Am J Physiol Cell Physiol  AJP: Regulatory, Integrative and Comparative Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 282: C768-C774, 2002. First published November 21, 2001; doi:10.1152/ajpcell.00494.2001
0363-6143/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/4/C768    most recent
00494.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (19)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Alden, K. J.
Right arrow Articles by García, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Alden, K. J.
Right arrow Articles by García, J.
Vol. 282, Issue 4, C768-C774, April 2002

Enhancement of L-type Ca2+ current from neonatal mouse ventricular myocytes by constitutively active PKC-beta II

Kris J. Alden1,*, Paul H. Goldspink2,*, Stuart W. Ruch2, Peter M. Buttrick2, and Jesús García1

1 Department of Physiology and Biophysics and 2 Section of Cardiology, Department of Medicine, College of Medicine, University of Illinois at Chicago, Chicago, Illinois 60607


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

The cardiac L-type calcium current (ICa) can be modified by activation of protein kinase C (PKC). However, the effect of PKC activation on ICa is still controversial. Some studies have shown a decrease in current, whereas other studies have reported a biphasic effect (an increase followed by a decrease in current or vice versa). A possible explanation for the conflicting results is that several isoforms of PKC with opposing effects on ICa were activated simultaneously. Here, we examined the influence of a single PKC isoform (PKC-beta II) on L-type calcium channels in isolation from other cardiac isoforms, using a transgenic mouse that conditionally expresses PKC-beta II. Ventricular cardiac myocytes were isolated from newborn mice and examined for expression of the transgene using single cell RT-PCR after ICa recording. Cells expressing PKC-beta II showed a twofold increase in nifedipine-sensitive ICa. The PKC-beta II antagonist LY-379196 returned ICa amplitude to levels found in non-PKC-beta II-expressing myocytes. The increase in ICa was independent of Cav1.2-subunit mRNA levels as determined by quantitative RT-PCR. Thus these data demonstrate that PKC-beta is a potent modulator of cardiac L-type calcium channels and that this specific isoform increases ICa in neonatal ventricular myocytes.

second messengers; signal transduction


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

CALCIUM IS AN IMPORTANT COMPONENT of several signaling cascades and subserves numerous cellular functions. In cardiac cells, a small influx of calcium quickly increases the free intracellular concentration by promoting calcium release from the sarcoplasmic reticulum. This process has been called calcium-induced calcium release and mediates the excitation-contraction coupling mechanism in the heart. Alteration of calcium regulation potentially perturbs excitation-contraction coupling, which may manifest as altered contractility. Furthermore, second messenger systems that are altered in cardiac disease may modify the L-type calcium channel properties to elevate intracellular calcium levels and activate calcium-sensitive signaling pathways. Several classes of protein kinases, especially protein kinase A (PKA), modulate voltage-gated calcium channels to enhance calcium influx (11, 14, 16, 17). The protein kinase C (PKC) signaling cascade may also play a central role in the regulation of calcium channels in a number of cell types, including cardiac myocytes (7, 12). However, results from studies (4, 24) examining the effects of PKC on cardiac calcium channels are contradictory, likely reflecting physiological and technical limitations. For example, studies that utilize cell expression systems reconstitute channel proteins outside their native environment and thereby diminish their physiological relevance. In addition, the use of nonselective PKC activators such as phorbol esters, either in cardiac cells or expression systems, activates multiple PKC isoforms and thereby obscures PKC isoform-specific functions. The typical response to PKC activation in expression systems is an initial increase followed by a decrease in current (4, 18-20), although other studies (13) report only a reduction of the current. Similarly, experiments using isolated cardiac cells have shown a biphasic response of the calcium current (ICa) to PKC activation with an initial increase followed by a decrease (3) or a decrease followed by an increase (24). In other experiments using cardiac cells, a PKC-mediated increase of ICa (1) or a phorbol ester-induced decrease in current (23) has been observed. Reduction of ICa induced by phorbol esters was attenuated by the addition of peptide inhibitors of the C2 region of PKC isoforms (alpha , beta I, beta II), suggesting that these isozymes are linked to channel inhibition (23). However, Asai et al. (2) suggested that some of the attenuation of ICa in cardiac myocytes may be due to a direct effect of phorbol esters on calcium channels and may be independent of PKC activity.

In the absence of consensus regarding the effect of specific PKC isoforms on L-type calcium channel function, we studied the modulation of calcium channels by a single PKC isozyme (PKC-beta II) in a relevant physiological environment, neonatal cardiocytes. We used a conditional binary transgenic mouse model that expresses modest levels of constitutively active PKC-beta II (5) while all the other PKC isoforms remain inactive. The expression of PKC-beta II is restricted to the heart and can be temporally regulated by oral tetracycline. We found that PKC-beta II substantially increased L-type ICa in cardiac cells. Current enhancement was blocked by a selective PKC-beta II inhibitor, supporting the idea that activation of this PKC isoform has a positive effect on ICa. The levels of Cav1.2 subunit mRNA were similar in PKC-beta II-expressing and non-PKC-beta II-expressing cells, suggesting that PKC-beta II exerted a direct effect on the calcium channel.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

The experiments were approved by the Animal Care and Use Committee of the University of Illinois at Chicago and followed the guidelines of the National Institutes of Health. We used the tetracycline transactivator only (tTA)/PKC-beta II mouse, in which expression of a constitutively active PKC-beta II can be induced by removal of tetracycline from the drinking water (5). In this transgenic mouse, the PKC-beta II isoform is rendered active by an internal deletion of the pseudosubstrate domain. To permit expression during fetal development, tetracycline was not placed in maternal drinking water.

Genomic diagnosis of PKC-beta II transgenic mice. A small section of tail (~5 mm) was cut from individual newborn mice (<24 h old) to isolate DNA, using a commercial kit (DNeasy tissue kit, Qiagen). PCR was performed on the DNA eluate with AmpliTaq DNA polymerase (Perkin Elmer) and gene-specific primers. Four different genotypes were determined on the basis of a heterozygote cross: wild type (WT), (tTA/PKC-beta II -/-); tTA, (tTA/PKC-beta II +/-); PKC-beta II only (PKC-beta II), (tTA/PKC-beta II -/+); and binary (tTA/PKC-beta II +/+). The genotype of individual animals was established both by Southern blotting and PCR as previously described (5). Because expression of PKC-beta II in this transgenic mouse requires the presence of both the tTA and PKC-beta II transgenes (binary), the PKC-beta II only group, which is missing the tTA transgene, was not included in this study.

Cell isolation. Primary cultures were prepared from cardiac muscle of newborn mice at postnatal day 0. Mice were anesthetized by methoxyflurane inhalation and decapitated. The hearts were removed, and the ventricles were isolated and finely minced. The small pieces of muscle were incubated at 37°C for 30 min in Ca2+, Mg2+-free rodent Ringer composed of 155 mM NaCl, 5 mM KCl, 11 mM glucose, and 10 mM HEPES, pH 7.4, containing 1 mg/ml collagenase type IA (Sigma). Dissociated muscle was triturated with a Pasteur pipette in culture medium (vol/vol, 90% DMEM with 4.5 g/l glucose and 10% horse serum). Large debris was removed from the solution by filtration and centrifugation, and a suspension of single myocytes was obtained. Each heart was dissociated individually, and the cells obtained from one heart were plated on two 35-mm culture dishes. Cultures were maintained in a 37°C incubator with a mixture of air and 5% CO2.

ICa measurements. ICa was measured using the whole cell configuration of the patch-clamp technique (8). Membrane linear components were digitally subtracted by appropriate scaling of the average of eight hyperpolarizing current records elicited from -80 mV. ICa were elicited with 250-ms test pulses, which were preceded by a 1-s prepulse to -50 mV to inactivate T-type and sodium currents. Recording electrodes were filled with a solution containing (in mM) 140 cesium aspartate, 5 MgCl2, 2.5 Mg ATP, 0.5 Tris GTP, 10 Cs2 EGTA, and 10 HEPES (pH 7.2 adjusted with CsOH). The recording solution contained (in mM) 145 tetraethylammonium chloride, 10 CaCl2, 10 HEPES, and 0.001 TTX, pH 7.4 adjusted with CsOH. Membrane capacitance was measured by integrating the area under the capacity transient before series resistance compensation. To normalize for differences in total membrane area, current densities (in pA/pF) were calculated by dividing the total current by the membrane capacitance of the cell. Data acquisition and processing were performed with pClamp 7.0 software (Axon Instruments).

The current-voltage relationship from a single cell was fit to the equation ICa = Gmax(V - Vrev)/{1 + exp[(V1/2 - V)/k]}, where Gmax is the maximum conductance, V is the membrane potential, Vrev is the reversal potential, V1/2 is the half-activation potential, and k is the slope.

PKC-beta inhibitors. Cultured ventricular myocytes were incubated with an inhibitor of PKC-beta , LY-379196 (Lilly Laboratories, Indianapolis, IN), for 1 h before patch-clamp experiments. LY-379196 was used at a concentration of 30 nM and was also present in the extracellular recording solution. Previous experiments (9, 10, 21) have demonstrated a selective and adequate inhibition of this particular enzyme isoform with these compounds. LY-379196 is highly selective for PKC-beta and shows nonspecific PKC inhibition only at concentrations 20 times higher than the one used here. At 600 nM, LY-379196 blocks the alpha  and gamma  isoforms, and even higher concentrations are needed to block other PKC isoforms (9, 10).

Single cell RT-PCR. The 3'-end amplification RT-PCR technique was applied to single cells and used to detect transgene expression. The 3'-end amplification-PCR protocol was previously described (6) and used in this study with minor modifications. To confirm the expression of PKC-beta II, cytoplasm from a single ventricular myocyte was aspirated by mechanical suction into the patch-clamp electrode following current recordings. The contents of the pipette were placed into a sterile PCR tube containing the reverse transcription reactants (without the enzyme) and frozen in liquid nitrogen before the RT reaction. Gene-specific PCR was carried out using 10 µl of the amplified cDNA in a 25 µl volume with 1× PCR buffer, 2 mM MgCl2, 1 mM dNTP, 0.625 U Taq DNA polymerase (Life Technologies), and 100 ng of each primer. PCR products were visualized on a 2% agarose gel and subcloned into pCRII-TOPO (Invitrogen) for sequencing to confirm the amplification of a specific product.

Quantitative RT-PCR. To determine the level of expression of various genes, real-time quantitative RT-PCR with SYBR Green detection was performed using a LightCycler thermocycler (Roche Diagnostics). Total RNA was extracted from transgenic and WT neonatal (day 1) hearts using TRIzol (Life Technologies), and a total of 100 ng was used in each RT-PCR reaction. The RT-PCR reaction was quantified on the basis of a series of in vitro transcribed mRNA standards prepared for each gene that were analyzed and run alongside to develop a standard curve. A one-step RT-PCR reaction using the RNA amplification kit with SYBR Green1 (Roche Molecular Biochemical) was used to analyze gene expression. The reaction conditions for RT were 55°C for 15 min, which was followed by a four-step PCR amplification with signal acquisition at 80-89°C for 2 s (depending on the Tm for each PCR product determined by melting curve analysis) for 45 cycles. The second derivative maximum (log linear phase) for each amplification curve was determined and plotted against the standard curve to calculate the amount of product. Samples were normalized against glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression to ensure equal loading. The following primers were used: PKC-beta II (bovine), forward ATGGCTGACCCGGCCG and reverse CTAAATGTTTCGTTCCACTCGGGG (GenBank M13974); alpha -myosin heavy chain (alpha -MHC), AAGGTGAAGGCCTACAAGCG and TTTCTGCTGGACAGGTTATTCC (M76601); beta -myosin heavy chain (beta -MHC), AAGGTGAAGGCCTACAAGCG and TTCTGCTTCCACCTAAAGGGC (M74752); GAPDH, TATGACAATGAATACGGCT and CTCCTGTTATTATGGGGG (M32599); and Cav1.2 subunit, GAAATTCAAGAAGCGAAAG and CCTGCTGTCACTCTGATAGTAG (NM009781).

Statistics. Data are expressed as means ± SE. ICa was analyzed using ANOVA with repeated measures (Statistica 5.1, StatSoft, Tulsa, OK). RNA data are reported as means ± SE. Comparisons among groups were determined by ANOVA followed by post hoc analysis with the Student-Newman-Keuls test. P < 0.05 was considered to be significant.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Single cell RT-PCR. Individual ventricular myocytes were examined for the presence of the PKC-beta II transgene to confirm the genomic diagnosis of the mouse from which the cells were isolated. The single cell analysis was performed because there is heterogeneity of expression in the hearts of transgenic mice, particularly in the neonatal mice with the oral tetracycline-off system of gene regulation (22).

Cytoplasm from individual myocytes was aspirated into the patch pipette for RT-PCR immediately after ICa recording. To determine the effects of PKC-beta II on ICa, we compared only PKC-beta II-expressing cells with the groups that did not contain the PKC transgene (WT and tTA). Concurrent with the detection of PKC-beta II, we used alpha - and beta -MHC mRNA as a selection criterion for the successful completion of the single cell RT-PCR procedure. Figure 1 shows the results obtained with this screening technique from a tTA and a PKC-beta II-expressing ventricular myocyte. All cells screened expressed the alpha - and beta -MHC mRNA independently of PKC-beta II expression. Cells in which PKC-beta II expression was uncertain, regardless of the presence of alpha - or beta -MHC, were not included in this study.


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 1.   Gene expression analysis by single-cell RT-PCR. A: expression of the myosin heavy chain (MHC) genes (alpha - and beta -MHC) in an individual myocyte isolated from a tetracycline transactivator only (tTA) heart. Note the lack of protein kinase C-beta II (PKC-beta II) transgene expression. The same results were found when wild-type (WT) myocytes were examined. B: analysis of a myocyte isolated from a binary mouse, which contained the PKC-beta II transgene and the 2 muscle genes alpha -MHC and beta -MHC. Cytoplasm of single myocytes was aspirated after recording of calcium currents (ICa), and mRNA was detected using the 3'-end amplification RT-PCR method.

ICa measurement in neonatal cells. L-type ICa were recorded 24-48 h after ventricular myocytes were plated. Data from tTA and WT mice were not statistically different and therefore were pooled and denoted as tTA/WT. The maximum ICa at each V was measured, and a current-voltage relationship was constructed (Fig. 2). In PKC-beta II-expressing cells, there was a significantly enhanced ICa density at V from -30 to 60 mV compared with tTA/WT cells (Fig. 2, A and B). Only the Gmax from PKC-beta II-expressing cells was significantly different from tTA/WT cells, while the other parameters of voltage dependence remained unchanged. The average parameters from PKC-beta II-expressing cells (n = 16) were as follows: Gmax, 0.18 ± 0.02 nS/pF; Vrev, 83.34 ± 3.28 mV; V1/2, -2.29 ± 4.24 mV; and k, 8.34 ± 1.22 mV. The parameters of tTA/WT cells (n = 22) were as follows: Gmax, 0.08 ± 0.01 nS/pF; Vrev, 80.81 ± 1.94 mV; V1/2, -0.39 ± 3.51 mV; and k, 10.79 ± 1.13 mV. Cell size, as measured through membrane capacitance, was not significantly different between PKC-beta II-expressing cells (mean = 57.6 ± 3.7 pF, n = 16) and tTA/WT cells (mean = 60.7 ± 5.6 pF, n = 22). We additionally analyzed the time course of decay of ICa in tTA/Wt and PKC-beta II-expressing cells by fitting a two-exponential function. The values of the fast and slow time constants of inactivation and their voltage dependence in PKC-beta II-expressing cells were similar to those from tTA/WT cells.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 2.   ICa in neonatal PKC-beta II and tTA/WT cells. A: ICa records from a representative tTA/WT cell and a PKC-beta II-expressing cell. Currents shown correspond to membrane potentials from -30 to 60 mV and were elicited using the prepulse protocol. B: maximum ICa densities obtained from PKC-beta II-expressing cells (black-lozenge ) (n = 16) were greater compared with tTA/WT cells (black-triangle) (n = 22) at membrane potentials from -30 to 60 mV. * P < 0.05, significantly different from tTA/WT cells. C: ICa records from a PKC-beta II-expressing cell before and after treatment with the L-type channel blocker nifedipine (10 µM). Currents were elicited at -30 to 60 mV from a holding potential (Vh) of -80 mV. ICa was significantly reduced in the presence of nifedipine from -80 mV. ICa was completely abolished when test pulses were preceded by a prepulse to -50 mV as shown by the lower records at right, which correspond to a different cell. D: current-voltage relationship of PKC-beta II cells before (black-lozenge ) (n = 9) and after nifedipine perfusion (black-triangle) (n = 9). Currents used in the graph were elicited from -80 mV. * P < 0.05, significantly different from untreated cells.

To verify the nature of the current increased by PKC-beta II, we measured ICa in PKC-beta II-expressing cells before and after the addition of the specific calcium channel blocker nifedipine. ICa from a PKC-beta II expressing cell is shown in Fig. 2C before and after perfusion with nifedipine in the extracellular recording solution. When cells were depolarized from a holding potential of -80 mV, 10 µM nifedipine caused a significant reduction of ICa. This result was confirmed in eight additional cells. Nifedipine block of ICa was larger in two of these cells when they were depolarized using a 1-s prepulse to -50 mV (Fig. 2C). The average current-voltage curve for all cells before and after nifedipine treatment is shown in Fig. 2D. Thus modulation of the L-type calcium channel was responsible for the large increase in current density observed in PKC-beta II-expressing cells.

PKC-beta II inhibition restores ICa amplitude to control levels. To further confirm that PKC-beta II enhanced the L-type ICa, we exposed PKC-beta II-expressing cells to a selective PKC-beta inhibitor, LY-379196, before patch- clamp experiments. LY-379196 (30 nM) was also maintained in the extracellular recording solution as described previously (9, 10, 21). As shown in Fig. 3A, LY-379196 had no significant effects on tTA/WT cells, which suggests minimal L-type calcium channel activation by PKC-beta in these cells. The lack of an effect of the drug on ICa amplitude in tTA/WT cells also underscores the isoform specificity of the agent, since other isoforms of PKC (such as PKC-delta ) have some basal activity in the absence of agonist stimulation. On the other hand, we observed a significant attenuation of ICa density in PKC-beta II-expressing cells with LY-379196 (Fig. 3B). The remaining ICa in PKC-beta II-expressing cells was identical to tTA/WT cells after exposure to LY-379196 (Fig. 3C). The rapid inhibition of ICa with LY-379196 strongly supports the idea that the augmented ICa observed in PKC-beta II-expressing cells was due to phosphorylation of the L-type calcium channel.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 3.   Current-voltage relationships of PKC-beta II and tTA/WT cells treated with the PKC-beta inhibitor LY-379196. A: 30 nM LY-379196 did not alter ICa densities in tTA/WT cells (n = 10) compared with control tTA/WT cells (n = 22). B: maximum current density was reduced in PKC-beta II-expressing cells (n = 16) treated with 30 nM LY-379196 compared with control PKC-beta II-expressing cells (n = 16) at membrane potentials of -30 to 60 mV. * P < 0.05, significantly different from control PKC-beta II-expressing cells. C: maximum ICa densities in tTA/WT (n = 10) and PKC-beta II-expressing cells (n = 16) treated with 30 nM LY-379196 were not significantly different at any membrane potentials.

Quantitative gene expression. Quantitative real time RT-PCR was performed on RNA extracted from neonatal hearts to determine whether the enhanced calcium influx seen in the PKC-beta II cells was correlated with an increased L-type calcium channel expression. We measured the levels of the Cav1.2 subunit (the pore-forming subunit) of the L-type calcium channel along with alpha -MHC, beta -MHC, and GAPDH in the same preparation. Similarly to the single cell analysis, alpha - and beta -MHC were included in this screening to serve as internal controls. GAPDH was used to normalize the level of expression of the other three genes. The results of this analysis are shown in Fig. 4. The amount of Cav1.2 subunit was 15.3 ± 3.73 fg/pg GAPDH (n = 5) in tTA/WT hearts and 20.8 ± 7.95 fg/pg GAPDH (n = 5) in PKC-beta II hearts (Fig. 4A). This difference was not statistically significant. This result suggests that the number of calcium channels remained constant and further supports the idea that the increase in current in neonatal cells was due to phosphorylation of the calcium channel.


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 4.   Quantification of gene expression by real-time RT-PCR. A: expression of the Cav1.2 subunit of the L-type calcium channel in whole hearts of neonatal tTA/WT and PKC-beta II mice showed no significant difference. B: the expression level of the alpha - and beta -MHC isoforms was similar in tTA/WT and PKC-beta II mice. Expression of beta -MHC was significantly higher than the expression of alpha -MHC in either group. Determination of mRNA levels was performed in 5 hearts for each group. GAPDH, glyceraldehyde-3-phosphate dehydrogenase. * P < 0.05, significantly different from alpha -MHC.

The levels of alpha - and beta -MHC were also similar between tTA/WT and PKC-beta II neonatal hearts (Fig. 4B). The levels of alpha -MHC were 0.27 ± 0.04 pg/pg GAPDH (n = 5) in tTA/WT mice and 0.46 ± 0.12 pg/pg GAPDH (n = 5) in PKC-beta II mice. beta -MHC levels were 2.18 ± 0.46 pg/pg GAPDH (n = 5) in tTA/WT mice and 1.56 ± 0.69 pg/pg GAPDH (n = 5) in PKC-beta II mice. In both tTA/WT and PKC-beta II mice, the amounts of beta -MHC were significantly higher than the levels of alpha -MHC. The embryonic isoform (beta -MHC) is expressed at the highest levels during embryonic development and then declines during postnatal development, when alpha -MHC predominates. We found significantly higher levels of beta -MHC expression compared with alpha -MHC, which is probably indicative of the very early stages of postnatal development (<24 h old) when the myocytes were isolated.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

The results of our study clearly show that expression of constitutively active PKC-beta II in neonatal cardiac myocytes enhances the L-type ICa. Furthermore, the stimulatory effect of PKC-beta II was completely blocked by the addition of the specific PKC-beta antagonist LY-379196. Our data also show that the ICa increase was independent of changes in the level of Cav1.2 subunit mRNA, suggesting that PKC-beta II exerts its effect directly on the calcium channel.

Numerous studies (1-5, 12, 13, 18-20, 23, 24) have examined the modulation of the cardiac L-type calcium channel by PKC activation, either in heterologous expression systems or in native cells. However, the experiments have produced conflicting data, and there is no consensus as to the effect of PKC on calcium channels. This apparent controversy may be explained by the use of cell expression systems or models in which nonspecific PKC activation or inhibition was employed; this is not an issue in the novel transgenic model system we have used here.

Detailed biochemical information regarding regulation of these channels by phosphorylation is quite limited because they are complex multimeric membrane proteins and difficult to study in native tissues. In addition, it is not known whether one or more of the channel proteins are directly phosphorylated by PKC or whether the observed alterations in channel function are the result of secondary activation of another downstream effector(s). Presently, both the Cav1.2 and beta  subunits are considered to be possible substrates for PKC-dependent phosphorylation in vitro (15, 18). The Cav1.2 subunit in particular has been examined for putative phosphorylation sites, and several have been recognized. Regulation by PKC could occur through either direct phosphorylation of one or more of the channel proteins or indirect phosphorylation of another downstream effector(s) that might alter channel kinetics and behavior. Alternatively, PKC could modify transcriptional or posttranslational aspects of L-type calcium channel expression to bring about changes in the number of channels within the membrane that would also alter channel kinetics and behavior. Therefore, to detail some of the biochemical information regarding L-type calcium channel regulation, we analyzed channel activity and correlated this with the expression of Cav1.2 subunit mRNA as an index of channel number in response to PKC-beta II activation.

The data presented here suggest that PKC-beta II modulates cardiac L-type calcium channels via posttranslational mechanisms. This conclusion is supported by a number of observations. Foremost is the return of ICa in PKC-beta II-expressing cells treated with LY-379196 to levels similar to those in tTA/WT cells during a short incubation. If a greater number of channels were responsible for the increased ICa, then upon inhibition the ICa in the PKC-beta II-expressing cells might still be greater than in the tTA/WT cells. It is unlikely, though not impossible, that the PKC effect is due to an increase in channel number. In conflict with this possibility is the fact that, at this developmental stage, the transgene would have only been expressed for ~3-4 days in the ventricular myocytes by virtue of the alpha -MHC promoter used to drive transgene expression and the mRNA data that document equivalent levels of the Cav1.2 subunit mRNA in transgenic and WT neonatal hearts. It is possible that the quantitative mRNA data obtained from the whole heart may reflect the mean level of Cav1.2 subunit expression. Therefore, it is still to be determined whether there are changes in the Cav1.2 subunit (or other subunits) mRNA expression in individual myocytes expressing the PKC-beta II transgene. Although we recognize that mRNA levels do not always correlate with protein expression, these data strongly suggest that PKC-beta II is capable of altering channel activity independent of an increase in channel number.

The present findings should be qualified by noting that studies were done in neonatal cells, which have immature mechanisms to regulate calcium homeostasis, specifically an undeveloped sarcoplasmic reticulum and lower levels of L-type calcium channel mRNA. While there is no reason to believe that the fundamental biology differs in the adult, in fact the presence of a mature sarcoplasmic reticulum and differences in gene or protein expression of the L-type calcium channel might certainly influence the acquired cardiac phenotype.

In summary, our data provide evidence that constitutively active PKC-beta II modifies the L-type calcium channel to enhance the current. The exact nature of the mechanism is yet to be determined, but the initial evidence suggests the possibility of channel posttranslational modification in neonatal cardiac myocytes. However, as presented here, the combination of these electrophysiological, molecular, and pharmacological techniques should allow for further dissection of the independent actions of these signaling molecules and their isoforms within individual myocytes.


    ACKNOWLEDGEMENTS

We thank Dr. T. D. Alden for help with statistical analysis and R. McKinney for laboratory assistance.


    FOOTNOTES

* K. J. Alden and P. H. Goldspink contributed equally to this work.

This work was supported by National Science Foundation Grant IBN-9733570 (J. García) and National Heart, Lung, and Blood Institute Grant R01-HL-62230 (P. M. Buttrick). K. J. Alden was partially supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant T32-DK-07739.

Address for reprint requests and other correspondence: J. García, Dept. of Physiology and Biophysics, College of Medicine, Univ. of Illinois at Chicago, 900 S. Ashland Ave. M/C 902, Chicago, Illinois 60607 (E-mail: garmar{at}uic.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

10.1152/ajpcell.00494.2001

Received 16 October 2001; accepted in final form 19 November 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Aiello, EA, and Cingolani HE. Angiotensin II stimulates cardiac L-type Ca2+ current by a Ca2+- and protein kinase C-dependent mechanism. Am J Physiol Heart Circ Physiol 280: H1528-H1536, 2001.

2.   Asai, T, Shuba LM, Pelzer DJ, and McDonald TF. PKC-independent inhibition of cardiac L-type Ca2+ channel current by phorbol esters. Am J Physiol Heart Circ Physiol 270: H620-H627, 1996.

3.   Boixel, C, Tessier S, Pansard Y, Lang-Lazdunski L, Mercadier JJ, and Hatem SN. Tyrosine kinase and protein kinase C regulate L-type Ca2+ current cooperatively in human atrial myocytes. Am J Physiol Heart Circ Physiol 278: H670-H676, 2000.

4.   Bourinet, E, Fournier F, Lory P, Charnet P, and Nargeot J. Protein kinase C regulation of cardiac calcium channels expressed in Xenopus oocytes. Pflügers Arch 421: 247-255, 1992.

5.   Bowman, JC, Steinberg SF, Jiang T, Geenen DL, Fishman GI, and Buttrick PM. Expression of protein kinase C beta in the heart causes hypertrophy in adult mice and sudden death in neonates. J Clin Invest 100: 2189-2195, 1997.

6.   Dixon, AK, Richardson PJ, Lee K, Carter NP, and Freeman TC. Expression profiling of single cells using 3 prime end amplification (TPEA) PCR. Nucleic Acids Res 26: 4426-4431, 1998.

7.   Dosemeci, A, Dhallan RS, Cohen NM, Lederer WJ, and Rogers TB. Phorbol ester increases calcium current and simulates the effects of angiotensin II on cultured neonatal rat heart myocytes. Circ Res 62: 347-357, 1988.

8.   Hamill, OP, Marty A, Neher E, Sakmann B, and Sigworth FJ. Improved patch-clamp techniques for high-resolution current recording from cells and cell-free membrane patches. Pflügers Arch 391: 85-100, 1981.

9.   Ishii, H, Jirousek MR, Koya D, Takagi C, Xia P, Clermont A, Bursell SE, Kern TS, Ballas LM, Heath WF, Stramm LE, Feener EP, and King GL. Amelioration of vascular dysfunctions in diabetic rats by an oral PKC beta inhibitor. Science 272: 728-731, 1996.

10.   Jirousek, MR, Gillig JR, Gonzalez CM, Heath WF, McDonald JH, III, Neel DA, Rito CJ, Singh U, Stramm LE, Melikian-Badalian A, Baevsky M, Ballas LM, Hall SE, Winneroski LL, and Faul MM. (S)-13-[(dimethylamino)methyl]-10,11,14,15-tetrahydro-4,9:16,21-dimetheno-1H,13H-dibenzo[e,k]pyrrolo[3,4-h][1,4,13]oxadiazacyclohexadecene-1,3(2H)-dione (LY333531) and related analogues: isozyme selective inhibitors of protein kinase C beta. J Med Chem 39: 2664-2671, 1996.

11.   Josephson, IR, and Sperelakis N. Phosphorylation shifts the time-dependence of cardiac Ca2+ channel gating currents. Biophys J 60: 491-497, 1991.

12.   Lacerda, AE, Rampe D, and Brown AM. Effects of protein kinase C activators on cardiac calcium channels. Nature 335: 249-251, 1988.

13.   McHugh, D, Sharp EM, Scheuer T, and Catterall WA. Inhibition of cardiac L-type calcium channels by protein kinase C phosphorylation of two sites in the N-terminal domain. Proc Natl Acad Sci USA 97: 12334-12338, 2000.

14.   Ono, K, and Fozzard HA. Phosphorylation restores activity of L-type calcium channels after rundown in inside-out patches from rabbit cardiac cells. J Physiol (Lond) 454: 673-688, 1992.

15.   Puri, TS, Gerhardstein BL, Zhao XL, Ladner MB, and Hosey MM. Differential effects of subunit interactions on protein kinase A- and C-mediated phosphorylation of L-type calcium channels. Biochemistry 36: 9605-9615, 1997.

16.   Sculptoreanu, A, Rotman E, Takahashi M, Scheuer T, and Catterall WA. Voltage-dependent potentiation of the activity of cardiac L-type calcium channel alpha 1 subunits due to phosphorylation by cAMP-dependent protein kinase. Proc Natl Acad Sci USA 90: 10135-10139, 1993.

17.   Sculptoreanu, A, Scheuer T, and Catterall WA. Voltage-dependent potentiation of L-type Calcium channels due to phosphorylation by cAMP-dependent protein kinase. Nature 364: 240-243, 1993.

18.   Shistik, E, Ivanina T, Blumenstein Y, and Dascal N. Crucial role of N terminus in function of cardiac L-type Ca2+ channel and its modulation by protein kinase C. J Biol Chem 28: 17901-17909, 1998.

19.   Shistik, E, Keren-Raifman T, Idelson GH, Blumenstein Y, Dascal N, and Ivanina T. The N terminus of the cardiac L-type Ca2+ channel alpha(1C) subunit. The initial segment is ubiquitous and crucial for protein kinase C modulation, but is not directly phosphorylated. J Biol Chem 274: 31145-31149, 1999.

20.   Singer-Lahat, D, Gershon E, Lotan I, Hullin R, Biel M, Flockerzi V, Hofmann F, and Dascal N. Modulation of cardiac Ca2+ channels in Xenopus oocytes by protein kinase C. FEBS Lett 306: 113-118, 1992.

21.   Xia, P, Aiello LP, Ishii H, Jiang ZY, Park DJ, Robinson GS, Takagi H, Newsome WP, Jirousek MR, and King GL. Characterization of vascular endothelial growth factor's effect on the activation of protein kinase C, its isoforms, and endothelial cell growth. J Clin Invest 98: 2018-2026, 1996.

22.   Yu, Z, Redfern CS, and Fishman GI. Conditional transgene expression in the heart. Circ Res 79: 691-697, 1996.

23.   Zhang, S, Hiraoka M, and Hirano Y. Effects of alpha 1-adrenergic stimulation on L-type Ca2+ current in rat ventricular myocytes. J Mol Cell Cardiol 30: 1955-1965, 1998.

24.   Zhang, ZH, Johnson JA, Chen L, El-Sherif N, Mochly-Rosen D, and Boutjdir M. C2 region-derived peptides of beta-protein kinase C regulate cardiac calcium channels. Circ Res 80: 720-729, 1997.


Am J Physiol Cell Physiol 282(4):C768-C774
0363-6143/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
Cardiovasc ResHome page
A. D. Maturana, S. Walchli, M. Iwata, S. Ryser, J. Van Lint, M. Hoshijima, W. Schlegel, Y. Ikeda, K. Tanizawa, and S. Kuroda
Enigma homolog 1 scaffolds protein kinase D1 to regulate the activity of the cardiac L-type voltage-gated calcium channel
Cardiovasc Res, June 1, 2008; 78(3): 458 - 465.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
V. Pastukh, S. Wu, C. Ricci, M. Mozaffari, and S. Schaffer
Reversal of hyperglycemic preconditioning by angiotensin II: role of calcium transport
Am J Physiol Heart Circ Physiol, April 1, 2005; 288(4): H1965 - H1975.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
K. D. Garcia, T. Shah, and J. Garcia
Immunolocalization of type 2 inositol 1,4,5-trisphosphate receptors in cardiac myocytes from newborn mice
Am J Physiol Cell Physiol, October 1, 2004; 287(4): C1048 - C1057.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
P. H. Goldspink, D. E. Montgomery, L. A. Walker, D. Urboniene, R. D. McKinney, D. L. Geenen, R. J. Solaro, and P. M. Buttrick
Protein Kinase C{epsilon} Overexpression Alters Myofilament Properties and Composition During the Progression of Heart Failure
Circ. Res., August 20, 2004; 95(4): 424 - 432.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
B. B. Roman, P. H. Goldspink, E. Spaite, D. Urboniene, R. McKinney, D. L. Geenen, R. J. Solaro, and P. M. Buttrick
Inhibition of PKC phosphorylation of cTnI improves cardiac performance in vivo
Am J Physiol Heart Circ Physiol, June 1, 2004; 286(6): H2089 - H2095.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
I. G. Brodsky, D. Suzara, T. A. Hornberger, P. Goldspink, K. E. Yarasheski, S. Smith, J. Kukowski, K. Esser, and S. Bedno
Isoenergetic Dietary Protein Restriction Decreases Myosin Heavy Chain IIx Fraction and Myosin Heavy Chain Production in Humans
J. Nutr., February 1, 2004; 134(2): 328 - 334.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
P. Ping
A new chapter in cardiac PKC signaling studies: searching for isoform-specific molecular targets. Focus on: "Isoenzyme-selective regulation of SERCA2 gene expression by protein kinase C in neonatal rat ventricular myocytes"
Am J Physiol Cell Physiol, July 1, 2003; 285(1): C19 - C21.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/4/C768    most recent
00494.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (19)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Alden, K. J.
Right arrow Articles by García, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Alden, K. J.
Right arrow Articles by García, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online