vesicles.
Am J Physiol Cell Physiol
249:
C417-C420,
1985
15.
Llopis, J,
McCaaffery M,
Miyawaki A,
Farquhuar MG,
and
Tsien RY.
Measurement of cytosolic, mitochondrial, and Golgi pH in single living cells with green fluorescent proteins.
Proc Natl Acad Sci USA
95:
6803-6808,
1998
16.
Lynch, RM,
Fogarty KE,
and
Fay FS.
Analysis of hexokinase association with mitochondria by quantitative confocal microscopy.
J Cell Biol
112:
385-395,
1991
17.
Lynch, RM,
and
Paul RJ.
Functional compartmentation of carbohydrate metabolism.
In: Microcompartmentation, edited by Jones DP.. Boca Raton, FL: CRC, 1998, p. 35-56.
18.
Martinez-Zaguilan, R,
Gurule M,
and
Lynch RM.
Simultaneous measurement of pH and Ca2+ in single insulin-secreting cells by microscopic spectral imaging.
Am J Physiol Cell Physiol
270:
C1438-C1446,
1996
19.
Martinez-Zaguilan, R,
Tompkins LS,
Gillies RJ,
and
Lynch RM.
Simultaneous analysis of pH and Ca2+ from cell populations.
Methods Mol Biol
114:
287-306,
1999[Medline].
20.
Mellman, I,
Fuchs R,
and
Helenius A.
Acidification of the endocytic and exocytic pathways.
Annu Rev Biochem
55:
663-700,
1986[Web of Science][Medline].
21.
Miesenbock, G,
De Angelis DA,
and
Rothman JE.
Visualizing secretion and synaptic transmission with pH-sensitive green fluorescent proteins.
Nature
394:
192-195,
1998[Medline].
22.
Moens, K,
Heimberg H,
Flamez D,
Huypens P,
Quartier E,
Ling Z,
Pipeleers D,
Gremlich S,
Thorens B,
and
Schuit F.
Expression and functional activity of glucagons, glucagons-like peptide 1, and glucose-dependent insulinotropic peptide receptors in rat pancreatic islet cells.
Diabetes
45:
257-261,
1996[Abstract].
23.
Montero, M,
Alvarez J,
Sheenen WJJ,
Rizzuto R,
Meldolesi J,
and
Pozzan T.
Ca2+ homeostasis in the endoplasmic reticulum: coexistence of high and low [Ca2+] subcompartments in intact HeLa cells.
J Cell Biol
139:
601-611,
1997
24.
Moore, HPH,
and
Kelly RB.
Re-routing of a secretory protein by fusion with human growth hormone.
Nature
321:
443-446,
1986[Medline].
25.
Mulberg, AE,
Tulk BM,
and
Forgac M.
Modulation of coated vesicle chloride channel activity and acidification by reversible protein kinase A-dependent phosphorylation.
J Biol Chem
266:
20590-20593,
1991
26.
Pace, C,
and
Sachs G.
Glucose-induced proton uptake in secretory granules of
-cells in monolayer culture.
Am J Physiol Cell Physiol
242:
C382-C387,
1982
27.
Patterson, GH,
Knobel SM,
Sharif WD,
Kain SR,
and
Piston DW.
Use of green fluorescent protein and its mutants in quantitative fluorescence microscopy.
Biophys J
73:
2782-2790,
1997[Web of Science][Medline].
28.
Pouli, AE,
Kennedy HJ,
Schofield JG,
and
Rutter GA.
Insulin targeted to the regulated secretory pathway after fusion with green fluorescent protein and firefly luciferase.
Biochem J
331:
669-675,
1998.
29.
Prentki, M,
and
Matshinsky FM.
Ca2+, cAMP, and phospholipid-derived messengers in coupling mechanisms of insulin secretion.
Physiol Rev
67:
1185-1248,
1987
30.
Roe, MW,
Mertz RJ,
Lancaster ME,
Worley JF, III,
and
Dukes ID.
Thapsigargin inhibits the glucose-induced decrease of intracellular Ca2+ in mouse islets of Langerhans.
Am J Physiol Endocrinol Metab
266:
E852-E862,
1994
31.
Stoorvogel, W,
Strous GJ,
Geuze HJ,
Oorschot V,
and
Schwartz AL.
Late endosomes derive from early endosomes by maturation.
Cell
65:
417-427,
1991[Web of Science][Medline].
32.
Storrie, B,
and
Kreis TE.
Probing the mobility of membrane proteins inside the cell.
Trends Cell Biol
6:
321-324,
1996[Web of Science][Medline].
33.
Tompkins, LS,
Clark SA,
Gordon DA,
Garrivito N,
and
Lynch RM.
Targeting GFP to secretory vesicles in an insulin-secreting pancreatic
-cell line.
FASEB J
12:
A428,
1998.
34.
Wu, MM,
Grabe M,
Adams S,
Tsien RY,
Moore HH,
and
Machen TE.
Mechanisms of pH regulation in the regulated secretory pathway.
J Biol Chem
276:
33027-33035,
2001
35.
Xie, XS,
Stone DK,
and
Racker E.
Determinants of clatherin-coated vesicle acidification.
J Biol Chem
258:
14834-14838,
1983
36.
Zen, K,
Biwersi J,
Periasamy N,
and
Verkman AS.
Second messengers regulate endosomal acidification in Swiss 3T3 fibroblasts.
J Cell Biol
119:
99-110,
1992
This article has been cited by other articles:
![]() |
M. Erent, A. Meli, N. Moisoi, V. Babich, M. J. Hannah, P. Skehel, L. Knipe, G. Zupancic, D. Ogden, and T. Carter Rate, extent and concentration dependence of histamine-evoked Weibel Palade body exocytosis determined from individual fusion events in human endothelial cells J. Physiol., August 15, 2007; 583(1): 195 - 212. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Tsuboi, M. A. Ravier, L. E. Parton, and G. A. Rutter Sustained Exposure to High Glucose Concentrations Modifies Glucose Signaling and the Mechanics of Secretory Vesicle Fusion in Primary Rat Pancreatic {beta}-Cells. Diabetes, April 1, 2006; 55(4): 1057 - 1065. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Y. Sautin, M. Lu, A. Gaugler, L. Zhang, and S. L. Gluck Phosphatidylinositol 3-Kinase-Mediated Effects of Glucose on Vacuolar H+-ATPase Assembly, Translocation, and Acidification of Intracellular Compartments in Renal Epithelial Cells Mol. Cell. Biol., January 15, 2005; 25(2): 575 - 589. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Oliveira-Souza, R. Musa-Aziz, G. Malnic, and M. de Mello Aires Arginine vasopressin stimulates H+-ATPase in MDCK cells via V1 (cell Ca2+) and V2 (cAMP) receptors Am J Physiol Renal Physiol, February 1, 2004; 286(2): F402 - F408. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |