|
|
||||||||
1 Laboratory of Muscle, Sarcopenia, and Muscle Diseases, Division of Exercise Physiology, West Virginia University School of Medicine, Morgantown, West Virginia 26506; and 2 Department of Physiology, University of Nijmegen, 6500 HB, Nijmegen, The Netherlands
| |
ABSTRACT |
|---|
|
|
|---|
Aging attenuates the overload-induced increase in myogenic regulatory transcription factor (MRF) expression and the extent of muscle enlargement. To identify whether mRNA levels of repressors of the MRFs are greater in overloaded muscles from aged animals, overload was achieved in plantaris muscle of aged (33 mo; n = 14) and adult (9 mo; n = 17) rats. After 14 days, plantaris muscles in the overloaded limb were ~25% and 6% larger in adult and aged rats, respectively, compared with the contralateral limb. Hypertrophied muscles of adult rats had significantly greater levels of mRNA and protein levels for myogenin and MyoD compared with control muscles, but neither MRF increased with overload in muscles of aged rats. Muscles of aged rats had greater Id mRNA (150-700%) and protein repressor (200-6,000%) levels compared with adult rats. BAX and caspase 9 protein levels were 9,500% and 300% greater, respectively, in both control and hypertrophied muscles of aged rats compared with young adult rats. These data are consistent with the hypothesis that aging increases Id transcripts that activate apoptotic pathways involving BAX. This may contribute to sarcopenia by attenuating MRF protein levels in muscles of old animals.
sarcopenia; muscle atrophy; transcription factors; aging; MyoD; myogenin
| |
INTRODUCTION |
|---|
|
|
|---|
MYOGENIC REPRESSOR PROTEINS (e.g., Id-2, Id-2, Id-3) are basic helix-loop-helix (bHLH) proteins that act as negative regulators of the myogenic regulatory transcription factor (MRF) family in a variety of ways. For example, Id repressors suppress the formation of MRF-E protein heterodimers (48), which bind to a CANNTG consensus or "E box" domain and transactivate downstream muscle genes such as myosin light chain (MLC), desmin, and creatine kinase (26), by sequestration of E proteins (51, 52). The action of MRFs might also be inhibited by the formation of MRF-Id heterodimers that are unable to bind to the E boxes and in this way prevent the initiation of transcription (7, 8, 17, 25).
Id proteins increase under conditions that impair neural transmission to the muscle such as denervation (22), and Id-1 is highest in fibers undergoing the greatest atrophy. Furthermore, Id proteins have been proposed to prevent muscle differentiation and the concomitant expression of muscle-specific genes (5, 17, 25, 40, 48). Moreover, recent observations have suggested that Id repressors may have dual functions in regulating cell function. For example, Id-2 has been shown to play a role in promoting apoptosis in nonmuscle cell lines (21, 38). However, the relationship between Id proteins and apoptosis in adult and aged muscles has not yet been investigated.
We found (2) elevated mRNA and protein levels of Id repressors in fast muscles of aged rats compared with young rats, suggesting that Id repressors are involved in sarcopenia during aging. Part of the mechanism responsible for the attenuated overload-induced hypertrophy in muscles of aged animals (30, 32) might be an elevated level of Id proteins. In line with this suggestion is the attenuated increase in MRF protein (2, 3) and mRNA (50) levels in response to changes in muscle loading in old age. In addition, the elevated Id repressor levels in old age may impair muscle growth via their activation of apoptotic pathways, counterbalancing the trophic stimulus. Therefore, we hypothesized that the elevated repressor levels in old age correlate with 1) an attenuated increase in MRF levels, 2) an increased level of markers of apoptosis, and 3) a consequently attenuated increase in muscle mass as a response to muscle overload. Because aging preferentially affects muscle fibers containing fast myosin, we chose to look at responses to an overload in the fast plantaris muscle.
Here we report that levels of Id repressors were greater in plantaris muscles of aged rats compared with muscles in young adult rats. Although Id levels increased with overload in muscles of young rats, there was no further increase in Id mRNA or protein levels in overloaded muscles of aged rats. The levels of the apoptotic markers BAX and caspase 9 are elevated in both control and overloaded muscles of aged rats, whereas the abundance of these markers of apoptosis was low or undetectable in control and hypertrophied muscles of young rats. These data suggest that an elevation of repressor transcripts in old age might activate apoptotic pathways involving BAX. We suggest that this mechanism contributes to sarcopenia in old age and, together with the attenuated change of MRF levels during hypertrophy, provides an explanation for the suppressed hypertrophic response in old age.
| |
METHODS |
|---|
|
|
|---|
Animals
Experiments were conducted on young adult (9 mo; n = 12) and aged (37 mo; n = 9) Fischer344 × Brown Norway F1 hybrid male rats (FBN344; Harlan, Indianapolis, IN). In addition, we examined young adult (6 mo; n = 5) and aged (26 mo; n = 5) Fischer344 (F344) rats. The rats were housed separately in pathogen-free conditions at 20-22°C with a 12-h light-dark cycle. They were fed rat chow and water ad libitum.Induction of Hypertrophy of Plantaris Muscles
Rats were placed under general anesthesia of 2% isoflurane and 1.5 l oxygen/min. After reflex activity had disappeared, the tibial nerve was dissected free from the surrounding tissue just proximal to the cranial border of the gastrocnemius muscle. Care was taken to avoid disrupting blood vessels and damaging the tibial nerve. The branches of the tibial nerve that innervate the medial and lateral heads of the gastrocnemius muscle and the soleus muscle were transected as close to their entry point to the muscle belly as possible (19). The sectioned nerves were reflected proximally and sutured to a segment of the hamstring muscles with 4-0 suture silk to ensure that the nerve stumps did not reinnervate the plantar flexor muscles. Innervation to the plantaris and deep toe flexor muscles was left intact so that the animals could ambulate normally around the cages, thereby overloading the plantaris muscle and inducing muscle growth. After experimental denervation, the hamstring muscle layers were closed with absorbable suture and the skin incision was closed with 9-mm wound clips. The contralateral limb served as the intra-animal control. Animals received 0.3 mg of buprenex subcutaneously as an analgesic at the end of each surgery. The animals recovered quickly and were alert and walking within ~45 min after surgery. A subset of animals underwent sham surgeries on the control limb, in which the plantar flexor muscles and the branches of the tibial nerve innervating them were freed from the surrounding tissue but the nerves were not cut. Because the muscle weights and gene expression of sham-operated and unoperated control muscles did not differ, the control limb was not sham operated in most animals.Fourteen days after surgery, control and overloaded plantaris muscles
were removed, quickly weighed, frozen in liquid nitrogen, and then
stored at
80°C. Animals were euthanized with an overdose of
pentobarbital sodium. All experiments carried approval from the
institutional animal use and care committee of West Virginia University
School of Medicine. Animal care standards were followed by adhering to
the recommendations for the care of laboratory animals as advocated by
the American Association for Accreditation of Laboratory Animal Care
(AAALAC) and following the policies and procedures detailed in the
Guide for the Care and Use of Laboratory Animals as
published by the US Department of Health and Human Services and
proclaimed in the Animal Welfare Act (PL89-544, PL91-979, and
PL94-279).
RNase Protection Assays for MRF Genes
RNase protection assays (RPAs) were performed according to the directions from the manufacturer (Ambion, Austin, TX) with riboprobes and hybridization conditions previously described in detail (3, 30, 32). Briefly, 50 µg of total RNA from plantaris muscles was used for each RPA. Positive and negative control samples consisted of all riboprobes and either yeast mRNA or mouse liver mRNA. Full-length riboprobes (
10% larger than protected fragments) were
observed when RNase digestion was omitted (positive controls), whereas
protected fragments were not observed when control samples were
digested with RNase (negative controls). Century Marker Template (Ambion) was transcribed with biotin-14-CTP and used as size standards in the RPAs. Protected fragments, controls, and standards were electrophoresed on 5% acrylamide-8 M urea gels, electroblotted onto
positive-charged nylon membranes, and immobilized by ultraviolet cross-linking. Chemiluminescence was used to detect the signals (BrightStar BioDetect nonisotopic detection kit; Ambion) and made visible by exposure to film (BioMax MS-1; Eastman Kodak, Rochester, NY)
for 2-4 h.
RT-PCR Estimates of mRNA for Repressor and MRF Genes
Because RNA quantities were insufficient to run additional RPAs, semi-quantitative RT-PCR analysis was conducted as described in detail elsewhere (2). Briefly, total RNA was extracted from plantaris muscles treated with DNase I (Ambion) and reverse transcribed (RT) with oligo dT primers (Invitrogen/Life Technologies, Bethesda, MD). PCR was conducted with the primers and conditions described previously (2). In addition, citrate synthase (CS; primers: upper 5'CCGTGCTCATGGACTTGGGCCTT 3', lower CCCCTGGCCCAACGTAGATGCTC) was evaluated as a marker for oxidative enzyme transcription levels. Amplification of cyclophilin was used as a negative control because cyclophilin levels do not differ in muscles of aged and young adult rats (31). In a separate series of experiments, we used 18S instead of cyclophilin as an internal control. In these experiments, cDNA was made from total RNA by using random primers and 18S primer pairs. Subsequently, competimers to the 18S primers were amplified in the PCR reaction along with the gene of interest according to the manufacturer's protocols (Ambion). The number of PCR cycles was determined for each gene from RNA isolated from both young and aged animals so that analyses were done in the linear range of amplification. The signal from the gene of interest was expressed as a ratio to the 18S signal or the cyclophilin signal in the same PCR product.The cDNA from all muscle samples were amplified simultaneously for a given gene. After amplification, 20 µl of each reaction was electrophoresed on 1.5% agarose gels. Gels were stained with ethidium bromide. PCR signals were quantified in arbitrary units as optical density × band area, with Kodak image analysis software (Eastman Kodak). Although the MRF and repressor signal ratios normalized to cyclophilin differed from the same gene normalized to 18S under these conditions, the relative aging-associated and overload-induced differences between muscles of aged and young adult rats were similar when the RT-PCR signals were normalized to either cyclophilin or 18S (2). PCR signals were normalized to the cyclophilin signal for the same PCR product to provide a semiquantitative estimate of gene expression (2).
Western Blot Analyses
Western blotting was conducted as reported previously (2) with only minor modifications. Briefly, muscle samples were minced on ice and homogenized in ice-cold T-PER tissue protein extraction buffer (Pierce, Rockford, IL) containing protease inhibitors (Sigma-Aldrich). Solubilized protein extracts were quantified in duplicate by using bicinchoninic acid reagents (Pierce) and bovine serum albumin standards. Forty micrograms of soluble protein was loaded on each lane of a 10% or 12% polyacrylamide gel and separated by routine SDS-PAGE for 1.5 h at 20°C (1, 2). The gels were blotted to polyvinylidene fluoride (PVDF) membranes (Bio-Rad, Hercules, CA) and stained with Ponceau S (Sigma) to confirm similar loading and transfers in each lane. As a second approach to verify equal loading between the lanes, the membranes were stripped of the initial antibody (Pierce) and reprobed with
-actin. Furthermore, gels were loaded in duplicate, with one gel stained with Coomassie blue
to confirm that protein loads were similar in each lane.
The membranes were probed with antibodies against myogenin, MyoD, Id-1, Id-2, Id-3, BAX, and Bcl-2 (Santa Cruz Biotechnology, Santa Cruz, CA, or PharMingen, San Diego, CA), at a concentration of 1-3 µg/ml. The signals were developed by chemiluminescence (Boehringer-Roche, Indianapolis, IN), and the membranes were then exposed to X-ray film (BioMax MS-1; Eastman Kodak). The resulting bands were quantified as optical density × band area with Kodak imaging software (Eastman Kodak) and expressed in arbitrary units.
Myosin Heavy Chain Composition
Because aging may affect plantaris myosin heavy chain (MHC) expression, as a consequence of an altered MyoD expression, we determined the MHC protein composition in a subset of plantaris muscles from young adult (n = 4) and aged (n = 4) FBN rats. The MHC isoforms were separated by SDS-PAGE largely as described previously (20, 43). Briefly, a 10-µm-thick section of the plantaris was homogenized and sonicated in a Tris buffer containing protease inhibitors and the total protein content was determined with bicinchoninic acid reagents (Pierce). The samples were diluted in a SDS sample buffer. Approximately 0.2 µg of protein was loaded on the gel. The acrylamide-bisacrylamide (37.5:1) concentrations of the gels were 4% (wt/vol) and 7% (wt/vol) in the stacking and separating gels, respectively. The samples were run for 25 h at 120 V, 15°C (20, 43). MHC bands were visualized by silver staining and identified as types I, IIb, IIa, and IIx/d in order of decreasing migration rate.Assessment of Caspase 9
Caspase 9 was measured with a commercial colorimetric caspase 9 apoptosis assay kit (bioWorld, Dublin, OH), with the free dye of 7-amino-4-trifluromethyl-coumarin (AFC) as a standard, according to the procedures outlined by the manufacturer. Briefly, 10 mg of tissue was homogenized in the lysis buffer supplied with the kit. Lysates were incubated in 50 µM of the AFC-conjugated substrate at 22°C and read at 405 nm with a Dynex MRX plate reader controlled through PC software (Revelation; Dynatech Laboratories). All data were read in duplicate and averaged for each muscle. Samples were incubated in fluromethyl ketone as a negative control.Statistical Analyses
The data were examined with a two-way ANOVA (age × experimental condition) with SPSS software (version 10.0). The within-subject variable was experimental induction of hypertrophy, and the between-animal variable was age. Bonferroni post hoc analyses were conducted when significant age effects were found. Significance level was set at P < 0.05. Data are presented as means ± SE.| |
RESULTS |
|---|
|
|
|---|
Body Mass and Muscle Characteristics
The body weight of aged rats was ~ 30% greater than that of young adult rats. However, control muscle weight was ~50% less in aged rats compared with young adult rats. In FBN344 rats, overload increased plantaris weight from 476 ± 24 to 584 ± 26 mg in young adults whereas in aged rats the hypertrophy was attenuated (plantaris weight increased from 282 ± 24 to 300 ± 25 mg). Hypertrophy was negligible in three aged rats. The age-related and overload-induced changes in muscle weight exhibited a similar pattern in F344 rats (Fig. 1).
|
mRNA and Protein Expression of MRFs
mRNA levels of MRFs.
At both young and old age, the relative changes in muscle mass and gene
expression induced by overload were similar in FBN344 and
F344 rats. Therefore, data from FBN344 and F344 rats were combined per age group (young adult, n = 17; aged,
n = 14) for further analysis. RPAs demonstrated that
both myogenin and MyoD were increased with hypertrophy in plantaris
from young adult rats but not in aged rats (Fig.
2).
|
|
Myogenin and MyoD protein levels.
The rats of both strains were pooled into a young adult
(n = 17) and an aged (n = 14) group.
Equal loading and transfer was confirmed as described in METHODS
(see, for example, Ponceau S staining in Fig.
4). With the appropriate antibodies,
immunoreactive bands of ~34 and ~35 kDa were detected,
corresponding to the molecular mass of rat myogenin and MyoD,
respectively. Their expression was higher in aged than in young control
plantaris muscles. In young adult animals, hypertrophy induced a
~1,100 and 430% increase in myogenin and MyoD, respectively. In aged
rats, however, hypertrophy failed to induce an increase in MyoD and
myogenin protein levels (Fig. 4).
|
mRNA levels of desmin, MLC, and CS.
Because MRFs regulate the transcription of desmin and MLC, we
determined the mRNA levels of these muscle-specific genes in plantaris
muscles. In young adult rats, hypertrophy resulted in a 120% and 200%
increase in mRNA levels for desmin and MLC, respectively (Fig.
5). In aged rats, only MLC was increased
by ~115% during hypertrophy, whereas desmin expression was not
significantly altered (Fig. 5). CS mRNA level was estimated by
semiquantitative RT-PCR and found to be greater in muscles from aged
rats compared with muscles from young adult rats. Overload did not
significantly affect the CS mRNA levels in young adult rat muscles but
tended to reduce the CS mRNA level in muscles from aged rats, which
tended (P = 0.07) to have lower levels of CS than
control muscles (Fig. 5).
|
MHC protein expression.
Because the expression of MHC isoforms is under the control of MRFs, we
also evaluated the MHC protein composition of the plantaris muscles. In
aged rats, a significant increase in type I MHC and a decrease in type
IIb MHC was found. Overload significantly lowered type I MHC content in
muscles from young adult rats but did not induce a significant change
in MHC composition in muscles of aged rats (Fig.
6).
|
mRNA and Protein Expression of Repressor Genes
mRNA levels of Id.
As for the MRFs, the RT-PCR signals were normalized to cyclophilin. As
we showed previously (2), aging was accompanied by a
~700%, 150%, and 180% increase in Id-1, Id-2, and Id-3 mRNA levels
in control plantaris muscles, respectively (Fig.
7). Although overload induced ~125%
increase in Id-1 levels in plantaris muscles of young adult rats, their
Id-1 levels were still ~200% less than in either control or
overloaded muscles of aged rats. Id-1 levels, however, did not change
with overload in the muscles of aged rats (Fig. 7). Id-2 was greater in
overloaded muscles of young adult rats (~85%), but the increase was
attenuated in hypertrophied muscles of aged rats (~30%). Overload
did not alter the levels of Id-3 mRNA in either young adult or aged
rats.
|
mRNA levels of Mist1 and Twist. The levels of Mist1 mRNA did not change significantly with age or overload. Although Twist levels were similar in control and overloaded muscle samples of aged rats and control samples of young adult rats, Twist levels in overloaded muscle in samples of young adult muscles were only ~45% of control levels (Fig. 7).
Id protein levels.
Consistent with the mRNA data, Id-1, Id-2, and Id-3 protein levels were
~1,300%, 200%, and 6,100% greater in muscles of aged rats compared
with young adult rats (Fig. 8). In young
adult rats, Id-1 and Id-2 protein levels increased by ~ 480%
and 95%, respectively, with overload compared with the intra-animal
control muscle, whereas no such change was observed in the aged rats.
Id-3 protein levels were unchanged in young adult rats after overload
but were decreased by ~50% in overloaded muscles of aged rats (Fig.
8).
|
Markers of apoptosis.
Immunoblotting indicated that the level of BAX protein, a
proapoptotic gene marker, was ~9,500% greater in control muscles of aged rats compared with young adult rats. The level of BAX protein
was not significantly changed by overload in either age group (Fig.
9). Caspase 9 was ~ 300% greater
in muscles of aged rats compared with muscles of young adult rats.
Similar to BAX, caspase 9 did not change significantly with overload in
muscles of either aged or young adult rats. Protein levels of Bcl-2, as estimated from immunoblot analysis, were ~500% greater in muscles of
young adult rats compared with aged rats. Moreover, Bcl-2 protein levels were very low and frequently below detection levels in muscles
from aged rats.
|
Relationship of Id protein levels and markers of apoptosis.
When the control muscles of both age groups were collapsed and treated
as a single group, Id-1, Id-2, and Id-3 protein levels correlated
positively with caspase 9 (r = 0.99; P < 0.001) and BAX (r = 0.98; P < 0.001) protein levels (see Fig. 10 for
an example). This relationship existed because muscles in aged animals
showed a marked increase in these Id repressors and apoptotic
markers compared with muscles from young adult animals. The
relationship between BCl2 and Id protein levels was negative but less
clear (r =
0.44; P = 0.07). There
were no significant correlations between caspase 9 and Id protein
levels within age groups or conditions, and the overload-associated
changes in Id-1 or Id-2 were not associated with changes in these
markers of apoptosis.
|
| |
DISCUSSION |
|---|
|
|
|---|
Main Findings
There is substantial evidence that MRFs are important regulators of muscle-specific gene expression during conditions of loading or unloading (2, 34). We observed that the hypertrophy-induced increase in the expression of MyoD and myogenin in the fast plantaris muscles is blunted in old age. This finding is consistent with the suggestion that aging attenuates the general transcriptional response associated with muscle protein accumulation during muscle loading (1, 28, 32, 50).In this study we provide evidence that Id mRNA and protein levels are elevated in overloaded muscles of young adults, whereas in old age the already elevated basal repressor mRNA and protein levels are not increased further during overload (14). Furthermore, the high levels of Id-1 and Id-2 in muscles from aged rats correlated with greater levels of BAX and caspase 9 and low levels of Bcl-2, suggesting that repressor proteins may be involved in apoptosis that apparently occurs in muscles from aged animals.
Aging and Overload
MyoD levels are typically higher in fast muscles (24, 53) containing a high percentage of type IIb MHC (47), whereas muscles with a high type I MHC content are associated with relatively high myogenin levels (24). However, MyoD mRNA and protein levels were higher, yet type IIb MHC expression was lower, in control muscles from aged rats compared with young adult rats. Furthermore, MyoD levels increased in overloaded muscles of young rats but type IIb MHC did not change relative to control muscles. In addition, myogenin levels were greater but type I MHC expression was lower in overloaded muscles of young adult rats compared with aged rats. Therefore, it seems unlikely that MRFs play a dominant role in regulating MHC expression in overloaded muscles of aged rats.We and others (10) have observed that overload-induced hypertrophy is attenuated in old age. Potentially, this could be related to a reduced activity level in old age, thereby decreasing the overload stimulus compared with that in young active rats and consequently attenuating muscle growth. Although we did not evaluate this systematically, we did not observe obvious differences in the activity levels between young adult and aged rats. Even if the activity level was reduced in old age, it is unlikely that this would completely explain the attenuated increase in muscle mass, because it has been found that increased activity does not enhance muscle mass or prevent the age-associated decline in muscle mass in aged rats (11). Moreover, the hypertrophic response to stretch overload, which is largely independent of muscle activity (4, 23), was also suppressed in old age (13, 32).
Differences in activity level between young and aged rats might also affect the expression of MRFs. However, the increase in MRF levels was attenuated in old age both in response to resistance exercise (50) and in response to an activity-independent stretch-induced overload (13, 32). Finally, we have found that the expression of myogenin and MyoD in plantaris muscles from young adult rats was unaltered 24 or 48 h after exhaustive treadmill exercise (unpublished data). Together, these data suggest that differences in activity levels alone cannot explain the attenuation of protein accumulation and MRF expression in aged rats.
Involvement of Id Proteins in Regulation of Proliferation
There is mounting evidence that Id proteins have an important role in the regulation of cell proliferation. Id gene expression is enhanced in response to mitogenic stimuli (6, 17) and is associated with the induction of DNA synthesis (41). Furthermore, Id gene expression is typically high during cellular proliferation and before differentiation in keratinocytes (36) and tumor and other cell lines (16, 27, 49). Overexpression of Id inhibits differentiation of cells of muscle lineage (7, 9, 17, 25, 29). Moreover, the observation that Id-2 knockout mice die at birth with an apparent lack of muscle tissue suggests that Id-2 is involved in the regulation of satellite cell proliferation during muscle growth (29). Because satellite cell proliferation provides additional nuclei that enable the muscle to increase its mass (35), it is possible that the elevation of Id-1 and Id-2 protein levels in muscles from aged rats is an apparently unsuccessful attempt to stimulate satellite cell proliferation to enhance fiber hypertrophy and thus to counterbalance sarcopenia. The attenuated overload-induced hypertrophy in old age and the absence of an increase in Id expression strongly suggest that Id repressor expression in aged control muscles is already maximal. Further work is needed to confirm that the expression of Id repressors has reached a maximum in old age. However, the data suggest that the inability to further upregulate Id expression in old age contributes to the attenuated hypertrophic response.Potential Involvement of Id Proteins in Apoptosis of Skeletal Muscle
In an apparent paradoxical role to proliferation, Id-1 has been shown to increase during denervation, which leads to muscle atrophy (12, 22). This paradox is also apparent in our data, because the overload-induced hypertrophy at young age and the age-related muscle atrophy were both accompanied by an elevated Id expression. Thus the data in the literature and our data point to a dual role for the Id gene.Both Id-1 and Id-2 protein levels and markers for apoptosis (i.e., BAX and caspase 9) were higher in muscles of the aged compared with the young adult rats (Fig. 10). Although these results do not prove a causative role for Id-1 and Id-2 in apoptosis in skeletal muscle of aged animals, they have been shown to at least partly play such a role in muscle damage and disease (18, 42, 45, 46). Moreover, clear evidence for a role of Id-1 and Id-2 in apoptosis in other cells was obtained by Florio and colleagues (21). However, further studies are required to determine whether Id-1 and Id-2 play a role in regulating apoptosis in skeletal muscle of aged animals via activation of BAX/Bcl-2 apoptotic pathways. In addition, because elevated Id-1 levels are associated with denervation (22), further studies are needed to determine whether the denervation-reinnervation process that occurs during aging regulates muscle Id protein levels in aging.
In contrast to the other Id proteins, Id-3 did not increase with overload in muscles of young rats and even decreased with overload in aged rat muscle. The discrepancy between this decrease and the unchanged BAX and caspase levels during hypertrophy in old age suggests that Id-3 plays no role in apoptosis. Nevertheless, overexpression of Id-3 has been shown to induce apoptosis in fibroblasts and other cell types (37, 39). In addition, in vitro studies raise the possibility that apoptosis induced by withdrawal of growth factors may induce apoptosis of satellite cells (33).
In summary, although Id levels increased in muscles of young adult rats with overload, there was no evidence that apoptosis increased. This suggests that Id may primarily function in pathways regulating satellite cell proliferation and growth in young adult muscles, because hypertrophy is dependent on satellite cell activation and fusion (44). Nevertheless, Id may have a dual role in pathways of both growth and apoptosis in muscles of aged rats. A dual role of genes in both growth and apoptosis is not unique to Id. For example, p53 and c-Myc activate progress through the cell cycle and E2F-1 transactivates genes required for progression into S phase, but those genes can also be uncoupled from these functions during apoptosis (15). Additional experiments are needed to determine whether Id has a direct role in apoptosis of aging skeletal muscle and sarcopenia.
| |
ACKNOWLEDGEMENTS |
|---|
This study was supported by National Institute on Aging Grant AG-17143 to S. E. Alway.
| |
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: S. E. Alway, Laboratory of Muscle, Sarcopenia, and Muscle Diseases, Div. of Exercise Physiology, West Virginia Univ. School of Medicine, Robert C. Byrd Health Science Center, Morgantown, WV 26506-9227 (E-mail: salway{at}hsc.wvu.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
First published February 13, 2002;10.1152/ajpcell.00598.2001
Received 20 December 2001; accepted in final form 10 February 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Alway, SE.
Overload-induced C-Myc oncoprotein is reduced in aged skeletal muscle.
J Gerontol A Biol Sci Med Sci
52:
B203-B211,
1997[Abstract].
2.
Alway, SE,
Degens H,
Lowe DA,
and
Krishnamurthy G.
Increased myogenic repressor Id mRNA and protein levels in hindlimb muscles of aged rats.
Am J Physiol Regulatory Integrative Comp Physiol
282:
R411-R422,
2002
3.
Alway, SE,
Lowe DA,
and
Chen KD.
The effects of age and hindlimb suspension on the levels of expression of the myogenic regulatory factors MyoD and myogenin in rat fast and slow skeletal muscles.
Exp Physiol
86:
509-517,
2001[Abstract].
4.
Ashmore, CR,
Lee YB,
Summers P,
and
Hitchcock L.
Stretch-induced growth in chicken wing muscles: nerve-muscle interaction in muscular dystrophy.
Am J Physiol Cell Physiol
246:
C378-C384,
1984
5.
Atherton, GT,
Travers H,
Deed R,
and
Norton JD.
Regulation of cell differentiation in C2C12 myoblasts by the Id3 helix-loop-helix protein.
Cell Growth Differ
7:
1059-1066,
1996[Abstract].
6.
Barone, MV,
Pepperkok R,
Peverali FA,
and
Philipson L.
Id proteins control growth induction in mammalian cells.
Proc Natl Acad Sci USA
91:
4985-4988,
1994
7.
Benezra, R,
Davis RL,
Lassar A,
Tapscott S,
Thayer M,
Lockshon D,
and
Weintraub H.
Id: a negative regulator of helix-loop-helix DNA binding proteins. Control of terminal myogenic differentiation.
Ann NY Acad Sci
599:
1-11,
1990[Medline].
8.
Benezra, R,
Davis RL,
Lockshon D,
Turner DL,
and
Weintraub H.
The protein Id: a negative regulator of helix-loop-helix DNA binding proteins.
Cell
61:
49-59,
1990[ISI][Medline].
9.
Biederer, CH,
Ries SJ,
Moser M,
Florio M,
Israel MA,
McCormick F,
and
Buettner R.
The basic helix-loop-helix transcription factors myogenin and Id2 mediate specific induction of caveolin-3 gene expression during embryonic development.
J Biol Chem
275:
26245-26251,
2000
10.
Blough, ER,
and
Linderman JK.
Lack of skeletal muscle hypertrophy in very aged male Fischer 344 × Brown Norway rats.
J Appl Physiol
88:
1265-1270,
2000
11.
Brown, M,
Ross TP,
and
Holloszy JO.
Effects of ageing and exercise on soleus and extensor digitorum longus muscles of female rats.
Mech Ageing Dev
63:
69-77,
1992[ISI][Medline].
12.
Carlsen, H,
and
Gundersen K.
Helix-loop-helix transcription factors in electrically active and inactive skeletal muscles.
Muscle Nerve
23:
1374-1380,
2000[ISI][Medline].
13.
Carson, JA,
Alway SE,
and
Yamaguchi M.
Time course of hypertrophic adaptations of the anterior latissimus dorsi muscle to stretch overload in aged Japanese quail.
J Gerontol A Biol Sci Med Sci
50:
B391-B398,
1995[Abstract].
14.
Carson, JA,
Yamaguchi M,
and
Alway SE.
Hypertrophy and proliferation of skeletal muscle fibers from aged quail.
J Appl Physiol
78:
293-299,
1995
15.
Chen, X,
Ko LJ,
Jayaraman L,
and
Prives C.
p53 Levels, functional domains, and DNA damage determine the extent of the apoptotic response of tumor cells.
Genes Dev
10:
2438-2451,
1996
16.
Chetcuti, A,
Margan S,
Mann S,
Russell P,
Handelsman D,
Rogers J,
and
Dong Q.
Identification of differentially expressed genes in organ-confined prostate cancer by gene expression array.
Prostate
47:
132-140,
2001[ISI][Medline].
17.
Christy, BA,
Sanders LK,
Lau LF,
Copeland NG,
Jenkins NA,
and
Nathans D.
An Id-related helix-loop-helix protein encoded by a growth factor-inducible gene.
Proc Natl Acad Sci USA
88:
1815-1819,
1991
18.
Dalla, LL,
Sabbadini R,
Renken C,
Ravara B,
Sandri M,
Betto R,
Angelini A,
and
Vescovo G.
Apoptosis in the skeletal muscle of rats with heart failure is associated with increased serum levels of TNF-alpha and sphingosine.
J Mol Cell Cardiol
33:
1871-1878,
2001[ISI][Medline].
19.
Degens, H,
Meessen NE,
Wirtz P,
and
Binkhorst RA.
The development of compensatory hypertrophy in the plantaris muscle of the rat.
Anat Anz
177:
285-289,
1995[Medline].
20.
Degens, H,
Yu F,
Li X,
and
Larsson L.
Effects of age and gender on shortening velocity and myosin isoforms in single rat muscle fibres.
Acta Physiol Scand
163:
33-40,
1998[ISI][Medline].
21.
Florio, M,
Hernandez MC,
Yang H,
Shu HK,
Cleveland JL,
and
Israel MA.
Id2 promotes apoptosis by a novel mechanism independent of dimerization to basic helix-loop-helix factors.
Mol Cell Biol
18:
5435-5444,
1998
22.
Gundersen, K,
and
Merlie JP.
Id-1 as a possible transcriptional mediator of muscle disuse atrophy.
Proc Natl Acad Sci USA
91:
3647-3651,
1994
23.
Holly, RG,
Barnett JG,
Ashmore CR,
Taylor RG,
and
Mole PA.
Stretch-induced growth in chicken wing muscles: a new model of stretch hypertrophy.
Am J Physiol Cell Physiol
238:
C62-C71,
1980
24.
Hughes, SM,
Koishi K,
Rudnicki M,
and
Maggs AM.
MyoD protein is differentially accumulated in fast and slow skeletal muscle fibres and required for normal fibre type balance in rodents.
Mech Dev
61:
151-163,
1997[ISI][Medline].
25.
Jen, Y,
Weintraub H,
and
Benezra R.
Overexpression of Id protein inhibits the muscle differentiation program: in vivo association of Id with E2A proteins.
Genes Dev
6:
1466-1479,
1992
26.
Kadesch, T.
Helix-loop-helix proteins in the regulation of immunoglobulin gene transcription.
Immunol Today
13:
31-36,
1992[ISI][Medline].
27.
Kebebew, E,
Treseler PA,
Duh QY,
and
Clark OH.
The helix-loop-helix transcription factor, Id-1, is overexpressed in medullary thyroid cancer.
Surgery
128:
952-957,
2000[ISI][Medline].
28.
Kostrominova, TY,
Macpherson PC,
Carlson BM,
and
Goldman D.
Regulation of myogenin protein expression in denervated muscles from young and old rats.
Am J Physiol Regulatory Integrative Comp Physiol
279:
R179-R188,
2000
29.
Lasorella, A,
Noseda M,
Beyna M,
Yokota Y,
and
Iavarone A.
Id2 is a retinoblastoma protein target and mediates signalling by Myc oncoproteins.
Nature
407:
592-598,
2000[Medline].
30.
Lowe, DA,
and
Alway SE.
Stretch-induced myogenin, MyoD, and MRF4 expression and acute hypertrophy in quail slow-tonic muscle are not dependent upon satellite cell proliferation.
Cell Tissue Res
296:
531-539,
1999[ISI][Medline].
31.
Lowe, DA,
Degens H,
Chen KD,
and
Alway SE.
Glyceraldehyde-3-phosphate dehydrogenase varies with age in glycolytic muscles of rats.
J Gerontol A Biol Sci Med Sci
55:
B160-B164,
2000
32.
Lowe, DA,
Lund T,
and
Alway SE.
Hypertrophy-stimulated myogenic regulatory factor mRNA increases are attenuated in fast muscle of aged quails.
Am J Physiol Cell Physiol
275:
C155-C162,
1998
33.
Mampuru, LJ,
Chen SJ,
Kalenik JL,
Bradley ME,
and
Lee TC.
Analysis of events associated with serum deprivation-induced apoptosis in C3H/Sol8 muscle satellite cells.
Exp Cell Res
226:
372-380,
1996[ISI][Medline].
34.
Marsh, DR,
Criswell DS,
Carson JA,
and
Booth FW.
Myogenic regulatory factors during regeneration of skeletal muscle in young, adult, and old rats.
J Appl Physiol
83:
1270-1275,
1997
35.
McCall, GE,
Allen DL,
Linderman JK,
Grindeland RE,
Roy RR,
Mukku VR,
and
Edgerton VR.
Maintenance of myonuclear domain size in rat soleus after overload and growth hormone/IGF-I treatment.
J Appl Physiol
84:
1407-1412,
1998
36.
Nickoloff, BJ,
Chaturvedi V,
Bacon P,
Qin JZ,
Denning MF,
and
Diaz MO.
Id-1 delays senescence but does not immortalize keratinocytes.
J Biol Chem
275:
27501-27504,
2000
37.
Norton, JD.
ID helix-loop-helix proteins in cell growth, differentiation and tumorigenesis.
J Cell Sci
113:
3897-3905,
2000[Abstract].
38.
Norton, JD,
and
Atherton GT.
Coupling of cell growth control and apoptosis functions of Id proteins.
Mol Cell Biol
18:
2371-2381,
1998
39.
Norton, JD,
Deed RW,
Craggs G,
and
Sablitzky F.
Id helix-loop-helix proteins in cell growth and differentiation.
Trends Cell Biol
8:
58-65,
1998[ISI][Medline].
40.
Perry, RL,
and
Rudnick MA.
Molecular mechanisms regulating myogenic determination and differentiation.
Front Biosci
5:
D750-D767,
2000[ISI][Medline].
41.
Peverali, FA,
Basdra EK,
and
Papavassiliou AG.
Stretch-mediated activation of selective MAPK subtypes and potentiation of AP-1 binding in human osteoblastic cells.
Mol Med
7:
68-78,
2001[ISI][Medline].
42.
Podhorska-Okolow, M,
Sandri M,
Zampieri S,
Brun B,
Rossini K,
and
Carraro U.
Apoptosis of myofibres and satellite cells: exercise-induced damage in skeletal muscle of the mouse.
Neuropathol Appl Neurobiol
24:
518-531,
1998[ISI][Medline].
43.
Roman, WJ,
and
Alway SE.
Stretch-induced transformations in myosin expression of quail anterior latissimus dorsi muscle.
Med Sci Sports Exerc
27:
1494-1499,
1995.
44.
Rosenblatt, JD,
Yong D,
and
Parry DJ.
Satellite cell activity is required for hypertrophy of overloaded adult rat muscle.
Muscle Nerve
17:
608-613,
1994[ISI][Medline].
45.
Sandri, M,
and
Carraro U.
Apoptosis of skeletal muscles during development and disease.
Int J Biochem Cell Biol
31:
1373-1390,
1999[ISI][Medline].
46.
Sandri, M,
Minetti C,
Pedemonte M,
and
Carraro U.
Apoptotic myonuclei in human Duchenne muscular dystrophy.
Lab Invest
78:
1005-1016,
1998[ISI][Medline].
47.
Seward, DJ,
Haney JC,
Rudnicki MA,
and
Swoap SJ.
bHLH transcription factor MyoD affects myosin heavy chain expression pattern in a muscle-specific fashion.
Am J Physiol Cell Physiol
280:
C408-C413,
2001
48.
Sun, XH,
Copeland NG,
Jenkins NA,
and
Baltimore D.
Id proteins Id1 and Id2 selectively inhibit DNA binding by one class of helix-loop-helix proteins.
Mol Cell Biol
11:
5603-5611,
1991
49.
Takai, N,
Miyazaki T,
Fujisawa K,
Nasu K,
and
Miyakawa I.
Id1 expression is associated with histological grade and invasive behavior in endometrial carcinoma.
Cancer Lett
165:
185-193,
2001[ISI][Medline].
50.
Tamaki, T,
Uchiyama S,
Uchiyama Y,
Akatsuka A,
Yoshimura S,
Roy RR,
and
Edgerton VR.
Limited myogenic response to a single bout of weight-lifting exercise in old rats.
Am J Physiol Cell Physiol
278:
C1143-C1152,
2000
51.
Weintraub, H,
Davis R,
Tapscott S,
Thayer M,
Krause M,
Benezra R,
Blackwell TK,
Turner D,
Rupp R,
and
Hollenberg S.
The myoD gene family: nodal point during specification of the muscle cell lineage.
Science
251:
761-766,
1991
52.
Weintraub, H,
Dwarki VJ,
Verma I,
Davis R,
Hollenberg S,
Snider L,
Lassar A,
and
Tapscott SJ.
Muscle-specific transcriptional activation by MyoD.
Genes Dev
5:
1377-1386,
1991
53.
Wheeler, MT,
Snyder EC,
Patterson MN,
and
Swoap SJ.
An E-box within the MHC IIB gene is bound by MyoD and is required for gene expression in fast muscle.
Am J Physiol Cell Physiol
276:
C1069-C1078,
1999
This article has been cited by other articles:
![]() |
R. J. Colman, T. M. Beasley, D. B. Allison, and R. Weindruch Attenuation of Sarcopenia by Dietary Restriction in Rhesus Monkeys J. Gerontol. A Biol. Sci. Med. Sci., June 1, 2008; 63(6): 556 - 559. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Degens, A. K. Swisher, Y. F. Heijdra, P. M. Siu, P. N. Richard Dekhuijzen, and S. E. Alway Apoptosis and Id2 expression in diaphragm and soleus muscle from the emphysematous hamster Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2007; 293(1): R135 - R144. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Thomson and S. E. Gordon Impaired overload-induced muscle growth is associated with diminished translational signalling in aged rat fast-twitch skeletal muscle J. Physiol., July 1, 2006; 574(1): 291 - 305. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. D. Reeves, M. V. Narici, and C. N. Maganaris Myotendinous plasticity to ageing and resistance exercise in humans Exp Physiol, May 1, 2006; 91(3): 483 - 498. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Siu, E. E. Pistilli, Z. Murlasits, and S. E. Alway Hindlimb unloading increases muscle content of cytosolic but not nuclear Id2 and p53 proteins in young adult and aged rats J Appl Physiol, March 1, 2006; 100(3): 907 - 916. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Lees, C. R. Rathbone, and F. W. Booth Age-associated decrease in muscle precursor cell differentiation Am J Physiol Cell Physiol, February 1, 2006; 290(2): C609 - C615. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Siu and S. E. Alway Subcellular responses of p53 and Id2 in fast and slow skeletal muscle in response to stretch-induced overload J Appl Physiol, November 1, 2005; 99(5): 1897 - 1904. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Siu and S. E. Alway Age-related apoptotic responses to stretch-induced hypertrophy in quail slow-tonic skeletal muscle Am J Physiol Cell Physiol, November 1, 2005; 289(5): C1105 - C1113. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Brack, H. Bildsoe, and S. M. Hughes Evidence that satellite cell decrement contributes to preferential decline in nuclear number from large fibres during murine age-related muscle atrophy J. Cell Sci., October 15, 2005; 118(20): 4813 - 4821. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Siu, E. E. Pistilli, and S. E. Alway Apoptotic responses to hindlimb suspension in gastrocnemius muscles from young adult and aged rats Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2005; 289(4): R1015 - R1026. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Siu, E. E. Pistilli, M. J. Ryan, and S. E. Alway Aging Sustains the Hypertrophy-Associated Elevation of Apoptotic Suppressor X-Linked Inhibitor of Apoptosis Protein (X |