|
|
||||||||
II
1 Department of Physiology and Biophysics and 2 Section of Cardiology, Department of Medicine, College of Medicine, University of Illinois at Chicago, Chicago, Illinois 60607
| |
ABSTRACT |
|---|
|
|
|---|
The cardiac
L-type calcium current (ICa) can be modified by
activation of protein kinase C (PKC). However, the effect of PKC activation on ICa is still controversial. Some
studies have shown a decrease in current, whereas other studies have
reported a biphasic effect (an increase followed by a decrease in
current or vice versa). A possible explanation for the conflicting
results is that several isoforms of PKC with opposing effects on
ICa were activated simultaneously. Here, we
examined the influence of a single PKC isoform (PKC-
II) on L-type
calcium channels in isolation from other cardiac isoforms, using a
transgenic mouse that conditionally expresses PKC-
II. Ventricular
cardiac myocytes were isolated from newborn mice and examined for
expression of the transgene using single cell RT-PCR after
ICa recording. Cells expressing PKC-
II showed
a twofold increase in nifedipine-sensitive ICa. The PKC-
II antagonist LY-379196 returned ICa
amplitude to levels found in non-PKC-
II-expressing myocytes. The
increase in ICa was independent of
Cav1.2-subunit mRNA levels as determined by quantitative
RT-PCR. Thus these data demonstrate that PKC-
is a potent modulator
of cardiac L-type calcium channels and that this specific isoform
increases ICa in neonatal ventricular myocytes.
second messengers; signal transduction
| |
INTRODUCTION |
|---|
|
|
|---|
CALCIUM IS AN IMPORTANT
COMPONENT of several signaling cascades and subserves numerous
cellular functions. In cardiac cells, a small influx of calcium quickly
increases the free intracellular concentration by promoting calcium
release from the sarcoplasmic reticulum. This process has been called
calcium-induced calcium release and mediates the excitation-contraction
coupling mechanism in the heart. Alteration of calcium regulation
potentially perturbs excitation-contraction coupling, which may
manifest as altered contractility. Furthermore, second messenger
systems that are altered in cardiac disease may modify the L-type
calcium channel properties to elevate intracellular calcium levels and
activate calcium-sensitive signaling pathways. Several classes of
protein kinases, especially protein kinase A (PKA), modulate
voltage-gated calcium channels to enhance calcium influx (11, 14,
16, 17). The protein kinase C (PKC) signaling cascade may also
play a central role in the regulation of calcium channels in a number of cell types, including cardiac myocytes (7, 12).
However, results from studies (4, 24) examining the
effects of PKC on cardiac calcium channels are contradictory, likely
reflecting physiological and technical limitations. For example,
studies that utilize cell expression systems reconstitute channel
proteins outside their native environment and thereby diminish their
physiological relevance. In addition, the use of nonselective PKC
activators such as phorbol esters, either in cardiac cells or
expression systems, activates multiple PKC isoforms and thereby
obscures PKC isoform-specific functions. The typical response to PKC
activation in expression systems is an initial increase followed by a
decrease in current (4, 18-20), although other
studies (13) report only a reduction of the current.
Similarly, experiments using isolated cardiac cells have shown a
biphasic response of the calcium current (ICa)
to PKC activation with an initial increase followed by a decrease
(3) or a decrease followed by an increase
(24). In other experiments using cardiac cells, a
PKC-mediated increase of ICa (1) or
a phorbol ester-induced decrease in current (23) has been
observed. Reduction of ICa induced by phorbol
esters was attenuated by the addition of peptide inhibitors of the C2 region of PKC isoforms (
,
I,
II), suggesting that these
isozymes are linked to channel inhibition (23). However,
Asai et al. (2) suggested that some of the attenuation of
ICa in cardiac myocytes may be due to a direct
effect of phorbol esters on calcium channels and may be independent of
PKC activity.
In the absence of consensus regarding the effect of specific PKC
isoforms on L-type calcium channel function, we studied the modulation
of calcium channels by a single PKC isozyme (PKC-
II) in a relevant
physiological environment, neonatal cardiocytes. We used a conditional
binary transgenic mouse model that expresses modest levels of
constitutively active PKC-
II (5) while all the other
PKC isoforms remain inactive. The expression of PKC-
II is restricted
to the heart and can be temporally regulated by oral tetracycline. We
found that PKC-
II substantially increased L-type
ICa in cardiac cells. Current enhancement was
blocked by a selective PKC-
II inhibitor, supporting the idea that
activation of this PKC isoform has a positive effect on
ICa. The levels of Cav1.2 subunit
mRNA were similar in PKC-
II-expressing and non-PKC-
II-expressing cells, suggesting that PKC-
II exerted a direct effect on the calcium channel.
| |
METHODS |
|---|
|
|
|---|
The experiments were approved by the Animal Care and Use
Committee of the University of Illinois at Chicago and followed the guidelines of the National Institutes of Health. We used the
tetracycline transactivator only (tTA)/PKC-
II mouse, in which
expression of a constitutively active PKC-
II can be induced by
removal of tetracycline from the drinking water (5). In
this transgenic mouse, the PKC-
II isoform is rendered active by an
internal deletion of the pseudosubstrate domain. To permit expression
during fetal development, tetracycline was not placed in maternal
drinking water.
Genomic diagnosis of PKC-
II transgenic mice.
A small section of tail (~5 mm) was cut from individual newborn mice
(<24 h old) to isolate DNA, using a commercial kit (DNeasy tissue kit,
Qiagen). PCR was performed on the DNA eluate with AmpliTaq DNA
polymerase (Perkin Elmer) and gene-specific primers. Four different
genotypes were determined on the basis of a heterozygote cross: wild
type (WT), (tTA/PKC-
II
/
); tTA, (tTA/PKC-
II +/
); PKC-
II
only (PKC-
II), (tTA/PKC-
II
/+); and binary (tTA/PKC-
II +/+).
The genotype of individual animals was established both by Southern
blotting and PCR as previously described (5). Because expression of PKC-
II in this transgenic mouse requires the presence of both the tTA and PKC-
II transgenes (binary), the PKC-
II only group, which is missing the tTA transgene, was not included in this study.
Cell isolation. Primary cultures were prepared from cardiac muscle of newborn mice at postnatal day 0. Mice were anesthetized by methoxyflurane inhalation and decapitated. The hearts were removed, and the ventricles were isolated and finely minced. The small pieces of muscle were incubated at 37°C for 30 min in Ca2+, Mg2+-free rodent Ringer composed of 155 mM NaCl, 5 mM KCl, 11 mM glucose, and 10 mM HEPES, pH 7.4, containing 1 mg/ml collagenase type IA (Sigma). Dissociated muscle was triturated with a Pasteur pipette in culture medium (vol/vol, 90% DMEM with 4.5 g/l glucose and 10% horse serum). Large debris was removed from the solution by filtration and centrifugation, and a suspension of single myocytes was obtained. Each heart was dissociated individually, and the cells obtained from one heart were plated on two 35-mm culture dishes. Cultures were maintained in a 37°C incubator with a mixture of air and 5% CO2.
ICa measurements.
ICa was measured using the whole cell
configuration of the patch-clamp technique (8). Membrane
linear components were digitally subtracted by appropriate scaling of
the average of eight hyperpolarizing current records elicited from
80
mV. ICa were elicited with 250-ms test pulses,
which were preceded by a 1-s prepulse to
50 mV to inactivate T-type
and sodium currents. Recording electrodes were filled with a solution
containing (in mM) 140 cesium aspartate, 5 MgCl2, 2.5 Mg
ATP, 0.5 Tris GTP, 10 Cs2 EGTA, and 10 HEPES (pH 7.2 adjusted with CsOH). The recording solution contained (in mM) 145 tetraethylammonium chloride, 10 CaCl2, 10 HEPES, and 0.001 TTX, pH 7.4 adjusted with CsOH. Membrane capacitance was measured by
integrating the area under the capacity transient before series resistance compensation. To normalize for differences in total membrane
area, current densities (in pA/pF) were calculated by dividing the
total current by the membrane capacitance of the cell. Data acquisition
and processing were performed with pClamp 7.0 software (Axon Instruments).
Vrev)/{1 + exp[(V1/2
V)/k]}, where Gmax is
the maximum conductance, V is the membrane potential, Vrev is the reversal potential,
V1/2 is the half-activation potential,
and k is the slope.
PKC-
inhibitors.
Cultured ventricular myocytes were incubated with an inhibitor of
PKC-
, LY-379196 (Lilly Laboratories, Indianapolis, IN), for 1 h
before patch-clamp experiments. LY-379196 was used at a concentration
of 30 nM and was also present in the extracellular recording solution.
Previous experiments (9, 10, 21) have demonstrated a
selective and adequate inhibition of this particular enzyme isoform
with these compounds. LY-379196 is highly selective for PKC-
and
shows nonspecific PKC inhibition only at concentrations 20 times higher
than the one used here. At 600 nM, LY-379196 blocks the
and
isoforms, and even higher concentrations are needed to block other PKC
isoforms (9, 10).
Single cell RT-PCR.
The 3'-end amplification RT-PCR technique was applied to single cells
and used to detect transgene expression. The 3'-end amplification-PCR
protocol was previously described (6) and used in this
study with minor modifications. To confirm the expression of PKC-
II,
cytoplasm from a single ventricular myocyte was aspirated by mechanical
suction into the patch-clamp electrode following current recordings.
The contents of the pipette were placed into a sterile PCR tube
containing the reverse transcription reactants (without the enzyme) and
frozen in liquid nitrogen before the RT reaction. Gene-specific PCR was
carried out using 10 µl of the amplified cDNA in a 25 µl volume
with 1× PCR buffer, 2 mM MgCl2, 1 mM dNTP, 0.625 U
Taq DNA polymerase (Life Technologies), and 100 ng of each
primer. PCR products were visualized on a 2% agarose gel and subcloned
into pCRII-TOPO (Invitrogen) for sequencing to confirm the
amplification of a specific product.
Quantitative RT-PCR.
To determine the level of expression of various genes, real-time
quantitative RT-PCR with SYBR Green detection was performed using a
LightCycler thermocycler (Roche Diagnostics). Total RNA was extracted
from transgenic and WT neonatal (day 1) hearts using TRIzol
(Life Technologies), and a total of 100 ng was used in each RT-PCR
reaction. The RT-PCR reaction was quantified on the basis of a series
of in vitro transcribed mRNA standards prepared for each gene that were
analyzed and run alongside to develop a standard curve. A one-step
RT-PCR reaction using the RNA amplification kit with SYBR Green1 (Roche
Molecular Biochemical) was used to analyze gene expression. The
reaction conditions for RT were 55°C for 15 min, which was followed
by a four-step PCR amplification with signal acquisition at
80-89°C for 2 s (depending on the Tm for each PCR product
determined by melting curve analysis) for 45 cycles. The second
derivative maximum (log linear phase) for each amplification curve was
determined and plotted against the standard curve to calculate the
amount of product. Samples were normalized against
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression to ensure
equal loading. The following primers were used: PKC-
II (bovine),
forward ATGGCTGACCCGGCCG and reverse CTAAATGTTTCGTTCCACTCGGGG (GenBank
M13974);
-myosin heavy chain (
-MHC), AAGGTGAAGGCCTACAAGCG and
TTTCTGCTGGACAGGTTATTCC (M76601);
-myosin heavy chain
(
-MHC), AAGGTGAAGGCCTACAAGCG and TTCTGCTTCCACCTAAAGGGC (M74752);
GAPDH, TATGACAATGAATACGGCT and CTCCTGTTATTATGGGGG (M32599); and
Cav1.2 subunit, GAAATTCAAGAAGCGAAAG and
CCTGCTGTCACTCTGATAGTAG (NM009781).
Statistics. Data are expressed as means ± SE. ICa was analyzed using ANOVA with repeated measures (Statistica 5.1, StatSoft, Tulsa, OK). RNA data are reported as means ± SE. Comparisons among groups were determined by ANOVA followed by post hoc analysis with the Student-Newman-Keuls test. P < 0.05 was considered to be significant.
| |
RESULTS |
|---|
|
|
|---|
Single cell RT-PCR.
Individual ventricular myocytes were examined for the presence of the
PKC-
II transgene to confirm the genomic diagnosis of the mouse from
which the cells were isolated. The single cell analysis was performed
because there is heterogeneity of expression in the hearts of
transgenic mice, particularly in the neonatal mice with the oral
tetracycline-off system of gene regulation (22).
II on ICa, we
compared only PKC-
II-expressing cells with the groups that did not
contain the PKC transgene (WT and tTA). Concurrent with the detection
of PKC-
II, we used
- and
-MHC mRNA as a selection criterion
for the successful completion of the single cell RT-PCR procedure.
Figure 1 shows the results obtained with
this screening technique from a tTA and a PKC-
II-expressing ventricular myocyte. All cells screened expressed the
- and
-MHC mRNA independently of PKC-
II expression. Cells in which PKC-
II expression was uncertain, regardless of the presence of
- or
-MHC, were not included in this study.
|
ICa measurement in neonatal cells.
L-type ICa were recorded 24-48 h after
ventricular myocytes were plated. Data from tTA and WT mice were not
statistically different and therefore were pooled and denoted as
tTA/WT. The maximum ICa at each V was
measured, and a current-voltage relationship was constructed (Fig.
2). In PKC-
II-expressing cells, there
was a significantly enhanced ICa density at
V from
30 to 60 mV compared with tTA/WT cells (Fig. 2,
A and B). Only the Gmax
from PKC-
II-expressing cells was significantly different from tTA/WT
cells, while the other parameters of voltage dependence remained
unchanged. The average parameters from PKC-
II-expressing cells
(n = 16) were as follows: Gmax,
0.18 ± 0.02 nS/pF; Vrev, 83.34 ± 3.28 mV; V1/2,
2.29 ± 4.24 mV;
and k, 8.34 ± 1.22 mV. The parameters of tTA/WT cells
(n = 22) were as follows: Gmax,
0.08 ± 0.01 nS/pF; Vrev, 80.81 ± 1.94 mV; V1/2,
0.39 ± 3.51 mV;
and k, 10.79 ± 1.13 mV. Cell size, as measured through
membrane capacitance, was not significantly different between
PKC-
II-expressing cells (mean = 57.6 ± 3.7 pF,
n = 16) and tTA/WT cells (mean = 60.7 ± 5.6 pF, n = 22). We additionally analyzed the time course
of decay of ICa in tTA/Wt and
PKC-
II-expressing cells by fitting a two-exponential function. The
values of the fast and slow time constants of inactivation and their
voltage dependence in PKC-
II-expressing cells were similar to those
from tTA/WT cells.
|
II, we measured
ICa in PKC-
II-expressing cells before and
after the addition of the specific calcium channel blocker nifedipine.
ICa from a PKC-
II expressing cell is shown in
Fig. 2C before and after perfusion with nifedipine in the
extracellular recording solution. When cells were depolarized from a
holding potential of
80 mV, 10 µM nifedipine caused a significant
reduction of ICa. This result was confirmed in
eight additional cells. Nifedipine block of ICa
was larger in two of these cells when they were depolarized using a 1-s
prepulse to
50 mV (Fig. 2C). The average current-voltage curve for all cells before and after nifedipine treatment is shown in
Fig. 2D. Thus modulation of the L-type calcium channel was responsible for the large increase in current density observed in
PKC-
II-expressing cells.
PKC-
II inhibition restores ICa amplitude to control
levels.
To further confirm that PKC-
II enhanced the L-type
ICa, we exposed PKC-
II-expressing cells to a
selective PKC-
inhibitor, LY-379196, before patch- clamp
experiments. LY-379196 (30 nM) was also maintained in the extracellular
recording solution as described previously (9, 10, 21). As
shown in Fig. 3A, LY-379196
had no significant effects on tTA/WT cells, which suggests minimal
L-type calcium channel activation by PKC-
in these cells. The lack
of an effect of the drug on ICa amplitude in
tTA/WT cells also underscores the isoform specificity of the agent,
since other isoforms of PKC (such as PKC-
) have some basal activity
in the absence of agonist stimulation. On the other hand, we
observed a significant attenuation of ICa
density in PKC-
II-expressing cells with LY-379196 (Fig.
3B). The remaining ICa in
PKC-
II-expressing cells was identical to tTA/WT cells after exposure
to LY-379196 (Fig. 3C). The rapid inhibition of
ICa with LY-379196 strongly supports the idea
that the augmented ICa observed in
PKC-
II-expressing cells was due to phosphorylation of the L-type
calcium channel.
|
Quantitative gene expression.
Quantitative real time RT-PCR was performed on RNA extracted from
neonatal hearts to determine whether the enhanced calcium influx seen
in the PKC-
II cells was correlated with an increased L-type calcium
channel expression. We measured the levels of the Cav1.2
subunit (the pore-forming subunit) of the L-type calcium channel along
with
-MHC,
-MHC, and GAPDH in the same preparation. Similarly to
the single cell analysis,
- and
-MHC were included in this
screening to serve as internal controls. GAPDH was used to normalize
the level of expression of the other three genes. The results of this
analysis are shown in Fig. 4. The amount
of Cav1.2 subunit was 15.3 ± 3.73 fg/pg GAPDH
(n = 5) in tTA/WT hearts and 20.8 ± 7.95 fg/pg
GAPDH (n = 5) in PKC-
II hearts (Fig. 4A). This difference was not statistically significant. This result suggests
that the number of calcium channels remained constant and further
supports the idea that the increase in current in neonatal cells was
due to phosphorylation of the calcium channel.
|
- and
-MHC were also similar between tTA/WT and
PKC-
II neonatal hearts (Fig. 4B). The levels of
-MHC
were 0.27 ± 0.04 pg/pg GAPDH (n = 5) in tTA/WT
mice and 0.46 ± 0.12 pg/pg GAPDH (n = 5) in
PKC-
II mice.
-MHC levels were 2.18 ± 0.46 pg/pg GAPDH
(n = 5) in tTA/WT mice and 1.56 ± 0.69 pg/pg GAPDH (n = 5) in PKC-
II mice. In both tTA/WT and
PKC-
II mice, the amounts of
-MHC were significantly higher than
the levels of
-MHC. The embryonic isoform (
-MHC) is expressed at
the highest levels during embryonic development and then declines
during postnatal development, when
-MHC predominates. We found
significantly higher levels of
-MHC expression compared with
-MHC, which is probably indicative of the very early stages of
postnatal development (<24 h old) when the myocytes were isolated.
| |
DISCUSSION |
|---|
|
|
|---|
The results of our study clearly show that expression of
constitutively active PKC-
II in neonatal cardiac myocytes enhances the L-type ICa. Furthermore, the stimulatory
effect of PKC-
II was completely blocked by the addition of the
specific PKC-
antagonist LY-379196. Our data also show that the
ICa increase was independent of changes in the
level of Cav1.2 subunit mRNA, suggesting that PKC-
II
exerts its effect directly on the calcium channel.
Numerous studies (1-5, 12, 13, 18-20, 23, 24) have examined the modulation of the cardiac L-type calcium channel by PKC activation, either in heterologous expression systems or in native cells. However, the experiments have produced conflicting data, and there is no consensus as to the effect of PKC on calcium channels. This apparent controversy may be explained by the use of cell expression systems or models in which nonspecific PKC activation or inhibition was employed; this is not an issue in the novel transgenic model system we have used here.
Detailed biochemical information regarding regulation of these channels
by phosphorylation is quite limited because they are complex multimeric
membrane proteins and difficult to study in native tissues. In
addition, it is not known whether one or more of the channel proteins
are directly phosphorylated by PKC or whether the observed alterations
in channel function are the result of secondary activation of another
downstream effector(s). Presently, both the Cav1.2 and
subunits are considered to be possible substrates for PKC-dependent
phosphorylation in vitro (15, 18). The Cav1.2 subunit in particular has been examined for putative phosphorylation sites, and several have been recognized. Regulation by PKC could occur
through either direct phosphorylation of one or more of the channel
proteins or indirect phosphorylation of another downstream effector(s)
that might alter channel kinetics and behavior. Alternatively, PKC
could modify transcriptional or posttranslational aspects of L-type
calcium channel expression to bring about changes in the number of
channels within the membrane that would also alter channel kinetics and
behavior. Therefore, to detail some of the biochemical information
regarding L-type calcium channel regulation, we analyzed channel
activity and correlated this with the expression of Cav1.2
subunit mRNA as an index of channel number in response to PKC-
II activation.
The data presented here suggest that PKC-
II modulates cardiac L-type
calcium channels via posttranslational mechanisms. This conclusion is
supported by a number of observations. Foremost is the return of
ICa in PKC-
II-expressing cells treated with LY-379196 to levels similar to those in tTA/WT cells during a short
incubation. If a greater number of channels were responsible for the
increased ICa, then upon inhibition the
ICa in the PKC-
II-expressing cells might
still be greater than in the tTA/WT cells. It is unlikely, though not
impossible, that the PKC effect is due to an increase in channel
number. In conflict with this possibility is the fact that, at this
developmental stage, the transgene would have only been expressed for
~3-4 days in the ventricular myocytes by virtue of the
-MHC
promoter used to drive transgene expression and the mRNA data that
document equivalent levels of the Cav1.2 subunit mRNA in
transgenic and WT neonatal hearts. It is possible that the quantitative
mRNA data obtained from the whole heart may reflect the mean level of
Cav1.2 subunit expression. Therefore, it is still to be
determined whether there are changes in the Cav1.2 subunit
(or other subunits) mRNA expression in individual myocytes expressing
the PKC-
II transgene. Although we recognize that mRNA levels do not
always correlate with protein expression, these data strongly suggest
that PKC-
II is capable of altering channel activity independent of
an increase in channel number.
The present findings should be qualified by noting that studies were done in neonatal cells, which have immature mechanisms to regulate calcium homeostasis, specifically an undeveloped sarcoplasmic reticulum and lower levels of L-type calcium channel mRNA. While there is no reason to believe that the fundamental biology differs in the adult, in fact the presence of a mature sarcoplasmic reticulum and differences in gene or protein expression of the L-type calcium channel might certainly influence the acquired cardiac phenotype.
In summary, our data provide evidence that constitutively active
PKC-
II modifies the L-type calcium channel to enhance the current.
The exact nature of the mechanism is yet to be determined, but the
initial evidence suggests the possibility of channel posttranslational modification in neonatal cardiac myocytes. However, as presented here,
the combination of these electrophysiological, molecular, and
pharmacological techniques should allow for further dissection of the
independent actions of these signaling molecules and their isoforms
within individual myocytes.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. T. D. Alden for help with statistical analysis and R. McKinney for laboratory assistance.
| |
FOOTNOTES |
|---|
* K. J. Alden and P. H. Goldspink contributed equally to this work.
This work was supported by National Science Foundation Grant IBN-9733570 (J. García) and National Heart, Lung, and Blood Institute Grant R01-HL-62230 (P. M. Buttrick). K. J. Alden was partially supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant T32-DK-07739.
Address for reprint requests and other correspondence: J. García, Dept. of Physiology and Biophysics, College of Medicine, Univ. of Illinois at Chicago, 900 S. Ashland Ave. M/C 902, Chicago, Illinois 60607 (E-mail: garmar{at}uic.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
10.1152/ajpcell.00494.2001
Received 16 October 2001; accepted in final form 19 November 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Aiello, EA,
and
Cingolani HE.
Angiotensin II stimulates cardiac L-type Ca2+ current by a Ca2+- and protein kinase C-dependent mechanism.
Am J Physiol Heart Circ Physiol
280:
H1528-H1536,
2001.
2.
Asai, T,
Shuba LM,
Pelzer DJ,
and
McDonald TF.
PKC-independent inhibition of cardiac L-type Ca2+ channel current by phorbol esters.
Am J Physiol Heart Circ Physiol
270:
H620-H627,
1996.
3.
Boixel, C,
Tessier S,
Pansard Y,
Lang-Lazdunski L,
Mercadier JJ,
and
Hatem SN.
Tyrosine kinase and protein kinase C regulate L-type Ca2+ current cooperatively in human atrial myocytes.
Am J Physiol Heart Circ Physiol
278:
H670-H676,
2000.
4.
Bourinet, E,
Fournier F,
Lory P,
Charnet P,
and
Nargeot J.
Protein kinase C regulation of cardiac calcium channels expressed in Xenopus oocytes.
Pflügers Arch
421:
247-255,
1992.
5.
Bowman, JC,
Steinberg SF,
Jiang T,
Geenen DL,
Fishman GI,
and
Buttrick PM.
Expression of protein kinase C beta in the heart causes hypertrophy in adult mice and sudden death in neonates.
J Clin Invest
100:
2189-2195,
1997.
6.
Dixon, AK,
Richardson PJ,
Lee K,
Carter NP,
and
Freeman TC.
Expression profiling of single cells using 3 prime end amplification (TPEA) PCR.
Nucleic Acids Res
26:
4426-4431,
1998.
7.
Dosemeci, A,
Dhallan RS,
Cohen NM,
Lederer WJ,
and
Rogers TB.
Phorbol ester increases calcium current and simulates the effects of angiotensin II on cultured neonatal rat heart myocytes.
Circ Res
62:
347-357,
1988.
8.
Hamill, OP,
Marty A,
Neher E,
Sakmann B,
and
Sigworth FJ.
Improved patch-clamp techniques for high-resolution current recording from cells and cell-free membrane patches.
Pflügers Arch
391:
85-100,
1981.
9.
Ishii, H,
Jirousek MR,
Koya D,
Takagi C,
Xia P,
Clermont A,
Bursell SE,
Kern TS,
Ballas LM,
Heath WF,
Stramm LE,
Feener EP,
and
King GL.
Amelioration of vascular dysfunctions in diabetic rats by an oral PKC beta inhibitor.
Science
272:
728-731,
1996.
10.
Jirousek, MR,
Gillig JR,
Gonzalez CM,
Heath WF,
McDonald JH, III,
Neel DA,
Rito CJ,
Singh U,
Stramm LE,
Melikian-Badalian A,
Baevsky M,
Ballas LM,
Hall SE,
Winneroski LL,
and
Faul MM.
(S)-13-[(dimethylamino)methyl]-10,11,14,15-tetrahydro-4,9:16,21-dimetheno-1H,13H-dibenzo[e,k]pyrrolo[3,4-h][1,4,13]oxadiazacyclohexadecene-1,3(2H)-dione (LY333531) and related analogues: isozyme selective inhibitors of protein kinase C beta.
J Med Chem
39:
2664-2671,
1996.
11.
Josephson, IR,
and
Sperelakis N.
Phosphorylation shifts the time-dependence of cardiac Ca2+ channel gating currents.
Biophys J
60:
491-497,
1991.
12.
Lacerda, AE,
Rampe D,
and
Brown AM.
Effects of protein kinase C activators on cardiac calcium channels.
Nature
335:
249-251,
1988.
13.
McHugh, D,
Sharp EM,
Scheuer T,
and
Catterall WA.
Inhibition of cardiac L-type calcium channels by protein kinase C phosphorylation of two sites in the N-terminal domain.
Proc Natl Acad Sci USA
97:
12334-12338,
2000.
14.
Ono, K,
and
Fozzard HA.
Phosphorylation restores activity of L-type calcium channels after rundown in inside-out patches from rabbit cardiac cells.
J Physiol (Lond)
454:
673-688,
1992.
15.
Puri, TS,
Gerhardstein BL,
Zhao XL,
Ladner MB,
and
Hosey MM.
Differential effects of subunit interactions on protein kinase A- and C-mediated phosphorylation of L-type calcium channels.
Biochemistry
36:
9605-9615,
1997.
16.
Sculptoreanu, A,
Rotman E,
Takahashi M,
Scheuer T,
and
Catterall WA.
Voltage-dependent potentiation of the activity of cardiac L-type calcium channel alpha 1 subunits due to phosphorylation by cAMP-dependent protein kinase.
Proc Natl Acad Sci USA
90:
10135-10139,
1993.
17.
Sculptoreanu, A,
Scheuer T,
and
Catterall WA.
Voltage-dependent potentiation of L-type Calcium channels due to phosphorylation by cAMP-dependent protein kinase.
Nature
364:
240-243,
1993.
18.
Shistik, E,
Ivanina T,
Blumenstein Y,
and
Dascal N.
Crucial role of N terminus in function of cardiac L-type Ca2+ channel and its modulation by protein kinase C.
J Biol Chem
28:
17901-17909,
1998.
19.
Shistik, E,
Keren-Raifman T,
Idelson GH,
Blumenstein Y,
Dascal N,
and
Ivanina T.
The N terminus of the cardiac L-type Ca2+ channel alpha(1C) subunit. The initial segment is ubiquitous and crucial for protein kinase C modulation, but is not directly phosphorylated.
J Biol Chem
274:
31145-31149,
1999.
20.
Singer-Lahat, D,
Gershon E,
Lotan I,
Hullin R,
Biel M,
Flockerzi V,
Hofmann F,
and
Dascal N.
Modulation of cardiac Ca2+ channels in Xenopus oocytes by protein kinase C.
FEBS Lett
306:
113-118,
1992.
21.
Xia, P,
Aiello LP,
Ishii H,
Jiang ZY,
Park DJ,
Robinson GS,
Takagi H,
Newsome WP,
Jirousek MR,
and
King GL.
Characterization of vascular endothelial growth factor's effect on the activation of protein kinase C, its isoforms, and endothelial cell growth.
J Clin Invest
98:
2018-2026,
1996.
22.
Yu, Z,
Redfern CS,
and
Fishman GI.
Conditional transgene expression in the heart.
Circ Res
79:
691-697,
1996.
23.
Zhang, S,
Hiraoka M,
and
Hirano Y.
Effects of
1-adrenergic stimulation on L-type Ca2+ current in rat ventricular myocytes.
J Mol Cell Cardiol
30:
1955-1965,
1998.
24.
Zhang, ZH,
Johnson JA,
Chen L,
El-Sherif N,
Mochly-Rosen D,
and
Boutjdir M.
C2 region-derived peptides of beta-protein kinase C regulate cardiac calcium channels.
Circ Res
80:
720-729,
1997.
This article has been cited by other articles:
![]() |
J. Davis, M. V. Westfall, D. Townsend, M. Blankinship, T. J. Herron, G. Guerrero-Serna, W. Wang, E. Devaney, and J. M. Metzger Designing Heart Performance by Gene Transfer Physiol Rev, October 1, 2008; 88(4): 1567 - 1651. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Maturana, S. Walchli, M. Iwata, S. Ryser, J. Van Lint, M. Hoshijima, W. Schlegel, Y. Ikeda, K. Tanizawa, and S. Kuroda Enigma homolog 1 scaffolds protein kinase D1 to regulate the activity of the cardiac L-type voltage-gated calcium channel Cardiovasc Res, June 1, 2008; 78(3): 458 - 465. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Pastukh, S. Wu, C. Ricci, M. Mozaffari, and S. Schaffer Reversal of hyperglycemic preconditioning by angiotensin II: role of calcium transport Am J Physiol Heart Circ Physiol, April 1, 2005; 288(4): H1965 - H1975. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. D. Garcia, T. Shah, and J. Garcia Immunolocalization of type 2 inositol 1,4,5-trisphosphate receptors in cardiac myocytes from newborn mice Am J Physiol Cell Physiol, October 1, 2004; 287(4): C1048 - C1057. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. H. Goldspink, D. E. Montgomery, L. A. Walker, D. Urboniene, R. D. McKinney, D. L. Geenen, R. J. Solaro, and P. M. Buttrick Protein Kinase C{epsilon} Overexpression Alters Myofilament Properties and Composition During the Progression of Heart Failure Circ. Res., August 20, 2004; 95(4): 424 - 432. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. B. Roman, P. H. Goldspink, E. Spaite, D. Urboniene, R. McKinney, D. L. Geenen, R. J. Solaro, and P. M. Buttrick Inhibition of PKC phosphorylation of cTnI improves cardiac performance in vivo Am J Physiol Heart Circ Physiol, June 1, 2004; 286(6): H2089 - H2095. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. G. Brodsky, D. Suzara, T. A. Hornberger, P. Goldspink, K. E. Yarasheski, S. Smith, J. Kukowski, K. Esser, and S. Bedno Isoenergetic Dietary Protein Restriction Decreases Myosin Heavy Chain IIx Fraction and Myosin Heavy Chain Production in Humans J. Nutr., February 1, 2004; 134(2): 328 - 334. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Ping A new chapter in cardiac PKC signaling studies: searching for isoform-specific molecular targets. Focus on: "Isoenzyme-selective regulation of SERCA2 gene expression by protein kinase C in neonatal rat ventricular myocytes" Am J Physiol Cell Physiol, July 1, 2003; 285(1): C19 - C21. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |