|
|
||||||||
Department of Pharmacology and Clinical Pharmacology, St. George's Hospital Medical School, London, SW17 ORE UK
| |
ABSTRACT |
|---|
|
|
|---|
Voltage-clamp studies of
freshly isolated smooth muscle cells from rabbit portal vein
revealed the existence of a time-dependent cation current evoked by
membrane hyperpolarization (termed Ih). Both the
rate of activation and the amplitude of Ih were
enhanced by membrane hyperpolarization. Half-maximal activation of
Ih was about
105 mV with conventional whole
cell and
80 mV when the perforated patch technique was used. In
current clamp, injection of hyperpolarizing current produced a marked
depolarizing "sag" followed by rebound depolarization. Activation
of Ih was augmented by an increase in the
extracellular K+ concentration and was blocked rapidly by
externally applied Cs+ (1-5 mM). The bradycardic agent
ZD-7288 (10 µM), a selective inhibitor of Ih,
produced a characteristically slow inhibition of the portal vein
Ih. The depolarizing sag recorded in current clamp was also abolished by application of 5 mM Cs+.
Cs+ significantly decreased the frequency of spontaneous
contractions in both whole rat portal vein and rabbit portal vein
segments. Multiplex RT-PCR of rabbit portal vein myocytes using primers derived from existing genes for hyperpolarization-activated cation channels (HCN1-4) revealed the existence of cDNA clones
corresponding to HCN2, 3, and 4. The present study shows that portal
vein myocytes contain genes shown to encode for
hyperpolarization-activated channels and exhibit an endogenous current
with characteristics similar to Ih in other cell
types. This conductance appears to determine, in part, the rhythmicity
of this vessel.
vascular smooth muscle; membrane hyperpolarization
| |
INTRODUCTION |
|---|
|
|
|---|
CATION CURRENTS ACTIVATED by membrane hyperpolarization (termed If, Iq, or Ih) have been studied extensively in neuronal and cardiac cells, where they regulate rhythmic oscillatory behavior (24, 28). These currents have distinctive characteristics, namely, sigmoidal activation that increases with hyperpolarization, permeability to K+ and Na+, enhancement by external K+ and cAMP, and inhibition by external Cs+ and the bradycardic agent ZD-7288 (5, 26). To date, four genes that encode Ih have been isolated from primarily neuronal and cardiac tissues (11, 12, 20, 28). These clones, termed hyperpolarization-activated cation channels (HCN) 1-4 for consistency (9), share a high degree of homology but exhibit subtle differences when the gene product is expressed in various vectors (e.g., Refs. 11 and 21). Moreover, the distribution of expression in various tissues is markedly different for each HCN isoform (11, 27, 30).
Cation currents evoked by membrane hyperpolarization have also been recorded in various spontaneously active smooth muscle cells such as the jejunum (4), bladder (13), stomach (15), lymphatic vessels (23), uterus (25), and ileum (35). Furthermore, these currents have been implicated in pacemaking activity in lymphatic vessels (23) and the uterus (25). However, hyperpolarization-activated cation currents have not been characterized in vascular smooth muscle cells. The aim of the present study was to characterize a hyperpolarization-activated cation current in smooth muscle cells isolated from portal vein, a blood vessel that is relatively unusual in that it exhibits regular spontaneous contractions (16, 31) and shares many similarities with visceral muscles (16, 31). Identification of Ih in portal vein cells was based on the exhibition of various characteristics that are distinctive for Ih in other cell types (listed above). Functional studies were also performed to determine whether blockers of this conductance (Cs+ or ZD-7288) could modify the spontaneous contractile activity of the portal vein. In addition, using the multiplex PCR (mRT-PCR) technique (7, 11), the expression profiles of HCN1-4 were determined in rabbit portal vein. A preliminary account of this work has been presented previously (14).
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Isolation of vascular myocytes. Cells were prepared from portal veins isolated from New Zealand White rabbits (2-3 kg) that had been killed by anesthesia overdose. After being dissected, longitudinal strips of the whole portal vein were placed in Ca2+-free physiological salt solution containing 0.2 mg/ml protease type IV for 5 min followed by incubation in physiological salt solution containing 50 µM Ca2+ and 0.5 mg/ml collagenase type 1A for 10 min. Cells were released by gentle agitation with a wide-bore Pasteur pipette. Cells were stored at 4°C and used within 6 h.
Functional studies. Portal veins have been shown to exhibit regular, spontaneous contractions under isometric conditions (31), and therefore functional experiments were undertaken using conventional organ baths (20-ml volume). However, due to the large size of the whole rabbit portal vein, transverse segments ~5 mm in length were taken from either the hepatic end or the middle of the vessel. Each segment was attached to an isometric force transducer by surgical thread at a resting tension of 1.5 g and was bathed in normal aerated Krebs solution at 37°C. Regular, spontaneous activity developed within 90 min and was stable for over 2 h. Control mechanical activity was recorded for 30 min, and then either Cs+ (1-5 mM) or ZD-7288 (10 µM) was added to the organ bath. Mechanical activity was recorded for 15 min in the presence of these agents. The mean amplitude and intercontraction interval were determined by measuring the amplitude of each individual contraction and also the interval between each contraction over a 5-min period before CsCl or ZD-7288 was added to the bath (control value) and for a 5-min period immediately before the blocker was washed from the bath (drug value). The intercontraction interval was determined as the time between the termination of one contraction and the onset of the next contraction (taken as a 0.02-g increase from baseline). In addition, experiments were performed on complete portal veins excised from Wistar-Kyoto rats (250 g) to determine how addition of Cs+ to the bathing solution affected the spontaneous activity of a complete portal vein. Animals were killed by cervical dislocation and exsanguination, and portal veins were ligated immediately distal to the intestines and proximal to the liver before removal. After removal of fat and connective tissue, the veins were bathed in aerated Krebs in the organ bath. All data were recorded and analyzed by MacLab software on an Apple Macintosh computer.
Electrophysiology.
Whole cell currents were recorded at room temperature (21-24°C)
using CED software (Cambridge Electronic Design, Cambridge, UK) and a
List amplifier (Heka Electronics). Analysis was performed using CED
software as well as Origin (Microcal, Northampton, MA). The
characteristics of Ih were investigated using
protocols adapted from Refs. 25 and 35. Cells
were held at
50 mV and initially stepped to
30 mV for 200 ms to
fully inactivate any contaminating voltage-dependent currents and to
ensure full activation of Ih. Cells were then
pulsed to various potentials between
30 mV and
150 mV for
either 4 s or 10 s to activate Ih. The
amplitude of Ih was taken as the current
amplitude immediately after stepping to the test potential subtracted
from the amplitude of the inward current at the end of the test pulse.
Current activation was fitted by a single exponential in most cases
using a nonlinear least-squares fitting routine where the time course
of activation was determined by the equation
|
(1) |
is the time constant.
In the present study, reversal potential
(Erev) was determined by the method of Mayer and
Westbrook (22) at negative test potentials at which the
influence of voltage-dependent currents would be minimal (see also Ref.
13). In this method, it is assumed that the instantaneous
current amplitude recorded on stepping from
30 mV to various
hyperpolarized test potentials was composed of a background conductance
plus an unknown but negligible contribution from
Ih. In comparison, the instantaneous current at
various negative test potentials following maximal activation of
Ih caused by hyperpolarization to
150 mV for
4 s would be dominated by Ih.
Erev was calculated by plotting the amplitude of
the current at test potentials between
150 mV and
70 mV following
an initial 4-s step to either
30 mV or
150 mV. The voltage at which
the two lines intersect was taken as Erev. In
two cells, Erev was also calculated by using a
conventional tail current protocol, which involved stepping the cell
from the holding potential of
50 mV to
120 mV for 4 s to
maximally activate Ih. The cell was then stepped
to various test potentials (
100 to
20 mV), and the amplitude of the
instantaneous current was plotted against the test potential. Identical
values for Erev were obtained with both methods.
Ih in other cell types has been shown to be a
mixed cation current with an Erev around
35 mV
(e.g., Refs. 13, 25, and 35), a
calculated permeability of Na+ relative to K+
of ~0.3 (see Ref. 26), and a minimal contribution from
divalent cations. The relative permeability of K+ to
Na+ (PK/PNa)
was calculated using the Goldman-Hodgkin-Katz (GHK) equation as in a
previous study (25)
|
(2) |
|
Solutions. The external solution for electrophysiological experiments contained (in mM) 126 NaCl, 6 KCl, 10 HEPES, 20 glucose, 1.8 CaCl2, and 1.2 MgCl2, and pH was set to 7.2 with NaOH. Tetraethylammonium-Cl (10 mM) and 4-aminopyridine (5 mM) were also included in the external solution to block any ion flux through either Ca2+-activated K+ channels or voltage-dependent K+ channels that are present in these cells (3, 17). The pipette solution contained (in mM) 126 KCl, 10 HEPES, 20 glucose, 0.1 EGTA, and 1.2 MgCl2, and pH was set to 7.2 with KOH. In some experiments, the perforated patch configuration was used, which was achieved by including 600 µg/ml amphotericin A in the same pipette solution used in conventional whole cell experiments (shown above). The Krebs solution for the functional studies contained (in mM) 117 NaCl, 4.7 KCl, 25 NaHCO3, 1.2 KH2PO4, 1.2 MgSO4, 11 glucose, and 2.6 CaCl2. All reagents used in this study were purchased from Sigma (Poole, UK) except for ZD-7288 (Tocris, Avonmouth, UK).
Molecular biology.
Single cells were prepared from rabbit portal vein as described in
Isolation of vascular myocytes. Cells were plated
onto glass coverslips and allowed to attach for 10 min. They were then rinsed with sterile PBS solution, and ~50 single smooth muscle cells
were sucked into a large-diameter micropipette under a microscope. The
pipette was then transferred to a Microfuge tube and frozen at
70°C
until use. Total RNA was isolated using the RNAqueous-4PCR Kit from
Ambion (Austin, Texas) as per the manufacturer's instructions with the
DNase treatment step. First strand cDNA was prepared using Superscript
II (Life Technologies, Paisley, UK) and 500 µg/µl oligo(dT) primers
in a total volume of 20 µl.
Multiplex and nested PCR.
The HCN1-4 were amplified simultaneously in the mPCR using
HCN1-4 primers as previously described (11, 30). The
primer sequences were taken from the following sequences in GenBank: HCN1 primers from HAC2, accession no. AJ225123; HCN2 primers from HAC1,
accession no. AJ225122; HCN3 primers from HAC3, accession no. AJ225124;
and HCN4 primers from mBCNG-3, accession no. AF064874. The primer pairs
(5' to 3') in the first PCR were: HCN1 sense, TCTTGCGGTTATTACGCCTT
(position 985), antisense, TTTTCTTGCCTATCCGATCG (position 1983); HCN2
sense, TACTTGCGTACGTGGTTCGT (position 810), antisense,
GAAATAGGAGCCATCCGACA (position 1775); HCN3 sense,
CGCATCCACGAGTACTACGA (position 1242), antisense, CACTTCCAGAGCCTTTACGC (position 2322); and HCN4 sense, TCTGATCATCATACCCGTGG (position 295),
antisense, GAAGACCTCGAAACGCAACT (position 1315). For mPCR, the final
volume of each sample was 100 µl containing 10 µl of the RT
reaction, 100 pmol of each primer, 0.2 mM each dNTP, 1.5 mM
MgCl2, 50 mM KCl, 20 mM Tris · HCl (pH 8.4), and
3.5 units of Platinum Taq polymerase (Life Technologies).
Amplification was performed according to the following schedule using a
Hybaid Touchdown PCR machine (Hybaid, Ashford, UK): 94°C, 3 min; 35 cycles of 94°C, 30s; 50°C, 60s; and 72°C, 3 min, followed by a
final elongation period of 7 min at 72°C. The nested PCR
amplifications were carried out in four individual reactions for each
tissue type, in each case with 2.5 µl of the first PCR product, 50 pmol of each primer, and 2.5 units of Platinum Taq
polymerase; the extension time was shortened to 60 s. For the
nested PCR amplifications, the primer pairs used were HCN1 sense,
CTCTTTTTGCTAACGCCGAT (position 1612), antisense, CATTGAAATTGTCCACCGAA
(position 1902); HCN2 sense, GTGGAGCGAGCTCTACTCGT
(position 1181), antisense, GTTCACAATCTCCTCACGCA (position 1550); HCN3 sense, GCAGCATTTGGTACAACACG (position
1808), antisense, AGCGTCTAGCAGATCGAGCT (position 2040); and HCN4 sense, GACAGCGCATCCATGACTAC (position 1110), antisense, ACAAAGTTGGGATCTGCGTT (position 1278). The PCR products were separated and visualized in an
ethidium bromide-stained 2% agarose gel by electrophoresis. The PCR
products were then excised and purified by using a QiaQuick gel
extraction kit (Qiagen) and were cloned into pGEMT (Promega). Cloned
cDNA were sequenced by the dideoxytermination method with fluorescent
labels on an ABI PRISM sequencer (Perkin Elmer) by the Advanced
Biotechnology Centre at Imperial College School of Medicine (London,
UK). The sequences were compared with those in EMBL using the program
BLAST via EMBOSS at Human Genome Mapping Project computing services
(Cambridge, UK). No genomic DNA was detected as determined by omission
of Superscript II in the RT reactions and by PCR of a 250-bp intron
spanning length of
-actin. The predicted sizes (bp) of the
PCR-generated fragments were 291 (HCN1), 370 (HCN2), 233 (HCN3), and
169 (HCN4).
Statistics. All data are means of n cells ± SE. All electrophysiological data contain experiments from at least three different animals.
| |
RESULTS |
|---|
|
|
|---|
Ih has distinctive characteristics that allow this conductance to be identified from other inward rectifiers. These characteristics include slow, sigmoidal activation on hyperpolarization, permeability to Na+ and K+, and blockade by Cs+ and ZD-7228. We have used these distinctive features to compare Ih in the present study with similar currents recorded in previous studies.
Hyperpolarization of portal vein smooth muscle cells from a holding
potential of
50 mV to potentials more negative to
70 mV for 4 s evoked a slowly developing inward current (termed
Ih) after an initial delay (see Fig.
1). This current did not inactivate during prolonged test pulses (see Fig. 5, for example) and did not
exhibit "rundown" over the course of an experiment. Progressive membrane hyperpolarization shortened the duration of the delay and
increased the amplitude of the current at the end of a 4-s step (Fig.
1B). The enhancement of current amplitude was associated with an enhanced rate of activation. Figure 1 shows that, at
110 mV,
the development of Ih could be fitted by a
single exponential with a time constant (
) of 6,000 ms. At
150 mV,
the current was also well fitted by a single exponential with a
of
371 ms. Figure 1C shows the mean data from 13 cells showing
that
decreased exponentially for a 18-mV hyperpolarization.
These values for the activation of Ih at room
temperature are comparable with time constants recorded in other smooth
muscle cell types (e.g., Refs. 23, 25, and
35). Figure 1 also shows that, following the test step to
negative potentials, stepping back to the holding potential revealed a
slowly declining inward "tail" current that represented the closure
of Ih channels opened by the previous membrane
hyperpolarization. The amplitude of the tail current following each
hyperpolarization relative to the amplitude of the maximum tail current
gives an index of the current availability. Fitting of the Boltzmann
function to these data (see Fig.
2C) gives a potential of
half-maximal activation (V0.5) of
112 ± 11 mV and a slope factor of 12 ± 2 mV (n = 7).
When the duration of the test step was prolonged to 10 s to ensure
greater activation of Ih at each test potential,
V0.5 was shifted to
108 ± 5 mV and the
slope factor was unchanged (n = 4). However, when
similar experiments were performed using the perforated patch
configuration of the whole cell voltage-clamp technique,
V0.5 was calculated to be
83 ± 3 mV and
the slope 13 ± 3 mV (n = 6). These values are
similar to Ih recorded in other cell types.
Moreover, because the perforated patch configuration minimizes
perturbation of the intracellular compartment, these data suggest that
intracellular regulators govern the availability of
Ih. Overall, the data show that a current
activated by membrane hyperpolarization with characteristics similar
to Ih recorded in other cell types is present in
vascular smooth muscle cells isolated from rabbit portal vein.
|
|
Effect of extracellular K+ and
Na+ on Ih.
A feature of Ih that distinguishes it from
conventional K+ inward rectifiers is that it is carried by
Na+ and K+ and has a concomitant
Erev that is between
25 mV and
40 mV (e.g.,
Refs. 4 and 23). Application of the modified
GHK to these reversal potential measurements shows that the relative permeability of Na+ to K+
(PNa/PK) is between 0.2 and 0.5 (26). In portal vein cells, Erev was
37 ± 2 mV (n = 7), which was markedly different from the theoretical potentials of
K+ and Cl
(EK and
ECl) with the solutions used (
78 mV
and
3 mV) and shows that Ih in portal vein
myocytes is also carried by K+ and Na+. A
similar value for Erev was obtained in two cells
where Erev was also calculated by determining
the reversal potential of the tail current following maximal activation
at
120 mV. Similar to previous reports (4, 23, 25), the
amplitude of Ih in portal vein myocytes was not
affected by complete removal of external Ca2+
(n = 3). Calculation of
PNa/PK in the portal vein
myocytes using the reversal potential values and the modified GHK
equation gave a value of 0.4 under physiological ion gradients that is
similar to values reported for Ih in jejunal,
lymphatic, and uterine smooth muscle.
110 mV was 35 ± 18 pA
(n = 7) in 6 mM external K+ and 114 ± 58 pA in 40 mM external K+ (n = 5). The
mean data from seven such experiments is shown in Fig. 2B,
and it can be seen that the amplitude of Ih was
augmented at every potential at which Ih was
activated. This was associated with an acceleration of the rate of
activation at each test potential. For example, the mean
for
current activation at
110 mV was 5.8 ± 1.2 s in 6 mM
K+ (n = 13) and 1.9 ± 0.19 s in
40 mM K+ (n = 7). Figure 2C
shows that the augmentation of current amplitude by an increase in the
external K+ concentration was associated with a shift in
the voltage dependence of activation to less negative potentials.
Reduction of external Na+ by 36 mM without a concomitant
increase in K+ (equimolar replacement with the impermeant
cation Tris) did not augment Ih (see
Fig. 3 for example). In four cells, the
mean amplitude of Ih at
110 mV was
27 ± 7 and
20 ± 2 pA with 136 mM and 102 mM external
Na+, respectively. These data show that, similar to
Ih in other studies (26),
the activation of this conductance in portal vein smooth muscle cells
is markedly accentuated by an increase in external K+
concentration.
|
Inhibition of Ih by extracellular
Cs+ and ZD-7288.
Previous studies have shown that Ih is rapidly
inhibited by extracellular Cs+ (e.g., Refs. 4
and 25) and slowly blocked by the bradycardic agent
ZD-7288 (5, 13). Figure 4A
shows an example of the effect of bath-applied Cs+ on
Ih activated in portal vein myocytes. Addition
of 2 mM Cs+ to the bathing solution produced a rapid and
complete inhibition of the time-dependent current (see Fig.
4B) that was fully reversible after 5- min wash with normal
extracellular solution (mean data are shown in Fig. 4B). In
comparison, application of Ba2+ up to 1 mM had no effect on
the amplitude of Ih. In three cells, the mean
amplitude of Ih at
110 mV in the absence and
after 2-min incubation in 1 mM Ba2+ was
120 ± 47 pA
and
119 ± 43 pA, respectively. Application of 10 µM ZD-7288
to the bathing solution produced a characteristically slow inhibition
of Ih (see Fig. 4C), in contrast to
the rapid effect of Cs+. Thus after 20-min application of
10 µM ZD-7288, the amplitude of Ih at
130 mV
was inhibited by 30 ± 5% (n = 3). The
pharmacological profile of Ih in portal vein
smooth muscle cells is therefore similar to Ih
recorded in other cell types.
|
Effect of dibutyryl cAMP on Ih.
It has been shown in numerous studies that activation of
Ih is rapidly (within 1 min) augmented by
maneuvers that increase cAMP concentration, such as stimulation of
adenylyl cyclase by forskolin or inhibition of phosphodiesterases
(10, 19, 26). In the present study, the cell-permeable
analog of cAMP, dibutyryl cAMP (10-100 µM), was applied to cells
exhibiting Ih. It can be seen from Fig.
5 that application of 100 µM dibutyryl
cAMP for 8 min did not enhance the activation of
Ih but actually diminished the current
amplitude. In Fig. 5, the amplitude of Ih at
150 mV was decreased from
93 to
76 pA after 8-min application of 100 µM dibutyryl cAMP, and the mean inhibition in five such
experiments was 20 ± 7%. Application of dibutyryl cAMP at 40 µM also inhibited the amplitude of Ih
(n = 3). However, Fig. 5 shows that application of
dibutyryl cAMP did increase the amplitude of the outward K+
current evoked by depolarization to
30 mV. In these experiments, tetraethylammonium and 4-aminopyridine were excluded from the external
solution to allow outward K+ currents to be recorded.
Overall, the data suggest that, compared with Ih
recorded in cardiac and neuronal cells, Ih in
portal vein smooth muscle cells is not enhanced by an increase in cAMP
concentration.
|
Functional role of Ih.
Previous studies have shown that Ih contributes
to the depolarizing "sag" in membrane voltage produced in response
to injection of hyperpolarizing current (e.g., Refs. 4,
23, and 25). This depolarizing potential can
elicit overshoot action potentials and underpins cellular rhythmicity.
Similar anomalous rectification of membrane potential was observed in
the present study. Figure 6 shows an
example of a current-clamp recording from a portal vein smooth muscle
cell made using the perforated patch technique. In the cell shown, the
resting membrane potential was
36 mV and injection of depolarizing
current evoked a rapid depolarizing action potential followed by a
sustained depolarization. Injection of 20-pA hyperpolarizing current
produced an initial deflection to
87 mV that gradually relaxed to a
level of
67 mV. Figure 6 also shows that the amplitude and rate of
sag was enhanced by injection of more hyperpolarizing current.
Termination of the current pulse was accompanied by an immediate
rebound depolarization, and similar effects were observed in four other
cells. In the presence of 5 mM Cs+, which abolishes
Ih, the voltage response to injection of
depolarizing current was unaffected, but the voltage sag seen following
injection of hyperpolarizing current was completely absent and the
extent of membrane hyperpolarization was more marked (Fig.
6B). Moreover, the generation of rebound depolarization
after termination of the current pulse was markedly slowed. These data
show that a hyperpolarization-activated and Cs+-sensitive
conductance limits the duration and extent of membrane hyperpolarizing
responses and provides a depolarizing influence.
|
|
Molecular biology of the underlying channel.
The characteristics of Ih in rabbit portal
vein resemble those of ion channels expressed by HCN genes.
Consequently, we used mRT-PCR to determine the molecular identity of
the channel underlying Ih. Three rabbit genes
encoding regions homologous to HCN2, HCN3, and HCN4 were found in
rabbit portal vein smooth muscle cells (Fig.
8). The clones isolated from the
smooth muscle cells (rpvsmHCN2, 3, and 4) showed significant homology
with those already published from rat and rabbit. rpvsmHCN2
was 93% homologous to accession no. AF067815, rpvsmHCN3 was 97%
homologous to accession no. AF247452, and rpvsmHCN4 was 93% homologous
to accession no. AB022927. These data show that cDNA corresponding to
HCN is amplified by mRT-PCR in single cells collected from rabbit
portal vein smooth muscle.
|
| |
DISCUSSION |
|---|
|
|
|---|
We show in the present study that in rabbit portal vein smooth muscle cells an ion current carried by monovalent cations is elicited by progressive membrane hyperpolarization. This current, termed Ih, was not affected by 100 µM Ba2+ but was rapidly inhibited by external Cs+ and slowly blocked by a specific inhibitor, ZD-7288. The degree of inhibition and slowness of effect of ZD-7288 was similar to that reported in rat detrusor myocytes (13). These kinetics and pharmacological properties of Ih are similar to those of Ih reported in other spontaneously active, visceral smooth muscles (see Introduction) and are clearly different from the features of the time-independent, Ba2+-sensitive inward rectifier K+ channels (Kir) that have been reported in some arterial smooth muscle cells (6). Although this current was described briefly by Kamouchi et al. (18), the present study represents the first extensive characterization of this conductance in vascular smooth muscle cells. Moreover, mRT-PCR reactions using primers specific to HCN1-4 revealed the existence of three HCN clones in portal vein myocytes that have been shown to encode for hyperpolarization-activated cation currents (9, 19, 29). A functional role for this conductance was implicated from current clamp experiments that showed that injection of hyperpolarizing current produced a marked Cs+-sensitive depolarizing sag. In addition, blockers of Ih modified the spontaneous contractile activity of rabbit and rat portal veins.
Voltage-dependence of Ih in portal vein myocytes.
In the present study, the activation of Ih at
room temperature was relatively slow, differentiating this conductance
form a conventional, pure K+ inward rectifier (e.g., Kir).
The activation of Ih was described by a single
exponential, and the time constant for activation was similar to values
reported for Ih in other smooth muscle cells (see Refs. 23, 25, and 35).
However, the V0.5 of Ih
using the whole cell configuration (approximately
108 mV) was more negative than values in other studies. Thus in other smooth
muscle cell types, the V0.5 values for
activation of Ih range between
74 mV (rat
bladder; Ref. 13) and
91 mV (guinea pig ileum; Ref.
35). The negative V0.5 of
Ih in portal vein cells suggests that the
physiological contribution of Ih would be
negligible. However, Yanagida et al. (35) have shown that
the V0.5 for activation becomes 12 mV less hyperpolarized per 10°C increase in temperature, and
therefore the involvement of Ih at physiological
temperatures would be greater. Moreover, in the present study the
V0.5 of Ih was shifted to
less negative potentials (
83 mV) when the perforated patch
configuration was used. Because the intracellular ionic conditions are
the same with this technique but loss of intracellular regulators is
minimized, these data suggest that a cytosolic mediator that is washed
out by the conventional whole cell configuration regulates the
activation of Ih in portal vein smooth muscle
cells. Hisada et al. (15) also proposed that the
activation of hyperpolarization-gated, but not stretch-activated,
cation currents in toad stomach myocytes was dependent on a soluble
mediator. In portal vein cells, the regulator seems not to be cAMP
(discussed in Modulation of Ih in portal vein cells
by cAMP), because, in general, binding of cAMP only shifts
V0.5 by about +11 mV, which is insufficient to explain the +30-mV shift in V0.5 observed in the
present study. Interestingly, cation currents generated by the
heterologous expression of HCN clones have V0.5
values of about
100 mV (19, 24, 28), and the activation
of Ih is exquisitely dependent on the local environment (see Ref. 29). It remains the focus of future
studies to determine what is the exact nature of the regulator
concerned in portal vein myocytes.
Modulation of Ih in portal vein cells by cAMP. One of the distinctive properties of endogenous hyperpolarization-activated cation currents in cardiac and neuronal preparations is that the voltage dependence is shifted to less negative potentials by the direct binding of cAMP to the channel (10, 26). In the present study, application of a cell-permeable analog of cAMP (dibutyryl cAMP) did not enhance Ih and actually reduced the amplitude of Ih slightly. However, dibutyryl cAMP did augment the outward current in portal vein cells, consistent with the effects of cAMP on delayed rectifier currents reported previously in this cell type (1). A similar lack of effect of cAMP has been observed on native Ih in octopus cells of the mammalian cochlear (2) and anterior pituitary cells (32), as well as some heterologously expressed HCN isoforms (8, 19). Moreover, it is significant that only one study of Ih in smooth muscle cells has reported a small stimulatory effect of cAMP on Ih (35). These data suggest that the channel underlying Ih may have a different molecular composition from Ih channels in cardiomyocytes and various neurons, where the current is highly sensitive to cAMP. Alternatively, the basal level of cAMP in portal vein smooth muscle cells may be sufficient to saturate the cyclic nucleotide binding site similar to the situation in mouse anterior pituitary cells (32). Future studies will attempt to elucidate the precise regulatory pathways that govern the activation of Ih in portal vein smooth muscle cells.
Identification of HCN in rabbit portal vein.
The facts that the native Ih in portal vein
myocytes is activated by hyperpolarization, that its selectivity for
K+ over Na+ is low, and that it can be blocked
by Cs+ all suggested that its molecular structure would be
similar to that encoded by the HCN gene family. Consequently, we
isolated partial cDNA clones for three rabbit genes homologous
to HCN2, 3, and 4 in rabbit portal vein smooth muscle cells. The rate
of activation of Ih in portal vein cells is
comparable to the slow kinetics of heterologously expressed HCN4 that
has an activation time constant at
150 mV of a few hundred
milliseconds (19, 29), which is considerably slower than
that of other HCN isoforms. However, activation of HCN4 is augmented
markedly by cAMP (19, 29), in contrast to the relative
insensitivity of the native Ih to cAMP in portal
vein cells. HCN1 channels are almost unaffected by cAMP (8, 19,
29), but the rate of activation of HCN1 channels is very fast,
and no expression of HCN1 gene products was detected in the single-cell
PCR of portal vein myocytes.
-subunits, such as minK-related
peptide 1 (MiRP1; Ref. 36), similar to the situation with
K+ channels (e.g., Ref. 34). Consequently,
which isoform (or isoforms) contribute to the channel protein
underlying Ih can only be guessed until the
portal vein transcripts are cloned and expressed in heterologous
expression systems. These experiments should also highlight whether the
features of the native current are the product of heterogeneous HCN
combinations alone or due to modulation by subunits such as MiRP1.
Additional PCR experiments to identify the presence of regulatory
subunits in the portal vein should also be undertaken. In addition,
antibodies to various HCN isoforms have been raised, and these could be
used to elucidate functional HCN isoforms.
Putative role of Ih in the generation of spontaneous contractile activity of the portal vein. In current-clamp experiments, injection of hyperpolarizing current evoked an electrotonic potential that had a pronounced depolarizing sag that was followed immediately on termination of current injection by a marked depolarization. Application of Cs+ abolished the anomalous rectification and increased the latency of the rebound depolarization. Moreover, Cs+ markedly slowed the spontaneous contractile activity of segments of rabbit portal vein as well as the rhythmic activity of whole rat portal veins. Similar effects of external Cs+ were observed on contractile activity in sheep lymphatic vessels (23) and rat uterine tissues (25). This effect is consistent with the blockade of an ion conductance that provides a depolarizing influence sufficient to activate voltage-dependent Ca2+ influx. The voltage dependence, activation kinetics, and lack of inactivation of Ih give this conductance the unique property of activating on membrane hyperpolarization that follows action potential discharge (19, 26). Hence, Ih has been implicated as a pacemaker current. This proposal is supported by the observation that Ih has so far been reported in smooth muscle cells that exhibit regular spontaneous contractions analogous to the rhythmic firing and contraction of thalamic neurons and cardiomyocytes (26). However, the fact that Cs+ did not abolish spontaneous contractile activity in either rat or rabbit portal vein suggests that Ih is not the sole mechanism responsible for generating spontaneous activity in these preparations. The precise mechanism that governs rhythmicity in the portal vein is unknown and would require the use of various agents such as tetraethylammonium and 4-aminopyridine in functional studies to tease apart the contributions of different ion channels to normal electrical activity. Moreover, it is a worthwhile caveat that application of Cs+ externally might also affect other ion channels involved with the normal electrical activity of smooth muscle cells. Ideally, a more selective and specific agent would be used to probe the functional role of Ih in the generation of spontaneous activity. However, application of the specific inhibitor of Ih, ZD-7288 (see Refs. 5 and 13), produced more complicated effects on the spontaneous activity of rabbit portal vein segments, including an increase in basal tension, that were comparable to the actions of this agent on spontaneous contractile activity in rat detrusor muscle (13). The mechanism by which ZD-7288 increases contractile activity was not determined in the previous study (13) but precluded the use of this agent to probe for a role of Ih in the generation of spontaneous activity.
In conclusion, the present study shows that a hyperpolarization-activated cation current with characteristics similar to Ih reported in cardiomyocytes, neurons, and visceral smooth muscle cells (26) is present in a vascular smooth muscle cell type. However, it is worth noting that the portal vein is a relatively specialized blood vessel in that it has a predominant longitudinal layer of smooth muscle (16, 31) that contributes to its function as a pumping unit exhibiting regular, coordinated contractions. It is therefore possible that the hyperpolarization-activated current studied in the present investigation may not exist in quiescent "conventional" blood vessels. It remains the aim of future experiments to determine the molecular and regulatory determinants of this conductance in smooth muscle and whether such a conductance exists in other blood vessels.| |
ACKNOWLEDGEMENTS |
|---|
We acknowledge the helpful comments of Dr. Mark Hollywood, Queen's University, Belfast and thank Professor Tom Bolton at St. George's Hospital Medical School for his advice and support.
| |
FOOTNOTES |
|---|
I. A. Greenwood is a Wellcome Trust Research Career Development Fellow (grant no. 053794/Z/98). S. A. Prestwich is a Research Fellow at St. George's Hospital Medical School.
Address for reprint requests and other correspondence: I. A. Greenwood, Dept. of Pharmacology and Clinical Pharmacology, St. George's Hospital Medical School, London, SW17 ORE UK (E-mail i.greenwood{at}sghms.ac.uk).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
10.1152/ajpcell.00393.2001
Received 10 August 2001; accepted in final form 21 November 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Aiello, EA,
Walsh MP,
and
Cole WC.
Phosphorylation by protein kinase A enhances delayed rectifier K+ current in rabbit vascular smooth muscle cells.
Am J Physiol Heart Circ Physiol
268:
H926-H933,
1995.
2.
Bal, R,
and
Oertel D.
Hyperpolarization-activated mixed-cation current (Ih) in octopus cells of the mammalian cochlear nucleus.
J Neurophysiol
84:
806-817,
2000.
3.
Beech, DJ,
and
Bolton TB.
Two components of potassium current activated by depolarization of single smooth muscle cells from the rabbit portal vein.
J Physiol (Lond)
418:
293-309,
1989.
4.
Benham, CD,
Bolton TB,
Denbigh JS,
and
Lang RJ.
Inward rectification in freshly isolated single smooth muscle cells of the rabbit jejunum.
J Physiol (Lond)
383:
461-476,
1987.
5.
BoSmith, RE,
Briggs I,
and
Sturgess NC.
Inhibitory actions of Zeneca ZD7288 on whole cell hyperpolarization activated inward current (If) in guinea-pig dissociated sinoatrial node cells.
Br J Pharmacol
110:
333-339,
1993.
6.
Bradley, KK,
Jaggar JH,
Bonev AD,
Heppner TJ,
Flynn ER,
Nelson MT,
and
Horowitz B.
Kir2.1 encodes the inward rectifier potassium channel in rat arterial smooth muscle cells.
J Physiol (Lond)
515:
639-651,
1999.
7.
Cauli, B,
Audinat E,
Lambolez B,
Angulo MC,
Ropert N,
Tsuzuki K,
Hestrin S,
and
Rossier J.
Molecular and physiological diversity of cortical nonpyramidal cells.
J Neurosci
17:
3894-3906,
1997.
8.
Chen, S,
Wang J,
and
Siegelbaum SA.
Properties of hyperpolarization-activated pacemaker current defined by coassembly of HCN1 and HCN2 subunits and basal modulation by cyclic nucleotide.
J Gen Physiol
117:
491-503,
2001.
9.
Clapham, DE.
Not so funny anymore: pacing channels are cloned.
Neuron
21:
5-7,
1998.
10.
Difrancesco, D,
and
Tortora P.
Direct activation of cardiac pacemaker channels by intracellular cyclic AMP.
Nature
351:
145-147,
1991.
11.
Franz, O,
Liss B,
Neu A,
and
Roeper J.
Single-cell mRNA expression of HCN 1 correlates with a fast phenotype of hyperpolarization-activated cyclic nucleotide-gated ion channels (Ih) in central neurones.
Eur J Neurosci
12:
2685-2693,
2000.
12.
Gauss, R,
Seifert R,
and
Kaupp UB.
Molecular identification of hyperpolarization-activated channel in sea urchin sperm.
Nature
393:
583-587,
1998.
13.
Green, ME,
Edwards G,
Kirkup AJ,
Miller M,
and
Weston AH.
Pharmacological characterization of the inwardly-rectifying current in the smooth muscle cells of the rat bladder.
Br J Pharmacol
119:
1509-1518,
1996.
14.
Greenwood, IA.
Characteristics of hyperpolarization-activated cation currents in portal vein smooth muscle cells (Abstract).
J Physiol (Lond)
528:
5P,
2000.
15.
Hisada, T,
Ordway RW,
Kirber MT,
Singer JJ,
and
Walsh JV.
Hyperpolarization-activated cation channels in smooth muscle cells are stretch sensitive.
Pflügers Arch
417:
493-499,
1991.
16.
Holman, ME,
Kasby CB,
Suthers MB,
and
Wilson JAF
Some properties of the smooth muscle of rabbit portal vein.
J Physiol (Lond)
196:
111-132,
1968.
17.
Hume, J,
and
Leblanc N.
Macroscopic K+ currents in single smooth muscle cells of the rabbit portal vein.
J Physiol (Lond)
413:
49-73,
1989.
18.
Kamouchi, M,
Xiong Z,
Teramoto N,
Kajioka S,
Okabe K,
and
Kitamura K.
Ionic currents involved in vasodilating actions of E4080, a newly synthesized bradycardia-inducing agent, in dispersed smooth muscle cells of the rabbit portal vein.
J Pharmacol Exp Ther
259:
1396-1403,
1991.
19.
Kaupp, UB,
and
Seifert R.
Molecular diversity of pacemaker ion channels.
Annu Rev Physiol
63:
235-257,
2001.
20.
Ludwig, A,
Zong X,
Jeglitsch M,
Hofmann F,
and
Biel M.
A family of hyperpolarization-activated mammalian cation channels.
Nature
393:
587-591,
1998.
21.
Ludwig, A,
Zong X,
Steiber J,
Hullin R,
Hofmann F,
and
Biel M.
Two pacemaker channels from human heart with profoundly different activation kinetics.
EMBO J
18:
2323-2329,
1999.
22.
Mayer, ML,
and
Westbrook GL.
A voltage clamp analysis of inward (anomalous) rectification in mouse spinal sensory ganglion neurones.
J Physiol (Lond)
330:
19-45,
1983.
23.
McCloskey, KD,
Toland HM,
Hollywood MA,
Thornbury KD,
and
McHale NG.
Hyperpolarization-activated inward current in isolated sheep mesenteric lymphatic smooth muscle.
J Physiol (Lond)
521:
201-212,
1999.
24.
Moroni, A,
Barbuti A,
Altomare C,
Viscomi C,
Morgan J,
Baruscotti M,
and
DiFrancesco D.
Kinetic and ionic properties of the human HCN2 pacemaker channel.
Pflügers Arch
439:
618-626,
2000.
25.
Okabe, K,
Inoue Y,
Kawarabayashi T,
Kajiya H,
Okamoto,
and
Soeda HF.
Physiological significance of hyperpolarization-activated inward currents (Ih) in smooth muscle cells from the circular layers of pregnant rat myometrium.
Pflügers Arch
439:
76-85,
1999.
26.
Pape, HC.
Queer current and pacemaker: the hyperpolarization-activated cation current in neurones.
Annu Rev Physiol
58:
299-327,
1996.
27.
Santoro, B,
Chen S,
Luthi A,
Pavlidis P,
Shumyatsky GP,
Tibbs GR,
and
Siegelbaum SA.
Molecular and functional heterogeneity of hyperpolarization-activated pacemaker channels in the mouse CNS.
J Neurosci
20:
5264-5275,
2000.
28.
Santoro, B,
Liu DT,
Yao H,
Bartsch D,
Kandel ER,
Siegelbaum SA,
and
Tibbs GR.
Identification of a gene encoding a hyperpolarization-activated pacemaker channel of brain.
Cell
93:
717-729,
1998.
29.
Santoro, B,
and
Tibbs GR.
The HCN gene family: molecular basis of the hyperpolarization-activated pacemaker channels.
Ann NY Acad Sci
868:
741-764,
1999.
30.
Shi, W,
Wymore R,
Yu H,
Wu J,
Wymore RT,
Pan Z,
Robinson RB,
Dixon JEE,
McKinnon D,
and
Cohen IS.
Distribution and prevalence of hyperpolarization-activated cation channel (HCN) mRNA expression in cardiac tissues.
Circ Res
85:
e1-e6,
1999.
31.
Sutter, MC.
The mesenteric-portal vein in research.
Pharmacol Rev
42:
287-325,
1990.
32.
Tian, L,
and
Shipston MJ.
Characterization of hyperpolarization-activated cation currents in mouse anterior pituitary, AtT20 D16:16 corticotropes.
Endocrinology
141:
2930-2937,
2000.
33.
Ulens, C,
and
Tygat J.
Functional heteromerization of HCN1 and HCN2 pacemaker channels.
J Biol Chem
276:
6069-6072,
2001.
34.
Wallner, M,
Meera P,
and
Toro L.
Determinant for beta-subunit regulation in high-conductance voltage-activated and Ca2+-sensitive K+ channels: an additional transmembrane region at the N terminus.
Proc Natl Acad Sci USA
93:
14922-14927,
1996.
35.
Yanagida, H,
Inoue R,
Tanaka M,
and
Ito Y.
Temperature-sensitive gating of cation current in guinea pig ileal muscle activated by hyperpolarization.
Am J Physiol Cell Physiol
278:
C40-C48,
2000.
36.
Yu, H,
Wu J,
Potapova I,
Wymore RT,
Holmes B,
Zuckerman J,
Pan Z,
Wang H,
Shi W,
Robinson RB,
El-Maghrabi MR,
Benjamin W,
Dixon J,
McKinnon D,
Cohen IS,
and
Wymore R.
MinK-related peptide 1. A
subunit for the HCN ion channel subunit family enhances expression and speeds activation.
Circ Res
88:
e84-e87,
2001.
This article has been cited by other articles:
![]() |
M. Biel, C. Wahl-Schott, S. Michalakis, and X. Zong Hyperpolarization-Activated Cation Channels: From Genes to Function Physiol Rev, July 1, 2009; 89(3): 847 - 885. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Beech, K. Muraki, and R. Flemming Non-selective cationic channels of smooth muscle and the mammalian homologues of Drosophila TRP J. Physiol., September 15, 2004; 559(3): 685 - 706. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ohya, B. Horowitz, and I. A. Greenwood Functional and molecular identification of ERG channels in murine portal vein myocytes Am J Physiol Cell Physiol, September 1, 2002; 283(3): C866 - C877. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |