Am J Physiol Cell Physiol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 283: C386-C395, 2002. doi:10.1152/ajpcell.00320.2001
0363-6143/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huang, X.-P.
Right arrow Articles by Malbon, C. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huang, X.-P.
Right arrow Articles by Malbon, C. C.
Vol. 283, Issue 2, C386-C395, August 2002

Targeted expression of activated Q227L Galpha s in vivo

Xi-Ping Huang1, Xiaosong Song1, Hsien-Yu Wang2, and Craig C. Malbon1

1 Department of Molecular Pharmacology and 2 Department of Physiology and Biophysics, Diabetes and Metabolic Diseases Research Program, University Medical Center, State University of New York at Stony Brook, Stony Brook, New York 11794


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

We report the creation of transgenic mice with an inducible, tissue-targeted expression of a constitutively active mutant form (Q227L) of Galpha s. Mice expressing activated Galpha s in fat tissue, liver, and skeletal muscle displayed normal body mass and blunted glucose metabolism. cAMP accumulation in adipose tissue was increased in the basal state, but far less than would be expected. Marked adaptation to elevated cAMP levels occurred, leading to an increase in total cAMP-specific phosphodiesterase activity, a 50% decline in cAMP-dependent protein kinase (protein kinase A) activity, and an increased expression of Galpha i2. The reduction in kinase activity coincided with >50% increase in the expression of RIalpha and RIIalpha regulatory subunits of protein kinase A, with no change in the amount of catalytic subunit. These data demonstrate the existence of adaptive responses of protein kinase A, phosphodiesterase, and Galpha i2 in tissues expressing constitutively active Galpha s that may act to rectify the impact of increased cAMP accumulation.

constitutively activated Galpha s; protein kinase A; regulatory subunits


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

A MOST INTRIGUING EXAMPLE of gain-of-function mutations in G protein alpha -subunits causing human disease is the case of McCune-Albright syndrome (MAS) (11). MAS is a sporadic disease typified by precocious puberty, monoostotic or polyostotic fibrous dysplasia, café au lait pigmentation, and several endocrinopathies (23). Hyperthyroidism, Cushing syndrome, hyperparathyroidism, acromegaly, and hepatomegaly are frequently observed in patients with this syndrome. The hyperactivity of the endocrine tissues appears to result from activating mutations (e.g., Arg201) in Galpha s that generate gain of function (23). The expression of activated Galpha s is not uniform in MAS but rather is a complex pattern reflecting the occurrence of a mutation in the multicell developing embryo. This feature of the disease generates a mosaic of expression that reflects the fate map of the cell in which the mutation arises. Patients with MAS are true chimera, the severity of the disease manifested largely by the spectrum of organs and tissues in which activated Galpha s occurs. Recent studies suggest that a severe form of the syndrome may be the cause of early death in childhood, especially when the activated G protein is expressed in tissues such as the liver, heart, and gastrointestinal tract, nonclassic targets of MAS (18, 19).

The impact of gain-of-function mutations of Galpha s on signaling has been examined in a variety of cell types in culture, including neuroblastoma × glioma hybrid NG108-15 cells (14), mouse NIH 3T3-L1 (4), Swiss 3T3 cells (27), rat pituitary GH3 cells (6), and FRTL-5 rat thyroid cells (15). Galpha s is known to regulate adenylyl cyclase activity, Ca2+ channels, and apoptosis (17, 24). Study of the stoichiometry of Galpha s protein-coupled receptors, Galpha s, and adenylyl cyclase suggests that Galpha s is in molar excess of receptor and effector (16). Spatial compartmentation and oligomerization of elements in the receptor > Galpha s > effector cascade may well negate the simple stoichiometry (16), because loss of ~50% of the Galpha s complement in Albright hereditary osteodystrophy leads to reduced signaling to adenylyl cyclase in humans (10, 21). These data suggest that probing the functions of Galpha s in vivo may best be approached by targeted expression of a constitutively activated form of Galpha s rather than wild-type Galpha s. Expression of wild-type Galpha s may contribute to endogenous levels of this G protein that may already be in excess of G protein-coupled receptors, whereas expression of Q227L Galpha s leads to a situation of chronic activation of Galpha s-regulated effectors. Overexpression of wild-type Galpha s in hearts of transgenic mice has been accomplished with the rat alpha -myosin heavy chain promoter (2). mRNA levels for Galpha s in the transgenic mice increased nearly 40-fold and Galpha s expression in the heart increased less than threefold, whereas there was little evidence by histopathological evaluation of the myocardium for lesions in the young adult (4-7 mo old) animals (2). These transgenic mice do develop increased cardiac contractility in response to beta -adrenergic stimulation and with aging cardiomyopathy (3).

Targeted expression of constitutively activated mutant forms of Galpha s in transgenic mice may provide a useful model for study of Galpha s function in specific tissues. The physiological mechanism(s) by which changes in G protein subunit expression are regulated and the extent to which cells adapt to changes in signaling in response to mutations in G protein alpha -subunits remain to be established and will be essential to our understanding of G protein signaling in human diseases. Creation of mice with tissue-specific expression of an activated Galpha s may provide insights into the adaptive mechanisms that arise to ameliorate the increase in cAMP levels.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Construction of pPEPCK-Q227L Galpha s plasmid. The cDNA encoding the Q227L mutant of Galpha s was engineered into convenient restriction sites of the pPEPCKQ205L Galpha i2 vector as previously reported (1). The coding sequence of a constitutively activated Galpha s (Q227L) and 3'-untranslated region (212 bp) was employed to replace the phosphoenolpyruvate carboxykinase (PEPCK) coding sequence, remaining under the control of PEPCK promoter.

Transfection and screening of FTO-2B cells. The calcium phosphate precipitation method was used in transfection of FTO-2B cells, which are normally grown in DMEM containing 5% FBS at 37°C under humidified 95% air-5% CO2 (12). The procedures used in the transfection, selection, and induction of the stably transfected FTO-2B clones with 8-(4-chlorophenylthio)adenosine 3',5'-cyclic monophosphate (CPT-cAMP) were described previously (1).

Creation of transgenic mice with conditional, tissue-specific expression of Q227L Galpha s. The Q227L Galpha s and PEPCK promoter (3.7 kb) were excised by XhoI and NotI from the pPEPCKQ227L Galpha s construct and isolated by low-melting agarose gel electrophoresis. The constructs were injected into preimplantation embryos, which were transplanted into pseudo-pregnant mice (C57Black6) in the University Transgenic Mouse Facility at the State University of New York at Stony Brook. Mouse tail DNAs were isolated with a DNeasy Tissue Kit according to the manufacturer's protocol and used for PCR amplification. The primers used were GACATCATCCAGCGCATGCATC (PT1) and CATCGGGATTACATCTGGCTGA (PT2), which on amplification yield a 574-bp fragment specific for the PEPCK-Q227L Galpha s construct. The amplification products were applied to electrophoresis on 1.5% agarose gels and made visible in ethidium bromide under ultraviolet irradiation. Transgenic mice were mated with wild-type C57Black6 mice purchased from Taconic (Germantown, NY) for five generations. Glucose tolerance tests and insulin sensitivity tests were performed as previously described (13). Wild-type control mice were littermates of the transgenic animals. The target age for analysis was 4 wk for identification of the transgenic mice and 4 mo for all other analyses. Only in the case where the intent was to sample mice at older ages for a phenotype were either 7- or 18-mo-old animals used.

Reverse transcription-polymerase chain reaction. Total mRNA was isolated and purified from cultured cells or tissues with RNA STAT-60 according to the manufacturer's instruction. Reverse transcription (RT) was conducted with 1 µg of total RNA in a final volume of 20 µl at 42°C for 1 h with the Promega RT system. Aliquots (4 µl) of RT product were applied to each polymerase chain reaction (PCR) and 30 cycles of amplification. For screening of transfected FTO-2B cells, primers PT1 and PT2 were used in the PCR amplifications. To probe tissue-specific expression of both the endogenous Galpha s mRNA and the mRNA of the transgene, additional primers were prepared. The 5' and 3' primers specific for endogenous Galpha s and Q227L Galpha s were 5'-TGG GTG CTG GAG AG TCTG G-3' (S1m) and 5'-AGG AAG TAC TGG GCA CAG T5' (S2m), respectively. A unique 5' primer, 5'-AGG GCT AGA CTC GAC ATG GGC T3' (S3m), specific only for the PEPCK-Q227L Galpha s transgene, was used to differentiate mRNAs of the mutant and wild-type forms. The PCR using primers S1m and S2m produces a 400-bp product from endogenous Galpha s and Q227L Galpha s, whereas the PCR using primers S3m and S2m produces a 551-bp product from PEPCK-Q227L Galpha s transgene only.

Isolation of adipocytes. Fat tissues were collected, minced, and digested with collagenase type 4 (1 mg/ml) in Krebs-Ringer Buffer [KRB; in mM: 120 NaCl, 4.8 KCl, 2.6 CaCl2, 1.2 MgSO4, 25 NaHCO3, 1 sodium phosphate buffer (pH 7.4), 2.5 D-glucose, and 5 HEPES] containing 3% bovine serum albumin (BSA) at 37°C on a shaker (100-150 rpm) for 30 min. The adipocytes were washed three times with KRB and transferred into KRB containing 3% BSA, 0.1 mM Ro-20-1724 (unless otherwise noted), and adenosine deaminase for cAMP production assays.

Adipocyte cAMP production assays. Assays were conducted in 1.5-ml test tubes in triplicate sets. The beta -adrenergic agonist isoproterenol and/or the diterpene forskolin were prepared in 50 µl of ice-cold KRB buffer containing Ro-20-1724 and adenosine deaminase; this aliquot was added to the incubation tubes first. The KRB buffer minus cells served as basal control. The reaction was started by addition of adipocytes (10,000-50,000/tube) and incubated at 37°C for 15 min on a shaker (300 rpm). To stop the reaction, the tubes were returned to an ice bath and 300 µl of prechilled (-20°C) ethanol was added to each well. The assay of the cAMP was as described elsewhere (20).

Protein kinase A assays. The assay is based on the phosphorylation of a synthetic peptide substract (kemptide: Leu-Arg-Arg-Ala-Ser-Leu-Gly) by cAMP-dependent protein kinase (protein kinase A; PKA) in the presence of [gamma -32P]ATP. The enzyme activity of PKA was determined with a PKA assay kit in triplicate in a final volume of 40 µl according to the manufacturer's protocol (20). The reaction contained 50 mM Tris (pH 7.5), 100 mM MgCl2, and 100 µM ATP supplemented with [gamma -32P]ATP, 0.25 mg/ml BSA, and 50 µM PKA substrate peptide kemptide. "Basal" PKA activities were determined in the absence of the PKA activator, cAMP, and defined as the PKA activity sensitive to inhibition by PKA inhibitor (PKI). PKI, a 17-amino acid peptide derived from the PKI sequence (1 µM final), was included to determine PKA-specific protein kinase activity. "Total" PKA activities were determined in the presence of 10 µM cAMP.

Briefly, fat tissues taken from mice were homogenized with a glass homogenizer fitted with a glass pestle and extraction buffer (in mM: 5 EDTA and 50 Tris, pH 7.5). The whole homogenate was cleared of cell debris by 2,000 g centrifugation for 15 min at 4°C, and the supernatant was recovered for PKA activity assay. The reaction was carried out at 30°C for 5 min. Aliquots (20 µl) were spotted onto phosphocellulose paper disks. The disks were washed three times with phosphoric acid (1% vol/vol) for 5 min and then rinsed once with acetone. The radioactivity of 32P contained in the disk papers was then counted by liquid scintillation counter. The PKA activity was defined as picomoles of [32P]phosphate transferred to kemptide substrate per minute per milligram of protein.

Phosphodiesterase activity assays. Fat tissues were collected and homogenized with a glass homogenizer in TMK buffer (in mM: 40 Tris, 5 MgCl2, and 30 KCl, pH 8.0) containing proteinase inhibitors [5 µg/ml aprotinin, 5 µg/ml leupeptin, and 200 µM phenylmethylsulfonyl fluoride (PMSF)] as described. After 2,000 g centrifugation, supernatants were collected for total phosphodiesterase (PDE) activity measurement. Briefly, PDE activity was determined in 1.5-ml microtubes (duplicate sets) with a final volume of 100 µl of TMK buffer containing cold cAMP (5.0 µM) and 0.05 µCi of [3H]cAMP as substrate. The reaction was initiated by addition of 50 µg of proteins and incubated in a shaker (300 rpm) at 37°C for 10 min. At the end of the 10-min incubation, tubes were placed in a boiling water bath for 3 min. Snake venom (100 µl of 1 mg/ml) was then added to convert 5'-AMP to adenosine by a 10-min incubation at 37°C in the shaker. Adenosine was then separated by addition of 1 ml of AG1-X8 resin (chloride form) to each tube. The tubes were then centrifuged for 15 min at 600 rpm. An aliquot of 500 µl of supernatant was counted for radioactivity in 3 ml of Ecoscint H. TMK buffer served as blanks. Ro-20-1724 (100 µM) was added to inhibit PDE4 activity.

Immunoblot analysis. FTO-2B cells were collected in PBS-EDTA buffer and suspended in ice-cold HME buffer (in mM: 20 HEPES pH 7.4, 2 MgCl2, and 1 EDTA) containing proteinase inhibitors (5 µg/ml aprotinin, 5 µg/ml leupeptin, and 200 µM PMSF). The suspension was sonicated for 10 s at a setting of 3 with a 550 Sonic Dismembrator from Fisher Scientific (Pittsburgh, PA). Animal tissues were collected and homogenized with a glass homogenizer in the presence of ice-cold HME buffer containing proteinase inhibitors. Intact cells and nuclei were then removed by low-speed centrifugation (2,000 g) at 4°C for 5 min, and supernatant was recovered. Membrane proteins were collected by high-speed centrifugation (16,000 g) at 4°C for 30 min. Protein pellets were resuspended in cold HME buffer containing proteinase inhibitors, and concentration was determined by a Lowry assay. For detection of Galpha s and Galpha i2 subunits, membrane proteins (30-100 µg) were subjected to SDS-polyacrylamide gel electrophoresis (PAGE). For PKA catalytic and regulatory subunits, whole homogenate (supernatant after 2,000 g; 10-100 µg protein) was subjected to SDS-PAGE. The separated proteins were transferred to nitrocellulose membranes, and the blots were stained with a rabbit polyclonal antibody specific for Galpha s subunit (CM129), mouse monoclonal antibodies for PKA catalytic and regulatory subunits, and then the second antibody peroxidase-labeled goat anti-rabbit or goat anti-mouse IgG. The immune complexes were visualized with enhanced chemiluminescence (ECL) methods and quantified with a GS-700 Imaging Densitometer (Bio-Rad Laboratories, Hercules, CA).

Materials. The DNeasy Tissue Kit for mouse tail DNA isolation was purchased from Qiagen (Valencia, CA). Reagents for PCR reactions were obtained from Life Technologies (Gaithersburg, MD). All PCR primers were synthesized by Operon Technologies (Alameda, CA). A cAMP-specific PDE inhibitor, Ro-20-1724, was purchased from Calbiochem (San Diego, CA). A stable analog of cAMP, CPT-cAMP, was purchased from Boehringer-Mannheim (Indianapolis, IN). A total RNA/mRNA isolation reagent, RNA STAT-60, was purchased from Tel-Test (Friendswood, TX). Horseradish peroxidase-labeled goat anti-rabbit IgG was purchased from Kirkegaard and Perry Laboratories (Gaithersburg, Maryland). An ECL Western detection kit was purchased from NEN Life Science Products (Boston, MA). [3H]cAMP and [gamma -32P]ATP were purchased from NEN. Collagenase type 4 was purchased from Worthington Biochemical (Lakewood, NY). AG 1-X8 resin was purchased from Bio-Rad Laboratories. Ecoscint H was purchased from National Diagnostics (Atlanta, GA). Snake venom, adenosine, cAMP, inosine, BSA, and all other chemicals were purchased from Sigma (St. Louis, MO). The PKA assay system was purchased from Life Technologies. Mouse monoclonal antibodies for PKA catalytic subunit (PKA cat) regulatory units Ialpha , IIalpha , and IIbeta were ordered from BD Transduction Laboratories (Lexington, KY).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The expression of the Q227L constitutively activated Galpha s was directed by use of the promoter for the PEPCK gene (Fig. 1A). The expression vector harboring Q227L Galpha s was first screened for expression in FTO-2B rat hepatoma cells, cells that enable induced expression of the PEPCK gene. FTO-2B clones stably transfected with the pPEPCK-Q227L Galpha s construct should display induction of the Q227L Galpha s in response to the positive regulator of the PEPCK gene, cAMP (Fig. 1B). Treatment of the clones with CPT-cAMP (25 µM) resulted in a robust expression of the transgene, as evidenced by RT-PCR amplification of the mRNA. The promoter was not found to be "leaky," i.e., the transgene mRNA was not detected in these clones in the absence of added CPT-cAMP. Expression of the Q227L Galpha s at the protein level in the FTO-2B clones induced with 25 µM CPT-cAMP was demonstrated by using immunoblotting with an antibody specific for Galpha s (Fig. 1C). Neither the wild-type FTO-2B cells nor the clones stably transfected with the pPEPCK-Q227L Galpha s plasmid but not treated with CPT-cAMP, in contrast, displayed increased expression of immunoreactive Galpha s. Quantification of the blots from several independent clones revealed a 40-50% increase in the total amount of Galpha s (endogenous Galpha s + expressed Q227L Galpha s), indicative of significant expression of the mutant Galpha s over that of wild-type Galpha s.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 1.   Expression of the pPEPCK Q227L Galpha s construct in FTO-2B rat hepatoma cells leads to cAMP-inducible expression of the Q227L Galpha s A: schematic of the pPEPCK-Q227L Galpha s vector. B: inducible expression of Q227L Galpha s in stably transfected FTO-2B cells: analysis by reverse transcription-polymerase chain reaction (RT-PCR) amplification of Q227L Galpha s. pPEPCK-Q227L Galpha s-transfected FTO-2B cells were treated with the cAMP analog 8-(4-chlorophenylthio)adenosine 3',5'-cyclic monophosphate (CPT-cAMP; 25 µM) for 72 h, and RT-PCR was performed on total RNA. DNA samples from nontransfected FTO-2B cells served as negative control, and PEPCK-Q227L Galpha s plasmid served as positive control. Amplification products were applied to electrophoresis on 1.5% agarose gels and made visible in ethidium bromide under ultraviolet irradiation. N, negative control; P, positive control; MK, 100-bp markers. C: inducible expression of Q227L Galpha s in transfected FTO-2B cells. pPEPCK-Q227L Galpha s-transfected FTO-2B cells were treated with CPT-cAMP (25 µM) for 4 days. Cells were harvested, and membrane proteins (50 µg protein/lane) were subjected to electrophoresis on a SDS-PAGE and then immunoblotting (IB). Resolved membrane proteins were incubated with a polyclonal rabbit Galpha s antibody (CM129) and a second goat anti-rabbit IgG coupled with horseradish peroxidase. Bands were visualized with enhanced chemiluminescence (ECL) methods and quantified with imaging densitometry. Transgenic mice expressing Q227L Galpha s (Q227L) or their nontransgenic wild-type controls (WT) were used. Data represent means ± SE from 4 experiments. A representative of blots is shown. L, lower-mobility "long form" of Galpha s; S, higher-mobility "short form." *P < 0.05 (paired t-test).

The linearized XhoI-NotI fragment (3.7 kb) was injected into preimplantation single-cell embryos to generate transgenic mice. Transgenic mice were identified at 4 wk of age by PCR amplification of tail DNA (Fig. 2A). Three founder lines were identified and propagated. The bulk of the studies were performed with mice that were 4 mo of age, unless otherwise noted. RT-PCR amplification was performed with primers common to all forms of Galpha s as well as with primers that would hybridize only with Q227L Galpha s DNA (Fig. 2B). Expression of the mRNA encoding the Q227L Galpha s was observed in the fat and liver target tissues, but not in kidney, of the transgenic but not the wild-type (nontransgenic littermates) mice. Examination at the level of protein expression in these transgenic mice revealed expression of increased immunoreactive Galpha s in tissues that are targeted by the PEPCK promoter, i.e., fat, liver, and skeletal muscle (Fig. 2C). The amount of mutant Galpha s expressed in vivo, equivalent to the differences in total immunoreactive Galpha s between the transgenic and the wild-type mice, was similar to that expressed in the stably transfected FTO-2B cells when challenged with cAMP (Fig. 1C). Tissues of the transgenic mice that are not targeted by the PEPCK promoter used in these studies, such as kidney, spleen, and brain (not shown), displayed no apparent increase in the amount of immunoreactive Galpha s (Fig. 2C). The nontargeted kidney and spleen tissues expressed the same amount of Galpha s in transgenic mice as in mice of the same age and sex as the transgenic counterparts (Fig. 2C) or nontransgenic littermates (not shown). We examined the expression of immunoreactive Galpha s in fat tissue of transgenic Q227L Galpha s mice and wild-type mice at 4 and 7 mo of age (Fig. 2D). The increased expression of immunoreactive Galpha s attributed to the expression of Q227L Galpha s was maintained up to 7 mo of age. The expression of Galpha i2 was also examined, because it has been shown that increased levels of cAMP provoke increased expression of Galpha i2 (5). Expression of Galpha i2 was found to be increased in fat tissue of the transgenic mice at both 4 and 7 mo of age (Fig. 2D). The expression of Galpha i2 in the liver, in contrast, was not found to be enhanced in the transgenic mice at 4 mo of age and only slightly increased in liver from 7-mo-old Q227L Galpha s mice compared with wild-type mice (Fig. 2E).


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 2.   Expression of the pPEPCK Q227L Galpha s construct in transgenic mice leads to inducible, tissue-specific expression of Q227L Galpha s and Galpha i2. A: mouse tail samples (~1 cm long) were collected at age of ~4 wk, and genomic DNAs were isolated and amplified by PCR. The PCR products were applied to electrophoresis on 1.5% agarose. Positive identification of 5 mice harboring the Q227L Galpha s transgene is observed (lanes 1-5). M, 100-bp markers; N, negative control with genomic DNA from C57B6 wild type mouse; P, positive control with pPEPCK-Q227L Galpha s plasmid as a template. B: RT-PCR amplification of mRNA encoding total Galpha s (endogenous + Q227L Galpha s) as well as mRNA of the Q227L Galpha s only. Samples from fat, liver, and kidney of 4-mo-old Q227L Galpha s transgenic (TG) mice and their WT counterparts were subjected to extraction of RNA. Total RNA was subjected to RT-PCR and amplified with primers that detect total Galpha s mRNA and primers unique to Q227L Galpha s mRNA. PCR products and detection were as in A. C: expression of Q227LGalpha s in tissues targeted and not targeted by the PEPCK gene promoter: analysis by immunoblotting with antibodies to Galpha s. Tissues were excised from 4-mo-old mice. Fat tissue (30 µg protein/lane), liver (100 µg protein/lane), and muscle (100 µg protein/lane), all targeted tissues for the PEPCK gene promoter, displayed increased expression of Galpha s, representing endogenous Galpha s and expressed Q227L Galpha s. Immunoblots of tissues, such as kidney (50 µg/lane) and spleen (50 µg/lane), not targeted for expression by the PEPCK promoter displayed equivalent expression of Galpha s in WT and TG mice. Target and nontarget tissues were taken from TG animals and WT littermates. Immune complexes were visualized with ECL methods and quantified with imaging densitometry. Data represent means ± SE from 4 experiments. A representative of blots is shown. *P <0.05 (paired t-test). D: Expression of Galpha s, Galpha i2, and Gbeta 2 in fat tissue obtained from Q227L mice and their WT counterparts. Tissues were excised from either the standard 4-mo-old mice or from 7-mo-old mice. Samples from fat were processed and expression of the G protein alpha -subunits was detected as in C. E: expression of Galpha i2 in liver tissue obtained from Q227L mice and their WT counterparts. Tissues were excised from the standard 4-mo-old mice or from 7-mo-old mice. Samples from liver were processed and expression of the G protein alpha -subunits was detected as in C.

The breeding and macroscopic phenotype of the Q227L Galpha s mice were found to be unremarkable, with growth curves for both male and female transgenic mice tracking identically with their nontransgenic counterparts (not shown). Necropsy data suggested some mixed inflammatory cell infiltrates in the liver and skeletal muscle but no routine significant lesions. Alterations in the expression of Galpha s, such as observed in Albright hereditary osteodystrophy and in hemizygous/heterozygous Galpha s knockout mice, have been shown to lead to changes in insulin action and glucose metabolism. Increased insulin sensitivity has been reported in such Galpha s knockout mice (25). We examined the glucose metabolism of the Q227L Galpha s mice. In glucose tolerance tests, the Q227L Galpha s mice demonstrated a markedly suppressed ability to rectify blood glucose levels in response to a bolus administration of glucose (Fig. 3). The Q227L Galpha s mice required an additional >2-3 h after bolus administration of glucose to achieve the blood glucose levels of their nontransgenic counterparts. Insulin sensitivity curves derived from studies with fasted Q227L Galpha s vs. control littermates performed over a range of insulin concentrations (0.75-6.0 IU/kg) were not significantly different (not shown).


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 3.   Expression of the pPEPCK Q227L Galpha s construct in transgenic mice leads to impaired glucose tolerance. Q227L mice and control WT littermates of the same age and sex were subjected to a glucose tolerance test. The 4-mo-old mice were administered an intraperitoneal (ip) bolus of glucose, and blood glucose was determined over the next 3 h. Results displayed are mean ± SE values for WT (n = 5) and Q227L (n = 8) mice.

Biochemical analysis of the impact of Q227L Galpha s expression on transgenic mice was performed with white fat cells isolated from the endometrial fat pads of transgenic and control mice. The levels of intracellular cAMP were found to be increased, but only by 25-30% (Fig. 4). In view of the level of expression of Q227L Galpha s and its constitutively active nature, we were surprised by the magnitude in the increase in basal cAMP levels of the fat cells from these mice. These relationships between the cAMP responses of the Q227L Galpha s mice vs. their nontransgenic littermates were the same in the absence (not shown) or presence (Fig. 4) of 0.1 mM RO20-1724, an inhibitor of cAMP-specific PDE activity. Furthermore, the cAMP response to stimulation with either a range of beta -adrenergic agonist (isoproterenol) or the plant diterpene forskolin was not significantly different although it was routinely greater in Q227L Galpha s compared with control mice. These data suggested that some adaptive mechanism(s) must be operating to nullify the output of the expression of the constitutively active Q227L Galpha s in vivo. The increased expression of the antagonistic heterotrimeric G protein Galpha i2 (Fig. 2, D and E) likely plays some role in dampening the signaling of Galpha s to adenylyl cyclase.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 4.   Expression of Q227L Galpha s in adipocytes of TG mice increases basal intracellular cAMP levels. Tissue was excised from 4-mo-old mice. Fat pads of control WT and TG mice were digested with collagenase, and cAMP accumulation was measured in the acutely prepared adipocytes. Isolated adipocytes were incubated in the absence or presence of isoproterenol (Iso; 0.01-10 µM) for 15 min at 37°C in buffer containing phosphodiesterase (PDE) inhibitor Ro-20-1724 (100 µM). For measurement of basal cAMP, cells were incubated in the absence or presence of Ro-20-1724. The relationships between the TG and WT samples were similar in both cases. Adipocytes were stimulated with forskolin (50 µM) as an indirect measure of total adenylyl cyclase activity. Data are means ± SE from at least 4 experiments, each assayed in triplicate. *P < 0.05 (paired t-test).

There is ample literature to demonstrate that elevating intracellular cAMP levels can provoke increases in PDEs that metabolize the cyclic nucleotide. We compared the bulk cAMP-specific PDE activity of fat cells from control mice with those of mice expressing Q227L Galpha s (Fig. 5). Total PDE activity increased ~15% in the fat cells from the Q227L Galpha s mice. Most of the increase was observed in the PDE activity that was sensitive to inhibition by the PDE inhibitor Ro-20-1724. Although PDE activity was increased in the fat cells expressing Q227L Galpha s, the increase in Ro-20-1724-sensitive PDE was modest and provided only a partial answer.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 5.   Expression of Q227L Galpha s in vivo leads to increased cAMP-specific PDE activity in adipose tissue. Fat pads excised from 4-mo-old Q227L mice and WT littermates were homogenized with a glass/glass homogenizer. The supernatant was collected by 2,000 g centrifugation for 10 min at 4°C and immediately assayed for PDE activity in the absence (total) or presence (Ro insensitive) of PDE inhibitor Ro-20-1724 (0.1 mM). Results are mean ± SE values from 4 separate experiments. Nine WT and eight Q227L animals were assayed, each in duplicate. *P < 0.05 (paired t-test).

The expression of a constitutively activated Galpha s would be expected to increase the activation of the cAMP-dependent protein kinase (PKA). Basal and total PKA activities were measured in adipocytes isolated acutely from mice expressing the Q227L Galpha s as well as from wild-type, nontransgenic littermates (Fig. 6A). Total PKA activities for adipocytes from Q227L Galpha s mice were not significantly different from those of adipocytes from wild-type controls. Remarkably, in contrast to the expected increased PKA activity, we observed a >50% decline in the amount of basal PKA activity in the Q227L Galpha s mouse adipocytes. These unexpected results were explored by immunoblotting with anti-PKA antibodies to ascertain the relative amounts of the PKA catalytic subunit (PKA cat) in adipocytes from wild-type and Q227L Galpha s mice (Fig. 6B). The amount of PKA cat, unlike the total PKA activity (Fig. 6A), was found to be equivalent for adipocytes from the wild-type and transgenic mice. In parallel, the relative amounts of the regulatory subunits of PKA were determined in adipocytes from both groups. The expression of RIalpha , RIIalpha , and RIIbeta subunits was studied via immunoblotting. Blots were prepared from whole cell extracts, subjected to SDS-PAGE, and then stained with subunit-specific antisera. Significant increases in the expression of all of the PKA regulatory subunits were observed (Fig. 6B). The increases for RIalpha and RIIalpha were the greatest, increasing in the adipocytes from transgenic mice by 70-80%. The expression of the highly abundant RIIbeta subunit was increased by >20% in fat tissue of the Q227L Galpha s mice. Analysis of the subcellular distribution of PKA catalytic and regulatory subunits revealed quantitative recovery in the postnuclear (2,000 g, 5 min) supernatants rather than in nuclear fractions obtained from whole homogenates of adipose tissue from wild-type as well as Q227L mice (Fig. 6C). Increased expression of RIalpha , RIIalpha , and RIIbeta was also detected in the liver of the Q227L Galpha s mice (data not shown).


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 6.   Expression of Q227L Galpha s in vivo leads to increased expression of the regulatory subunits of cAMP-dependent protein kinase (PKA) and an associated reduction in basal PKA activity in adipose tissue. A: total and basal PKA activities were assayed in postnuclear supernatants of fat tissue excised from 4-mo-old Q227L mice and WT littermates. PKA activity is reported in picomoles of [32P]phosphate transferred to the kemptide substrate per minute per milligram of protein. Basal activity was measured in the absence of added cAMP; total activity was measured in the presence of 10 µM cAMP. *P < 0.05 (paired t-test). B: immunoblotting of PKA subunits was performed with whole homogenates of fat tissues (postnuclear supernatant after 2,000 g; 10-100 µg protein) subjected to SDS-PAGE. The separated proteins were transferred to nitrocellulose membranes, and the blots were stained with mouse monoclonal antibodies for PKA catalytic (cat) and regulatory (R) subunits. The immune complexes were visualized with ECL methods and quantified with imaging densitometer. *P < 0.05 (paired t-test) for the difference between WT and Q227L mouse preparations (n = 4). C: analysis of the subcellular distribution of PKA catalytic and regulatory subunits in total homogenate (2,000 g, 5 min) postnuclear supernatants and the resultant nuclear fraction prepared from whole homogenates of fat tissues obtained from WT and Q227L mice. Samples were subjected to SDS-PAGE, immunoblotting, and staining with subunit-specific antibodies. Equivalent amounts of homogenate were subjected to no further processing (H) or centrifugation, yielding the postnuclear supernatant (S) and nuclear (N) fractions. The results presented are from a single experiment. D: analysis of RIIbeta subunit of PKA performed in the standard cocktail of protease inhibitors in the absence and presence of 0.2 mM benzamidine. Tissue was excised from the standard 4-mo-old control wild-type mice (WT4) or their transgenic counterparts (TG4). Tissue sampling was also obtained from 18-mo-old mice (TG18). Samples were otherwise prepared as in B. The immunoblots were intentionally overexposed to reveal any marked proteolytic degradation products that might differentiate WT from TG mice. Results shown are from a single representative experiment. E: quantitative immunoblotting of RIIbeta subunit of PKA. Samples were prepared as in B. Sampling loading was varied from 0.1 to 40 µg protein/lane. Immunoblots were subjected to image densitometry and quantified. All assays were performed with samples at loading concentration within the linear region of the plot. The results displayed are from a single experiment.

In fat and liver, analysis of PKA subunit by SDS-PAGE and immunoblotting did not reveal any gross alterations in the stability of RIIbeta subunits, RIalpha , and RIIalpha (not shown) prepared in the usual cocktail of protease inhibitors (Fig. 6D). The addition of 0.2 mM benzamidine to this cocktail had no dramatic effect on RIIbeta subunit recovery, although recoveries seemed slightly lower than greater in the presence of this protease inhibitor (Fig. 6D). Even though the immunoblots were intentionally overexposed, there was little evidence of altered proteolytic processing of the RIIbeta subunit of PKA in tissues prepared from transgenic compared with wild-type mice. Tissues excised from a set of older Q227L Galpha s transgenic mice (18 mo old) displayed the same expression pattern as observed in the 4-mo-old mice. The quantitative aspects of the immunoblotting of PKA subunits was tested and shown to be essentially linear within the range of protein loading (5-20 µg) used in these studies (Fig. 6E). The increased expression of PKA regulatory subunits, but a normal level of catalytic subunit, provides a likely explanation for the reduction in PKA activity in fat and suggests that chronic elevation of Galpha s activity and/or of intracellular cAMP may provoke several adaptive responses that act to dampen the cAMP signaling pathway.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

To achieve the creation of a chimeric mouse model, we employed a transgene in which the expression of Q227L Galpha s was regulated by the promoter for the PEPCK gene. The PEPCK promoter offers a number of advantages for this line of investigation (12). The PEPCK promoter is silent in utero, which ensured that the transgene would be carried by a viable pup. Although this design precludes expression until after birth, it seemed a valuable compromise. Germline alterations in the expression of Galpha s (i.e., -/- knockouts) to date have not yield viable pups (26). Secondly, the PEPCK promoter is not leaky, is relatively strong, and maintains a level of expression sustained throughout adulthood. We demonstrated that the expression of Q227L Galpha s was inducible in vitro in rat hepatoma cells and that the transgene was expressed in vivo in targeted organs. The tissue-selective expression of the PEPCK promoter was most desirable, i.e., we achieved the creation of a "chimeric" mouse in which Q227L Galpha s expression was confined to adipose tissue, liver, and skeletal muscle. As deduced from immunoblotting experiments, the expression of Q227L Galpha s achieved ~40% of that observed for the endogenous Galpha s.

Phenotypically, the Q227L Galpha s transgenic mice were quite normal on a gross level. The transgenic mice were fertile, they procreated, and they displayed gross body mass, organ weights, and growth curves that were indistinguishable from those of their nontransgenic littermates or mice of the same age and sex. Although expression of Q227L Galpha s was observed in liver, a tissue targeted by the PEPCK gene promoter, we observed no hepatomegaly. Hepatomegaly has been observed in some patients with MAS, who show expression of the constitutively active Galpha s in liver among other targeted tissues (18). We did observe, however, a delayed rectification of blood glucose after the administration of a bolus of glucose. The delay was pronounced and required an additional 2-3 h for the transgenic mice to rectify glucose levels to those of their littermates. Both Galpha s (25, 26) and Galpha i2 (13) have been shown to influence insulin action and glucose metabolism in vivo. Loss-of-function mutants lacking Galpha i2 display frank insulin resistance (13), whereas gain-of-function mutants of Galpha i2, such as the Q205L Galpha i2, yield an insulinomimetic state (1). The Galpha s-/- knockouts have proven lethal in mice, whereas the heterozygotes demonstrate increased insulin sensitivity (25). In the current studies the gain-of-function Q227L Galpha s mice display the opposite phenotype of the loss-of-function Galpha s-/+ heterozygotes, showing impaired glucose tolerance.

The modest increase in intracellular cAMP levels that accompanied expression of the gain-of-function, constitutively active Q227L Galpha s in vivo was unexpected. However, earlier studies provide some precedent for these paradoxical observations. Overexpression of wild-type Galpha s targeted to heart created mice with enhanced chronotropic and ionotropic responses to sympathetic stimulation, cardiomyopathy with age, and increased apoptosis (2, 3). Although expression of wild-type Galpha s in the heart was increased 2.8-fold, basal levels of adenylyl cyclase activity were unaffected (2). These observations support the premise that addition to the possible molar excess of Galpha s may have limited consequences for cAMP levels (16). The studies reported herein, however, involved targeted overexpression of a constitutively active mutant of Galpha s, not the wild-type form. The expression of a constitutively active form of Galpha s in adipocytes did result in elevated basal cAMP levels, but the increase was modest, apparently reflecting some adaptive response(s) provoked by the elevation of intracellular cAMP. The increases in Galpha i2 expression and cAMP-specific PDE observed in the Q227L Galpha s mice may partially explain the adaptive response observed in the adipocytes. These adaptive responses may not be universal. In rat vascular smooth muscle cells in culture treated with an adenovirus-directed vector harboring Q227L Galpha s, resting cAMP levels were found to increase 10-fold, although the expression of Q227L Galpha s was clearly more robust than that obtained with the PEPCK gene promoter used here (8). Our laboratory showed earlier (5) that increasing intracellular cAMP levels in various cells in culture provoked an increase in Galpha i2 mRNA and a threefold increase in Galpha i2. Here, we demonstrate a likely correlate in vivo that chronic increases in cAMP levels may increase Galpha i2 expression in both fat and liver. We examined a second Galpha s readout, activation of pp60Src nonreceptor tyrosine kinase (11), but found no Q227L Galpha s-induced change in the amount of Src or its phosphorylation (data not shown). Thus the cellular context and adaptive changes in PDE and in Galpha i2 may be important in defining the extent to which expression of Q227L Galpha s translates into comparable increases in resting cAMP, a primary readout for Galpha s.

The most exciting adaptive response observed involves the expression of PKA subunits. Studies in human neoplastic B-(Reh) cells in culture have reported increased expression of both the catalytic subunit and the RI regulatory subunit mRNA in response to elevated cAMP levels, although immunoreactive RIalpha and Calpha levels were observed to decline in response to an eightfold elevation of cAMP by forskolin stimulation (22). In Sertoli MSC-1 cells in culture, elevation of cAMP levels leads to an increase in the expression of RIIbeta only, not RIalpha , RIIalpha , Calpha , or Cbeta (7, 9). Here we made use of targeted expression of Q227L Galpha s in mice to address this issue in vivo. In adipocytes from Q227L Galpha s mice, expression of the catalytic subunit of PKA was unaffected. Expressions of RIalpha , RIIalpha , and RIIbeta , in contrast, were all increased in both fat and liver from Q227L Galpha s mice. This increased abundance of the regulatory subunits of PKA occurred with no apparent change in the amount of PKA cat, moderating PKA activity and constituting an important part of a possible adaptive response to increased cAMP levels. Taking into consideration the modest changes in cAMP that were noted in response to the expression of the Q227L Galpha s in vivo, we only can speculate that such adaptive changes, although related to expression of the transgene, are directly related to the change in intracellular cAMP. Indeed, if elevated cAMP levels were driving some of these adaptive changes, the adaptive changes may have already succeeded in attenuating elevated cAMP levels in this interesting mouse model. Levels of expression of PKA regulatory and catalytic subunits as well as PDE have not been analyzed in tissue samples from patients with MAS, but they may well provide a basis for some adaptive correction to the presence of a constitutively active Galpha s.


    ACKNOWLEDGEMENTS

This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-30111.


    FOOTNOTES

Address for reprint requests and other correspondence: C. C. Malbon, Pharmacology-HSC, SUNY/Stony Brook, Stony Brook, NY 11794-8651 (E-mail craig{at}pharm.som.sunysb.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

10.1152/ajpcell.00320.2001

Received 17 July 2001; accepted in final form 22 March 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1.   Chen, JF, Guo JH, Moxham CM, Wang HY, and Malbon CC. Conditional, tissue-specific expression of Q205L G alpha i2 in vivo mimics insulin action. J Mol Med 75: 283-289, 1997[Web of Science][Medline].

2.   Gaudin, C, Ishikawa Y, Wight DC, Mahdavi V, Nadal G, Wagner TE, Vatner DE, and Homcy CJ. Overexpression of Gs alpha protein in the hearts of transgenic mice. J Clin Invest 95: 1676-1683, 1995[Web of Science][Medline].

3.   Geng, YJ, Ishikawa Y, Vatner DE, Wagner TE, Bishop SP, Vatner SF, and Homcy CJ. Apoptosis of cardiac myocytes in Gsalpha transgenic mice. Circ Res 84: 34-42, 1999[Abstract/Free Full Text].

4.   Gordeladze, JO, Hovik KE, Merendino JJ, Hermouet S, Gutkind S, and Accili D. Effect of activating and inactivating mutations of Gs- and Gi2-alpha protein subunits on growth and differentiation of 3T3-L1 preadipocytes. J Cell Biochem 64: 242-257, 1997[Web of Science][Medline].

5.   Hadcock, JR, Ros M, Watkins DC, and Malbon CC. Cross-regulation between G-protein-mediated pathways. Stimulation of adenylyl cyclase increases expression of the inhibitory G-protein, Gi alpha 2. J Biol Chem 265: 14784-14790, 1990[Abstract/Free Full Text].

6.   Ham, J, Ivan M, Wynford-Thomas D, and Scanlon MF. GH3 cells expressing constitutively active Gs alpha (Q227L) show enhanced hormone secretion and proliferation. Mol Cell Endocrinol 127: 41-47, 1997[Web of Science][Medline].

7.   Hansson, V, Skalhegg BS, and Tasken K. Cyclic-AMP-dependent protein kinase (PKA) in testicular cells. Cell specific expression, differential regulation and targeting of subunits of PKA. J Steroid Biochem Mol Biol 73: 81-92, 2000[Medline].

8.   Holness, W, Santore TA, Brown GP, Fallon JT, Taubman MB, and Iyengar R. Expression of Q227L-Galpha(s) inhibits intimal vessel wall hyperplasia after balloon injury. Proc Natl Acad Sci USA 98: 1288-1293, 2001[Abstract/Free Full Text].

9.   Knutsen, HK, Reinton N, Tasken KA, Hansson V, and Eskild W. Regulation of protein kinase A subunits by cyclic adenosine 3',5'-monophosphate in a mouse Sertoli cell line (MSC-1): induction of RII beta messenger ribonucleic acid is independent of continuous protein synthesis. Biol Reprod 55: 5-10, 1996[Abstract].

10.   Levine, MA, Downs RW, Jr, Singer M, Marx SJ, Aurbach GD, and Spiegel AM. Deficient activity of guanine nucleotide regulatory protein in erythrocytes from patients with pseudohypoparathyroidism. Biochem Biophys Res Commun 94: 1319-1324, 1980[Web of Science][Medline].

11.   Morris, AJ, and Malbon CC. Physiological regulation of G protein-linked signaling. Physiol Rev 79: 1373-1430, 1999[Abstract/Free Full Text].

12.   Moxham, CM, Hod Y, and Malbon CC. Gi alpha 2 mediates the inhibitory regulation of adenylyl cyclase in vivo: analysis in transgenic mice with Gi alpha 2 suppressed by inducible antisense RNA. Dev Genet 14: 266-273, 1993[Web of Science][Medline].

13.   Moxham, CM, and Malbon CC. Insulin action impaired by deficiency of the G-protein subunit G ialpha2. Nature 379: 840-844, 1996[Medline].

14.   Mullaney, I, Carr IC, and Milligan G. Overexpression of G(s)alpha in NG108-15, neuroblastoma×glioma cells: effects on receptor regulation of the stimulatory adenylyl cyclase cascade. FEBS Lett 397: 325-330, 1996[Web of Science][Medline].

15.   Nemoz, G, Sette C, Hess M, Muca C, Vallar L, and Conti M. Activation of cyclic nucleotide phosphodiesterases in FRTL-5 thyroid cells expressing a constitutively active Gs alpha. Mol Endocrinol 9: 1279-1287, 1995[Abstract/Free Full Text].

16.   Ostrom, RS, Post SR, and Insel PA. Stoichiometry and compartmentation in G protein-coupled receptor signaling: implications for therapeutic interventions involving G(s). J Pharmacol Exp Ther 294: 407-412, 2000[Abstract/Free Full Text].

17.   Post, SR, Aguila-Buhain O, and Insel PA. A key role for protein kinase A in homologous desensitization of the beta 2-adrenergic receptor pathway in S49 lymphoma cells. J Biol Chem 271: 895-900, 1996[Abstract/Free Full Text].

18.   Shenker, A, Weinstein LS, Moran A, Pescovitz OH, Charest NJ, Boney CM, Van Wyk JJ, Merino MJ, Feuillan PP, and Spiegel AM. Severe endocrine and nonendocrine manifestations of the McCune-Albright syndrome associated with activating mutations of stimulatory G protein GS. J Pediatr 123: 509-518, 1993[Web of Science][Medline].

19.   Shenker, A, Weinstein LS, Sweet DE, and Spiegel AM. An activating Gs alpha mutation is present in fibrous dysplasia of bone in the McCune-Albright syndrome. J Clin Endocrinol Metab 79: 750-755, 1994[Abstract].

20.   Shih, M, and Malbon CC. Oligodeoxynucleotides antisense to mRNA encoding protein kinase A, protein kinase C, and beta-adrenergic receptor kinase reveal distinctive cell-type-specific roles in agonist-induced desensitization. Proc Natl Acad Sci USA 91: 12193-12197, 1994[Abstract/Free Full Text].

21.   Spiegel, AM. G protein defects in signal transduction. Horm Res 53, Suppl 3: 17-22, 2000.

22.   Tasken, K, Andersson KB, Skalhegg BS, Tasken KA, Hansson V, Jahnsen T, and Blomhoff HK. Reciprocal regulation of mRNA and protein for subunits of cAMP-dependent protein kinase (RI alpha and C alpha) by cAMP in a neoplastic B cell line (Reh). J Biol Chem 268: 23483-23489, 1993[Abstract/Free Full Text].

23.   Weinstein, LS, Shenker A, Gejman PV, Merino MJ, Friedman E, and Spiegel AM. Activating mutations of the stimulatory G protein in the McCune- Albright syndrome. N Engl J Med 325: 1688-1695, 1991[Abstract].

24.   Yan, L, Herrmann V, Hofer JK, and Insel PA. beta -Adrenergic receptor/cAMP-mediated signaling and apoptosis of S49 lymphoma cells. Am J Physiol Cell Physiol 279: C1665-C1674, 2000[Abstract/Free Full Text].

25.   Yu, S, Castle A, Chen M, Lee R, Takeda K, and Weinstein LS. Increased insulin sensitivity in gsalpha knockout mice. J Biol Chem 276: 19994-19998, 2001[Abstract/Free Full Text].

26.   Yu, S, Yu D, Lee E, Eckhaus M, Lee R, Corria Z, Accili D, Westphal H, and Weinstein LS. Variable and tissue-specific hormone resistance in heterotrimeric Gs protein alpha-subunit (Gsalpha) knockout mice is due to tissue-specific imprinting of the Gsalpha gene. Proc Natl Acad Sci USA 95: 8715-8720, 1998[Abstract/Free Full Text].

27.   Zachary, I, Masters SB, and Bourne HR. Increased mitogenic responsiveness of Swiss 3T3 cells expressing constitutively active Gs alpha. Biochem Biophys Res Commun 168: 1184-1193, 1990[Web of Science][Medline].


Am J Physiol Cell Physiol 283(2):C386-C395
0363-6143/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
Physiol. Rev.Home page
N. Wettschureck and S. Offermanns
Mammalian G Proteins and Their Cell Type Specific Functions
Physiol Rev, October 1, 2005; 85(4): 1159 - 1204.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. F. Steinberg
Focus on "Targeted expression of activated Q227L Galpha s in vivo"
Am J Physiol Cell Physiol, August 1, 2002; 283(2): C383 - C385.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huang, X.-P.
Right arrow Articles by Malbon, C. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huang, X.-P.
Right arrow Articles by Malbon, C. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online