Am J Physiol Cell Physiol Add DOIs to your references at manuscript stage!
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 282: C1212-C1224, 2002. First published January 2, 2002; doi:10.1152/ajpcell.00496.2001
0363-6143/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/6/C1212    most recent
00496.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (40)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brar, S. S.
Right arrow Articles by Hoidal, J. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brar, S. S.
Right arrow Articles by Hoidal, J. R.
Vol. 282, Issue 6, C1212-C1224, June 2002

An NAD(P)H oxidase regulates growth and transcription in melanoma cells

Sukhdev S. Brar1, Thomas P. Kennedy1, Anne B. Sturrock2, Thomas P. Huecksteadt2, Mark T. Quinn3, A. Richard Whorton4, and John R. Hoidal2

1 Departments of Internal Medicine and Cannon Research Center, Carolinas Medical Center, Charlotte, North Carolina 28232; 2 Division of Respiratory, Critical Care and Occupational (Pulmonary) Medicine, University of Utah, Salt Lake City, Utah 84132; 3 Department of Veterinary Molecular Biology, Montana State University, Bozeman, Montana 59717; and 4 Department of Pharmacology and Cancer Biology, Duke University Medical Center, Durham, North Carolina 27710


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Malignant melanoma cells spontaneously generate reactive oxygen species (ROS) that promote constitutive activation of the transcription factor nuclear factor-kappa B (NF-kappa B). Although antioxidants and inhibitors of NAD(P)H oxidases significantly reduce constitutive NF-kappa B activation and suppress cell proliferation (11), the nature of the enzyme responsible for ROS production in melanoma cells has not been determined. To address this issue, we now have characterized the source of ROS production in melanoma cells. We report that ROS are generated by isolated, cytosol-free melanoma plasma membranes, with inhibition by NAD(P)H oxidase inhibitors. The p22phox, gp91phox, and p67phox components of the human phagocyte NAD(P)H oxidase and the gp91phox homolog NOX4 were demonstrated in melanomas by RT-PCR and sequencing, and protein product for both p22phox and gp91phox was detected in cell membranes by immunoassay. Normal human epidermal melanocytes expressed only p22phox and NOX4. Melanoma proliferation was reduced by NAD(P)H oxidase inhibitors and by transfection of antisense but not sense oligonucleotides for p22phox and NOX4. Also, the flavoprotein inhibitor diphenylene iodonium inhibited constitutive DNA binding of nuclear protein to the NF-kappa B and cAMP-response element consensus oligonucleotides, without affecting DNA binding activity to activator protein-1 or OCT-1. This suggests that ROS generated in autocrine fashion by an NAD(P)H oxidase may play a role in signaling malignant melanoma growth.

superoxide anion; diphenylene iodonium; p22phox; gp91phox; p67phox; NOX1; NOX4; nuclear factor-kappa B; cAMP response element; dicumarol


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

REACTIVE OXYGEN SPECIES (ROS) generated by an NAD(P)H oxidase have been recently recognized as important signaling molecules for proliferation of normal cells. The role of a signaling NAD(P)H oxidase has been most extensively explored in vascular smooth muscle cells, where both p22phox and the unique gp91phox homolog NOX1 have been shown to be important for function of an NAD(P)H oxidase activity that mediates angiotensin II-induced superoxide (O<UP><SUB>2</SUB><SUP>−</SUP></UP>) formation and redox-sensitive signaling pathways (19, 30). Similar but structurally distinct NAD(P)H oxidases also perform signaling functions in normal vascular endothelial cells (18, 25) and adventitial cells (38), and the gp91phox homolog NOX4 has recently been described in renal tubular epithelium (17, 45), fetal tissue (12), placenta (12), and proliferating vascular smooth muscle (30).

Like normal cells, human tumor cells also produce substantial amounts of ROS spontaneously (15, 37, 49), and evidence points to a role for these ROS in signaling neoplastic proliferation. Mitogenic signaling through both Ras (22) and Rac (26) is mediated by O<UP><SUB>2</SUB><SUP>−</SUP></UP>, and transfection with mitogenic oxidase NOX1 transforms normal fibroblasts (48) and creates cell lines that are tumorigenic in athymic mice (2). The NOX1 homolog has been found expressed in the Caco human colon carcinoma cells (12, 28, 48) and HepG2 hepatoma cells (28), and gp91phox expression has been demonstrated in small cell lung cancer (54). However, a potential role for a phagocyte-like NAD(P)H membrane oxidase in signaling proliferation of malignant melanoma cells has not been previously demonstrated.

We recently reported that endogenously produced ROS signal constitutive activation of nuclear factor-kappa B (NF-kappa B) and cellular proliferation in M1619 malignant melanoma cells (11). On the basis of inhibition of these events by the NAD(P)H:quinone oxidoreductase (NQO) inhibitor dicumarol, we speculated that cytosolic NQO might provide the enzymatic source of electrons for reduction of membrane ubiquinone to ubiquinol, with subsequent generation of O<UP><SUB>2</SUB><SUP>−</SUP></UP> from molecular O2. However, dicumarol also inhibited growth of H596 non-small cell lung cancer cells (11). H596 cells express a mutant NQO protein and have elevated mRNA for NQO but no detectable enzymatic activity (50). We therefore repeated our original studies, performing reverse transcriptase-polymerase chain reaction (RT-PCR) under different conditions (11). We found that dicumarol inhibits O<UP><SUB>2</SUB><SUP>−</SUP></UP> generation by isolated plasma membranes lacking a cytosolic source of NQO. M1619, other malignant melanomas, and normal human epidermal melanocytes express mRNA for the p22phox membrane subunit of the NAD(P)H oxidase, and melanomas express gp91phox. Melanomas and melanocytes additionally express the gp91phox homolog NOX4, which has been recently found in renal tubular epithelial cells and renal cell carcinomas (44), glioblastomas (12), and Caco colon cancer cells (12). Finally, membrane O<UP><SUB>2</SUB><SUP>−</SUP></UP> generation and melanoma proliferation are reduced by inhibitor strategies directed at the leukocyte NAD(P)H oxidase, raising the possibility that a form of this same enzyme system serves as a growth regulatory oxidase in malignant melanoma cells.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Materials. Human malignant cell lines were obtained from American Type Culture Collection (Rockville, MD). Human epidermal melanocytes, medium 154, and human melanocyte growth supplement (HMGS) were purchased from Cascade Biologics (Portland, OR). RPMI medium 1640, HEPES, antibiotic-antimycotic (10,000 U/ml penicillin, 10,000 µg/ml streptomycin, and 25 µg/ml amphotericin B), and trypsin-EDTA solution were purchased from the GIBCO-BRL division of Life Technologies (Grand Island, NY). Fetal bovine serum (FBS) was purchased from Hyclone Laboratories (Logan, UT). The intracellular oxidant sensitive probe 2',7'-dichlorofluorescin diacetate (DCFH-DA) was from Molecular Probes (Eugene, OR). Electrophoretic mobility shift assay (EMSA) supplies were purchased from Promega (Madison, WI). Supershift antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Rabbit phospho-specific antibodies for inhibitor of NF-kappa B (Ikappa Balpha ) phosphorylated at serine 32 were purchased from New England Biolabs (Beverly, MA). Protease inhibitors were from Sigma Chemical (St. Louis, MO). All other materials were purchased from Sigma Chemical unless otherwise specified.

Culture of malignant cell lines and cell culture treatments. Malignant melanoma cell lines were cultured and passaged as previously described (11). Human epidermal melanocytes were cultured in medium 154 supplemented with HMGS according to the supplier's instructions and passed with 0.05% trypsin and 0.53 mmol/l EDTA. Growth rates of melanocytes and M1619 melanoma cells were compared by measuring proliferation (as described in Measurement of proliferation in cell cultures) every 24 h for 72 h. Intracellular generation of ROS by melanocytes or M1619 cells was measured by oxidation of DCFH-DA to 2',7'-dichlorofluorescein (DCF) by H2O2. The effect of NAD(P)H oxidase inhibitors and blockade of the flavoprotein-dependent enzymes xanthine oxidase and nitric oxide synthetase on proliferation of malignant cell lines was studied in cultures stimulated with 10% FBS and grown for 48 h before proliferation was measured. The effect of NAD(P)H oxidase activity on transcriptional activation was studied by incubation of 70% confluent cultures with 0-50 µmol/l of the flavoprotein inhibitor diphenylene iodonium (DPI) for 24 h before measurement of DNA binding by EMSA, detection of constitutive NF-kappa B nuclear activation by immunohistochemical staining for the p65 component, or immunoassay of levels of active transcription factor component in nuclear protein.

Measurement of proliferation in cell cultures. Proliferation of cultured cells seeded into 24-well uncoated plastic plates (Costar) at 50,000 cells/well (except where indicated) was quantitated as previously described (11) by using a colorimetric method based on metabolic reduction of the soluble yellow tetrazolium dye 3-(4,5,-dimethylthiazol)-2-yl-2,5-diphenyltetrazolium bromide (MTT) to its insoluble purple formazan by the action of mitochondrial succinyl dehydrogenase. For studies with a final cell density of less than about 40,000 cells/well, direct cell counts were performed on 10 random fields/well of Wright's-modified Geimsa-stained monolayers viewed at a ×100 magnification with a 0.01-cm2 ocular grid.

Measurement of ROS generation by intact cells. Intracellular production of ROS by M1619 cells or epidermal melanocytes was measured by oxidation of DCFH-DA to DCF (42). DCFH-DA is a nonpolar compound that readily diffuses into cells, where it is hydrolyzed to the nonfluorescent polar derivative DCFH and thereby trapped within the cells. In the presence of H2O2, DCFH is oxidized to the highly fluorescent DCF. Approximately 1 × 106 M1619 cells or human epidermal melanocytes were incubated in the dark for 10 min at 37°C with 50 µmol/l DCFH-DA, harvested, and resuspended in plain medium. Fluorescence was analyzed by using a FACScan (Becton Dickinson, Sunnyvale, CA) flow cytometer with excitation at 488 nm and emission at 530 nm.

Measurement of ROS generation by cell membranes. The method of Pagano et al. (38), with centrifugation speeds modified according to the work of Mohazzab-H and Wolin (36), was used to prepare membranes for measurement of ROS. M1619 cells from six near-confluent T-75 flasks were harvested with cell dissociation solution (Sigma), washed once with ice-cold Dulbecco's phosphate-buffered saline (DPBS), and centrifuged for 5 min at 675 g. The pellet was resuspended in 500 µl of ice-cold Tris-sucrose buffer [pH 7.1; composed of (in mmol/l) 10 Trizma base, 340 sucrose, 1 phenylmethylsulfonyl fluoride, 1 EDTA, and 10 µg/ml protease inhibitor cocktail (Sigma)] and sonicated by four 15-s bursts. The cell sonicate was centrifuged at 1,475 g and 4°C for 15 min in an Eppendorf microfuge to remove nuclei and unbroken cells. The supernatant was then centrifuged at 29,000 g and 4°C for 15 min in a Beckman Optima TL ultracentrifuge. The pellet was discarded, and the supernatant was further centrifuged at 100,000 g and 4°C for 75 min. The pellet was resuspended in 100 µl of Tris-sucrose buffer and stored at -80°C. Supernatant from the last centrifugation was also saved as a representative of lactate dehydrogenase-containing soluble elements of cytoplasm (36). Generation of ROS was measured by superoxide dismutase (SOD)-inhibitable lucigenin chemiluminescence, as recently reported (38, 56), in 500 µl of 50 mmol/l phosphate buffer (pH 7.0) containing 1 mmol/l EGTA, 150 mmol/l sucrose, 5 µmol/l lucigenin, 15 µg of cell membrane protein, 50 µg of cytosolic protein, and 100 µmol/l NADH or NADPH as substrate. Chemiluminescence (in arbitrary light units) was measured by using a Turner model 20/20D luminometer (Turner Designs, Sunnyvale, CA) at 30-s intervals for 5 min with and without addition of 300 units of SOD to determine dependence of light generation on O<UP><SUB>2</SUB><SUP>−</SUP></UP> generation. The signal was expressed as the sum of all measurements after subtraction of the buffer blank (45). DPI (50 µmol/l) and phenylarsine oxide (1 µmol/l) were added to determine dependence of light generation on flavoprotein- and gp91phox- or NOX-containing NADPH oxidase enzymatic activity, respectively.

RT-PCR detection of NAD(P)H oxidase components. To probe for the presence of p22phox, gp91phox, p47phox, and p67phox components of the putative analog of neutrophil NAD(P)H oxidase and the newly described gp91phox homologs NOX1 (2, 4, 48) and NOX4 (12, 17, 30, 45), we performed semiquantitative RT-PCR, as recently described (10), on triplicate near-confluent cultures of proliferating cells grown in 25-mm plastic dishes. Cell monolayers were washed twice with DPBS and lysed with 4 mol/l guanidine thiocyanate, 25 mmol/l sodium citrate, and 0.5% N-lauroylsarcosine. After scraping, lysates were sheared with four passes through a pipette. RNA was extracted by the phenol-chloroform method (13) and quantitated spectrophotometrically at 260 and 280 nm. RNA (2 µg) was reverse transcribed by using 200 units of M-MLV revere transcriptase (Promega) in a reaction mixture containing 1 mmol/l dATP, dCTP, dGTP, and dTTP, 40 units of RNase inhibitor, 25 µmol/l random hexamers, 5 mmol/l MgCl2, 500 mmol/l KCl, and 100 mmol/l Tris · HCl (pH 8.3) in a total volume of 50 µl. The resultant cDNA was PCR amplified for glyceraldehyde-3-phosphate dehydrogenase (GAPDH), p22phox, gp91phox, p47phox, p67phox, NOX1, and NOX4 by using human gene-specific sense and antisense primers based on sequences published in GenBank: GAPDH-5', ACCACCATGGAGAAGGCTGG; GAPDH-3', CTCAGTGTAGCCCAGGATGC; p22phox-5', ATGGAGCGCTGGGGACAGAAGCACATG; p22phox-3', GATGGTGCCTCCGATCTGCGGCCG; gp91phox-5', TGGTACACACATCATCTCTTTGTG; gp91phox-3', AAAGGGCCCATCAAGCGCTATCTTAGGTAG; NOX1-5', CTGGGTGGTTAACCACTGGTTT; NOX1-3', ACCAATGCCGTGAATCCCTAAG; NOX4-5', TAACCAAGGGCCAGAGTATCACT; NOX4-3', CCGGGAGGGTGGGTATCTAA; p47phox-5', ACCCAGCCAGCACTATGTGT; p47phox-3', AGTAGCCTGTGACGTCGTCT; p67phox-5', CGAGGGAACCAGCTGATAGA; and p67phox-3', CATGGGAACACTGAGCTTCA. PCR was carried out on a Perkin-Elmer DNA thermal cycler 480. Except where indicated, amplification was carried out for 30 cycles for GADPH, 32 cycles for p22phox, 34 cycles for NOX4, and 36 cycles for all other primers at 95°C for 1 min, 58°C for 1 min, and 72°C for 2 min, followed by an extension step at 72°C for 10 min. PCR-amplified DNA was separated on 1.2% agarose gel, stained with ethidium bromide, and visualized and photographed under ultraviolet light. PCR products from defined bands were purified with QiaQuick gel extraction kits (Qiagen, Chatsworth, CA) and sequenced automatically with an ABI Prism 310 genetic analyzer (Applied Biosystems, Foster City, CA) by using the same respective primers for sequencing as for PCR.

Immunoassay for p22phox, gp91phox, Ikappa Balpha , phosphorylated Ikappa Balpha , and p65 component of NF-kappa B. To measure protein expression of p22phox and gp91phox in the cytosol and in the 100,000 g plasma membrane fraction of M1619 cells, we performed immunoassays as detailed earlier (10, 11) using previously described rabbit polyclonal antibodies prepared against whole human p22phox (R3179) (24) and gp91phox COOH-terminal peptide (R2089) (40) at dilutions of 1:1,000. To assess nuclear translocation of the cytosolic transcription factor NF-kappa B, we similarly immunoassayed the p65 NF-kappa B component in nuclear protein that was isolated as outlined below. For immunoassay of the NF-kappa B inhibitor Ikappa Balpha or for Ikappa Balpha phosphorylated at serine 32, we followed the same procedure previously reported (11), with cells lysed in boiling buffer to which 50 mM dithiothreitol had been added as a reducing agent.

Transfection protocol for p22phox and NOX4 sense and antisense treatment of M1619 cells. To transfect antisense oligonucleotides for p22phox, M1619 cells were culture in six-well plates at a density of 20,000 cells/well and grown in RPMI 1640 containing 10% FBS. After 24 h, wells were washed once with DPBS, and 800 µl of RPMI 1640 (serum and antibiotic free) were added to each well. Previously reported (33) p22phox sense (5'-GGTCCTCACCATGGGGCAGATC-3') or antisense (5'-GATCTGCCCCATGGTGAGGACC-3') oligonucleotides (2 µg) were mixed with 5 µl of Lipofectace reagent (Life Technologies) and 200 µl of serum- and antibiotic-free RPMI 1640 at room temperature for 15 min. This mixture was then added to each well, and cells were incubated at 37°C. After 6 h the transfection mixture was gently removed and replaced with 2.5 ml of RPMI 1640 containing 10% FBS. Cell were incubated an additional 48 h before staining with hematoxylin and eosin for photography or quantitation of growth with the MTT assay. M1619 cells were transfected with NOX4 sense (5'-TCGAGGAGGTCCTGTGTCGG-3') or antisense (5'-AGCTCCTCCAGGACACAGCC-3') oligonucleotides based on gene-specific unique sequences published in GenBank (accession no. NM 016931). The transfection protocol was identical to that used for p22phox oligonucleotides, except that 10 µl of Lipofectin reagent (Life Technologies) were used instead, and cells were photographed with a phase-contrast microscope and a green filter.

EMSAs. To assess DNA binding of NF-kappa B or the cAMP response element (CRE) family of binding proteins, nuclear protein was isolated and EMSAs were performed as previously reported (11). The consensus binding oligonucleotides 5'-AGTTGAGGGGACTTTCCCAGGC-3' and 3'-TCAACTCCCCTGAAAGGGTCCG-5' for the p50 component of NF-kappa B, 5'-AGAGATTGCCTGACGTCAGAGAGCTAG-3' and 3'-TCTCTAACGGACTGCAGTCTCTCGATC-5' for CRE, 5'-CGCTTGATGAGTCAGCCGGAA-3' and 3'- GCGAACTACTCAGTCGGCCTT-5' for AP-1, and 5'-TGTCGAATGCAAATCACTAGAA-3' and 3'-ACAGCTTACGTTTAGTGATCTT-5' for OCT-1 were used in binding reactions after end-labeling by phosphorylation with [gamma -32P]ATP and T4 polynucleotide kinase. Competition experiments were performed with 10× respective unlabeled wild-type oligonucleotide sequences, and supershift experiments were carried out by incubating the binding reaction with 1 µg of supershift antibody.

Immunohistochemical localization of NF-kappa B. Constitutive activation of NF-kappa B was also studied by qualitatively assessing nuclear localization of the p65 component by immunohistochemical staining, as described previously (11).

Transduction protocols for Ikappa Balpha gene transfer. To repress activation of NF-kappa B, cells were transduced with adenoviral (Ad serotype 5) vectors that were E1a/E1b-deleted and expressed a superrepressor of NF-kappa B (AdIkappa Balpha SR; 2 × 1011 plaque forming units/ml) under the regulation of the cytomegalovirus (CMV) immediate-early promoter region (6) or expressed the CMV immediate-early promoter region alone (AdCMV-3; 2.05 × 1011 plaque forming units/ml, control vector). These adenoviral vectors were constructed in the Vector Core Laboratory [Gene Therapy Center, University of North Carolina (UNC), Chapel Hill, NC] and were generous gifts, respectively, from Dr. Albert S. Baldwin of the UNC Lineberger Comprehensive Cancer Center and Dr. Andrew Ghio of the U.S. Environmental Protection Agency (UNC Human Health Effects Center). Transduction was performed by using previously published protocols (6). M1619 cells were seeded onto 24-well plates at a density of 25,000 cells/well and grown for 6 h in RPMI 1640 with 10% FBS. Medium was removed and replaced with 200 µl of complete medium containing ~1.25 × 106-2.0 × 107 colony forming units of AdIkappa Balpha SR or AdCMV-3. After overnight incubation, the vector-containing medium was removed, and cells were washed once with warm DPBS and reincubated with fresh complete medium. After an additional 24 h, proliferation was assessed with the MTT assay.

Statistical analysis. Data are expressed as means ± SE for a minimum number of four observations, unless indicated. Differences between two groups were compared using the unpaired Student's t-test. Two-tailed tests of significance were employed. Differences between multiple groups were compared using one-way analysis of variance. The post hoc test used was the Newman-Keuls multiple comparison test. Significance was assumed at P < 0.05.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Malignant melanoma cells produce intracellular ROS. We have previously reported that proliferation of M1619 malignant melanoma cells is strongly inhibited by a number of antioxidants, including the H2O2 scavenger catalase, the sulfhydryl donor N-acetylcysteine, and the glutathione peroxidase mimetic ebselen, suggesting the importance of oxidants in regulating growth of this cell line (11). We have also previously demonstrated that cultured melanoma cells release O<UP><SUB>2</SUB><SUP>−</SUP></UP> into the extracellular medium (11). Because NF-kappa B activation, interleukin-8 and GRO-alpha secretion, O<UP><SUB>2</SUB><SUP>−</SUP></UP> release, and melanoma proliferation were all reduced by the anticoagulant vitamin K antagonist dicumarol, which blocks cytosolic NQO1, we had postulated that M1619 cells generate ROS via the reductive action of NQO on membrane ubiquinone, with subsequent one-electron transfer to O2 to form O<UP><SUB>2</SUB><SUP>−</SUP></UP> (11). M1619 melanoma cells oxidized DCFH to DCF (Fig. 1), suggesting intracellular generation of H2O2 (42). Pretreatment of cells with the flavoprotein inhibitor DPI or dicumarol inhibited intracellular oxidation of DCFH to DCF (Fig. 1). Proliferating epidermal melanocytes also oxidized DCFH to DCF, DCFH oxidation was inhibited by both DPI and dicumarol, and melanocyte proliferation was significantly reduced by addition of catalase to the culture medium (data not shown). Thus, during proliferation, melanomas and melanocytes produce intracellular ROS, oxidant generation is blocked by DPI and dicumarol, and growth is disrupted by antioxidant strategies, suggesting that a signaling oxidase may play a role in regulating cell proliferation.


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 1.   Generation of intracellular reactive oxygen species (ROS) in melanomas is inhibited by diphenylene iodonium (DPI) and dicumarol. Intracellular production of ROS by M1619 cells was measured using oxidation of 2',7'-dichlorofluorescin diacetate (DCFH-DA) to 2',7'-dichlorofluorescein (DCF) (42). DCFH-DA is a nonpolar compound that readily diffuses into cells, where it is hydrolyzed to the nonfluorescent polar derivative DCFH and thereby trapped within the cells. In the presence of H2O2, DCFH is oxidized to the highly fluorescent DCF. Approximately 1 × 106 M1619 cells were incubated in the dark for 10 min at 37°C with 50 µmol/l DCFH-DA, harvested, and resuspended in plain medium. Fluorescence was analyzed in ~10,000 cells each with a FACScan (Becton Dickinson, Sunnyvale, CA) flow cytometer with excitation at 488 nm and emission at 530 nm. Compared with spontaneous fluorescence of cells without DCFH treatment, M1619 melanoma cells oxidized DCFH to DCF. Pretreatment of cells for 15 min with DPI (50 µmol/l) or dicumarol (250 µmol/l) reduced DCFH oxidation to DCF. Treatment with DPI or dicumarol in the absence of DCFH did not result in significant cellular fluorescence within the monitored spectrum (data not shown). Mean fluorescence is 754 for untreated, 408 for DPI, and 396 for dicumarol; median fluorescence is 685 for untreated, 355 for DPI, and 359 for dicumarol.

Malignant melanoma cell membranes produce ROS. To further study the source of O<UP><SUB>2</SUB><SUP>−</SUP></UP> generation, we prepared plasma membrane and cytosolic fractions from proliferating M1619 melanoma cells and studied their respective abilities to support SOD-inhibitable lucigenin chemiluminescence. Plasma membranes alone significantly increased SOD-inhibitable lucigenin chemiluminescence without addition of cell cytosol (Fig. 2). When lucigenin was used at a concentration of 5 µmol/l to prevent artifactual redox cycling (32, 46), the preferred substrate for generation of O<UP><SUB>2</SUB><SUP>−</SUP></UP> was NADPH rather than NADH (Fig. 2, M + NADPH vs. M + NADH). Cytosol from M1619 cells did not support chemiluminescence (Fig. 2, M + C), mitigating against the cytosolic enzyme NQO1 as the source driving O<UP><SUB>2</SUB><SUP>−</SUP></UP> generation in this cell line (11). Also, addition of cytosol to membranes and NADPH did not increase light emission. Chemiluminescence was significantly inhibited by SOD and by addition of the NADPH oxidase inhibitor phenylarsine oxide (31) and the flavoprotein inhibitor DPI. This suggests that light emission is the result of O<UP><SUB>2</SUB><SUP>−</SUP></UP> generated by a membrane NAD(P)H oxidase. Both phenylarsine oxide (10-50 nmol/l) and DPI (10-50 µmol/l) also significantly inhibited M1619 malignant melanoma cell growth (96.2 ± 0.6% and 86.0 ± 0.5% inhibition after 48 h, respectively, at the highest dose of each; P < 0.001), but melanoma growth was unaffected by inhibitors of the other flavoprotein oxidases xanthine oxidase (allopurinol, 1 mmol/l) or nitric oxide synthetase (Nomega -nitro-L-arginine, 100 µmol/l) (data not shown). Chemiluminescence generation was likewise reduced by direct addition of dicumarol to the membrane preparation in the absence of cytosol. This raises the possibility dicumarol inhibits plasma membrane NAD(P)H oxidase activity, perhaps by disrupting substrate binding in a fashion similar to the mechanism by which it inhibits cytosolic NQO1 (34).


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 2.   Plasma membranes from malignant melanoma cells generate ROS. The 100,000 g membrane fraction of proliferating M1619 melanoma cells was prepared as described in text. Chemiluminescence stimulated by 15 µg of membrane protein was measured after incubation for 5 min in the presence of 5 µmol/l lucigenin and 100 µmol/l NADH or NADPH, with and without addition of 50 µg of cytosolic protein, 300 U/ml superoxide dismutase, 50 µmol/l DPI, 1 µmol/l phenylarsine oxide, or 50 µmol/l dicumarol. M, membrane; C, cytosol; SOD, membrane + superoxide dismutase; DC, membrane + dicumarol; PArs, membrane + phenylarsine oxide; DPI, membrane + DPI; n = 4 for each observation. * P < 0.001 vs. M + NADPH.

Malignant melanoma cells and melanocytes express NAD(P)H oxidase components that are necessary for proliferation. The best-described membrane NAD(P)H oxidase is that of the neutrophil. To determine whether components of this NAD(P)H oxidase or its reported homologs are also expressed in melanomas and nonmalignant melanocytes, we performed RT-PCR on RNA extracted from proliferating cells stimulated by 10% FBS (melanomas) or HMGS (melanocytes). M1619 melanoma cells (Fig. 3 A, M1619 melanoma, lane 2) and other malignant melanomas (Table 1) strongly expressed the alpha -subunit of cytochrome b558, p22phox, initially detected at 32 cycles. The 252-base pair PCR product obtained was sequenced and is identical to bases 221-372 of the reported human mRNA sequence (accession no. XM 008040). The cytochrome- and flavin-bearing beta -subunit of the cytochrome, gp91phox, was also present in malignant melanomas (Fig. 3A, M1619 melanoma, lane 3, and Table 1), but only after 36 cycles. This 527-base pair product was sequenced and corresponds to bases 630-1158 of the reported human mRNA sequence (accession no. NM 000397). By immunoassay, both p22phox and gp91phox were easily detectable in the 100,000 g plasma membrane fraction of M1619 melanoma cells (Fig. 3B). No evidence was found for the NOX1 homolog of gp91phox (Fig. 3A, M1619 melanoma, lane 6). However, NOX4 was easily detectable at 34 cycles in M1619 and other malignant melanoma cells (Fig. 3A, M1619 melanoma, lane 7, and 3C, lanes 1-5) as a 564-base pair product, with sequences corresponding to bases 197-741 of the reported human mRNA sequence (accession no. NM 016931). Melanocytes also expressed p22phox (Fig. 3A, melanocytes, lane 2) and NOX4 (Fig. 3A, melanocytes, lane 7) but did not contain mRNA for gp91phox (Fig. 3A, melanocytes, lane 3). The p67phox cytosolic component was observed in M1619 cells (Fig. 3A, M1619 melanoma, lane 5) as a 747-base pair product with sequences identical from bases 556-1283 of the reported human mRNA sequence (accession no. BC 001606) and was also observed in two other malignant melanoma cell lines (Table 1). Faint PCR product was also detected in M1619 cells for the p47phox cytosolic component of the leukocyte NADPH oxidase (Fig. 3A, M1619 melanoma, lane 4), but this product was not sufficiently well expressed to be sequenced. Neither p67phox nor p47phox was found in epidermal melanocytes. Thus three known membrane components (p22phox and two possible partners, gp91phox and NOX4) and the p67phox cytosolic component of the NAD(P)H oxidase are present in proliferating M1619 and other melanoma cells, and p47phox may be expressed at low levels. In contrast, when proliferating, normal melanocytes expressed only p22phox and NOX4.


View larger version (54K):
[in this window]
[in a new window]
 
Fig. 3.   Proliferating malignant melanoma cells express p22phox, gp91phox, NOX4, and p67phox. A: RT-PCR performed on nearly confluent M1619 melanoma cells and normal human epidermal melanocytes. Gels represent RT-PCR at 36 cycles. M1619 cells strongly expressed p22phox (lane 2; first detected at 32 cycles). The 252-base pair PCR product obtained has been sequenced and is identical to bases 221-372 of the reported human mRNA sequence (accession no. XM 008040). Proliferating human melanoma cells also expressed gp91phox (lane 3; detectable only after 36 cycles). The 557-base pair product was sequenced and corresponded to bases 630-1158 of the reported human mRNA sequence (accession no. NM 000397). Normal melanocytes expressed p22phox but not gp91phox. Surprisingly, M1619 melanoma cells strongly and melanocytes modestly expressed the gp91phox homolog NOX4 (lane 7), detected with the primers NOX4-5' TAACCAAGGGCCAGAGTATCACT and NOX4-3' CCGGGAGGGTGGGTATCTAA. The 564-base pair product corresponded to bases 197-741 of the reported human mRNA sequence (accession no. NM 016931). No NOX1 homolog was found in either melanomas or melanocytes (lane 6, 36 cycles). The p67phox cytosolic component was also detected in melanomas (lane 5, 36 cycles). The 727-base pair product has sequences identical to bases 556-1283 of the reported human mRNA sequence (accession no. BC 001606), and faint PCR product was found in melanomas for p47phox (lane 4, 36 cycles). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is shown in lane 1. PCR products were compared with that from an equal amount of mRNA from human polymorphonuclear neutrophils (PMNs; lanes 2-5) or Caco colon carcinoma cells (lanes 6 and 7), respectively, as shown. RT-PCR was performed using human gene-specific sense and antisense primers based on sequences and conducted as detailed in text and in Table 1. B: immunoassays of M1619 cells for p22phox and gp91phox. The 100,000 g membrane fraction from triplicate preparations demonstrated clear evidence of full-size p22phox and gp91phox. A second lighter band in immunoassays for gp91phox may represent unglycosylated protein. C: malignant melanoma cells express NOX4. RT-PCR was performed for 34 cycles using the gene-specific primers as described above. NOX4 was strongly expressed in the malignant melanoma cell lines M1619 (lane 1), M1585 (lane 2), RLW1495 (lane 3), CMC 9212 (lane 4), and RLW 537 (lane 5).


                              
View this table:
[in this window]
[in a new window]
 
Table 1.   RT-PCR expression of NAD(P)H oxidase components in human normal and malignant cell lines

To begin probing the role of individual NAD(P)H oxidase components in melanoma proliferation, we transfected sense and antisense oligonucleotides for p22phox mRNA into growing M1619 cells. A wide range of commercially available tranfection reagents all produced some toxicity to the cells, including the transfection reagents we ultimately employed. Nevertheless, M1619 cells treated with p22phox antisense oligonucleotides had significantly slower growth subsequent to treatment than did identical cells transfected with sense oligonucleotides for p22phox (Fig. 4A). Melanoma cells transfected with NOX4 antisense oligonucleotides also had significantly slower growth subsequent to treatment than did cells transfected with sense oligonucleotides for NOX4 (Fig. 4B). Thus p22phox and NOX4 appear to play roles in growth signaling for this melanoma cell line. Whether p22phox partners with gp91phox or its NOX4 homolog in forming the complete membrane portion of the growth regulatory NAD(P)H oxidase remains to be determined.


View larger version (53K):
[in this window]
[in a new window]
 
Fig. 4.   Antisense oligonucleotides for NAD(P)H oxidase components inhibit melanoma cell proliferation. A: antisense oligonucleotides for p22phox block melanoma growth. M1619 cells (20,000 cells/well) were seeded into 6-well plastic plates and grown for 24 h. Oligonucleotides were transfected into cells using Lipofectace, as detailed in MATERIALS AND METHODS. After 6 h of exposure, transfection solution was replaced with complete medium and cells were grown an additional 48 h. Proliferation was measured by the 3-(4,5,-dimethylthiazol)-2-yl-2,5-diphenyltetrazolium bromide (MTT) assay in triplicate experiments. Compared with sense oligonucleotides, treatment with p22phox antisense oligonucleotides significantly reduced subsequent growth (* P < 0.01 vs. respective sense oligonucleotides). Hematoxylin- and eosin-stained M1619 cells treated with sense or antisense oligonucleotides for p22phox are shown. As did several other transfection reagents, Lipofectace alone also inhibited proliferation compared with untreated cells (55 ± 4%; P < 0.01). B: antisense oligonucleotides for NOX4 block melanoma growth. M1619 cells were transfected with sense and antisense oligonucleotides for NOX4 and studied as in A, except that Lipofectin was used. Compared with sense oligonucleotides, treatment with NOX4 antisense oligonucleotides significantly reduced subsequent growth (* P < 0.01 vs. respective sense oligonucleotides). Phase-contrast micrographs show cells treated with sense or antisense oligonucleotides for NOX4. As did Lipofectace, Lipofectin alone also inhibited proliferation compared with untreated cells (21 ± 1%; P < 0.01).

Using the same primers, we also detected expression of p22phox, gp91phox, and occasionally p67phox by other malignant cell lines, including small cell and non-small cell lung cancers and ovarian, breast, and prostate adenocarcinomas (Table 1). Prostate LnCap carcinoma expressed the NOX1 homolog. H82 small cell carcinoma strongly and H520 squamous cell lung cancer weakly expressed NOX4 (data not shown).

NF-kappa B is constitutively expressed in melanoma cells and may be regulated by the NAD(P)H oxidase. We have previously reported that NF-kappa B is constitutively activated in M1619 melanoma cells (11). NF-kappa B is also constitutively activated in proliferating human epidermal melanocytes (35). The flavoprotein-dependent NAD(P)H oxidase inhibitor DPI reduced constitutive activation of NF-kappa B in melanoma cells as studied by NF-kappa B DNA binding activity (Fig. 5, A and B), immunohistochemically detectable p65 in nuclei (Fig. 5, C vs. D), and immunoassay of the p65 NF-kappa B component in nuclear protein (Fig. 5E). DPI treatment of melanoma cells also decreased phosphorylation of the NF-kappa B inhibitor Ikappa Balpha (Fig. 5F). Taken together, these findings and those reported previously (11) suggest that a flavoprotein-containing NAD(P)H oxidase may play a role in stimulating constitutive NF-kappa B transcriptional activity in these cells through generation of ROS.


View larger version (76K):
[in this window]
[in a new window]
 
Fig. 5.   Nuclear factor (NF)-kappa B activation in melanomas is inhibited by the NAD(P)H oxidase inhibitor DPI. A: the flavoprotein-dependent NAD(P)H oxidase inhibitor DPI decreases NF-kappa B DNA binding. Near-confluent (70%) cultures of M1619 cells (n = 3 per group) were incubated overnight with or without 50 µmol/l DPI. Cells were then lysed, nuclear protein was isolated, and electrophoretic mobility shift assays (EMSAs) were performed with 32P-labeled NF-kappa B consensus oligonucleotides. The p65/p50-containing dimer is indicated by the arrow. Constitutive NF-kappa B DNA binding of melanoma cells was greatly reduced in DPI-treated cells (lanes 4-6), compared with cells incubated in growth medium alone (lanes 1-3). FBS, fetal bovine serum; CRE, cAMP responsive element. B: densitometry results of the p65-p50-containing bands from gels in A. * P < 0.001 compared with no DPI. C: constitutive nuclear translocation of NF-kappa B is demonstrated in M1619 cells by intense brown immunohistochemical staining for p65 in nuclei. Confluent cells were fixed in paraformaldehyde, permeabilized, stained with an antibody to the p65 component of NF-kappa B and a streptavidin-biotin-immunoperoxidase-based method outlined in text, viewed under light microscopy with a blue filter to enhance contrast, and photographed at ×400 magnification. D: DPI (50 µmol/l overnight) reduced constitutive nuclear translocation of NF-kappa B. Compared with the intense brown nuclear staining for p65 shown in C, DPI-treated M1619 cells demonstrate little anti-p65 brown staining in nuclei. Nucleoli are recognizable in DPI-treated cells (D) but are only occasionally visible in untreated control cells (C). E: DPI reduced immunoreactive p65 in nuclear protein. Near-confluent (75%) cultures of M1619 cells (n = 3 per group) were incubated overnight with (lanes 4-6) or without (lanes 1-3) 50 µmol/l DPI. Nuclear protein was isolated, and immunoassays were performed for the p65 component of NF-kappa B. F: DPI inhibited phosphorylation of the NF-kappa B inhibitor (Ikappa Balpha ). Near-confluent (75%) cultures of M1619 cells (n = 3 per group) were incubated overnight with (lanes 4-6) or without (lanes 1-3) 25 µmol/l DPI. Cells were lysed, and immunoassays were performed with a phospho-specific antibody for Ikappa Balpha phosphorylated at serine 32 (Ikappa Balpha -P).

Inhibition of NF-kappa B does not impair melanoma proliferation. Inhibition of NF-kappa B by antisense strategies reduces tumorigenicity of fibrosarcomas (20), and overexpression of the NF-kappa B inhibitor Ikappa Balpha blocks tumor cell growth of Hodgkin's disease (5), squamous cell lung cancer (6), squamous cell head and neck cancer (16), and breast cancer (47) cells. We therefore infected M1619 cells with an adenoviral vector encoding a superrepressor version of the NF-kappa B inhibitor Ikappa Balpha (AdIkappa Balpha SR) to determine whether selectively inhibiting NF-kappa B could reduce M1619 melanoma cell proliferation. Infection with AdIkappa Balpha SR resulted in dose-related increases Ikappa Balpha SR expression (Fig. 6A). However, infection with even the highest dose (1 × 107 colony forming units) of AdIkappa Balpha SR did not substantially reduce M1619 melanoma proliferation (Fig. 6B), especially compared with the profound growth inhibitory effect shown by antioxidants and NAD(P)H oxidase inhibitors in Fig. 1. Therefore, oxidant generation by a growth regulatory NAD(P)H oxidase must regulate proliferation through other signal transduction pathways.


View larger version (49K):
[in this window]
[in a new window]
 
Fig. 6.   Inhibition of NF-kappa B does not reduce melanoma proliferation. A: immunoassays of control M1619 cells or cells transduced with the adenovirus-linked superrepressor form of Ikappa Balpha (AdIkappa Balpha SR). Cells were grown to near confluence on 25-mm petri dishes and then transduced with 2.5 × 106-1.0 × 107 colony forming units (CFU) of AdIkappa Balpha SR. After 24 h, cells were lysed and immunoblots were performed for Ikappa Balpha . The Ikappa Balpha SR form of Ikappa Balpha is shown as a band (arrow) slightly heavier than native Ikappa Balpha . B: transduction with Ikappa Balpha SR did not impair melanoma proliferation. M1619 melanoma cells were seeded onto 24-well plates at a density of 25,000 cells/well and grown for 6 h in RPMI 1640 and 10% FBS. Medium was removed and replaced with 200 µl of complete medium containing 1 × 107 CFU of AdIkappa Balpha SR or the adenoviral vector linked to the cytomegalovirus promoter (AdCMV-3). After overnight incubation, the vector-containing medium was removed and cells were washed once with warm DPBS and then reincubated with fresh complete medium. After an additional 24 h, proliferation was quantitated with the MTT assay. Both AdIkappa Balpha SR and AdCMV-3 slightly reduced proliferation, but neither had the profound inhibitory effect shown by antioxidants or NAD(P)H oxidase inhibitors in Fig. 1. Ad vector, adenoviral vector. * P < 0.05 vs. FBS.

Inhibition of NAD(P)H oxidase in melanoma cells reduces DNA binding activity for CRE. Another family of redox responsive transcription factors important for melanoma proliferation are activating transcription factor/CRE-binding (ATF/CREB) proteins that bind CRE. The transcription factor CREB and its associated family member ATF-1 promote tumor growth, metastasis, and survival through CRE-dependent gene expression (58), and expression of the dominant negative KCREB construct in melanoma cells decreases their tumorigenicity and metastatic potential in nude mice (23). We therefore explored whether inhibition of NAD(P)H oxidase in melanoma cells might reduce DNA binding of transcription factors to CRE. As reported previously for the MeWo melanoma cell line (23, 58), proliferating M1619 cells displayed prominent DNA binding activity for CRE, composed of ATF-1, ATF-2, and CREB-1 transcription factors (Fig. 7A). Treatment of proliferating M1619 cells overnight with DPI inhibits CRE-binding activity in a dose-dependent manner (Fig. 7, B and C) but does not change DNA binding activity of nuclear protein for the transcription factors AP-1 (Fig. 7D) or OCT-1 (Fig. 7E). Thus the growth regulatory NAD(P)H oxidase may signal melanoma proliferation in part through activation of CRE-mediated transcriptionally related events.


View larger version (65K):
[in this window]
[in a new window]
 
Fig. 7.   NAD(P)H oxidase inhibition reduces DNA binding to the CRE but not to activator protein-1 (AP-1) or OCT-1. A: proliferating M1619 melanoma cells displayed prominent DNA binding activity (lanes 1 and 6) for the CRE. Supershift experiments with specific antibodies demonstrated that the CRE binding protein (CREB) family members activating transcription factor (ATF)-1 (lane 2), ATF-2 (lane 3), and CREB-1 (lane 4) contribute to DNA binding activity for CRE. A competition experiment is shown at right, in which addition of 10× molar excess unlabeled CRE (lane 7) but not AP-1 (lane 8) eliminated DNA binding activity for CRE in melanoma nuclear protein. B: DPI inhibited CRE DNA binding activity in M1619 cells in a dose-dependent manner. Near-confluent cultures of M1619 cells were treated overnight with DPI, and nuclear protein was harvested for EMSAs. Compared with that in untreated cells (lanes 1-3), treatment with DPI inhibits DNA binding of nuclear protein to CRE in a dose-dependent manner (lanes 4-6, 10 µmol/l; lanes 7-9, 15 µmol/l; lanes 10-12, 20 µmol/l). C: densitometry results of EMSAs shown in B. * P < 0.001 vs. untreated cells. D: DPI treatment of M1619 cells did not inhibit DNA binding to the AP-1 oligonucleotide consensus sequence. Lanes 1-3, untreated cells; lanes 4-6, cells treated with 10 µmol/l; lanes 7-9, cells treated with 15 µmol/l; lanes 10-12, cells treated with 20 µmol/l. E: DPI treatment of M1619 cells did not inhibit DNA binding to the OCT-1 oligonucleotide consensus sequence. Lanes 1-3, untreated cells; lanes 4-6, cells treated with 10 µmol/l; lanes 7-9, cells treated with 15 µmol/l; lanes 10-12, cells treated with 20 µmol/l.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

In this report we demonstrate evidence for a growth regulatory oxidase activity in human malignant melanoma cells. By using RT-PCR, we found clear evidence in M1619 melanoma cells for mRNA expression of the NAD(P)H oxidase components p22phox, gp91phox, the gp91phox homolog NOX4, p67phox, and possibly p47phox (Fig. 3, A and C). Expression of oxidase components is not necessarily a transforming event in melanomas, because p22phox and NOX4 were also expressed in normal melanocytes. However, several oxidase components appear critically important for malignant growth, because melanoma proliferation is reduced by transfection of antisense but not sense oligonucleotides p22phox (Fig. 4A) and NOX4 (Fig. 4B). Thus the NAD(P)H oxidase is a normal component of signaling machinery that may be parasitized to serve malignant proliferation.

The putative melanoma NAD(P)H oxidase shares some of the functional properties of the NAD(P)H oxidase of phagocytes but with important differences. Like the phagocyte oxidase, the initial enzyme product appears to be O<UP><SUB>2</SUB><SUP>−</SUP></UP> (Fig. 2). Also, the melanoma oxidase activity appears to be localized in membranes rather than in the cytosol (Fig. 2), but whether it is found at the cell surface or at an endoplasmic location remains to be explored. Similar to what has been reported recently for vascular smooth muscle cells (46), the melanoma oxidase utilizes NADPH as its preferred substrate (Fig. 2). However, the exact functionally important components of the melanoma oxidase, and their potential interactions, remain to be settled. Because both are expressed, more work is needed to identify whether gp91phox or NOX4 is the dominant functional homolog important for oxidase performance. A similar dilemma exists in vascular smooth muscle cells, which express gp91phox, NOX1, and NOX4 but appear to employ only NOX1 as the functional homolog (30).

In phagocytes, the NAD(P)H oxidase consists of two membrane proteins, gp91phox and p22phox, that bind a flavin adenine nucleotide (FAD) and form a cytochrome with a redox midpoint potential of -245 mV and a reduced-minus-oxidized difference spectrum of 558 (3). At least two and possibly three cytosolic proteins (p47phox, p67phox, and p40) are also essential, and several other cytosolic components participate, including the small GTPases Rac1 or Rac2. The oxidase is thought to contain all the factors necessary for transporting electrons from the donor substrate NADPH via FAD to generate O<UP><SUB>2</SUB><SUP>−</SUP></UP> from molecular O2. A similar oxidase has recently been reported to serve a signaling function in nonphagocytic cells, where it appears to share some of the components with its phagocyte cousin but with critical distinctions, including a delayed time course for activation and lower level of activity. Endothelial cells appear to express all the phagocyte oxidase components, including gp91phox, p22phox, p47phox, and p67phox (18, 25). In contrast, vascular smooth muscle cells express p22phox (19, 51), p47phox (19), and the unique homolog NOX1 (2, 4, 19, 48). Yet another gp91phox homolog, NOX4, has been described in renal tubular epithelial cells (17, 45), fetal tissue (12), placenta (12), and proliferating vascular smooth muscle (30). We now report NOX4 in normal human epidermal melanocytes and in malignant melanoma cells, where interference with its expression substantially inhibits malignant proliferation (Fig. 4B). These results differ from experiments in normal cells, where NOX4 transfection suppresses rather than enhances proliferation (17, 45). However, the finding of NOX4 in renal cell carcinomas (45), glioblastomas (12), Caco colon cancer cells (12), and now in malignant melanomas raises the possibility that this unique homolog might play an important redox signaling role necessary for malignant prosperity and progression.

A potentially large number of signal transduction and gene expression systems might be influenced by a growth regulatory NAD(P)H oxidase (2), among which is the redox-regulated transcription factor NF-kappa B. We have previously shown that antioxidants reduce Ikappa Balpha phosphorylation and constitutive NF-kappa B activation in malignant melanoma cells (11). We now demonstrate that the flavoprotein inhibitor DPI reduces Ikappa Balpha phosphorylation (Fig. 5F) and constitutive NF-kappa B activation (Fig. 5, A-E), suggesting that ROS from an NAD(P)H oxidase contribute to constitutive NF-kappa B activation. NF-kappa B has been recently demonstrated to be important for malignant proliferation of a variety of cancers (5, 6, 9, 47, 55). Repression of NF-kappa B interferes with normal and transformed cell proliferation (21, 27), and inhibition of NF-kappa B by antisense strategies (20) or overexpression of the NF-kappa B inhibitor Ikappa Balpha (5, 6, 16, 47) blocks tumor growth. In malignant melanomas NF-kappa B is activated as a result of enhanced constitutive Ikappa B kinase activity (44) and is thought to play a significant role in autocrine generation by melanomas of the chemokines MGSA-alpha /GRO-alpha and interleukin-8 (56). However, in contrast to results with other tumor types, we were unable to suppress growth of M1619 melanoma cells by expression of a superrepressor form of the NF-kappa B inhibitor Ikappa Balpha (Fig. 6). Thus NF-kappa B activation in this melanoma cell line may play a greater role in conferring resistance of the tumor to apoptosis, chemotherapy, and radiation through upregulating expression of antiapoptotic Bcl-2 family proteins (7, 52, 53). As shown by the significant inhibition by DPI of DNA binding to CRE (Fig. 7, B and C), an alternative group of transcription factors that could be redox regulated by the NAD(P)H oxidase is the ATF/CREB family (1, 29). Molecular disruption of ATF/CREB-mediated transcription has been previously shown to reduce proliferation, metastatic potential, and radiation resistance of malignant melanomas (14, 23, 41, 57, 58).

Others have previously shown the importance of O<UP><SUB>2</SUB><SUP>−</SUP></UP> in mitogenic signaling (22, 26), and transfection with NOX1 transforms normal fibroblasts (48) and creates cell lines that are tumorigenic in athymic mice (2). The exact contribution of autocrine ROS toward the transformed, neoplastic condition is still unclear. However, based on its strategic role in melanomas and its presence in other malignant cell lines (12, 28, 45, 48, 54), a membrane NAD(P)H oxidase may be fundamentally important for growth signaling in a broad array of tumors. If so, NAD(P)H oxidase inhibitors might present a new strategy for cancer therapy, with coumarin analogs offering promise to this end. We had previously shown that dicumarol inhibits ferricytochrome c reduction, constitutive NF-kappa B activation, and proliferation in melanomas (11). In this report we show that dicumarol inhibits lucigenin chemiluminescence by melanoma plasma membranes in an in vitro system lacking cytosolic components (Fig. 2), suggesting inhibition of membrane NAD(P)H oxidase activity. Other coumarins have previously been reported to block O<UP><SUB>2</SUB><SUP>−</SUP></UP> by the neutrophil NADPH oxidase (8, 39). Furthermore, prolonged treatment with the coumarin warfarin has been recently shown to reduce subsequent risk of cancer (43). This beneficial effect of warfarin has been attributed to anticoagulation (43, 59), but an alternative possibility is that certain coumarins inhibit a growth regulatory NAD(P)H oxidase important for malignant cell growth.


    ACKNOWLEDGEMENTS

This work was funded by grants from the Charlotte-Mecklenberg Health Care Foundation and in part by National Institutes of Health Grants HL-40665 (to J. R. Hoidal), HL-61377 (to A. R. Whorton), and AR-42426 and HL-66767 (to M. T. Quinn).


    FOOTNOTES

Address for reprint requests and other correspondence: T. P. Kennedy, Carolinas Medical Center, 410 Cannon Research Center, PO Box 32861, Charlotte, NC 28232 (E-mail: tkennedy{at}carolinas.org).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

First published January 2, 2002;10.1152/ajpcell.00496.2001

Received 16 October 2001; accepted in final form 17 December 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Andrisani, OM. CREB-mediated transcriptional control. Crit Rev Eukaryot Gene Expr 9: 19-32, 1999.

2.   Arnold, R, Shi J, Murad E, Whalen AM, Sun CQ, Polavarapu R, Parthasarathy S, Petros JA, and Lambeth JD. Hydrogen peroxide mediates the cell growth and transformation caused by the mitogenic oxidase Nox1. Proc Natl Acad Sci USA 98: 5550-5555, 2001.

3.   Babior, BM. NADPH oxidase: an update. Blood 93: 1464-1476, 1999.

4.   Banfi, B, Maturana A, Jaconi S, Arnaudeau S, Laforge T, Sinha B, Ligeti E, Demaurex N, and Krause KH. A mammalian H+ channel generated through alternative splicing of the NADPH oxidase homolog NOH-1. Science 287: 138-142, 2000.

5.   Bargou, RC, Emmerich F, Drappmann D, Bommert K, Mapara MY, Arnold W, Royer HD, Grinstein E, Greiner A, Scheidereit C, and Dorken B. Constitutive nuclear factor-kappa B-Rel A activation is required for proliferation and survival of Hodgkin's disease tumor cells. J Clin Invest 100: 2961-2969, 1997.

6.   Batra, RK, Gutteridge DC, Brenner DA, Dubinett SM, Baldwin AS, and Boucher RC. Ikappa Balpha gene transfer is cytotoxic to squamous-cell lung cancer cells and sensitizes them to tumor necrosis factor-alpha -mediated cell death. Am J Respir Cell Mol Biol 21: 238-245, 1999.

7.   Beg, AA, and Baltimore D. An essential role for NF-kappa B in preventing TNF-alpha -induced cell death. Science 274: 782-784, 1996.

8.   Bertocchi, F, Breviario F, Proserpio P, Wang JM, Ghezzi P, Travagli RA, Prosdocimi M, and Dejana E. In vitro inhibition of human polymorphonuclear cell function by cloricromene. Naunyn Schmiedebergs Arch Pharmacol 339: 697-703, 1989.

9.   Bours, V, Dejardin E, Goujon-Letawe F, Merville MP, and Castronovo B. The NF-kappa B transcription factor and cancer: high expression of NF-kappa B- and Ikappa B-related proteins in tumor cell lines. Biochem Pharmacol 47: 145-149, 1994.

10.   Brar, SS, Kennedy TP, Whorton AR, Murphy TM, Chitano P, and Hoidal JR. Requirement for reactive oxygen species in serum-induced and platelet-derived growth factor-induced growth of airway smooth muscle. J Biol Chem 274: 20017-20026, 1999.

11.   Brar, SS, Kennedy TP, Whorton AR, Sturrock AB, Huecksteadt TP, Ghio AJ, and Hoidal JR. Reactive oxygen species from NAD(P)H:quinone oxidoreductase constitutively activate NF-kappa B in malignant melanoma cells. Am J Physiol Cell Physiol 280: C659-C676, 2001.

12.   Cheng, G, Cao Z, Xu X, van Meir EG, and Lambeth JD. Homologs of gp91phox: cloning and tissue expression of Nox3, Nox4 and Nox5. Gene 269: 131-140, 2001.

13.   Chomczynski, P, and Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156-159, 1987.

14.   Cox, PM, and Goding CR. An ATF/CREB binding motif is required for aberrant constitutive expression of the MHC class II Dralpha promoter and activation by SV40 T-antigen. Nucleic Acids Res 20: 4881-4887, 1992.

15.   Del Bello, B, Paolicchi A, Comporti M, Pompella A, and Maellaro E. Hydrogen peroxide produced during gamma -glutamyl transpeptidase activity is involved in prevention of apoptosis and maintenance of proliferation in U937 cells. FASEB J 13: 69-79, 1999.

16.   Duffey, DC, Chen Z, Dong G, Ondrey FG, Wolf JS, Brown K, Siebenlist U, and Van Waes C. Expression of a dominant-negative mutant inhibitor-kappa Balpha of nuclear factor-kappa B in human head and neck squamous cell carcinoma inhibits survival, proinflammatory cytokine expression, and tumor growth in vivo. Cancer Res 59: 3468-3474, 1999.

17.   Geiszt, M, Kopp JB, Varnai P, and Leto TL. Identification of renox, an NAD(P)H oxidase in kidney. Proc Natl Acad Sci USA 97: 8010-8014, 2000.

18.   Gorlach, A, Brandes RP, Nguyen K, Amidi M, Dehghani F, and Busse R. A gp91phox containing NADPH oxidase selectively expressed in endothelial cells is a major source of oxygen radical generation in the arterial wall. Circ Res 87: 26-32, 2000.

19.   Griendling, KK, Sorescu D, and Ushio-Fukai M. NAD(P)H oxidase: role in cardiovascular biology and disease. Circ Res 86: 494-501, 2000.

20.   Higgins, KA, Perez JR, Coleman TA, Dorshkind K, McComas WA, Sarmiento UM, Rosen CA, and Narayanan R. Antisense inhibition of the p65 subunit of NF-kappa B blocks tumorigenicity and causes tumor regression. Proc Natl Acad Sci USA 90: 9901-9905, 1993.

21.   Hinz, M, Krappmann D, Eichten A, Heder A, Scheidereit C, and Strauss M. NF-kappa B function in growth control: regulation of cyclin D1 expression and G0G1-to-S-phase transition. Mol Cell Biol 19: 2690-2698, 1999.

22.   Irani, K, Xia Y, Zweier JL, Sollott SJ, Der CJ, Fearon ER, Sundaresan M, Finkel T, and Goldschmidt-Clermont PJ. Mitogenic signaling mediated by oxidants in ras-transformed fibroblasts. Science 275: 1649-1652, 1997.

23.   Jean, D, Harbison M, McConkey DJ, Ronai Z, and Bar-Eli M. CREB and its associated proteins act as survival factors for human melanoma cells. J Biol Chem 273: 24884-24890, 1998.

24.   Jesaitis, AJ, Buescher ES, Harrison D, Quinn MT, Parkos CA, Livesey S, and Linner J. Ultrastructural localization of cytochrome b in the membranes of resting and phagocytosing human granulocytes. J Clin Invest 85: 821-835, 1990.

25.   Jones, SA, O'Donnell VB, Wood JD, Broughton JP, Hughes EJ, and Jones OTG Expression of phagocyte NADPH oxidase components in human endothelial cells. Am J Physiol Heart Circ Physiol 271: H1626-H1634, 1996.

26.   Joneson, T, and Bar-Sagi D. A Rac1 effector site controlling mitogenesis through superoxide production. J Biol Chem 273: 17991-17994, 1998.

27.   Kaltschmidt, B, Kaltschmidt C, Hehner SP, Droge W, and Schmitz ML. Repression of NF-kappa B impairs HeLa cell proliferation by functional interference with cell cycle checkpoint regulators. Oncogene 18: 3213-3225, 1999.

28.   Kikuchi, H, Hikage M, Miyashita H, and Fukumoto M. NADPH oxidase subunit, gp91phox homologue, preferentially expressed in human colon epithelial cells. Gene 254: 237-243, 2000.

29.   Kurata, SI. Selective activation of p38 MAPK cascade and mitotic arrest caused by low level oxidative stress. J Biol Chem 275: 23413-233416, 2000.

30.   Lassegue, B, Sorescu D, Szocs K, Yin Q, Akers M, Zhang Y, Grant SL, Lambeth JD, and Griendling KK. Novel gp91phox homologs in vascular smooth muscle cells: Nox1 mediates angiotensin II-induced superoxide formation and redox-sensitive signaling pathways. Circ Res 88: 888-894, 2001.

31.   Le Cabec, V, and Maridonneau-Parini I. Complete and reversible inhibition of NADPH oxidase in human neutrophils by phenylarsine oxide at a step distal to membrane translocation of the enzyme subunits. J Biol Chem 270: 2067-2073, 1995.

32.   Li, Y, Zhu H, Kuppusamy P, Roubaud V, Zweier JL, and Trush MA. Validation of lucigenin (bis-N-methylacridinium) as a chemilumigenic probe for detecting superoxide anion radical production by enzymatic and cellular systems. J Biol Chem 273: 2015-2023, 1998.

33.   Lynn, S, Gurr JR, Lai HT, and Jan KY. NADH oxidase activation is involved in arsenite-induced oxidative DNA damage in human vascular smooth muscle cells. Circ Res 86: 514-519, 2000.

34.   Ma, Q, Cui K, Ziao F, Lu AYH, and Yang CS. Identification of a glycine-rich sequence as a NAD(P)H-binding site and tyrosine 128 as a dicumarol-binding site in rat liver NAD(P)H:quinone oxidoreductase by site-directed mutagenesis. J Biol Chem 267: 22298-22304, 1992.

35.   Meyskens, FL, Jr, Buckmeier JA, McNulty SE, and Tohidian NB. Activation of nuclear factor-kappa B in human metastatic melanoma cells and the effect of oxidative stress. Clin Cancer Res 5: 1197-1202, 1999.

36.   Mohazzab-H, KM, and Wolin MS. Sites of superoxide anion production detected by lucigenin in calf pulmonary artery smooth muscle. Am J Physiol Lung Cell Mol Physiol 267: L815-L822, 1994.

37.   Morre, DJ, Cheuh PJ, and Morre DM. Capsaicin inhibits preferentially the NADH oxidase and growth of transformed cells in culture. Proc Natl Acad Sci USA 92: 1831-1835, 1995.

38.   Pagano, PJ, Clark JK, Cifuentes-Pagno ME, Clark SM, Callis GM, and Quinn MT. Localization of a constitutively active, phagocyte-like NADPH oxidase in rabbit aortic adventitia: enhancement by angiotensin II. Proc Natl Acad Sci USA 94: 14483-14488, 1997.

39.   Paya, M, Ferrandiz ML, Miralles F, Montesinos C, Ubeda A, and Alcaraz MJ. Effects of coumarin derivatives on superoxide anion generation. Arzneimittelforschung 43: 655-658, 1993.

40.   Quinn, MT, Parkos CA, Walker L, Orkin SH, Dinauer MC, and Jesaitis AJ. Association of a ras-related protein with cytochrome b of human neutrophils. Nature 342: 198-200, 1989.

41.   Ronai, Z, Yang YM, Fuchs SY, Adler V, Sardana M, and Herlyn M. ATF2 confers radiation resistance to human melanoma cells. Oncogene 16: 523-531, 1998.

42.   Royall, JA, and Ischiropoulos H. Evaluation of 2',7'-dichlorofluorescin and dihydrorhodamine 123 as fluorescent probes for intracellular H2O2 in cultured endothelial cells. Arch Biochem Biophys 302: 348-355, 1993.

43.   Schulman, S, and Linmarker P. Incidence of cancer after prophylaxis with warfarin against recurrent venous thromboembolism. N Engl J Med 342: 1953-1958, 2000.

44.   Shattuck-Brandt, RL, and Richmond A. Enhanced degradation of I-kappa Balpha contributes to endogenous activation of NF-kappa B in Hs294T melanoma cells. Cancer Res 57: 3032-3039, 1997.

45.   Shiose, A, Kuroda J, Tsuruya K, Hirai M, Hirakata H, Naito S, Hattori M, Sakaki Y, and Sumimoto H. A novel superoxide-producing NAD(P)H oxidase in kidney. J Biol Chem 276: 1417-1423, 2001.

46.   Sorescu, D, Somers MJ, Lassegue B, Grant S, Harrison DG, and Griendling KK. Electron spin resonance characterization of the NAD(P)H oxidase in vascular smooth muscle cells. Free Radic Biol Med 30: 603-612, 2001.

47.   Sovak, MA, Bellas RE, Kim DW, Zanieski GJ, Rogers AE, Traish TM, and Sonenshein GE. Aberrant nuclear factor-kappa B/Rel expression and the pathogenesis of breast cancer. J Clin Invest 100: 2952-2960, 1997.

48.   Suh, YA, Arnold RS, Lassegue B, Shi J, Xu X, Sorescu D, Chung AB, Griendling KK, and Lambeth JD. Cell transformation by the superoxide-generating oxidase Mox1. Nature 410: 79-82, 1999.

49.   Szatrowski, TP, and Nathan CF. Production of large amounts of hydrogen peroxide by human tumor cells. Cancer Res 51: 794-798, 1991.

50.   Traver, RD, Siegel D, Beall HD, Phillips RM, Gibson NW, Franklin WA, and Ross D. Characterization of a polymorphism in NAD(P)H:quinone oxidoreductase (DT-diaphorase). Br J Cancer 75: 69-75, 1997.

51.   Ushio-Fukai, M, Zafari AM, Fukui T, Ishizaka N, and Griendling KK. p22phox is a critical component of the superoxide-generating NADH/NADPH oxidase system and regulates angiotensin II-induced hypertrophy in vascular smooth muscle cells. J Biol Chem 271: 23317-23321, 1996.

52.   Wang, CY, Cusack JS, Jr, Liu R, and Baldwin AS, Jr. Control of inducible chemoresistance: enhanced anti-tumor therapy through increased apoptosis by inhibition of NF-kappa B. Nat Med 5: 412-417, 1999.

53.   Wang, CY, Mayo MW, and Baldwin AS, Jr. TNF- and cancer therapy-induced apoptosis: potentiation by inhibition of NF-kappa B. Science 274: 784-789, 1996.

54.   Wang, D, Youngson C, Wong V, Yeger H, Dinauer MC, Vega-Saenz Miera E, Rudy B, and Cutz E. NADPH-oxidase and a hydrogen peroxide-sensitive K+ channel may function as an oxygen sensor complex in airway chemoreceptors and small cell lung carcinoma cell lines. Proc Natl Acad Sci USA 93: 13182-13187, 1996.

55.   Wang, W, Abbruzzese JL, Evans DB, Larry L, Cleary KR, and Chiao PJ. The nuclear factor-kappa B RelA transcription factor is constitutively activated in human pancreatic adenocarcinoma cells. Clin Cancer Res 5: 110-127, 1999.

56.   Yang, J, and Richmond A. Constitutive Ikappa B kinase activity correlates with nuclear factor-kappa B activation in human melanoma cells. Cancer Res 61: 4901-4909, 2001.

57.   Xie, S, Luca M, Huang SY, Gutman M, Reich R, Johnson JP, and Bar-Eli M. Expression of MCAM/MUC18 by human melanoma cells leads to increased tumor growth and metastasis. Cancer Res 57: 2295-2303, 1997.

58.   Xie, S, Price JE, Luca M, Jean D, Ronai Z, and Bar-Eli M. Dominant-negative CREB inhibits tumor growth and metastasis of human melanoma cells. Oncogene 15: 2069-2075, 1997.

59.   Zielinski, CC, and Hejna M. Warfarin for cancer prevention. N Engl J Med 342: 1991-1993, 2000.


Am J Physiol Cell Physiol 282(6):C1212-C1224
0363-6143/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
Cancer Res.Home page
M. Yamaura, J. Mitsushita, S. Furuta, Y. Kiniwa, A. Ashida, Y. Goto, W. H. Shang, M. Kubodera, M. Kato, M. Takata, et al.
NADPH Oxidase 4 Contributes to Transformation Phenotype of Melanoma Cells by Regulating G2-M Cell Cycle Progression
Cancer Res., March 15, 2009; 69(6): 2647 - 2654.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
K. Chen, M. T. Kirber, H. Xiao, Y. Yang, and J. F. Keaney Jr.
Regulation of ROS signal transduction by NADPH oxidase 4 localization
J. Cell Biol., October 22, 2008; 181(7): 1129 - 1139.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
K. Bedard and K.-H. Krause
The NOX Family of ROS-Generating NADPH Oxidases: Physiology and Pathophysiology
Physiol Rev, January 1, 2007; 87(1): 245 - 313.
[Abstract] [Full Text] [PDF]


Home page
Integr Cancer TherHome page
M. F. McCarty and K. I. Block
Preadministration of High-Dose Salicylates, Suppressors of NF-{kappa}B Activation, May Increase the Chemosensitivity of Many Cancers: An Example of Proapoptotic Signal Modulation Therapy
Integr Cancer Ther, September 1, 2006; 5(3): 252 - 268.
[Abstract] [PDF]


Home page
Cardiovasc ResHome page
L. Moldovan, K. Mythreye, P. J. Goldschmidt-Clermont, and L. L. Satterwhite
Reactive oxygen species in vascular endothelial cell motility. Roles of NAD(P)H oxidase and Rac1
Cardiovasc Res, July 15, 2006; 71(2): 236 - 246.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
H. ten Freyhaus, M. Huntgeburth, K. Wingler, J. Schnitker, A. T. Baumer, M. Vantler, M. M. Bekhite, M. Wartenberg, H. Sauer, and S. Rosenkranz
Novel Nox inhibitor VAS2870 attenuates PDGF-dependent smooth muscle cell chemotaxis, but not proliferation
Cardiovasc Res, July 15, 2006; 71(2): 331 - 341.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. G. Havens, A. Ho, N. Yoshioka, and S. F. Dowdy
Regulation of Late G1/S Phase Transition and APCCdh1 by Reactive Oxygen Species
Mol. Cell. Biol., June 15, 2006; 26(12): 4701 - 4711.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Ishihara and N. Shimamoto
Involvement of Endonuclease G in Nucleosomal DNA Fragmentation under Sustained Endogenous Oxidative Stress
J. Biol. Chem., March 10, 2006; 281(10): 6726 - 6733.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. H.M. Ellmark, G. J. Dusting, M. Ng Tang Fui, N. Guzzo-Pernell, and G. R. Drummond
The contribution of Nox4 to NADPH oxidase activity in mouse vascular smooth muscle
Cardiovasc Res, February 1, 2005; 65(2): 495 - 504.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
S. S. Brar, C. Grigg, K. S. Wilson, W. D. Holder Jr., D. Dreau, C. Austin, M. Foster, A. J. Ghio, A. R. Whorton, G. W. Stowell, et al.
Disulfiram inhibits activating transcription factor/cyclic AMP-responsive element binding protein and human melanoma growth in a metal-dependent manner in vitro, in mice and in a patient with metastatic disease
Mol. Cancer Ther., September 1, 2004; 3(9): 1049 - 1060.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
B. Lassegue and R. E. Clempus
Vascular NAD(P)H oxidases: specific features, expression, and regulation
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2003; 285(2): R277 - R297.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
Y. Gorin, J. M. Ricono, N.-H. Kim, B. Bhandari, G. G. Choudhury, and H. E. Abboud
Nox4 mediates angiotensin II-induced activation of Akt/protein kinase B in mesangial cells
Am J Physiol Renal Physiol, August 1, 2003; 285(2): F219 - F229.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. S. Brar, Z. Corbin, T. P. Kennedy, R. Hemendinger, L. Thornton, B. Bommarius, R. S. Arnold, A. R. Whorton, A. B. Sturrock, T. P. Huecksteadt, et al.
NOX5 NAD(P)H oxidase regulates growth and apoptosis in DU 145 prostate cancer cells
Am J Physiol Cell Physiol, August 1, 2003; 285(2): C353 - C369.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/6/C1212    most recent
00496.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (40)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brar, S. S.
Right arrow Articles by Hoidal, J. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brar, S. S.
Right arrow Articles by Hoidal, J. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online