Am J Physiol Cell Physiol Information on EB 2010
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 282: C420-C433, 2002. First published October 31, 2001; doi:10.1152/ajpcell.00253.2001
0363-6143/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/3/C420    most recent
00253.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (14)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jones, S. M.
Right arrow Articles by Kurten, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jones, S. M.
Right arrow Articles by Kurten, R. C.
Vol. 282, Issue 3, C420-C433, March 2002

EGF receptor downregulation depends on a trafficking motif in the distal tyrosine kinase domain

Stacie M. Jones1,2, Susan K. Foreman1, Brian B. Shank2, and Richard C. Kurten2

Departments of 1 Pediatrics and 2 Physiology and Biophysics, University of Arkansas for Medical Sciences, Little Rock, Arkansas 72205


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

On binding to its receptor, epidermal growth factor (EGF) initiates a cascade of events leading to cell proliferation or differentiation. In addition, the EGF receptor itself is downregulated to attenuate mitogenic signaling. Downregulation occurs through trafficking of receptors to lysosomes, culminating in proteolytic destruction of both the receptor and ligand; however, endocytic sorting mechanisms that underlie lysosomal targeting remain obscure. The goal of this study was to explore one aspect of the molecular basis for ligand-induced lysosomal targeting and degradation of EGF receptors. In this study, we identify a tyrosine-leucine motif (954YLVI) that is essential for transit of ligand-receptor complexes to lysosomes. When this motif is mutated, HEK 293 cells expressing the mutant receptors demonstrate impaired lysosomal targeting and downregulation compared with wild-type receptors. 954YLVI is highly conserved among EGF receptors from various mammalian and invertebrate species and is critical for receptor downregulation. We propose that 954YLVI works in concert with at least two additional regions within the EGF receptor cytoplasmic domain that are essential for efficiently targeting ligand-receptor complexes to the lysosome.

degradation; lysosomes; ubiquitination; targeting


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

THE ABILITY OF A CELL TO RESPOND to growth factors is dependent on the presence of specific receptors on the plasma membrane. Ligands bind to these receptors and initiate cascades of events that lead to either differentiation or proliferation. Specific responses are dictated by the constellation of receptors and signal transduction proteins expressed by a particular cell type. In addition, the magnitude and duration of the response can be controlled by the number of receptors on the surface available for the ligand to bind. In many cases, receptor downregulation occurs when the number of cell surface receptors is rapidly reduced after ligand binding and activation. This reduction in receptor number involves mechanisms for receptor internalization (endocytosis) and receptor degradation (downregulation) (1).

Receptor-mediated endocytosis is a well-characterized process that involves clathrin coating and cytoplasmic invagination of regions of the plasma membrane to form coated pits. These events are followed by the scission of coated pits from the plasma membrane and clathrin uncoating to form vesicles that constitute the endosomal compartment (21). Endosomal vesicles are processed within cells such that the integral membrane proteins are either transported back to the plasma membrane in recycling endosomes (e.g., nutrient receptors such as the transferrin receptor; Ref. 22) or transported to lysosomes in late endosomes for degradation (e.g., growth factor receptors; Refs. 28, 29). The distinct itineraries of integral membrane proteins are thought to be mediated by a sorting process within an intersecting compartment known as the sorting endosome (27). Considerable evidence indicates that the sorting of integral membrane proteins is mediated by specific signals on their cytoplasmic domains (42). These signals are thought to be recognized by specific proteins that mediate the sorting process. The present study is focused on one such candidate domain in the receptor for epidermal growth factor (EGF).

The EGF receptor is a single-pass transmembrane protein with a large cytoplasmic carboxy terminus that includes a tyrosine kinase domain and numerous regulatory elements with sites for autophosphorylation and adapter protein binding and regions known to participate in endocytosis (see Fig. 1A). Multiple endocytic codes mediate ligand-induced internalization (2, 3), and at least three regions have been identified that may participate in ligand-induced receptor degradation. One region (amino acid residues 945-991) was identified as facilitating endosomal retention of EGF receptors in a series of deletion mutagenesis experiments (33). This region is located at the distal border of the tyrosine kinase domain and contains a candidate tyrosine-based sorting signal (954YLVI) that is similar to that found in proteins, such as LAMP1 and LAMP2, known to target to lysosomes from the trans-Golgi network (12). In addition, kinase-deficient receptors that terminated with this signal (truncated after residue 958) were transferred to lysosomes as efficiently as wild-type EGF receptors (15). With a yeast two-hybrid screen, this region was also identified as a binding site for sorting nexin (SNX) 1, a cytoplasmic and peripheral membrane protein that participates in targeting EGF receptors to lysosomes (24). A second signal containing a dileucine motif (679LL) is located in the juxtamembrane region of the EGF receptor. Site-directed mutagenesis of this dileucine motif results in reduced downregulation of ligand-occupied receptors (679LL) because of a reduction in lysosomal targeting efficiency without a change in endocytosis (19, 20). These two regions flank the tyrosine kinase domain, the activity of which is essential for ligand-dependent tyrosine phosphorylation of substrate proteins (including EGF receptors) (43), subsequent signal transduction (5), and ligand-induced endocytosis (10). Autophosphorylation at a third site, tyrosine residue 1045 (1045Y), is also important for EGF receptor downregulation. When phosphorylated, 1045Y is bound by c-Cbl, resulting in c-Cbl phosphorylation and the recruitment of ubiquitin-activating and -conjugating enzymes, receptor ubiquitination, and enhanced degradation dependent on both proteosomal and lysosomal hydrolases (26, 44). Thus at least three distinct elements in the EGF receptor cytoplasmic domain, 679LL, 954YLVI, and 1045Y, may contribute to EGF-induced degradation of its receptor.


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 1.   Epidermal growth factor (EGF) receptor structure and sequence comparisons. A: linear map of the EGF receptor intracellular domain. TM, transmembrane region; LL, dileucine motif, residues 679-680; Kinase, tyrosine kinase domain; SNX1, sorting nexin (SNX)1 binding site, residues 954-955; AP2, adaptin binding site, residues 974-978; c-Cbl, c-Cbl binding site, phosphorylated residue 1045. B: sequence alignments between human EGF receptor (HER) family members and EGF receptors from various species in regions containing EGF receptor trafficking signals. The residues in bold indicate the position of EGF receptor trafficking signals. 679LL, dileucine motif; 954YLVI, SNX1 binding site; 974FYRAL, adaptin binding site; 1045Y, c-Cbl binding site. The various receptors were identified in sequence database searches using BLAST, and the retrieved sequences were aligned with CLUSTAL W (1.881; Ref. 41). The GenBank database accession numbers for the sequences used to generate the alignment are HER1, GQHUE; HER2, P0426; HER3, P21860; HER4, Q15303; mouse, AAG24386; dog, BAA23127; chicken, TVCHLV; fish, AAD10500; mosquito, CAC35008; fly, P04412; fluke, A45558; and worm, P24348. C: structural model of the insulin receptor tyrosine kinase domain with the predicted location of EGF receptor regions containing LL and YL highlighted in yellow. These regions were identified by aligning the primary sequence of the EGF receptor to the insulin receptor and the locations of 679LL and 954YL were mapped to a kinase active conformation of the insulin receptor with the NCBI Molecular Modeling DataBase (http://www.ncbi.nlm.nih.gov:80/Structure/MMDB/mmdb.shtml).

The goal of this study was to further define the molecular basis for ligand-dependent lysosomal targeting and degradation of EGF receptors by determining whether the presence of 954YLVI is essential for receptor degradation as has been established for the juxtamembrane dileucine motif (679LL) and the c-Cbl binding autophosphorylated 1045Y. This region is highly conserved among species (see Fig. 1B), is similar to a targeting signal in several lysosomal membrane proteins (12), and binds sorting proteins (e.g., SNX1) (24). These properties thus make 954YLVI a potentially important signal that mediates ligand-dependent downregulation of the EGF receptor. We now show that 954YLVI must be present for ligand-dependent EGF receptor downregulation. Using mutant receptors analyzed in transfected human embryonic kidney cells (HEK 293), we examined the location and abundance of EGF receptors in the presence and absence of ligand. Our results indicate that mutation of 954YLVI to either 954AAVI or 954VDVI abolishes the EGF-induced reduction in receptor mass (i.e., downregulation) normally observed for intact receptors, with only a small effect on receptor internalization. Furthermore, our results show that when 954YLVI is mutated and rendered nonfunctional, neither the juxtamembrane dileucine domain nor the c-Cbl-dependent ubiquitination pathway is able to rescue downregulation. On the basis of these observations, we suggest that these three distinct elements do not represent redundant mechanisms but are part of a concerted mechanism for receptor downregulation.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Mutagenesis. A HindIII-BamHI fragment of the human EGF receptor was excised from the plasmid pRcK+ (provided by Gordon N. Gill, University of California, San Diego) and subcloned into pUC18. Site-directed mutagenesis of the EGF receptor cDNA in pUC18 was performed with the GeneEditor in vitro site-directed mutagenesis system (Promega, Madison, WI). Mutagenic oligonucleotides were synthesized and purified commercially (Genosys Biotechnologies, The Woodlands, TX). The tyrosine (Y) and leucine (L) amino acids at positions 954 and 955 (954YL) in the mature EGF receptor were mutated to valine (V) and aspartate (D) for the mutant EGF receptor designated pRc954VD-K+ (5'TCTCCAAAATGGCCCGAGACCCCCAGCGCGTCGACGTCATTCAGGGGGATGAAAGAATGCATTTG3'; bold letters represent mutated bases) and to alanines (A) for the mutant EGF receptor designated pRc954AA-K+ (5'TCTCCAAAATGGCCCGAGACCCCCAGCGCGCCGCGGTCATTCAGGGGGATGAAAGAATGCATTTG3'; bold letters represent mutated bases). Both mutant receptors were made to analyze the effect of a conservative mutation (i.e., alanine substitution) and a less conservative mutation (i.e., valine-asparate substitution) on receptor function and trafficking. Sequences of the mutant EGF receptors prepared in pUC18 were verified by dideoxynucleotide sequencing with Sequenase (Amersham, Piscataway, NJ). The HindIII-BamHI fragment containing the mutant EGF receptor cDNAs was excised and returned to the pRc/CMV expression vector (Invitrogen, Carlsbad, CA).

Cell culture. All experiments were conducted with the human embryonic kidney cell line HEK 293 obtained from the American Type Culture Collection (Manassas, VA). Cells were grown in a monolayer at 37°C in DMEM-Ham's F-12 (50:50, vol/vol) supplemented with 15 mM HEPES, 2.5 mM L-glutamine, 5% calf serum, 100 units/ml penicillin, 100 µg/ml streptomycin, and 0.25 µg/ml amphotericin B in a 5% CO2 incubator. For transfection experiments, HEK 293 cells were cultured in serum-free medium (substituting 0.1% bovine serum albumin for 5% calf serum) at a density of 7.5 × 105 cells/well in six-well plates for 24 h before transfection. Cells were transfected using a mixture of 15 µl of Lipofectamine (Life Technologies, Grand Island, NY) and 2.5 µg of plasmid DNA. The plasmids used for transfection were pRcK+ (pRc954YL-K+), pRc954VD-K+, pRc954AA-K+, pEGFP (green fluorescent protein; Clontech Laboratories, Palo Alto, CA), pCMVbeta Gal, and pGFP-Rab5 (Philip Stahl, Washington University School of Medicine, St. Louis, MO). In each vector, transcription was driven by the constitutively active human cytomegalovirus immediate-early promoter/enhancer. For transient assays, HEK 293 cells were cotransfected with 0.25 µg of reporter DNA (pEGFP, pCMVbeta Gal, or GFP-Rab5) and 2.25 µg of human EGF receptor DNA (pRc954YL-K+, pRc954VD-K+, or pRc954AA-K+) for 5 h. For the generation of stable HEK 293 cell lines, only the EGF receptor-containing plasmids were transfected and the cells were incubated for 48 h in growth medium before selection. Transfected cells were selected with 400 µg/ml of Geneticin (G418; Calbiochem) and propagated in growth medium supplemented with 100 µg/ml G418. Experiments were conducted at least twice in each stable cell line analyzed.

Fluorescence microscopy and receptor trafficking. In all experiments, HEK 293 cells were cultured at a density of 3.75 × 105 cells/well on glass coverslips. For transient transfections, cells were cotransfected with 0.25 µg of pEGFP or pGFP-Rab5 reporters and with 2.25 µg of wild-type (pRc954YL-K+) or mutant (pRc954AA-K+ or pRc954VD-K+) EGF receptor plasmids. Ligand binding experiments were performed 48 h after transfection, with the last 16 h of culture in serum-free medium. Cells were incubated with 5 µg/ml Texas red-labeled EGF (Molecular Probes, Eugene, OR) at 4°C for 1 h, and unbound EGF was removed by washing in serum-free medium. Cells were warmed to 37°C, and GFP-expressing cells were imaged at various intervals to assess EGF receptor trafficking in transfected cells. Fluorescence microscopy was performed with a Zeiss Axiovert S inverted microscope (Carl Zeiss, Thornwood, NY).

For colocalization assays that assessed trafficking of EGF receptors to lysosomes, stably transfected cells were incubated with 5 µg/ml Texas red EGF at 4°C for 1 h and then cultured at 37°C for up to 2 h. Cells were fixed with 1% paraformaldehyde for 15 min at designated time intervals during the 2-h incubation. Cells were stained for 1 h with mouse anti-LAMP1 (1:100, H4A3; Ref. 4), a membrane glycoprotein that localizes to lysosomes. Cells were incubated with 10 µg/ml FITC-labeled goat anti-mouse IgG (F2761; Molecular Probes) and then mounted on glass slides with Prolong Antifade reagent (Molecular Probes). Fluorescence imaging was performed with a Zeiss LSM410 confocal microscope (Carl Zeiss).

For determination of steady-state distribution of EGF receptors, stably transfected cells were incubated overnight in serum-free medium and then fixed in 4% paraformaldehyde. Cells were incubated sequentially in blocking buffer (4% goat serum, 1% BSA, 0.012% saponin, 0.2 M sodium vanadate, and PBS) for 30 min, with 0.25 µg/ml anti-EGF receptor antibody (no. 12020; BD Transduction Labs, Lexington, KY) for 1 h, and then with 10 µg/ml Texas red-labeled goat anti-mouse IgG (T862; Molecular Probes) for 1 h, mounted, and imaged by confocal microscopy.

Fluid phase endocytosis and transport to lysosomes was assessed by incubating cells with 0.5 mg/ml Texas red dextran (molecular weight 70,000; Molecular Probes) overnight at 37°C. The labeled cells were rinsed twice with 0.1% BSA-DMEM-F12 and incubated for an additional 1.5 h at 37°C, fixed in 1% paraformaldehyde, mounted in antifade compound, and imaged as described above.

EGF receptor binding assay. We used iodinated mouse EGF in a saturation binding assay to measure cell surface EGF receptor levels. Binding reactions were performed at 4°C in 0.1% BSA-DMEM-F12 with ~200,000 cpm/ml labeled EGF (specific activity ~2,000 cpm/fmol) and 0.078-100 nM cold EGF. Unbound counts were removed by washing in a buffer (in mM: 20 HEPES, pH 7.4, 130 NaCl, 0.5 MgCl2, and 1 CaCl2 with 1 mg/ml polyvinyl pyrolidone), the cells were solubilized in 1% SDS-0.1 N NaOH, and bound counts were measured with a gamma counter. Receptor numbers were estimated by Scatchard analysis. To determine whether receptors were internalized, the cells were first incubated in the presence of 100 nM EGF for 30 min at 37°C. Surface EGF was removed with a 5-min acid strip (in mM: 50 acetic acid, pH 2.5, 135 NaCl, and 2.5 KCl). After being rinsed in buffer, the cells were labeled with 125I-labeled EGF (200,000 cpm/ml) for 4 h at 4°C, washed, and counted as described above. Nonspecific binding was determined in the presence of 100 nM cold EGF.

EGF receptor metabolic labeling and immunoprecipitation. Stable cell lines expressing EGF receptors were incubated overnight in serum-free medium. The cells were incubated in methionine-free medium for 30 min before being labeled with 1 mCi/ml Tran35S label (ICN, Costa Mesa, CA) for 2 h in the absence or presence of EGF. SDS lysates were prepared, and 100-µg aliquots were immunoprecipitated with 5 µg of anti-EGF receptor (no. 12020; Transduction Labs) and protein A beads. Immunoprecipitates were solubilized in SDS sample buffer and separated on SDS gels, and the radiolabeled receptors were visualized by fluorography.

Western immunoblot analysis for EGF receptor downregulation. Transiently transfected cells were harvested 48 h after transfection. Cells were allowed to recover from the transfection for 32 h in growth medium and then serum-starved for 16 h before treatment with 100 nM EGF. EGF receptors were extracted by scraping in lysis buffer [50 mM HEPES pH 7.4, 1% Triton X-100, 10% glycerol, 75 mM NaCl, 10 mM NaF, 1 mM sodium vanadate, 1 mM EDTA, 1 mM EGTA, 1 mM phenylmethylsulfonyl fluoride (PMSF), 10 mM benzamidine, 10 µg/ml leupeptin, 10 µg/ml antipain, and 10 µg/ml aprotinin], incubated at 4°C on a rotating wheel for 15 min, and clarified by centrifugation at 13,000 g for 15 min. To control for transfection efficiency, samples were loaded to normalize beta -galactosidase activity encoded by a cotransfected plasmid (generally 50-100 µg of protein/lane).

EGF receptors in stably transfected cells were extracted by lysis in boiling SDS sample buffer [1% SDS, 10 mM Tris-Cl (pH 7.4), 1 mM sodium vanadate, 1 mM NaF, 1 mM EDTA, 1 mM EGTA, 10 mM benzamide, 10 µg/ml leupeptin, 10 µg/ml aprotinin, and 1 mM PMSF]. The extracts were clarified by centrifugation at 13,000 g at 4°C for 15 min. To control for potential differences in protein recovery, total protein determinations were made with the bicinchoninic acid protein assay (Pierce, Rockford, IL). Between 50 and 100 µg of protein was loaded per lane, and all lanes in a blot were loaded with the same amount of protein.

For detection of EGF receptors, the membranes were incubated with 0.25 µg/ml mouse monoclonal anti-EGF receptor antibody specific for residues 996-1022 (Transduction Laboratories) diluted in 1% Carnation nonfat dry milk-Tween-Tris-buffered saline (TBS). For detection of phosphotyrosine activity, membranes were incubated with 0.5 µg/ml mouse monoclonal anti-phosphotyrosine antibody PY20 (Transduction Laboratories) diluted in 1% BSA in Tween-TBS. Primary antibody binding was detected with 0.2 µg/ml alkaline phosphatase-conjugated affinity-purified goat anti-mouse IgG (Fc) (Promega, Madison WI) diluted in Tween-TBS. Secondary antibody binding was detected by incubating the filters with 0.4 mM nitro blue tetrazolium (NBT) and 0.45 mM 5-bromo-4-chloro-3-indolyl phosphate (BCIP).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Comparison of EGF receptor sequences among species. To evaluate the relevance of the 954YLVI motif as a potential candidate for ligand-induced EGF receptor downregulation, we compared the sequence in EGF receptors with other human family members and with EGF receptors in various species (Fig. 1B). We reasoned that sequence conservation across species should imply functional importance. We found that the 954YLVI motif is highly conserved among all species examined. With the exceptions of human EGF receptor (HER) family member HER2 and the Caenorhabditis elegans receptor let23, the tyrosine residue at 954 is conserved and the sequences match the lysosomal targeting motif Y-x-x-Phi (12). We also made comparisons with other trafficking motifs in the EGF receptor intracellular domain. The dileucine motif important for EGF receptor downregulation (19, 20) is unique to the EGF receptor (HER1) among human family members and is not conserved in the EGF receptors of other species. Compared with the dileucine motif, the broader evolutionary conservation of the 954YLVI motif may imply a more general functional significance for EGF receptor trafficking. An alpha -adaptin binding site (974FYRAL), thought to be important in clathrin recruitment (3, 30, 31, 39), is located in close proximity to the 954YLVI motif and was widely conserved, although not to the same extent as for 954YLVI. Similarly, the tyrosine residue necessary for c-Cbl binding is also well conserved.

Trafficking of mutant EGF receptors in transiently transfected HEK 293 cells. To study the contribution of the 954YLVI domain to EGF receptor targeting to lysosomes, two mutant EGF receptors, pRc954VD-K+ and pRc954AA-K+, were generated and analyzed compared with the wild-type receptor (pRc954YL-K+) after transient cotransfection into HEK 293 cells. Receptor trafficking was assessed with fluorescent tracers and digital microscopy. Transfected cells were identified by green fluorescence from cotransfected GFP, and the EGF receptors were visualized by Texas red EGF binding. After labeling at 4°C, both wild-type and mutant receptors were localized on the cell surface (Fig. 2), as defined by Texas red EGF fluorescence. After warming to 37°C for 30 min, plasma membrane fluorescence was lost as both wild-type and mutant receptors were internalized to small, punctate intracellular vesicles (Fig. 2). Naive (nontransfected) HEK 293 cells express extremely low levels of endogenous EGF receptors as demonstrated by a lack of Texas red EGF binding by fluorescent microscopy (data not shown). These results indicate that both ligand binding and endocytosis remain intact in the mutant receptors.


View larger version (126K):
[in this window]
[in a new window]
 
Fig. 2.   Analysis of EGF receptor trafficking in transiently transfected HEK 293 cells. HEK 293 cells transiently transfected with wild-type (954YL-K+) and mutant (954VD-K+, 954AA-K+) EGF receptors were incubated with Texas red EGF, and the bound EGF was visualized by epifluorescence microscopy. Both wild-type (A) and mutant (C, E) receptor-expressing cell lines displayed surface staining after labeling with 5 µg/ml Texas red EGF at 4°C. After warming to 37°C for 30 min, both wild-type (B) and mutant (D, F) receptors were endocytosed into small, punctate vesicles. This experiment was performed 4 times with identical results. Scale bar, 10 µM.

Previous studies indicated that EGF receptor sorting begins in the early endosomal compartment (19). To determine whether mutation of 954YLVI altered trafficking into or through early endosomes, HEK 293 cells were cotransfected with an established early endosome marker, Rab5, that was fused to GFP (37). Consistent with our initial observations, living cells incubated with Texas red EGF at 4°C displayed cell surface localization of wild-type and mutant EGF receptors (Figs. 3 and 4). In contrast, GFP-Rab5 was found in the cytoplasm localized to early endosomes (Figs. 3 and 4). When the cells were warmed to 37°C to permit trafficking and examined at intervals, Texas red EGF entered the cells for both the wild-type EGF receptor and the mutant (954VD-K+) receptors. Both receptors were prominently colocalized with GFP-Rab5 after being warmed to 37°C for 20 min after ligand binding at 4°C. However, after 60 min at 37°C, neither wild-type nor mutant (954VD-K+) EGF receptors colocalized with GFP-Rab5 (Figs. 3 and 4). These results indicate that EGF receptor internalization and trafficking through early endosomes is not impaired by the modification of 954YLVI.


View larger version (111K):
[in this window]
[in a new window]
 
Fig. 3.   Analysis of wild-type (954YL-K+) EGF receptor trafficking through early endosomes in transiently transfected HEK 293 cells. Cells were cotransfected with wild-type EGF receptor and the early endosome marker Rab5 fused to green fluorescent protein (GFP-Rab5). The cells were labeled with 5 µg/ml Texas red EGF at 4°C and warmed to 37°C for the indicated times. The cells were fixed and mounted, and GFP-Rab5-expressing cells were imaged with red (A, D, G, J) and green (B, E, H, K) filter sets. Composite images (C, F, I, L) were generated by superimposing the red and green channels. Texas red EGF-labeled receptors were localized on the surface immediately after labeling (A) and then moved into small, punctate vesicles after warming to 37°C for 10-20 min (D, G). After 60 min, wild-type receptors trafficked to large, perinuclear vesicles (J). GFP-Rab5 was localized to intracellular vesicles at all time points. Colocalization with GFP-Rab5 was detectable only at 10 and 20 min (F, I). This experiment was performed 4 times with identical results. Scale bar, 10 µM.



View larger version (102K):
[in this window]
[in a new window]
 
Fig. 4.   Mutant (954VD-K+) EGF receptor trafficking through early endosomes in transiently transfected HEK 293 cells appears normal. Cells were cotransfected with wild-type EGF receptor and GFP-Rab5. The cells were labeled with 5 µg/ml Texas red EGF at 4°C and warmed to 37°C for the indicated times. The cells were fixed and mounted, and GFP-Rab5-expressing cells were imaged with red (A, D, G, J) and green (B, E, H, K) filter sets. Composite images (C, F, I, L) were generated by superimposing the red and green channels. Texas red EGF-labeled receptors were localized on the surface immediately after labeling (A) and then moved into small, punctate vesicles after warming to 37°C for 10-20 min (D, G). After 60 min, wild-type receptors trafficked to large, perinuclear vesicles (J). GFP-Rab5 was localized to intracellular vesicles at all time points. Colocalization with GFP-Rab5 was detectable only at 10 and 20 min (F, I). This experiment was performed 4 times with identical results. Scale bar, 10 µM.

Receptor degradation is impaired in mutant EGF receptors. Although fluorescent tracers are useful for qualitatively analyzing initial stages of receptor trafficking, we could not use them to analyze receptor degradation directly because the ligand and receptor dissociate at acidic pH (7, 40). To determine whether 954YLVI is necessary for ligand-dependent EGF receptor degradation, we measured the total mass of EGF receptors in extracts derived from serum-starved, EGF-treated cells by Western immunoblotting. If we assume that EGF receptor synthesis rates are unchanged by EGF treatment, then changes in steady-state receptor levels should be due to increases in degradation rates. Given that receptor expression is driven by a constitutively active cytomegalovirus promoter, this is a reasonable assumption. Accordingly, parallel cultures of serum-starved HEK 293 cells transiently transfected with EGF receptor cDNAs were incubated in the absence or presence of EGF for 2 h and the total mass of EGF receptors was determined. In cells expressing wild-type EGF receptors, there was strong receptor expression in untreated cells that was reduced by ~44% within 2 h after the addition of EGF (Fig. 5A). In contrast, the total mass of 954AA-K+ mutant EGF receptors was not reduced by EGF treatment and the mass of 954VD-K+ mutant EGF receptors was only reduced by ~20% (Fig. 5A). Although the absolute levels of expression of the mutant receptors are lower than those observed for wild-type receptors, there nevertheless appears to be a block in EGF receptor downregulation with point mutations in the 954YLVI motif. The impaired EGF receptor downregulation was observed for both the conservative mutation (954AA-K+) and the less conservative mutant (954VD-K+).


View larger version (83K):
[in this window]
[in a new window]
 
Fig. 5.   EGF receptor downregulation is impaired in mutant receptors compared with wild-type EGF receptor. Detergent (1% Triton X-100) extracts of HEK 293 cells transiently transfected with wild-type (954YL-K+) and mutant (954VD-K+, 954AA-K+) EGF receptors (EGFR) treated with 100 nM EGF were prepared and analyzed by Western immunoblotting. To control for transfection efficiency, cells were cotransfected with a beta -galactosidase expression plasmid and sample loading was normalized to beta -galactosidase activity in the extracts. A: steady-state EGF receptor levels in HEK 293 cell lines were estimated by Western immunoblot with a monoclonal antibody against EGF receptors. The EGF receptor was not detectable in untransfected HEK 293 cells (lane 1, con). The EGF receptor was present in both wild-type and mutant receptor-transfected cells under conditions of serum starvation (0 min; lanes 2, 5, 8) or treatment with 100 nM EGF for 10 min (lanes 3, 6, 9). However, after treatment with EGF for 120 min, wild-type EGF receptors were reduced by 44% as determined by densitometry (lane 4, fold change = 0.56 ± 0.07; n = 8) whereas mutant receptors showed little or no reduction [lanes 7, 10: fold change for 954AA-K+ 1.01 ± 0.06 (n = 3); for 954VD-K+ 0.79 ± 0.07 (n = 8)]. The overall level of receptor expression was lower in mutant compared with wild-type receptors. B: steady-state levels of tyrosine phosphorylation in transiently transfected HEK293 cell were estimated by Western immunoblot with a monoclonal antibody against phosphotyrosine. Both wild-type and mutant EGF receptor-transfected cells showed tyrosine kinase activity under conditions of serum starvation (0 min; lanes 2, 5, 8). However, the tyrosine phosphorylation of several proteins (P-P98, P-P52, P-P40) by wild-type and mutant receptors was transiently stimulated by EGF. The phosphorylation of these proteins was detected within 10 min of EGF treatment (lanes 3, 6, 9) and was reduced to near baseline 120 min after EGF was added (lanes 4, 7, 10). Sustained EGF receptor autophosphorylation (P-EGFR) was detected only in extracts from cells transfected with wild-type receptors (lanes 2-4). This experiment was performed 3 times with similar results.

Receptor kinase activity is intact in mutant EGF receptors. Because the 954YLVI motif is located at the distal junction of the EGF receptor kinase domain and could disrupt kinase activity, mutant EGF receptors were analyzed for their ability to undergo receptor activation as measured by ligand-induced substrate phosphorylation in Western immunoblots with anti-phosphotyrosine antibodies (Fig. 5B). The extent (or stability) of EGF-induced receptor autophosphorylation, as deduced by the appearance of a major phosphoprotein migrating slightly slower than the EGF receptor in ligand-treated cells, is reduced in the mutant receptors. Compared with wild-type (954YL-K+) EGF receptor, mutants 954VD-K+ and 954AA-K+ are indistinguishable with regard to their basal tyrosine kinase activity and EGF-induced phosphorylation of several substrate proteins after 10 and 120 min (Fig. 5B). All receptors display some tyrosine kinase activity in the absence of ligand. Activity is enhanced after 10 min of ligand treatment and is then reduced to a level near baseline after 120 min (Fig. 5B). Three prominent ligand-induced phosphotyrosine-containing proteins were detected at ~98, 52, and 40 kDa. The 52- and 40-kDa bands likely correspond closely with Shc isoforms that are phosphorylated by activated EGF receptors (11). Receptor tyrosine kinase activation thus appears to remain intact in mutant receptors, indicating that the 954YLVI motif is not essential for EGF receptor kinase activity.

Stable cell lines also exhibit impaired degradation EGF receptors. To complement the preceding observations made in transient transfection experiments, we also evaluated wild-type (954VD-K+) and mutant (954AA-K+ and 954VD-K+) EGF receptor expression and stability in permanently transfected HEK 293 cells (Fig. 6A). In 12 clonal lines expressing wild-type EGF receptors, the receptors were downregulated by ~35% after incubation with EGF for 2 h (Fig. 6A). Clones expressing the 954AA-K+ (8 clones) and 954VD-K+ (5 clones) mutant EGF receptors all expressed EGF receptors, but there was no evidence of downregulation after 2 h of EGF treatment in cells expressing either mutation (Fig. 6A). Even after 4 or 8 h of EGF treatment, the mutant EGF receptors were not downregulated (data not shown). These findings provide additional evidence that mutation of the 954YLVI motif results in impaired EGF receptor degradation. In addition, ligand-stimulated tyrosine phosphorylation of exogenous substrates was intact after stimulation for 5 min with EGF in all clones tested (Fig. 6B). However, as was also the case in the transient transfection experiments, the steady-state levels of EGF-induced receptor autophosphorylation were reduced by the point mutations. This may simply reflect the reduced numbers of mutants receptors expressed on the cell surface. Compared with the expression of 146,000 ± 63,000 (n = 4) wild-type receptors per cell, cell lines expressing mutants receptors had 69,000 ± 24,000 (n = 4) 954AA-K+ receptors per cell and 26,000 ± 7,600 (n = 4) 954VD-K+ receptors per cell. The lack of downregulation is not due to changes in EGF receptor biosynthesis because the incorporation of 35S-labeled methionine into immunoprecipitated EGF receptors was not changed by a 2-h EGF treatment. However, the absolute rate of receptor synthesis was greater for mutant receptors than for wild-type receptors (Fig. 6C), indicating that the constitutive turnover of the mutant receptors may be enhanced. Ligand-dependent internalization was intact for all receptors but was more efficient in wild-type (62.7% ± 2.3) than in 954AAVI (27.7% ± 5.0) and 954VDVI (33.7% ± 7.1) mutant EGF receptors (Fig. 6D). Although reduced internalization might account for a reduction in EGF receptor downregulation, it would not be expected to completely abolish downregulation as we have observed.


View larger version (46K):
[in this window]
[in a new window]
 
Fig. 6.   EGF receptor degradation is impaired in stable cell lines expressing mutant EGF receptors. HEK 293 cells were stably transfected with wild-type (954YL-K+) and mutant (954AA-K+, 954VD-K+) EGF receptors. Cell lines were treated with 100 nM EGF, and EGF receptors were extracted with 1% SDS and analyzed by Western immunoblotting. Equivalent amounts of protein were loaded in each lane. A: the EGF receptor was easily detected in Western immunoblots of protein extracts with a monoclonal antibody to EGF receptors in a human mammary tumor cell line, MCF-7Z, constitutively expressing high levels of EGF receptors (lane 1) but was absent in parental HEK 293 cells (lane 2). EGF receptors were detected in serum-starved cells (lanes 3, 5, 7) expressing wild-type or mutant receptors and were reduced by 35% after 2 h of EGF treatment in 954YL-K+ expressing cells (lane 4; fold change: 0.65 ± 0.06; n = 10). In contrast, cell lines expressing mutant receptors show no reduction in steady-state levels [lanes 6, 8: fold change for 954AA-K+: 1.0 ± 0.02 (n = 8); for 954VD-K+: 1.1 ± 0.19 (n = 4)]. B: steady-state levels of tyrosine phosphorylation in stably transfected HEK 293 cell lines were estimated by Western immunoblot with a monoclonal antibody against phosphotyrosine. Basal tyrosine phosphorylation was detected in cells under conditions of serum starvation (lanes 1, 2). Both wild-type and mutant EGF receptor-transfected cells showed some tyrosine kinase activity under conditions of serum starvation (0 min; lanes 3, 5, 7). However, the tyrosine phosphorylation of several proteins (P-P98, P-P52, P-P40) by wild-type and mutant receptors was transiently stimulated by EGF. The phosphorylation of these proteins was detected within 5 min of EGF treatment (lanes 4, 6, 8) and was reduced to near baseline 2 h after EGF was added (lanes 4, 7, 10). Sustained EGF receptor autophosphorylation was easily detected in extracts from cells transfected with wild-type receptors (lane 4), but the intensity was substantially reduced for the 954AA-K+ (lane 6) and 954VD-K+ (lane 8) receptors. This experiment was performed 3 times with similar results. C: EGF does not alter the rate of mutant receptor biosynthesis in stable cell lines. EGF receptor biosynthesis in the indicated cell lines was assessed by labeling cells with 35S-labeled methionine in the presence or absence of EGF for 2 h. EGF receptors were collected by immunoprecipitation from 50 µg of a clarified 1% SDS lysate, separated by SDS-PAGE, and visualized by fluorography. D: EGF induces endocytosis of both wild-type and mutant EGF receptors in stable cell lines. Surface EGF receptors were detected by 125I-EGF binding and incubated in the presence of 50 nM EGF for 30 min at 37°C to induce endocytosis. Means ± SD of the ratio of 125I-EGF counts after EGF treatment to 125I-EGF counts before EGF treatment are plotted (n = 3).

In stably transfected HEK 293 cells, the steady-state distribution of wild-type and mutant EGF receptors (Fig. 7, D and I) was indistinguishable as were the uptake and trafficking of Texas red dextran (Fig. 7, H and P). Both mutant and wild-type receptors bound and endocytosed Texas red EGF (Fig. 7), although stable lines expressing mutant receptors consistently bound less Texas red EGF. This is consistent with the reduced levels of mutant EGF receptor expression observed in ligand binding and Western immunoblot assays. The transit of Texas red EGF through the early endosomal compartment defined by GFP-Rab5 was not perturbed for the mutant receptors (data not shown). However, in longer incubations at 37°C (60-120 min), we noted that Texas red-EGF-labeled vesicles were larger or more "clumped" in cells expressing wild-type receptors (Fig. 7G) than in cells expressing either of the mutant receptors (Fig. 7O).


View larger version (123K):
[in this window]
[in a new window]
 
Fig. 7.   Mutant EGF receptors in stable cell lines are defective in lysosomal targeting. A cell line expressing wild-type EGF receptors (F14 clone, 954YL-K+) was compared with a cell line expressing mutant EGF receptors (B5 clone, 954AA-K+) by fluorescent microscopy after labeling with 5 µg/ml Texas red-EGF at 4°C. The labeled cells were warmed to 37°C for 0, 5, 15, 30, 60, and 120 min, fixed in paraformaldehyde, and imaged. Texas red EGF binding to the plasma membranes of wild-type and mutant EGF receptors was similar at 0 min (A, I), and both receptors were endocytosed into small, punctate vesicles after warming to 37°C for 5 (B, J) and 15 (C, K) min. The trafficking patterns of wild-type and mutant receptors began to diverge after 30 min (E, M) and became more pronounced by 60 (F, N) and 120 (G, O) min with clumping of wild-type receptors in large perinuclear regions while mutant receptors were retained in small, punctate vesicles. The binding of Texas red EGF was reduced for the EGF receptor mutant 954AA-K+-expressing cells because of lower levels of receptor expression. Indirect immunofluorescence analysis with anti-EGF receptors antibodies showed predominant surface labeling for both wild-type (D) and mutant (L) EGF receptors in serum-starved cells. Fluid phase endocytosis, as detected by Texas red dextran uptake and accumulation in lysosomes overnight, was similar in cells expressing wild-type (H) and mutant (P) receptors. These experiments were performed 3 times with identical results. Scale bar, 10 µM.

To determine whether differences in lysosomal targeting account for the enhanced stability of mutant receptors observed by Western immunoblotting, a colocalization experiment with LAMP1 and Texas red EGF was performed. HEK 293 cells expressing wild-type and mutant EGF receptors were labeled with Texas red EGF, warmed to 37°C, fixed at discrete intervals, stained with a monoclonal antibody specific for the lysosomal membrane protein LAMP1, and imaged by confocal microscopy (Figs. 8 and 9). As we have consistently observed, on warming to 37°C, both wild-type and mutant receptors entered the cell with an identical pattern. However, after 60 min, there was substantial overlap between endocytosed wild-type EGF receptors and LAMP1, but there was no overlap between the mutant receptor and LAMP1 (Figs. 8 and 9). Thus the impaired downregulation of mutant EGF receptors appears to be due to a reduction in their lysosomal targeting efficiency. Importantly, the Texas red EGF also remained inside cells expressing the mutant receptors and did not appear to be recycled. To the extent that the Texas red EGF is faithfully tracking the itinerary of the EGF receptor, this finding indicates that endosomal retention and lysosomal targeting may be distinct processes.


View larger version (115K):
[in this window]
[in a new window]
 
Fig. 8.   Wild-type EGF receptors (954YL-K+) are targeted to lysosomes in stable cell lines. Cells were labeled with 5 µg/ml Texas red EGF for 60 min, fixed at the indicated intervals, and stained with anti-LAMP1 to visualize lysosomes. Cells were imaged with red (A, D, G, J) and green (B, E, H, K) filter sets, and composite images (C, F, I, L) were generated by superimposing the red and green channels. Texas red labeling was initially on the cell surface (A), in punctate intracellular vesicles by 15-20 min (D, G), and in large, clumped vesicles by 60 min (J). Anti-LAMP1 stained large intracellular vesicles at all time points. Colocalization with LAMP1 (yellow overlap) was detectable after 60 min (L), indicating trafficking of wild-type EGF receptors to lysosomes. The experiments were performed 3 times with the same results. Scale bar, 10 µM.



View larger version (61K):
[in this window]
[in a new window]
 
Fig. 9.   Lysosomal targeting is impaired in stable cell lines expressing mutant EGF receptors (954AA-K+). Cells were labeled with 5 µg/ml Texas red EGF for 60 min, fixed at the indicated intervals, and stained with anti-LAMP1 to visualize lysosomes. Cells were imaged with red (A, D, G, J) and green (B, E, H, K) filter sets, and composite images (C, F, I, L) were generated by superimposing the red and green channels. Texas red labeling was initially on the cell surface (A) and in punctate intracellular vesicles by 15-20 min (D, G). After 60 min (J), labeling remained confined to small vesicles. Anti-LAMP1 stained large intracellular vesicles at all time points, and no colocalization with Texas red EGF was detectable after 60 min (L). This experiment was performed 3 times with the same results. Scale bar, 10 µM.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

In this study we have directly analyzed the contribution of a putative lysosomal targeting signal located in the intracellular domain of the EGF receptor to ligand-dependent degradation of EGF receptors. We demonstrated that human EGF receptor 954YLVI residues are obligatory for ligand-induced receptor degradation by site-directed mutagenesis and analysis of receptor trafficking in transfected cells. The mutant EGF receptors that we created bind ligand and exhibit ligand-induced tyrosine kinase activity, indicating that the tyrosine kinase domain is intact and retains its ability to be activated by ligand. Unactivated mutant receptors, like wild-type EGF receptors, are located on the cell surface and internalize normally after ligand binding. A significant difference between wild-type and mutated EGF receptors is their impaired downregulation, suggesting that trafficking to lysosomes is impaired. Whereas wild-type receptors colocalized with the lysosomal marker LAMP1 after incubation with EGF for 60 min, the mutant receptors did not.

The functional significance of the region containing 954YL was first proposed based on a deletion mutation analysis (33), and a 954YLVI motif was identified with amino acid similarity to several lysosomally targeted enzymes (12). Despite this amino acid similarity to other enzymes, we found that there is a degree of specificity in this motif and its flanking residues. A comparison of the human EGF receptor sequence to the sequence databases revealed that this sequence is widely conserved in EGF and closely related receptors (with the exception of HER2) from humans to worms but that it is found in few other proteins. Kinetic studies indicated that EGF receptor lysosomal targeting involves endosomal retention and that this is a saturatable process (9). These observations led to the suggestion that targeting signals should be recognized by limiting cytoplasmic proteins. A candidate targeting signal recognition protein, SNX1, was identified in a yeast two-hybrid screen, and EGF receptor binding was localized to residues 943-957 (24). This protein has since defined a family of endosomal proteins capable of interacting with a variety of receptors (8, 13, 34-36).

The precise role of the SNX proteins in receptor trafficking remains undefined. Overexpression of SNX1 has been found to downregulate EGF receptors in transfected cells (24). This response is modulated by another protein, HRS, that was found to suppress SNX1-dependent downregulation of EGF receptors in HeLa cells (6). SNX family members can also be coimmunoprecipitated with other receptors, including the insulin receptor, the platelet-derived growth factor receptor, the transferrin receptor, and the short form of the leptin receptor (13). In yeast, a SNX1 homolog, Vps5p, is involved in retrograde transport of the receptor essential for carboxypeptidase Y transport to the vacuole (16, 32). Several additional yeast proteins are found in a complex with Vps5p (38). Human homologs to three of these proteins have been identified that coexist in a complex with SNX1 (14). Given that a variety of complexes have been identified in mammalian cells, it appears that the function of SNX1 is dependent on the presence and assembly of additional proteins into a SNX complex.

The present studies establish that the SNX1 binding site is necessary for targeting EGF receptors to lysosomes. Point mutations stabilize receptors against EGF-induced downregulation. Ligand binding is intact, and the mutant receptors internalize, although somewhat less efficiently than wild-type receptors. Transit through the early endosome compartment is not perturbed, yet the mutant receptors fail to colocalize with LAMP1 within 2 h of addition of EGF to cultured cells. Thus a failure in the transport of mutant receptors to lysosomes appears to be responsible for their enhanced stability to ligand-induced proteolysis detectable in Western immunoblots. The potential impact of enhanced biosynthesis and reduced endocytosis of the mutant receptors on downregulation remains to be determined. In any event, neither change seems likely to account for the complete block in downregulation that we have consistently observed. Interestingly, receptor autophosphorylation also appears to be reduced for the mutant receptors. Whether this reflects an increased susceptibility of these receptors to phosphatases, a direct reduction in autophosphorylation, or simply a consequence of lower receptor expression remains to be determined. However, the ability of the kinase domain to phosphorylate exogenous substrates indicates that the first possibility is more likely the case. This could be caused by trafficking delays that prolong the residence time of the receptor in a phosphatase-positive compartment (e.g., exposed to the cytoplasm).

Although our findings indicate that ligand-induced EGF receptor downregulation is dependent on the 954YLVI motif, downregulation is not sufficient with this motif alone. There are additional trafficking motifs that also appear to be obligatory for lysosomal targeting. An intact juxtamembrane dileucine motif located at amino acid residues 679 and 680 (679LL) is essential in EGF receptor trafficking to lysosomes for degradation. Full-length EGF receptors incorporating dialanine mutations for the dileucine motif resulted in complete impairment of EGF receptor degradation (19, 20). Taken together with the present results, this indicates that the presence of both 954YLVI and 679LL is important for efficient trafficking and degradation of intact human EGF receptors. However, in other species, only the 954YLVI motif is widely conserved.

What mechanisms could account for the apparent requirement for both 954YLVI and 679LL for efficient EGF receptor lysosomal targeting? Because these motifs do not appear to work independently, they must work either sequentially or in concert with one another. One hypothesis is that these motifs form a bipartite binding domain. Although no structural data are available, a model of the EGF receptor tyrosine kinase domain (amino acids 688-950) has been created by comparison to the cAMP-dependent protein kinase (23). More recently, the structure of the tyrosine kinase domain of the human insulin receptor has been solved (17, 18). We aligned (Fig. 1C) the tyrosine kinase domains of the EGF (P00053) and insulin receptors and used the National Center for Biotechnology Information (NCBI) Molecular Modeling DataBase (http://www.ncbi.nlm.nih.gov:80/Structure/MMDB/mmdb.shtml) to determine where EGF receptor residues 954YLVI and 679LL might lie based on the structure of the active insulin receptor tyrosine kinase structure (1IR3). Although the residues in the insulin receptor corresponding to the location of 679LL and 954YLVI in the EGF receptor were on different lobes of the enzyme, they did fall on the same side of the structure, indicating that they could form a bipartite binding site. The primary sequence alignment between the EGF receptor and the insulin receptor was poor in these flanking areas, indicating the need for EGF receptor structural data to evaluate this hypothesis. The concept of a bipartite binding domain provides a testable hypothesis accounting for the requirement of both the 679LL and 954YLVI motifs for efficient lysosomal targeting of EGF receptors. Indeed, in binding experiments with the yeast two-hybrid system, maximal SNX1 binding was observed with a bait of EGF receptor residues 647-957 (containing both 679LL and 954YLVI) that was dramatically reduced by deletion of residues 943-957 (647-942, containing only 679LL) (24).

EGF receptor ubiquitination is also important for lysosomal degradation (26). Ubiquitination is mediated by the recruitment of c-Cbl to a quantitatively minor phosphorylation site (1045Y) (25). Recruitment of c-Cbl then targets ubiquitin-conjugating enzymes (e.g., UbcH7) to the intracellular domain of the EGF receptor, leading to receptor ubiquitination (44). Ubiquitin-tagged proteins are substrates for cytoplasmic degradation by the proteosome. The process of ubiquitination is temporally correlated with transit of the receptor between the early and late endosomal compartments. Mutation of 1045Y to 1045F severely attenuates EGF receptor degradation, indicating that ubiquitination is also obligatory for EGF receptor degradation (25). The present findings indicate that this pathway for receptor degradation also requires the 954YLVI motif, because the c-Cbl binding site at 1045Y remained intact in our mutants. Together, these observations indicate that both proteosomal and lysosomal mechanisms may mediate efficient EGF receptor degradation. Topological considerations indicate that proteosomal degradation is limited to the cytoplasmic domain of the EGF receptor and should precede the movement of the EGF receptor into the multivesicular body. A logical sequence of events consistent with these observations is that ubiquitin conjugation stabilizes a conformation essential for efficient EGF receptor transport to the lysosome.

Together, the present results and those from previous studies indicate that interdependent pathways play collaborative roles in efficiently transporting EGF receptors to lysosomes. We propose a model for EGF receptor trafficking and degradation that involves the activity of each of these downregulation motifs working in concert with one another. In this model, ligand binding and receptor autophosphorylation leads to a c-Cbl-dependent stabilized conformation that exposes cryptic binding domains (679LL and 954YLVI) essential for lysosomal targeting. The result of this exposure is an interaction that forms a complete bipartite downregulation trafficking motif capable of binding cytoplasmic protein complexes that efficiently target the receptor to the lysosome. The present study defines 954YLVI as an obligatory lysosomal targeting motif for the human EGF receptor.


    ACKNOWLEDGEMENTS

We are grateful to Dr. Lawrence E. Cornett and Dr. Vladmir Lupashin, University of Arkansas for Medical Sciences, for advice during this project and during preparation of this manuscript; Dr. Gordon N. Gill, University of California, San Diego, for providing the pRcK+ plasmid; and Dr. Philip Stahl, Washington University School of Medicine, for providing the GFP-Rab5 plasmid. Monoclonal antibody H4A3 against LAMP1 developed by J. T. August and J. E. K. Hildreth was obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the National Institute of Child Health and Human Development and maintained by the University of Iowa, Department of Biological Sciences (Iowa City, IA).


    FOOTNOTES

This work was supported by National Institute of Allergy and Infectious Diseases Grant 1K23-AI-01818-01 (to S. M. Jones), American Heart Association Grant 9960280Z (to S. M. Jones), and American Cancer Society grant RPG 97-102-01-C.S.M. (to R. C. Kurten).

Address for reprint requests and other correspondence: R. C. Kurten, Dept. of Physiology and Biophysics, Univ. of Arkansas for Medical Sciences, 4301 West Markham Slot 750, Little Rock, AR 72005 (E-mail: KurtenRichardC{at}uams.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

10.1152/ajpcell.00253.2001

Received 18 September 2001; accepted in final form 30 October 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Beguinot, L, Lyall RM, Willingham MC, and Pastan I. Down-regulation of the epidermal growth factor receptor in KB cells is due to receptor internalization and subsequent degradation in lysosomes. Proc Natl Acad Sci USA 81: 2384-2388, 1984.

2.   Chang, CP, Kao JP, Lazar CS, Walsh BJ, Wells A, Wiley HS, Gill GN, and Rosenfeld MG. Ligand-induced internalization and increased cell calcium are mediated via distinct structural elements in the carboxyl terminus of the epidermal growth factor receptor. J Biol Chem 266: 23467-23470, 1991.

3.   Chang, CP, Lazar CS, Walsh BJ, Komuro M, Collawn JF, Kuhn LA, Tainer JA, Trowbridge IS, Farquhar MG, Rosenfeld MG, Wiley HS, and Gill GN. Ligand-induced internalization of the epidermal growth factor receptor is mediated by multiple endocytic codes analogous to the tyrosine motif found in constitutively internalized receptors. J Biol Chem 268: 19312-19320, 1993.

4.   Chen, JW, Murphy TL, Willingham MC, Pastan I, and August JT. Identification of two lysosomal membrane glycoproteins. J Cell Biol 101: 85-95, 1985.

5.   Chen, WS, Lazar CS, Poenie M, Tsien RY, Gill GN, and Rosenfeld MG. Requirement for intrinsic protein tyrosine kinase in the immediate and late actions of the EGF receptor. Nature 328: 820-823, 1987.

6.   Chin, LS, Raynor MC, Wei X, Chen HQ, and Li L. Hrs interacts with sorting nexin 1 and regulates degradation of epidermal growth factor receptor. J Biol Chem 276: 7069-7078, 2000.

7.   Dautry-Varsat, A, Ciechanover A, and Lodish HF. pH and the recycling of transferrin during receptor-mediated endocytosis. Proc Natl Acad Sci USA 80: 2258-2262, 1983.

8.   Florian, V, Schluter T, and Bohnensack R. A new member of the sorting nexin family interacts with the C-terminus of P-selectin. Biochem Biophys Res Commun 281: 1045-1050, 2001.

9.   French, AR, Sudlow GP, Wiley HS, and Lauffenburger DA. Postendocytic trafficking of epidermal growth factor-receptor complexes is mediated through saturable and specific endosomal interactions. J Biol Chem 269: 15749-15755, 1994.

10.   Glenney, JR, Jr, Chen WS, Lazar CS, Walton GM, Zokas LM, Rosenfeld MG, and Gill GN. Ligand-induced endocytosis of the EGF receptor is blocked by mutational inactivation and by microinjection of anti-phosphotyrosine antibodies. Cell 52: 675-684, 1988.

11.   Gotoh, N, Tojo A, Muroya K, Hashimoto Y, Hattori S, Nakamura S, Takenawa T, Yazaki Y, and Shibuya M. Epidermal growth factor-receptor mutant lacking the autophosphorylation sites induces phosphorylation of Shc protein and Shc-Grb2/ASH association and retains mitogenic activity. Proc Natl Acad Sci USA 91: 167-171, 1994.

12.   Guarnieri, FG, Arterburn LM, Penno MB, Cha Y, and August JT. The motif Tyr-X-X-hydrophobic residue mediates lysosomal membrane targeting of lysosome-associated membrane protein 1. J Biol Chem 268: 1941-1946, 1993.

13.   Haft, CR, de la Luz Sierra M, Barr VA, Haft DH, and Taylor SI. Identification of a family of sorting nexin molecules and characterization of their association with receptors. Mol Cell Biol 18: 7278-7287, 1998.

14.   Haft, CR, Sierra ML, Bafford R, Lesniak MA, Barr VA, and Taylor SI. Human orthologs of yeast vacuolar protein sorting proteins Vps26, 29, and 35: assembly into multimeric complexes. Mol Biol Cell 11: 4105-4116, 2000.

15.   Herbst, JJ, Opresko LK, Walsh BJ, Lauffenburger DA, and Wiley HS. Regulation of postendocytic trafficking of the epidermal growth factor receptor through endosomal retention. J Biol Chem 269: 12865-12873, 1994.

16.   Horazdovsky, BF, Davies BA, Seaman MN, McLaughlin SA, Yoon S, and Emr SD. A sorting nexin-1 homologue, Vps5p, forms a complex with Vps17p and is required for recycling the vacuolar protein-sorting receptor. Mol Biol Cell 8: 1529-1541, 1997.

17.   Hubbard, SR. Crystal structure of the activated insulin receptor tyrosine kinase in complex with peptide substrate and ATP analog. EMBO J 16: 5572-5581, 1997.

18.   Hubbard, SR, Wei L, Ellis L, and Hendrickson WA. Crystal structure of the tyrosine kinase domain of the human insulin receptor. Nature 372: 746-754, 1994.

19.   Kil, SJ, and Carlin C. EGF receptor residues leu(679), leu(680) mediate selective sorting of ligand-receptor complexes in early endosomal compartments. J Cell Physiol 185: 47-60, 2000.

20.   Kil, SJ, Hobert M, and Carlin C. A leucine-based determinant in the epidermal growth factor receptor juxtamembrane domain is required for the efficient transport of ligand-receptor complexes to lysosomes. J Biol Chem 274: 3141-3150, 1999.

21.   Kirchhausen, T. Clathrin. Annu Rev Biochem 69: 699-727, 2000.

22.   Klausner, RD, Ashwell G, van Renswoude J, Harford JB, and Bridges KR. Binding of apotransferrin to K562 cells: explanation of the transferrin cycle. Proc Natl Acad Sci USA 80: 2263-2266, 1983.

23.   Knighton, DR, Cadena DL, Zheng J, Ten Eyck LF, Taylor SS, Sowadski JM, and Gill GN. Structural features that specify tyrosine kinase activity deduced from homology modeling of the epidermal growth factor receptor. Proc Natl Acad Sci USA 90: 5001-5005, 1993.

24.   Kurten, RC, Cadena DL, and Gill GN. Enhanced degradation of EGF receptors by a sorting nexin, SNX1. Science 272: 1008-1010, 1996.

25.   Levkowitz, G, Waterman H, Ettenberg SA, Katz M, Tsygankov AY, Alroy I, Lavi S, Iwai K, Reiss Y, Ciechanover A, Lipkowitz S, and Yarden Y. Ubiquitin ligase activity and tyrosine phosphorylation underlie suppression of growth factor signaling by c-Cbl/Sli-1. Mol Cell 4: 1029-1040, 1999.

26.   Levkowitz, G, Waterman H, Zamir E, Kam Z, Oved S, Langdon WY, Beguinot L, Geiger B, and Yarden Y. c-Cbl/Sli-1 regulates endocytic sorting and ubiquitination of the epidermal growth factor receptor. Genes Dev 12: 3663-3674, 1998.

27.   Mellman, I. Endocytosis and molecular sorting. Annu Rev Cell Dev Biol 12: 575-625, 1996.

28.   Miskimins, WD, and Shimizu N. Dual pathways for epidermal growth factor processing after receptor-mediated endocytosis. J Cell Physiol 112: 327-338, 1982.

29.   Mukherjee, S, Ghosh RN, and Maxfield FR. Endocytosis. Physiol Rev 77: 759-803, 1997.

30.   Nesterov, A, Kurten RC, and Gill GN. Association of epidermal growth factor receptors with coated pit adaptins via a tyrosine phosphorylation-regulated mechanism. J Biol Chem 270: 6320-6327, 1995.

31.   Nesterov, A, Wiley HS, and Gill GN. Ligand-induced endocytosis of epidermal growth factor receptors that are defective in binding adaptor proteins. Proc Natl Acad Sci USA 92: 8719-8723, 1995.

32.   Nothwehr, SF, and Hindes AE. The yeast VPS5/GRD2 gene encodes a sorting nexin-1-like protein required for localizing membrane proteins to the late Golgi. J Cell Sci 110: 1063-1072, 1997.

33.   Opresko, LK, Chang CP, Will BH, Burke PM, Gill GN, and Wiley HS. Endocytosis and lysosomal targeting of epidermal growth factor receptors are mediated by distinct sequences independent of the tyrosine kinase domain. J Biol Chem 270: 4325-4333, 1995.

34.   Otsuki, T, Kajigaya S, Ozawa K, and Liu JM. SNX5, a new member of the sorting nexin family, binds to the Fanconi anemia complementation group A protein. Biochem Biophys Res Commun 265: 630-635, 1999.

35.   Parks, WT, Frank DB, Huff C, Renfrew Haft C, Martin J, Meng X, de Caestecker MP, McNally JG, Reddi A, Taylor SI, Roberts AB, Wang T, and Lechleider RJ. Sorting nexin 6, a novel SNX, interacts with the transforming growth factor-beta family of receptor serine-threonine kinases. J Biol Chem 276: 19332-19339, 2001.

36.   Phillips, SA, Barr VA, Haft DH, Taylor SI, and Haft CR. Identification and characterization of SNX15, a novel sorting nexin involved in protein trafficking. J Biol Chem 276: 5074-5084, 2001.

37.   Roberts, RL, Barbieri MA, Pryse KM, Chua M, Morisaki JH, and Stahl PD. Endosome fusion in living cells overexpressing GFP-rab5. J Cell Sci 112: 3667-3675, 1999.

38.   Seaman, MN, McCaffery JM, and Emr SD. A membrane coat complex essential for endosome-to-Golgi retrograde transport in yeast. J Cell Biol 142: 665-681, 1998.

39.   Sorkin, A, Mazzotti M, Sorkina T, Scotto L, and Beguinot L. Epidermal growth factor receptor interaction with clathrin adaptors is mediated by the Tyr974-containing internalization motif. J Biol Chem 271: 13377-13384, 1996.

40.   Sorkin, AD, Teslenko LV, and Nikolsky NN. The endocytosis of epidermal growth factor in A431 cells: a pH of microenvironment and the dynamics of receptor complex dissociation. Exp Cell Res 175: 192-205, 1988.

41.   Thompson, JD, Higgins DG, and Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673-4680, 1994.

42.   Trowbridge, IS, Collawn JF, and Hopkins CR. Signal-dependent membrane protein trafficking in the endocytic pathway. Annu Rev Cell Biol 9: 129-161, 1993.

43.   Ushiro, H, and Cohen S. Identification of phosphotyrosine as a product of epidermal growth factor-activated protein kinase in A-431 cell membranes. J Biol Chem 255: 8363-8365, 1980.

44.   Yokouchi, M, Kondo T, Houghton A, Bartkiewicz M, Horne WC, Zhang H, Yoshimura A, and Baron R. Ligand-induced ubiquitination of the epidermal growth factor receptor involves the interaction of the c-Cbl RING finger and UbcH7. J Biol Chem 274: 31707-31712, 1999.


Am J Physiol Cell Physiol 282(3):C420-C433
0363-6143/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
Cancer Res.Home page
T. C. Karagiannis, P. N. Lobachevsky, B. K.Y. Leung, J. M. White, and R. F. Martin
Receptor-Mediated DNA-Targeted Photoimmunotherapy
Cancer Res., November 1, 2006; 66(21): 10548 - 10552.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
B. J. Schnackenberg, S. M. Jones, C. Pate, B. Shank, L. Sessions, L. M. Pittman, L. E. Cornett, and R. C. Kurten
The beta-agonist isoproterenol attenuates EGF-stimulated wound closure in human airway epithelial cells
Am J Physiol Lung Cell Mol Physiol, March 1, 2006; 290(3): L485 - L491.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. Tsacoumango, S. J. Kil, L. Ma, F. D. Sonnichsen, and C. Carlin
A novel dileucine lysosomal-sorting-signal mediates intracellular EGF-receptor retention independently of protein ubiquitylation
J. Cell Sci., September 1, 2005; 118(17): 3959 - 3971.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
R. C. Kurten, P. Chowdhury, R. C. Sanders Jr., L. M. Pittman, L. W. Sessions, T. C. Chambers, C. S. Lyle, B. J. Schnackenberg, and S. M. Jones
Coordinating epidermal growth factor-induced motility promotes efficient wound closure
Am J Physiol Cell Physiol, January 1, 2005; 288(1): C109 - C121.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Stoorvogel, S. Kerstens, I. Fritzsche, J. C. d. Hartigh, R. Oud, M. A. G. van der Heyden, J. Voortman, and P. M. P. van Bergen en Henegouwen
Sorting of Ligand-activated Epidermal Growth Factor Receptor to Lysosomes Requires Its Actin-binding Domain
J. Biol. Chem., March 19, 2004; 279(12): 11562 - 11569.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
E. D. Shpak, M. B. Lakeman, and K. U. Torii
Dominant-Negative Receptor Uncovers Redundancy in the Arabidopsis ERECTA Leucine-Rich Repeat Receptor-Like Kinase Signaling Pathway That Regulates Organ Shape
PLANT CELL, May 1, 2003; 15(5): 1095 - 1110.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. F. Hamm-Alvarez
Focus on "EGF receptor downregulation depends on a trafficking motif in the distal tyrosine kinase domain"
Am J Physiol Cell Physiol, March 1, 2002; 282(3): C417 - C419.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/3/C420    most recent
00253.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (14)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jones, S. M.
Right arrow Articles by Kurten, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jones, S. M.
Right arrow Articles by Kurten, R. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online