|
|
||||||||
s in vivo
1 Department of Molecular Pharmacology and 2 Department of Physiology and Biophysics, Diabetes and Metabolic Diseases Research Program, University Medical Center, State University of New York at Stony Brook, Stony Brook, New York 11794
| |
ABSTRACT |
|---|
|
|
|---|
We report
the creation of transgenic mice with an inducible, tissue-targeted
expression of a constitutively active mutant form (Q227L) of
G
s. Mice expressing activated G
s in fat
tissue, liver, and skeletal muscle displayed normal body mass and
blunted glucose metabolism. cAMP accumulation in adipose tissue was
increased in the basal state, but far less than would be expected.
Marked adaptation to elevated cAMP levels occurred, leading to an
increase in total cAMP-specific phosphodiesterase activity, a 50%
decline in cAMP-dependent protein kinase (protein kinase A) activity, and an increased expression of G
i2. The reduction in
kinase activity coincided with >50% increase in the expression of
RI
and RII
regulatory subunits of protein kinase A, with no
change in the amount of catalytic subunit. These data demonstrate the
existence of adaptive responses of protein kinase A, phosphodiesterase, and G
i2 in tissues expressing constitutively active
G
s that may act to rectify the impact of increased cAMP accumulation.
constitutively activated G
s; protein kinase A; regulatory subunits
| |
INTRODUCTION |
|---|
|
|
|---|
A MOST INTRIGUING
EXAMPLE of gain-of-function mutations in G protein
-subunits
causing human disease is the case of McCune-Albright syndrome (MAS)
(11). MAS is a sporadic disease typified by
precocious puberty, monoostotic or polyostotic fibrous dysplasia,
café au lait pigmentation, and several endocrinopathies
(23). Hyperthyroidism, Cushing syndrome,
hyperparathyroidism, acromegaly, and hepatomegaly are frequently
observed in patients with this syndrome. The hyperactivity of the
endocrine tissues appears to result from activating mutations (e.g.,
Arg201) in G
s that generate gain of function
(23). The expression of activated G
s is not
uniform in MAS but rather is a complex pattern reflecting the
occurrence of a mutation in the multicell developing embryo. This
feature of the disease generates a mosaic of expression that reflects
the fate map of the cell in which the mutation arises. Patients with
MAS are true chimera, the severity of the disease manifested largely by
the spectrum of organs and tissues in which activated G
s
occurs. Recent studies suggest that a severe form of the syndrome may
be the cause of early death in childhood, especially when the activated
G protein is expressed in tissues such as the liver, heart, and
gastrointestinal tract, nonclassic targets of MAS (18,
19).
The impact of gain-of-function mutations of G
s on
signaling has been examined in a variety of cell types in culture,
including neuroblastoma × glioma hybrid NG108-15 cells
(14), mouse NIH 3T3-L1 (4), Swiss 3T3 cells
(27), rat pituitary GH3 cells (6), and FRTL-5
rat thyroid cells (15). G
s is known to
regulate adenylyl cyclase activity, Ca2+ channels, and
apoptosis (17, 24). Study of the stoichiometry of
G
s protein-coupled receptors, G
s, and
adenylyl cyclase suggests that G
s is in molar excess of
receptor and effector (16). Spatial compartmentation and
oligomerization of elements in the receptor > G
s > effector cascade may well negate the simple
stoichiometry (16), because loss of ~50% of the
G
s complement in Albright hereditary osteodystrophy
leads to reduced signaling to adenylyl cyclase in humans (10,
21). These data suggest that probing the functions of
G
s in vivo may best be approached by targeted expression
of a constitutively activated form of G
s rather than wild-type G
s. Expression of wild-type G
s
may contribute to endogenous levels of this G protein that may already
be in excess of G protein-coupled receptors, whereas expression of
Q227L G
s leads to a situation of chronic activation of
G
s-regulated effectors. Overexpression of wild-type
G
s in hearts of transgenic mice has been accomplished with the rat
-myosin heavy chain promoter (2). mRNA
levels for G
s in the transgenic mice increased nearly
40-fold and G
s expression in the heart increased less
than threefold, whereas there was little evidence by histopathological
evaluation of the myocardium for lesions in the young adult (4-7
mo old) animals (2). These transgenic mice do develop
increased cardiac contractility in response to
-adrenergic
stimulation and with aging cardiomyopathy (3).
Targeted expression of constitutively activated mutant forms of
G
s in transgenic mice may provide a useful model
for study of G
s function in specific tissues. The
physiological mechanism(s) by which changes in G protein subunit
expression are regulated and the extent to which cells adapt to changes
in signaling in response to mutations in G protein
-subunits remain
to be established and will be essential to our understanding of G
protein signaling in human diseases. Creation of mice with
tissue-specific expression of an activated G
s may
provide insights into the adaptive mechanisms that arise to ameliorate
the increase in cAMP levels.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Construction of pPEPCK-Q227L G
s plasmid.
The cDNA encoding the Q227L mutant of G
s was engineered
into convenient restriction sites of the pPEPCKQ205L G
i2
vector as previously reported (1). The coding sequence of
a constitutively activated G
s (Q227L) and
3'-untranslated region (212 bp) was employed to replace the
phosphoenolpyruvate carboxykinase (PEPCK) coding sequence, remaining
under the control of PEPCK promoter.
Transfection and screening of FTO-2B cells. The calcium phosphate precipitation method was used in transfection of FTO-2B cells, which are normally grown in DMEM containing 5% FBS at 37°C under humidified 95% air-5% CO2 (12). The procedures used in the transfection, selection, and induction of the stably transfected FTO-2B clones with 8-(4-chlorophenylthio)adenosine 3',5'-cyclic monophosphate (CPT-cAMP) were described previously (1).
Creation of transgenic mice with conditional, tissue-specific
expression of Q227L G
s.
The Q227L G
s and PEPCK promoter (3.7 kb) were excised by
XhoI and NotI from the pPEPCKQ227L
G
s construct and isolated by low-melting agarose gel
electrophoresis. The constructs were injected into preimplantation
embryos, which were transplanted into pseudo-pregnant mice (C57Black6)
in the University Transgenic Mouse Facility at the State University of
New York at Stony Brook. Mouse tail DNAs were isolated with a DNeasy
Tissue Kit according to the manufacturer's protocol and used for PCR
amplification. The primers used were GACATCATCCAGCGCATGCATC (PT1) and
CATCGGGATTACATCTGGCTGA (PT2), which on amplification yield a 574-bp
fragment specific for the PEPCK-Q227L G
s construct. The
amplification products were applied to electrophoresis on 1.5% agarose
gels and made visible in ethidium bromide under ultraviolet
irradiation. Transgenic mice were mated with wild-type C57Black6 mice
purchased from Taconic (Germantown, NY) for five generations. Glucose
tolerance tests and insulin sensitivity tests were performed as
previously described (13). Wild-type control mice were
littermates of the transgenic animals. The target age for analysis was
4 wk for identification of the transgenic mice and 4 mo for all other
analyses. Only in the case where the intent was to sample mice at older
ages for a phenotype were either 7- or 18-mo-old animals used.
Reverse transcription-polymerase chain reaction.
Total mRNA was isolated and purified from cultured cells or tissues
with RNA STAT-60 according to the manufacturer's instruction. Reverse
transcription (RT) was conducted with 1 µg of total RNA in a final
volume of 20 µl at 42°C for 1 h with the Promega RT system.
Aliquots (4 µl) of RT product were applied to each polymerase chain
reaction (PCR) and 30 cycles of amplification. For screening of
transfected FTO-2B cells, primers PT1 and PT2 were used in the PCR
amplifications. To probe tissue-specific expression of both the
endogenous G
s mRNA and the mRNA of the transgene,
additional primers were prepared. The 5' and 3' primers specific for
endogenous G
s and Q227L G
s were 5'-TGG
GTG CTG GAG AG TCTG G-3' (S1m) and 5'-AGG AAG TAC TGG GCA CAG T5'
(S2m), respectively. A unique 5' primer, 5'-AGG GCT AGA CTC GAC ATG GGC
T3' (S3m), specific only for the PEPCK-Q227L G
s
transgene, was used to differentiate mRNAs of the mutant and wild-type
forms. The PCR using primers S1m and S2m produces a 400-bp product from
endogenous G
s and Q227L G
s, whereas the
PCR using primers S3m and S2m produces a 551-bp product from
PEPCK-Q227L G
s transgene only.
Isolation of adipocytes. Fat tissues were collected, minced, and digested with collagenase type 4 (1 mg/ml) in Krebs-Ringer Buffer [KRB; in mM: 120 NaCl, 4.8 KCl, 2.6 CaCl2, 1.2 MgSO4, 25 NaHCO3, 1 sodium phosphate buffer (pH 7.4), 2.5 D-glucose, and 5 HEPES] containing 3% bovine serum albumin (BSA) at 37°C on a shaker (100-150 rpm) for 30 min. The adipocytes were washed three times with KRB and transferred into KRB containing 3% BSA, 0.1 mM Ro-20-1724 (unless otherwise noted), and adenosine deaminase for cAMP production assays.
Adipocyte cAMP production assays.
Assays were conducted in 1.5-ml test tubes in triplicate sets. The
-adrenergic agonist isoproterenol and/or the diterpene forskolin
were prepared in 50 µl of ice-cold KRB buffer containing Ro-20-1724
and adenosine deaminase; this aliquot was added to the incubation tubes
first. The KRB buffer minus cells served as basal control. The reaction
was started by addition of adipocytes (10,000-50,000/tube) and
incubated at 37°C for 15 min on a shaker (300 rpm). To stop the
reaction, the tubes were returned to an ice bath and 300 µl of
prechilled (
20°C) ethanol was added to each well. The assay of the
cAMP was as described elsewhere (20).
Protein kinase A assays.
The assay is based on the phosphorylation of a synthetic peptide
substract (kemptide: Leu-Arg-Arg-Ala-Ser-Leu-Gly) by cAMP-dependent protein kinase (protein kinase A; PKA) in the presence of
[
-32P]ATP. The enzyme activity of PKA was determined
with a PKA assay kit in triplicate in a final volume of 40 µl
according to the manufacturer's protocol (20). The
reaction contained 50 mM Tris (pH 7.5), 100 mM MgCl2, and
100 µM ATP supplemented with [
-32P]ATP, 0.25 mg/ml
BSA, and 50 µM PKA substrate peptide kemptide. "Basal" PKA
activities were determined in the absence of the PKA activator, cAMP,
and defined as the PKA activity sensitive to inhibition by PKA
inhibitor (PKI). PKI, a 17-amino acid peptide derived from the PKI
sequence (1 µM final), was included to determine PKA-specific protein
kinase activity. "Total" PKA activities were determined in the
presence of 10 µM cAMP.
Phosphodiesterase activity assays. Fat tissues were collected and homogenized with a glass homogenizer in TMK buffer (in mM: 40 Tris, 5 MgCl2, and 30 KCl, pH 8.0) containing proteinase inhibitors [5 µg/ml aprotinin, 5 µg/ml leupeptin, and 200 µM phenylmethylsulfonyl fluoride (PMSF)] as described. After 2,000 g centrifugation, supernatants were collected for total phosphodiesterase (PDE) activity measurement. Briefly, PDE activity was determined in 1.5-ml microtubes (duplicate sets) with a final volume of 100 µl of TMK buffer containing cold cAMP (5.0 µM) and 0.05 µCi of [3H]cAMP as substrate. The reaction was initiated by addition of 50 µg of proteins and incubated in a shaker (300 rpm) at 37°C for 10 min. At the end of the 10-min incubation, tubes were placed in a boiling water bath for 3 min. Snake venom (100 µl of 1 mg/ml) was then added to convert 5'-AMP to adenosine by a 10-min incubation at 37°C in the shaker. Adenosine was then separated by addition of 1 ml of AG1-X8 resin (chloride form) to each tube. The tubes were then centrifuged for 15 min at 600 rpm. An aliquot of 500 µl of supernatant was counted for radioactivity in 3 ml of Ecoscint H. TMK buffer served as blanks. Ro-20-1724 (100 µM) was added to inhibit PDE4 activity.
Immunoblot analysis.
FTO-2B cells were collected in PBS-EDTA buffer and suspended in
ice-cold HME buffer (in mM: 20 HEPES pH 7.4, 2 MgCl2, and 1 EDTA) containing proteinase inhibitors (5 µg/ml aprotinin, 5 µg/ml
leupeptin, and 200 µM PMSF). The suspension was sonicated for 10 s at a setting of 3 with a 550 Sonic Dismembrator from Fisher
Scientific (Pittsburgh, PA). Animal tissues were collected and
homogenized with a glass homogenizer in the presence of ice-cold HME
buffer containing proteinase inhibitors. Intact cells and nuclei were
then removed by low-speed centrifugation (2,000 g) at 4°C
for 5 min, and supernatant was recovered. Membrane proteins were
collected by high-speed centrifugation (16,000 g) at 4°C for 30 min. Protein pellets were resuspended in cold HME buffer containing proteinase inhibitors, and concentration was determined by a
Lowry assay. For detection of G
s and G
i2
subunits, membrane proteins (30-100 µg) were subjected to
SDS-polyacrylamide gel electrophoresis (PAGE). For PKA catalytic and
regulatory subunits, whole homogenate (supernatant after 2,000 g; 10-100 µg protein) was subjected to SDS-PAGE. The
separated proteins were transferred to nitrocellulose membranes, and
the blots were stained with a rabbit polyclonal antibody specific for
G
s subunit (CM129), mouse monoclonal antibodies for PKA
catalytic and regulatory subunits, and then the second antibody
peroxidase-labeled goat anti-rabbit or goat anti-mouse IgG. The immune
complexes were visualized with enhanced chemiluminescence (ECL) methods
and quantified with a GS-700 Imaging Densitometer (Bio-Rad
Laboratories, Hercules, CA).
Materials.
The DNeasy Tissue Kit for mouse tail DNA isolation was purchased from
Qiagen (Valencia, CA). Reagents for PCR reactions were obtained from
Life Technologies (Gaithersburg, MD). All PCR primers were synthesized
by Operon Technologies (Alameda, CA). A cAMP-specific PDE inhibitor,
Ro-20-1724, was purchased from Calbiochem (San Diego, CA). A stable
analog of cAMP, CPT-cAMP, was purchased from Boehringer-Mannheim
(Indianapolis, IN). A total RNA/mRNA isolation reagent, RNA STAT-60,
was purchased from Tel-Test (Friendswood, TX). Horseradish
peroxidase-labeled goat anti-rabbit IgG was purchased from Kirkegaard
and Perry Laboratories (Gaithersburg, Maryland). An ECL Western
detection kit was purchased from NEN Life Science Products (Boston,
MA). [3H]cAMP and [
-32P]ATP were
purchased from NEN. Collagenase type 4 was purchased from Worthington
Biochemical (Lakewood, NY). AG 1-X8 resin was purchased from Bio-Rad
Laboratories. Ecoscint H was purchased from National Diagnostics
(Atlanta, GA). Snake venom, adenosine, cAMP, inosine, BSA, and all
other chemicals were purchased from Sigma (St. Louis, MO). The PKA
assay system was purchased from Life Technologies. Mouse monoclonal
antibodies for PKA catalytic subunit (PKA cat) regulatory units I
,
II
, and II
were ordered from BD Transduction Laboratories
(Lexington, KY).
| |
RESULTS |
|---|
|
|
|---|
The expression of the Q227L constitutively activated
G
s was directed by use of the promoter for the PEPCK
gene (Fig.
1A). The
expression vector harboring Q227L G
s was first screened
for expression in FTO-2B rat hepatoma cells, cells that enable induced expression of the PEPCK gene. FTO-2B clones stably transfected with the
pPEPCK-Q227L G
s construct should display induction of the Q227L G
s in response to the positive regulator of
the PEPCK gene, cAMP (Fig. 1B). Treatment of the clones with
CPT-cAMP (25 µM) resulted in a robust expression of the transgene, as
evidenced by RT-PCR amplification of the mRNA. The promoter was not
found to be "leaky," i.e., the transgene mRNA was not detected in
these clones in the absence of added CPT-cAMP. Expression of the Q227L G
s at the protein level in the FTO-2B clones induced
with 25 µM CPT-cAMP was demonstrated by using immunoblotting with an
antibody specific for G
s (Fig. 1C). Neither
the wild-type FTO-2B cells nor the clones stably transfected with the
pPEPCK-Q227L G
s plasmid but not treated with CPT-cAMP,
in contrast, displayed increased expression of immunoreactive
G
s. Quantification of the blots from several independent
clones revealed a 40-50% increase in the total amount of
G
s (endogenous G
s + expressed Q227L
G
s), indicative of significant expression of the mutant
G
s over that of wild-type G
s.
|
The linearized XhoI-NotI fragment (3.7 kb) was
injected into preimplantation single-cell embryos to generate
transgenic mice. Transgenic mice were identified at 4 wk of age by PCR
amplification of tail DNA (Fig.
2A). Three founder lines were
identified and propagated. The bulk of the studies were performed with
mice that were 4 mo of age, unless otherwise noted. RT-PCR
amplification was performed with primers common to all forms of
G
s as well as with primers that would hybridize only
with Q227L G
s DNA (Fig. 2B). Expression of
the mRNA encoding the Q227L G
s was observed in the fat
and liver target tissues, but not in kidney, of the transgenic but not
the wild-type (nontransgenic littermates) mice. Examination at the
level of protein expression in these transgenic mice revealed
expression of increased immunoreactive G
s in tissues that are targeted by the PEPCK promoter, i.e., fat, liver, and skeletal
muscle (Fig. 2C). The amount of mutant G
s
expressed in vivo, equivalent to the differences in total
immunoreactive G
s between the transgenic and the
wild-type mice, was similar to that expressed in the stably transfected
FTO-2B cells when challenged with cAMP (Fig. 1C). Tissues of
the transgenic mice that are not targeted by the PEPCK promoter used in
these studies, such as kidney, spleen, and brain (not shown), displayed
no apparent increase in the amount of immunoreactive G
s
(Fig. 2C). The nontargeted kidney and spleen tissues
expressed the same amount of G
s in transgenic mice as in
mice of the same age and sex as the transgenic counterparts (Fig.
2C) or nontransgenic littermates (not shown). We examined
the expression of immunoreactive G
s in fat tissue of
transgenic Q227L G
s mice and wild-type mice at 4 and 7 mo of age (Fig. 2D). The increased expression of
immunoreactive G
s attributed to the expression of Q227L
G
s was maintained up to 7 mo of age. The expression of
G
i2 was also examined, because it has been shown that
increased levels of cAMP provoke increased expression of
G
i2 (5). Expression of G
i2
was found to be increased in fat tissue of the transgenic mice at both
4 and 7 mo of age (Fig. 2D). The expression of
G
i2 in the liver, in contrast, was not found to be
enhanced in the transgenic mice at 4 mo of age and only slightly
increased in liver from 7-mo-old Q227L G
s mice compared
with wild-type mice (Fig. 2E).
|
The breeding and macroscopic phenotype of the Q227L G
s
mice were found to be unremarkable, with growth curves for both male and female transgenic mice tracking identically with their
nontransgenic counterparts (not shown). Necropsy data suggested some
mixed inflammatory cell infiltrates in the liver and skeletal muscle
but no routine significant lesions. Alterations in the expression of
G
s, such as observed in Albright hereditary
osteodystrophy and in hemizygous/heterozygous G
s
knockout mice, have been shown to lead to changes in insulin action and
glucose metabolism. Increased insulin sensitivity has been reported in
such G
s knockout mice (25). We examined the glucose metabolism of the Q227L G
s mice. In glucose
tolerance tests, the Q227L G
s mice demonstrated a
markedly suppressed ability to rectify blood glucose levels in response
to a bolus administration of glucose (Fig.
3). The Q227L G
s mice
required an additional >2-3 h after bolus administration of
glucose to achieve the blood glucose levels of their nontransgenic
counterparts. Insulin sensitivity curves derived from studies with
fasted Q227L G
s vs. control littermates performed over a
range of insulin concentrations (0.75-6.0 IU/kg) were not
significantly different (not shown).
|
Biochemical analysis of the impact of Q227L G
s
expression on transgenic mice was performed with white fat cells
isolated from the endometrial fat pads of transgenic and control mice. The levels of intracellular cAMP were found to be increased, but only
by 25-30% (Fig. 4). In view of the
level of expression of Q227L G
s and its constitutively
active nature, we were surprised by the magnitude in the increase in
basal cAMP levels of the fat cells from these mice. These relationships
between the cAMP responses of the Q227L G
s mice vs.
their nontransgenic littermates were the same in the absence (not
shown) or presence (Fig. 4) of 0.1 mM RO20-1724, an inhibitor of
cAMP-specific PDE activity. Furthermore, the cAMP response to
stimulation with either a range of
-adrenergic agonist
(isoproterenol) or the plant diterpene forskolin was not significantly
different although it was routinely greater in Q227L G
s
compared with control mice. These data suggested that some adaptive
mechanism(s) must be operating to nullify the output of the expression
of the constitutively active Q227L G
s in vivo. The
increased expression of the antagonistic heterotrimeric G protein
G
i2 (Fig. 2, D and E) likely plays
some role in dampening the signaling of G
s to adenylyl
cyclase.
|
There is ample literature to demonstrate that elevating intracellular
cAMP levels can provoke increases in PDEs that metabolize the cyclic
nucleotide. We compared the bulk cAMP-specific PDE activity of fat
cells from control mice with those of mice expressing Q227L
G
s (Fig. 5). Total PDE
activity increased ~15% in the fat cells from the Q227L
G
s mice. Most of the increase was observed in the PDE
activity that was sensitive to inhibition by the PDE inhibitor
Ro-20-1724. Although PDE activity was increased in the fat cells
expressing Q227L G
s, the increase in
Ro-20-1724-sensitive PDE was modest and provided only a partial answer.
|
The expression of a constitutively activated G
s would be
expected to increase the activation of the cAMP-dependent protein kinase (PKA). Basal and total PKA activities were measured in adipocytes isolated acutely from mice expressing the Q227L
G
s as well as from wild-type, nontransgenic littermates
(Fig. 6A). Total PKA activities for adipocytes from Q227L G
s mice
were not significantly different from those of adipocytes from
wild-type controls. Remarkably, in contrast to the expected increased
PKA activity, we observed a >50% decline in the amount of basal PKA activity in the Q227L G
s mouse adipocytes. These
unexpected results were explored by immunoblotting with anti-PKA
antibodies to ascertain the relative amounts of the PKA catalytic
subunit (PKA cat) in adipocytes from wild-type and Q227L
G
s mice (Fig. 6B). The amount of PKA cat,
unlike the total PKA activity (Fig. 6A), was found to be
equivalent for adipocytes from the wild-type and transgenic mice. In
parallel, the relative amounts of the regulatory subunits of PKA were
determined in adipocytes from both groups. The expression of RI
,
RII
, and RII
subunits was studied via immunoblotting. Blots were
prepared from whole cell extracts, subjected to SDS-PAGE, and then
stained with subunit-specific antisera. Significant increases in the
expression of all of the PKA regulatory subunits were observed (Fig.
6B). The increases for RI
and RII
were the greatest,
increasing in the adipocytes from transgenic mice by 70-80%. The
expression of the highly abundant RII
subunit was increased by
>20% in fat tissue of the Q227L G
s mice. Analysis of
the subcellular distribution of PKA catalytic and regulatory subunits
revealed quantitative recovery in the postnuclear (2,000 g,
5 min) supernatants rather than in nuclear fractions obtained from
whole homogenates of adipose tissue from wild-type as well as Q227L
mice (Fig. 6C). Increased expression of RI
, RII
, and
RII
was also detected in the liver of the Q227L G
s
mice (data not shown).
|
In fat and liver, analysis of PKA subunit by SDS-PAGE and
immunoblotting did not reveal any gross alterations in the stability of
RII
subunits, RI
, and RII
(not shown) prepared in the usual cocktail of protease inhibitors (Fig. 6D). The addition of
0.2 mM benzamidine to this cocktail had no dramatic effect on RII
subunit recovery, although recoveries seemed slightly lower than greater in the presence of this protease inhibitor (Fig.
6D). Even though the immunoblots were intentionally
overexposed, there was little evidence of altered proteolytic
processing of the RII
subunit of PKA in tissues prepared from
transgenic compared with wild-type mice. Tissues excised from a set of
older Q227L G
s transgenic mice (18 mo old) displayed the
same expression pattern as observed in the 4-mo-old mice. The
quantitative aspects of the immunoblotting of PKA subunits was tested
and shown to be essentially linear within the range of protein loading
(5-20 µg) used in these studies (Fig. 6E). The
increased expression of PKA regulatory subunits, but a normal level of
catalytic subunit, provides a likely explanation for the reduction in
PKA activity in fat and suggests that chronic elevation of
G
s activity and/or of intracellular cAMP may provoke
several adaptive responses that act to dampen the cAMP signaling pathway.
| |
DISCUSSION |
|---|
|
|
|---|
To achieve the creation of a chimeric mouse model, we employed a
transgene in which the expression of Q227L G
s was
regulated by the promoter for the PEPCK gene. The PEPCK promoter offers a number of advantages for this line of investigation
(12). The PEPCK promoter is silent in utero, which ensured
that the transgene would be carried by a viable pup. Although this
design precludes expression until after birth, it seemed a valuable
compromise. Germline alterations in the expression of G
s
(i.e.,
/
knockouts) to date have not yield
viable pups (26). Secondly, the PEPCK promoter is not
leaky, is relatively strong, and maintains a level of expression
sustained throughout adulthood. We demonstrated that the expression of
Q227L G
s was inducible in vitro in rat hepatoma cells
and that the transgene was expressed in vivo in targeted organs. The
tissue-selective expression of the PEPCK promoter was most desirable,
i.e., we achieved the creation of a "chimeric" mouse in which Q227L
G
s expression was confined to adipose tissue, liver, and
skeletal muscle. As deduced from immunoblotting experiments, the
expression of Q227L G
s achieved ~40% of that observed
for the endogenous G
s.
Phenotypically, the Q227L G
s transgenic mice were quite
normal on a gross level. The transgenic mice were fertile, they
procreated, and they displayed gross body mass, organ weights, and
growth curves that were indistinguishable from those of their
nontransgenic littermates or mice of the same age and sex. Although
expression of Q227L G
s was observed in liver, a tissue
targeted by the PEPCK gene promoter, we observed no hepatomegaly.
Hepatomegaly has been observed in some patients with MAS, who show
expression of the constitutively active G
s in liver
among other targeted tissues (18). We did observe,
however, a delayed rectification of blood glucose after the
administration of a bolus of glucose. The delay was pronounced and
required an additional 2-3 h for the transgenic mice to rectify
glucose levels to those of their littermates. Both G
s
(25, 26) and G
i2 (13) have
been shown to influence insulin action and glucose metabolism in vivo.
Loss-of-function mutants lacking G
i2 display frank
insulin resistance (13), whereas gain-of-function mutants
of G
i2, such as the Q205L G
i2, yield an
insulinomimetic state (1). The
G
s
/
knockouts have proven
lethal in mice, whereas the heterozygotes demonstrate increased insulin
sensitivity (25). In the current studies the
gain-of-function Q227L G
s mice display the opposite phenotype of the loss-of-function
G
s
/+ heterozygotes, showing
impaired glucose tolerance.
The modest increase in intracellular cAMP levels that accompanied
expression of the gain-of-function, constitutively active Q227L
G
s in vivo was unexpected. However, earlier studies
provide some precedent for these paradoxical observations.
Overexpression of wild-type G
s targeted to heart created
mice with enhanced chronotropic and ionotropic responses to sympathetic
stimulation, cardiomyopathy with age, and increased apoptosis
(2, 3). Although expression of wild-type G
s
in the heart was increased 2.8-fold, basal levels of adenylyl cyclase
activity were unaffected (2). These observations support
the premise that addition to the possible molar excess of
G
s may have limited consequences for cAMP levels
(16). The studies reported herein, however, involved
targeted overexpression of a constitutively active mutant of
G
s, not the wild-type form. The expression of a
constitutively active form of G
s in adipocytes did
result in elevated basal cAMP levels, but the increase was modest,
apparently reflecting some adaptive response(s) provoked by the
elevation of intracellular cAMP. The increases in G
i2
expression and cAMP-specific PDE observed in the Q227L
G
s mice may partially explain the adaptive response observed in the adipocytes. These adaptive responses may not be universal. In rat vascular smooth muscle cells in culture treated with
an adenovirus-directed vector harboring Q227L G
s,
resting cAMP levels were found to increase 10-fold, although the
expression of Q227L G
s was clearly more robust than that
obtained with the PEPCK gene promoter used here (8). Our
laboratory showed earlier (5) that increasing
intracellular cAMP levels in various cells in culture provoked an
increase in G
i2 mRNA and a threefold increase in
G
i2. Here, we demonstrate a likely correlate in vivo
that chronic increases in cAMP levels may increase G
i2
expression in both fat and liver. We examined a second
G
s readout, activation of pp60Src nonreceptor tyrosine
kinase (11), but found no Q227L G
s-induced
change in the amount of Src or its phosphorylation (data not shown).
Thus the cellular context and adaptive changes in PDE and in
G
i2 may be important in defining the extent to which
expression of Q227L G
s translates into comparable
increases in resting cAMP, a primary readout for G
s.
The most exciting adaptive response observed involves the expression of
PKA subunits. Studies in human neoplastic B-(Reh) cells in culture have
reported increased expression of both the catalytic subunit and the RI
regulatory subunit mRNA in response to elevated cAMP levels, although
immunoreactive RI
and C
levels were observed to decline in
response to an eightfold elevation of cAMP by forskolin stimulation
(22). In Sertoli MSC-1 cells in culture, elevation of cAMP
levels leads to an increase in the expression of RII
only, not
RI
, RII
, C
, or C
(7, 9). Here we made use of
targeted expression of Q227L G
s in mice to address this
issue in vivo. In adipocytes from Q227L G
s mice, expression of the catalytic subunit of PKA was unaffected. Expressions of RI
, RII
, and RII
, in contrast, were all increased in both fat and liver from Q227L G
s mice. This increased
abundance of the regulatory subunits of PKA occurred with no apparent
change in the amount of PKA cat, moderating PKA activity and
constituting an important part of a possible adaptive response to
increased cAMP levels. Taking into consideration the modest changes in
cAMP that were noted in response to the expression of the Q227L
G
s in vivo, we only can speculate that such adaptive
changes, although related to expression of the transgene, are directly
related to the change in intracellular cAMP. Indeed, if elevated cAMP
levels were driving some of these adaptive changes, the adaptive
changes may have already succeeded in attenuating elevated cAMP levels in this interesting mouse model. Levels of expression of PKA regulatory and catalytic subunits as well as PDE have not been analyzed in tissue
samples from patients with MAS, but they may well provide a basis for
some adaptive correction to the presence of a constitutively active
G
s.
| |
ACKNOWLEDGEMENTS |
|---|
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-30111.
| |
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: C. C. Malbon, Pharmacology-HSC, SUNY/Stony Brook, Stony Brook, NY 11794-8651 (E-mail craig{at}pharm.som.sunysb.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
10.1152/ajpcell.00320.2001
Received 17 July 2001; accepted in final form 22 March 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Chen, JF,
Guo JH,
Moxham CM,
Wang HY,
and
Malbon CC.
Conditional, tissue-specific expression of Q205L G alpha i2 in vivo mimics insulin action.
J Mol Med
75:
283-289,
1997[ISI][Medline].
2.
Gaudin, C,
Ishikawa Y,
Wight DC,
Mahdavi V,
Nadal G,
Wagner TE,
Vatner DE,
and
Homcy CJ.
Overexpression of Gs alpha protein in the hearts of transgenic mice.
J Clin Invest
95:
1676-1683,
1995[ISI][Medline].
3.
Geng, YJ,
Ishikawa Y,
Vatner DE,
Wagner TE,
Bishop SP,
Vatner SF,
and
Homcy CJ.
Apoptosis of cardiac myocytes in Gsalpha transgenic mice.
Circ Res
84:
34-42,
1999
4.
Gordeladze, JO,
Hovik KE,
Merendino JJ,
Hermouet S,
Gutkind S,
and
Accili D.
Effect of activating and inactivating mutations of Gs- and Gi2-alpha protein subunits on growth and differentiation of 3T3-L1 preadipocytes.
J Cell Biochem
64:
242-257,
1997[ISI][Medline].
5.
Hadcock, JR,
Ros M,
Watkins DC,
and
Malbon CC.
Cross-regulation between G-protein-mediated pathways. Stimulation of adenylyl cyclase increases expression of the inhibitory G-protein, Gi alpha 2.
J Biol Chem
265:
14784-14790,
1990
6.
Ham, J,
Ivan M,
Wynford-Thomas D,
and
Scanlon MF.
GH3 cells expressing constitutively active Gs alpha (Q227L) show enhanced hormone secretion and proliferation.
Mol Cell Endocrinol
127:
41-47,
1997[ISI][Medline].
7.
Hansson, V,
Skalhegg BS,
and
Tasken K.
Cyclic-AMP-dependent protein kinase (PKA) in testicular cells. Cell specific expression, differential regulation and targeting of subunits of PKA.
J Steroid Biochem Mol Biol
73:
81-92,
2000[Medline].
8.
Holness, W,
Santore TA,
Brown GP,
Fallon JT,
Taubman MB,
and
Iyengar R.
Expression of Q227L-Galpha(s) inhibits intimal vessel wall hyperplasia after balloon injury.
Proc Natl Acad Sci USA
98:
1288-1293,
2001
9.
Knutsen, HK,
Reinton N,
Tasken KA,
Hansson V,
and
Eskild W.
Regulation of protein kinase A subunits by cyclic adenosine 3',5'-monophosphate in a mouse Sertoli cell line (MSC-1): induction of RII beta messenger ribonucleic acid is independent of continuous protein synthesis.
Biol Reprod
55:
5-10,
1996[Abstract].
10.
Levine, MA,
Downs RW, Jr,
Singer M,
Marx SJ,
Aurbach GD,
and
Spiegel AM.
Deficient activity of guanine nucleotide regulatory protein in erythrocytes from patients with pseudohypoparathyroidism.
Biochem Biophys Res Commun
94:
1319-1324,
1980[ISI][Medline].
11.
Morris, AJ,
and
Malbon CC.
Physiological regulation of G protein-linked signaling.
Physiol Rev
79:
1373-1430,
1999
12.
Moxham, CM,
Hod Y,
and
Malbon CC.
Gi alpha 2 mediates the inhibitory regulation of adenylyl cyclase in vivo: analysis in transgenic mice with Gi alpha 2 suppressed by inducible antisense RNA.
Dev Genet
14:
266-273,
1993[ISI][Medline].
13.
Moxham, CM,
and
Malbon CC.
Insulin action impaired by deficiency of the G-protein subunit G ialpha2.
Nature
379:
840-844,
1996[Medline].
14.
Mullaney, I,
Carr IC,
and
Milligan G.
Overexpression of G(s)alpha in NG108-15, neuroblastoma×glioma cells: effects on receptor regulation of the stimulatory adenylyl cyclase cascade.
FEBS Lett
397:
325-330,
1996[ISI][Medline].
15.
Nemoz, G,
Sette C,
Hess M,
Muca C,
Vallar L,
and
Conti M.
Activation of cyclic nucleotide phosphodiesterases in FRTL-5 thyroid cells expressing a constitutively active Gs alpha.
Mol Endocrinol
9:
1279-1287,
1995[Abstract].
16.
Ostrom, RS,
Post SR,
and
Insel PA.
Stoichiometry and compartmentation in G protein-coupled receptor signaling: implications for therapeutic interventions involving G(s).
J Pharmacol Exp Ther
294:
407-412,
2000
17.
Post, SR,
Aguila-Buhain O,
and
Insel PA.
A key role for protein kinase A in homologous desensitization of the beta 2-adrenergic receptor pathway in S49 lymphoma cells.
J Biol Chem
271:
895-900,
1996
18.
Shenker, A,
Weinstein LS,
Moran A,
Pescovitz OH,
Charest NJ,
Boney CM,
Van Wyk JJ,
Merino MJ,
Feuillan PP,
and
Spiegel AM.
Severe endocrine and nonendocrine manifestations of the McCune-Albright syndrome associated with activating mutations of stimulatory G protein GS.
J Pediatr
123:
509-518,
1993[ISI][Medline].
19.
Shenker, A,
Weinstein LS,
Sweet DE,
and
Spiegel AM.
An activating Gs alpha mutation is present in fibrous dysplasia of bone in the McCune-Albright syndrome.
J Clin Endocrinol Metab
79:
750-755,
1994[Abstract].
20.
Shih, M,
and
Malbon CC.
Oligodeoxynucleotides antisense to mRNA encoding protein kinase A, protein kinase C, and beta-adrenergic receptor kinase reveal distinctive cell-type-specific roles in agonist-induced desensitization.
Proc Natl Acad Sci USA
91:
12193-12197,
1994
21.
Spiegel, AM.
G protein defects in signal transduction.
Horm Res
53, Suppl 3:
17-22,
2000.
22.
Tasken, K,
Andersson KB,
Skalhegg BS,
Tasken KA,
Hansson V,
Jahnsen T,
and
Blomhoff HK.
Reciprocal regulation of mRNA and protein for subunits of cAMP-dependent protein kinase (RI alpha and C alpha) by cAMP in a neoplastic B cell line (Reh).
J Biol Chem
268:
23483-23489,
1993
23.
Weinstein, LS,
Shenker A,
Gejman PV,
Merino MJ,
Friedman E,
and
Spiegel AM.
Activating mutations of the stimulatory G protein in the McCune- Albright syndrome.
N Engl J Med
325:
1688-1695,
1991[Abstract].
24.
Yan, L,
Herrmann V,
Hofer JK,
and
Insel PA.
-Adrenergic receptor/cAMP-mediated signaling and apoptosis of S49 lymphoma cells.
Am J Physiol Cell Physiol
279:
C1665-C1674,
2000
25.
Yu, S,
Castle A,
Chen M,
Lee R,
Takeda K,
and
Weinstein LS.
Increased insulin sensitivity in gsalpha knockout mice.
J Biol Chem
276:
19994-19998,
2001
26.
Yu, S,
Yu D,
Lee E,
Eckhaus M,
Lee R,
Corria Z,
Accili D,
Westphal H,
and
Weinstein LS.
Variable and tissue-specific hormone resistance in heterotrimeric Gs protein alpha-subunit (Gsalpha) knockout mice is due to tissue-specific imprinting of the Gsalpha gene.
Proc Natl Acad Sci USA
95:
8715-8720,
1998
27.
Zachary, I,
Masters SB,
and
Bourne HR.
Increased mitogenic responsiveness of Swiss 3T3 cells expressing constitutively active Gs alpha.
Biochem Biophys Res Commun
168:
1184-1193,
1990[ISI][Medline].
This article has been cited by other articles:
![]() |
N. Wettschureck and S. Offermanns Mammalian G Proteins and Their Cell Type Specific Functions Physiol Rev, October 1, 2005; 85(4): 1159 - 1204. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. F. Steinberg Focus on "Targeted expression of activated Q227L Galpha s in vivo" Am J Physiol Cell Physiol, August 1, 2002; 283(2): C383 - C385. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||