Am J Physiol Cell Physiol Journal of Applied Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 282: C347-C359, 2002. First published November 14, 2001; doi:10.1152/ajpcell.00283.2001
0363-6143/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/2/C347    most recent
00283.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (121)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jung, S.
Right arrow Articles by Plant, T. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jung, S.
Right arrow Articles by Plant, T. D.
Vol. 282, Issue 2, C347-C359, February 2002

TRPC6 is a candidate channel involved in receptor-stimulated cation currents in A7r5 smooth muscle cells

Silke Jung, Rainer Strotmann, Günter Schultz, and Tim D. Plant

Institut für Pharmakologie, Freie Universität Berlin, 14195 Berlin, Germany


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

To investigate the possible role of members of the mammalian transient receptor potential (TRP) channel family (TRPC1-7) in vasoconstrictor-induced Ca2+ entry in vascular smooth muscle cells, we studied [Arg8]-vasopressin (AVP)-activated channels in A7r5 aortic smooth muscle cells. AVP induced an increase in free cytosolic Ca2+ concentration ([Ca2+]i) consisting of Ca2+ release and Ca2+ influx. Whole cell recordings revealed the activation of a nonselective cation current with a doubly rectifying current-voltage relation strikingly similar to those described for some heterologously expressed TRPC isoforms. The current was also stimulated by direct activation of G proteins as well as by activation of the phospholipase Cgamma -coupled platelet-derived growth factor receptor. Currents were not activated by store depletion or increased [Ca2+]i. Application of 1-oleoyl-2-acetyl-sn-glycerol stimulated the current independently of protein kinase C, a characteristic property of the TRPC3/6/7 subfamily. Like TRPC6-mediated currents, cation currents in A7r5 cells were increased by flufenamate. Northern hybridization revealed mRNA coding for TRPC1 and TRPC6. We therefore suggest that TRPC6 is a molecular component of receptor-stimulated Ca2+-permeable cation channels in A7r5 smooth muscle cells.

transient receptor potential channel; calcium ion influx; receptor-operated channel


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

IN MAMMALIAN CELLS, stimulation of receptors linked to phospholipase C (PLC) leads to an increase in free cytosolic Ca2+ concentration ([Ca2+]i) mediated by release of Ca2+ from intracellular stores such as the endoplasmic reticulum (ER) and/or Ca2+ influx across the plasma membrane. The signal transduction cascade that links receptor activation to Ca2+ release has been thoroughly investigated (for review, see Ref. 3). In short, receptor stimulation results in PLC-dependent hydrolysis of membrane-bound phosphatidylinositol 4,5-bisphosphate (PIP2) into the soluble messenger inositol 1,4,5-trisphosphate (InsP3) and membrane-bound diacylglycerol (DAG). InsP3 mediates Ca2+ release by opening InsP3 receptor channels in the membrane of the ER Ca2+ stores, whereas DAG couples receptor stimulation to the activation of protein kinase C (PKC). On the other hand, the mechanisms underlying the regulation of Ca2+ entry from the extracellular space are less well understood. Multiple pathways appear to be involved and may operate in parallel (for review, see Refs. 2 and 6). In many cell types, depletion of intracellular Ca2+ stores stimulates Ca2+ influx via a pathway that is commonly referred to as the "capacitative" or "store-operated" Ca2+ entry pathway (for review, see Ref. 38). Important for the concept of store-operated Ca2+ entry is the fact that receptor activation is not an indispensable requirement. Any means of depleting the intracellular Ca2+ pool provides a full and sufficient signal for activation of Ca2+ entry, even in the absence of receptor stimulation or generation of InsP3. The best-characterized current through store-operated channels is the highly Ca2+-selective calcium release-activated current (ICRAC; Ref. 35). However, other less Ca2+-selective channels have also been described. Although current models of PLC-dependent Ca2+ entry mechanisms focus on the capacitative concept, there is increasing evidence that many Ca2+ entry pathways may be activated independently of store depletion by various messengers of the signal transduction cascade such as InsP3, inositol 1,3,4,5-tetrakisphosphate (InsP4), Ca2+, G proteins, DAG, PKC, or arachidonic acid (AA).

Despite intensive research, reliable evidence for the molecular identity of the Ca2+-permeable channels involved in receptor-stimulated Ca2+ entry is still lacking. Mammalian homologues of the Drosophila transient receptor potential (TRP) channel family (TRPC1-7) have been implicated as molecular candidates for channels mediating receptor-stimulated Ca2+ influx (for review, see Ref. 13). The properties and activation mechanisms of all family members have been extensively studied in heterologous expression systems. However, the gating mechanisms of the recombinant mammalian TRPCs remain highly controversial. Whereas some studies have proposed store-operated activation mechanisms for many family members (23, 36, 42, 48, 49), others report the involvement of store-independent pathways in the activation of TRPC2-7 (17, 27, 30, 33, 39), e.g., through direct activation by DAG in the case of the TRPC3/6/7 subfamily of TRP channels (17, 30, 33). The reasons for these contradictory findings remain elusive. The discrepancies could be due to differences in the expression systems used and/or different expression levels of the proteins (22). In contrast to the abundance of reports on TRP channels in heterologous expression systems, relatively little information is available on their role in native tissues. In most studies on the role of TRPCs in native tissues, these channels have been implicated as a component of store-operated channels (1, 9, 10, 29, 31, 37, 45-47). However, a role for TRPCs in receptor-regulated, store-independent channels has also been proposed (26).

Although smooth muscle cells are known to express voltage-activated Ca2+ channels, receptor-activated Ca2+-permeable channels stimulated downstream of PLC activation form an additional, important Ca2+ entry pathway. In A7r5 cells, a clonal cell line derived from embryonic rat thoracic aorta, [Arg8]-vasopressin (AVP) activates Ca2+ influx through store-dependent and -independent pathways (4, 5, 8, 44). The electrophysiological properties of different nonselective cation conductances have been described in these cells (19, 20, 25, 32, 43). In the present study, we investigated receptor-stimulated Ca2+ entry in A7r5 smooth muscle cells and tried to evaluate the role of TRP channels using combined Ca2+ imaging, electrophysiological, and molecular biological techniques. From the results, we propose a major role for TRPC6 in mediating vasopressin-induced Ca2+ entry in A7r5 cells.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Cell Culture

Vascular smooth muscle cells derived from embryonic rat thoracic aorta (A7r5) were purchased from American Type Culture Collection (Manassas, VA) and grown in 75-cm2 plastic tissue culture flasks (Greiner, Frickenhausen, Germany) at 37°C in a humidified atmosphere (7% CO2) in DMEM (4.5 g/l glucose) supplemented with 10% (vol/vol) fetal bovine serum (Life Technologies, Karlsruhe, Germany), 4 mM L-glutamine (Fluka, Taufkirchen, Germany), 100 U/ml penicillin, and 100 U/ml streptomycin (Biochrom, Berlin, Germany). For recordings, cells were plated onto glass coverslips. All experiments were performed between 1 and 3 days after plating.

Molecular Biology

For PCR cloning and Northern blotting, total RNA was purified from A7r5 cells and rat brain and vomeronasal organ (VNO) with TRIzol LS (Life Technologies) according to the standard protocol. For cDNA synthesis, 1-5 µg of total RNA was reverse transcribed with 200 U of Superscript II reverse transcriptase (Life Technologies) and 5 pM primer 5'-CCAGTGAGCAGCAGAGTGACGAGGACTCGAGCTCAAGCTTTTTTTTTTTTTTTTT. The cDNAs were used as templates for PCR amplification of partial cDNA fragments of rat TRPC1-7. The following primer sets were used for amplification of reverse transcripts: rtrpc1, GGGAATTCGCCCCGGCTACACAGAGAAACC (sense)/GGGAATTCGGGAACACTTAAACCTGGGACATT (antisense); rtrpc2, GGGAATTCAGGGCCAGCTGGGTCTCGTG (sense)/GGGAATTCATGCCCCGGTAGGTGTTGATTC (antisense); rtrpc3, GGGAATTCGAACTGGGCATGGGTAACTCAAAG (sense)/GGGAATTCCGTCATGGCTGGTCGTAAAACA (antisense); rtrpc4, GCTGAGCAAAACGCAAACCA (sense)/AATTATTACGTCAAGATGGATGGAAGT (antisense); rtrpc5, GGCATCGCACAGCAGCACTCTAT (sense)/CAGCATGGGCAGCGTGTAAGC (antisense); rtrpc6, CGGTGGTCATCAACTACAATCA (sense)/TCCAAATGATCCAAGTTACCAGTT (antisense); and rtrpc7, TCCCTTTAACCTGGTGCCGAGTC (sense)/ATGTGCGTATGTTGGGGAGGAA (antisense).

Cycling conditions were 2 min at 95°C, followed by 10 cycles of 30 s at 95°C, 15 s at 55-65°C, and 60-70 s at 72°C, followed by 20 cycles of 30 s at 95°C, 15 s at 55-65°C, and 60-70 s + 5 s/cycle at 72°C, and a final extension at 72°C for 7 min. The PCR products were subcloned into pCR2.1/TOPO or pcDNA3.1/TOPO vectors (Invitrogen, Karlsruhe, Germany), and the sequences were confirmed by DNA sequencing. EcoRI, BstX1, or NotI fragments (New England Biolabs, Frankfurt/Main, Germany), depending on the vector used and on the presence of internal restriction sites, were radiolabeled by random priming (Prime-It Rmt random primer labeling kit; Stratagene, Amsterdam, The Netherlands) with [alpha -32P]dCTP (NEN Life Science Products, Zaventem, Belgium) and purified by gel filtration (ProbeQuant; Amersham Pharmacia Biotech Europe, Freiburg, Germany). For Northern blotting, 40 µg of total RNA (or purified mRNA in the case of TRPC1; Oligotex, Invitrogen) from the desired cells or tissues (48 µg of VNO total RNA) was separated by gel electrophoresis on a formaldehyde-agarose gel and transferred to a nylon membrane (Hybond-XL, Amersham Pharmacia Biotech Europe, or Tropilon-Plus, Applied Biosystems, Weiterstadt, Germany). Four to five hours of prehybridization in UltraHyb hybridization solution (Ambion, Huntingdon, UK) was followed by overnight hybridization at 42-50°C with the same solution supplemented with 1 × 106 cpm/ml of labeled probe. Blots were washed with high-stringency washing protocols [twice with 2× standard saline citrate (SSC)-0.1% SDS at 50°C for 10 min, 60 min in 0.2× SSC-0.1% SDS at 50°C, twice with 0.1× SSC-0.1% SDS at 55-60°C for 60 min]. Autoradiographs were obtained using a phosphoimaging system (BAS-reader, Fuji) and exposure times of at least 24 h. As a control for the integrity and the amount of the transferred RNA, blot membranes were stained with methylene blue before hybridization. Furthermore, after hybridization, blots were stripped and rehybridized with a 888-bp cDNA fragment of rat glyceraldehyde-3-phosphate dehydrogenase.

Fluorometric Measurements of Intracellular Ca2+ Concentration

[Ca2+]i was monitored using the fluorescent Ca2+ indicator fura 2-AM. Cells were loaded in standard extracellular solution (in mM: 140 NaCl, 5 KCl, 1 MgCl2, 2 CaCl2, 10 glucose, and 10 HEPES, pH 7.4 with NaOH) supplemented with 4 µM fura 2-AM and 0.005% Pluronic F-127 for 60-120 min at room temperature. Cells were then rinsed with standard extracellular solution and allowed to deesterify for at least 30 min at room temperature. Measurements of [Ca2+]i were performed with an inverted microscope (Axiovert 10; Zeiss, Göttingen, Germany) equipped with an imaging system (T.I.L.L. Photonics, Gräfeling, Germany). The illumination was generated by a xenon arc lamp. The excitation wavelength was alternated between 340 and 380 nm, and the fluorescence emission of selected areas within the A7r5 cell layer was long-pass filtered at 520 nm and recorded with a charge-coupled device camera. After correction for background fluorescence, the fluorescence ratio F340/F380 was calculated. Monochromator settings and data acquisition were controlled by Fucal 5.12 C software (T.I.L.L. Photonics). All experiments were performed at room temperature. Coverslips were mounted in a recording chamber on the microscope stage (chamber volume ~0.5 ml) and continuously superfused at a rate of ~5 ml/min by gravity feed. For Ca2+-free solutions, Ca2+ was replaced by 1 mM EGTA.

Patch-Clamp Recordings

For electrophysiological recordings, cells were placed in a recording chamber (chamber volume ~0.5 ml) and continuously superfused with solution by gravity feed at a rate of 3 ml/min. Single cells were voltage-clamped in the whole cell mode (12) with an EPC-7 amplifier and Pulse software (HEKA, Lambrecht, Germany). Patch pipettes were made from borosilicate glass and had resistances of 3-6 MOmega when filled with the standard intracellular solutions. Cells were held at a potential of -60 mV, and current-voltage (I-V) relations were obtained every 5 s from voltage ramps from -100 to +100 mV with a duration of 400 ms. Ramp data were acquired at a frequency of 4 kHz and filtered at 1 kHz. The holding current was acquired at 30 Hz. Series resistance (6-15 MOmega ) was not compensated. For fluctuation analysis, the holding current was sampled at 10 kHz and filtered at 5 kHz. The current variance (sigma 2) was plotted against mean current amplitude (I), and the single-channel current (i) as well as the total number of channels in the patch (N) were estimated by fitting the equation sigma 2 = iI - I2/N to the plots. The single-channel chord conductance at -60 mV was calculated from the single-channel current using Ohm's law.

The standard extracellular solution contained (in mM) 140 NaCl, 5 CsCl, 2 CaCl2, 1 MgCl2, 10 glucose, and 10 HEPES (pH 7.4 with NaOH). Solutions with reduced Ca2+ concentrations were made by adjusting the Ca2+ content to the desired value. For Ca2+-free solutions, Ca2+ was omitted or replaced by 1 mM EGTA. For Na+-free solutions, Na+ was replaced by N-methyl-D-glucamine (NMDG+). In 0 Ca2+-0 Na2+ solutions, Na+ was replaced by NMDG+ and Cs+ and Ca2+ were omitted. Unless otherwise stated, nimodipine (10 µM) was present in the external solutions to block voltage-dependent Ca2+ currents activated by depolarizing ramps. The standard intracellular solution contained (in mM) 110 cesium methanesulfonate, 25 CsCl, 2 MgCl2, 3.62 CaCl2, 10 EGTA, and 30 HEPES (pH 7.2 with CsOH) with a calculated [Ca2+] of 100 nM. In some experiments, Ca2+-free pipette solutions (only 10 mM EGTA, no CaCl2) were used. For experiments with 10 µM Ca2+, the pipette solution contained 0.098 mM CaCl2 and 1 mM N-(2-hydroxyethyl)ethylenediamine-N,N',N'-triacetic acid (HEDTA). All experiments were performed at room temperature (20-25°C).

Chemicals

AVP, flufenamate (FFA), guanosine 5'-O-(3-thiotriphosphate) (GTPgamma S), heparin, 5-hydroxytryptamine (serotonin; 5-HT), InsP3, niflumic acid, nimodipine, 5-nitro-2-(3-phenylpropylamino)-benzoate (NPPB), 1-oleoyl-2-acetyl-sn-glycerol (OAG), phorbol 12-myristate 13-acetate (PMA), and SKF-96365 were obtained from Sigma (Taufkirchen, Germany). Fura 2 and Pluronic F-127 were purchased from Molecular Probes (Eugene, OR). Thapsigargin was from Alomone Labs (Jerusalem, Israel), and recombinant human platelet-derived growth factor (rhPDGF-BB) was from Calbiochem (Bad Soden, Germany). Different batches of AA from Sigma and from Cayman Chemical (Ann Arbor, MI) were used. Stock solutions were made in water or DMSO and diluted to final concentrations with respective solutions.

Statistics

All data are given as means ± SE. The statistical significance of differences between mean values was assessed with Student's t-test. Differences were regarded as statistically significant for P < 0.05.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Vasopressin-Induced Ca2+ Signals in A7r5 Cells

To compare the effects of AVP application on [Ca2+]i of single A7r5 cells with previous studies on this cell type (4, 5, 32), we first performed ratiometric imaging experiments with the Ca2+-sensitive dye fura 2. In the presence of extracellular Ca2+, addition of AVP (100 nM) to the extracellular solution elicited a substantial increase in F340/F380 consisting of a fast rise and a slower decline to baseline (Fig. 1A). The slow component of response decay was very heterogeneous in different cells. Some cells exhibited a clear plateau phase (n = 112 of 178; see also Fig. 1A, inset), whereas in others [Ca2+]i returned to baseline monophasically (n = 66 of 178; Fig. 1A, inset). Removal of the agonist did not notably affect the rate of decline. To separate Ca2+ release from Ca2+ entry across the plasma membrane, the effects of Ca2+ removal from the bath solution on response amplitude and kinetics were studied (Fig. 1B). In the absence of extracellular Ca2+, AVP was still able to increase [Ca2+]i, suggesting that Ca2+ release contributed to the observed Ca2+ response (n = 162). However, the response kinetics were changed. The increase in [Ca2+]i was now followed by a rapid return to prestimulation levels. When, in the continued presence of AVP, Ca2+ was added to the bath solution, an increase in F340/F380 was observed (n = 113). Hence, in addition to Ca2+ release, Ca2+ entry was involved in AVP-induced Ca2+ signaling in A7r5 cells. The above findings suggest that AVP increases the plasma membrane permeability for divalent cations in A7r5 smooth muscle cells. AVP-induced divalent cation entry is not mediated by voltage-gated Ca2+ channels because all experiments were performed in the presence of nimodipine (10 µM). Addition or removal of nimodipine did not change the slow component of the response (data not shown).


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 1.   A: time-dependent changes in free cytosolic Ca2+ concentration ([Ca2+]i) revealed by changes in fluorescence ratio F340/F380 of individual fura 2-loaded A7r5 smooth muscle cells on application of 100 nM vasopressin. Inset, selected traces extracted from A. B: removal and readdition of external Ca2+ during vasopressin application. In the absence of external Ca2+, vasopressin induced a transient increase in F340/F380 followed by a fast decline to baseline. In the continued presence of the agonist, readdition of external Ca2+ revealed an additional slower response component. The trace is the mean of 22 cells.

Electrophysiological Recordings

Cation currents activated by vasopressin. Whole cell voltage-clamp recordings were performed to study the nature of the AVP-stimulated cationic currents underlying the observed Ca2+ signals. To block currents mediated by voltage-gated K+ channels and voltage-gated Ca2+ channels, pipette and bath solutions contained Cs+ rather than K+ and nimodipine was added to all bath solutions. In ~90% of the cells tested (n = 288), application of AVP resulted in the rapid, transient activation of a noisy inward current at a holding potential of -60 mV (Fig. 2A). The I-V relations of the AVP-induced current had a characteristic doubly rectifying form (Fig. 2B) similar to those described for various members of the TRPC family in heterologous expression systems (17, 18, 24, 33, 39, 41). The currents displayed a reversal potential of ~0 mV. Replacement of external Na+, Cs+, and Ca2+ by NMDG+ almost completely abolished the inward current, whereas outward currents at positive potentials were either unaffected or slightly increased (Fig. 2, C and D). The Cl- channel blockers NPPB (50 µM; n = 8) and niflumic acid (100 µM; n = 7) did not block the AVP-induced current (data not shown). Together, these results suggest that the AVP-induced current observed in A7r5 cells is a cation current. Because the I-V relationship of the AVP-induced current is markedly different from those described for agonist-evoked cation currents in previous studies on A7r5 cells (19, 20, 25, 43), we characterized the electrophysiological properties of the AVP-induced current in more detail. To relate the results to the possible involvement of TRPC isoforms, we focused on the activation mechanism and current inhibition.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 2.   A: addition of vasopressin (100 nM) resulted in the transient activation of a noisy inward current at a holding potential of -60 mV [external Ca2+ concentration ([Ca2+]o) = 50 µM]. B: characteristic doubly rectifying current-voltage (I-V) relationship of the vasopressin-induced current. The I-V relation was obtained during voltage ramps from -100 mV to +100 mV at the peak of the inward current shown in A. Leak subtraction was performed. C: vasopressin-induced whole cell currents at -100 and +100 mV in an external solution containing 200 µM Ca2+. In the absence of external Na+ and Ca2+, inward currents were abolished. D: I-V relationship of the vasopressin-induced current in C obtained during voltage ramps from -100 mV to +100 mV shortly before or after (gray traces) and during (black trace) removal of Na+ and Ca2+.

Dependence of cation currents on external Ca2+ concentration The experiments described above were performed in reduced external Ca2+ concentration ([Ca2+]o; 50 or 200 µM) because larger response amplitudes were obtained in these solutions. As reported for norepinephrine-evoked currents in rabbit portal vein smooth muscle cells (14), the amplitudes of the AVP-induced currents in A7r5 cells were highly variable and displayed a complex dependence on [Ca2+]o. Figure 3A shows a typical experiment in which the AVP-induced current was first evoked in an external solution containing 2 mM Ca2+. After the inward current at -60 mV had reached its peak, [Ca2+]o was decreased to 50 µM. This decrease in [Ca2+]o resulted in a substantial increase in current amplitude. On readdition of 2 mM Ca2+ to the extracellular solution, the current amplitude decreased again. These data suggest that external Ca2+ inhibits the AVP-induced cation current. The inhibitory effect of external Ca2+ was observed at both negative and positive potentials (Fig. 3B). Adding to the complexity of the external Ca2+ dependence of the AVP-induced current is the fact that when [Ca2+]o was further decreased (nominally Ca2+-free solutions or substituting EGTA for external Ca2+) inward current amplitudes did not further increase but were slightly decreased [n = 9; Fig. 3C; current activation by infusion of AlF<UP><SUB>4</SUB><SUP>−</SUP></UP> was used (see Mechanism of Current Activation)], whereas outward currents remained unaffected or increased slightly. Thus, despite its inhibitory actions, external Ca2+ also facilitates AVP-induced cation currents.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 3.   A: the amplitude of the vasopressin-induced inward current recorded at a holding potential of -60 mV was reversibly increased by reducing [Ca2+]o from 2 mM to 50 µM. B: whole cell currents recorded at -60 mV (top trace) and at -100 and +100 mV (bottom traces). Increasing [Ca2+]o from 50 µM to 2 mM reversibly decreased the amplitude of the vasopressin-induced currents at all potentials. C: inward current elicited by infusion of AlF<UP><SUB>4</SUB><SUP>−</SUP></UP> at -60 mV in an external solution containing 200 µM Ca2+. Removing Ca2+ from the extracellular solution did not increase the amplitude of the current but resulted in a reversible reduction of the inward current. Replacement of external Ca2+ by Sr2+ (2 mM) had little effect on the current amplitude. Removal of both Na+ and Ca2+ completely abolished inward currents activated by AlF<UP><SUB>4</SUB><SUP>−</SUP></UP>. D: normalized I-V relations of vasopressin-induced currents in external solutions with no (black trace) or 2 mM (gray trace) external Ca2+ added. The curves, obtained during voltage ramps from -100 mV to +100 mV, were normalized to the respective maximum inward current. The form of the I-V relationship of the vasopressin-induced current was not markedly different in the presence and absence of external Ca2+.

As shown in Fig. 2, the AVP-induced current in A7r5 cells showed marked rectification. The potentiating effect of Ca2+ may be due to the alteration of those rectifying properties. Consequently, we normalized I-V relationships obtained in high and low external Ca2+ to the peak current at negative potentials (which is -1) and superimposed the normalized I-V curves (Fig. 3D). The I-V relationships were similar in solutions containing high and low external Ca2+, and the reversal potential of the current remained largely unchanged, suggesting that external Ca2+ does not influence current rectification.

Because current amplitudes were larger in extracellular solutions with lower [Ca2+]o, solutions containing 200 or 50 µM Ca2+ were used for the remainder of the study. In general, cells were less stable at 50 µM [Ca2+]o. At -60 mV, the mean peak inward current densities in response to AVP were 2.3 ± 0.2 pA/pF [membrane capacitance (Cm) = 61.8 ± 1.1 pF; n = 151] at 200 µM [Ca2+]o and 0.6 ± 0.1 pA/pF (Cm = 68.8 ± 2.7 pF; n = 44) at 2 mM [Ca2+]o.

We tried to determine the relative permeabilities of the AVP-induced current for mono- and divalent cations. However, because of to the inhibitory effect of high [Ca2+]o, inward currents in solutions with Ca2+ as the only permeant cation were very small and the effects of high [Ca2+]o on baseline ("leak") currents could not be reliably separated from those on the AVP-induced current. This problem was not solved by increasing [Ca2+]o from 10 to 100 mM. Therefore, we were not able to determine the relative Ca2+ permeability. Likewise, inward currents in extracellular solutions containing only Ba2+ or Sr2+ as permeant ions were too small to determine the reversal potential accurately.

Effects of di- and trivalent cations and SKF-96365 on AVP-induced currents. The effects of other di- and trivalent cations commonly used to block nonselective cation currents were also studied on AVP-induced currents in A7r5 cells. As can be seen in Fig. 4, A and B, Gd3+ (100 µM; n = 4) completely blocked the AVP-induced current at all potentials whereas a lower concentration of 1 µM was only partially inhibitory (~40% inhibition at -60 mV; n = 4; data not shown). Likewise, La3+ (100 µM) completely inhibited AVP-induced inward currents by 100% (n = 6; data not shown). The effects of both La3+ and Gd3+ at a concentration of 100 µM were not readily reversible. Moreover, current noise was completely abolished in the presence of these ions. In contrast, the divalent cations Ni2+ (1 mM; 80 ± 7% inhibition at -60 mV; n = 5), Co2+ [100 µM (n = 1), 500 µM (n = 2), and 2 mM (n = 2): ~30%, ~50%, and ~90% inhibition, respectively, at -60 mV], and Mn2+ (2 mM; 92 ± 5% inhibition at -60 mV; n = 5) only partially blocked AVP-induced inward currents in A7r5 cells (Fig. 4C). Inhibition of AVP-induced currents was readily reversible on removal of these cations from the bath solution. AVP-induced outward currents were inhibited to a lesser extent than the inward currents, suggesting a voltage-dependent block by these cations. On the other hand, Ba2+ (2 mM; n = 5; data not shown) and Sr2+ (500 µM or 2 mM; n = 4; Fig. 4C) did not change current amplitudes when added to the extracellular solution. Furthermore, Sr2+ (2 mM; n = 8) was able to prevent the inhibitory action of complete external Ca2+ removal on AVP-induced inward currents (Fig. 3C). Removal of Mg2+, which was normally present at 1 mM in all extracellular solutions, slightly augmented AVP-induced currents (Fig. 4D; n = 4), whereas the I-V relation remained largely unchanged. SKF-96365 (100 µM), a commonly used organic cation channel blocker, inhibited AVP-evoked cation currents in A7r5 smooth muscle cells at -60 mV by 98 ± 2% (n = 5; data not shown).


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 4.   A: whole cell currents at -60 mV in an external solution containing 50 µM Ca2+. The vasopressin-induced inward current was completely abolished when Gd3+ (100 µM) was added to the bath solution. B: I-V relationships of the same cell obtained during voltage ramps from -100 mV to +100 mV before (gray trace) and after (black trace) addition of Gd3+. C: whole cell currents at -100 and +100 mV in 200 µM [Ca2+]o. Addition of Co2+ (2 mM), but not of Sr2+ (2 mM), reversibly inhibited vasopressin-induced currents. Inhibition of the inward current was more pronounced than inhibition of the outward current. D: whole cell currents at -60 mV in an external solution containing 200 µM Ca2+. Removal of Mg2+ from the external solution slightly increased the inward current elicited by vasopressin.

Single-Channel Conductance

For most members of the TRP channel family, single-channel conductances have been estimated from single-channel recordings or fluctuation analysis (17, 18, 23, 39, 41, 49). We wanted to compare these data with the single-channel properties of the AVP-evoked currents in A7r5 cells. Because of low current densities, we performed fluctuation analysis rather than single-channel recordings. For this purpose, whole cell currents at -60 mV were recorded at increased sampling rates (see MATERIALS AND METHODS) and leak-subtracted. Mean currents and current variances were calculated for 100-ms periods during the rising phase of the AVP-induced current response. The results of a representative experiment are shown in Fig. 5. In many cases, the relationship between current variance and mean current was not parabolic but essentially linear, probably because the open probability of the channels was low even at the peak of the current evoked by AVP. Therefore, no reliable estimates of the average number of AVP-activated cation channels present in the plasma membrane of A7r5 cells can be given as would be expected from the equation sigma 2 = iI - I2/N used to fit the plots. At 200 µM [Ca2+]o, the mean single-channel current at a holding potential of -60 mV was -1.82 ± 0.13 pA (n = 12). From this, a single-channel chord conductance of 30 pS was calculated.


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 5.   A: whole cell currents recorded at -60 mV in an external solution containing 200 µM Ca2+. The activation phase of the vasopressin-induced current was recorded at a sampling rate of 10 kHz (filter frequency 5 kHz). B: relationship between current variance (sigma ) and mean current (I) as determined from the current in A. N, total no. of channels in patch; i, single-channel current; gamma , single-channel chord conductance.

Mechanism of Current Activation

We investigated the mechanism of cation current activation in A7r5 smooth muscle cells in more detail. PLCbeta -activating agonists such as 5-HT (50 µM; n = 8 of 9; Fig. 6B) and endothelin-1 (100 nM; n = 3 of 6; data not shown) as well as PLCgamma -activating PDGF (40-80 ng/ml; n = 5 of 9; Fig. 6A) stimulated a cation current with the typical doubly rectifying I-V relationship in A7r5 cells. In the case of PDGF, current activation was slower than that with PLCbeta -activating agonists. These data suggest a role for PLC in current activation as described for other members of the TRPC family (17, 30, 33, 39). To determine whether direct activation of G proteins can stimulate the cation current in A7r5 cells, AlF<UP><SUB>4</SUB><SUP>−</SUP></UP> was added to the intracellular solution. With a variable delay, activation of a cation current could be observed after AlF<UP><SUB>4</SUB><SUP>−</SUP></UP> infusion (n = 20 of 23; Fig. 6C). The current displayed a doubly rectifying I-V relation identical to that described for AVP-induced currents (Fig. 6D). Consistent with the currents evoked by AVP, the amplitude of the AlF<UP><SUB>4</SUB><SUP>−</SUP></UP>-evoked current was increased by decreasing [Ca2+]o and inward current was abolished by removal of extracellular cations (Fig. 6C).


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 6.   Whole cell currents recorded at a holding potential of -60 mV in an external solution containing 50 (B) or 200 (A) µM external Ca2+. Noisy inward currents that were abolished by removal of external Na+ and Ca2+ were evoked by platelet-derived growth factor (PDGF, 80 ng/ml; A) and 5-hydroxytryptamine (5-HT, 50 µM; B). C: infusion of AlF<UP><SUB>4</SUB><SUP>−</SUP></UP> elicited a noisy inward current at -60 mV with a doubly rectifying I-V relationship (D; leak subtracted). The current amplitude could be reversibly increased by decreasing the Ca2+ concentration of the bath solution from 2 mM to 200 µM. The inward current recorded at -60 mV was almost completely abolished when external Na+ and Ca2+ were removed.

To test for a role of intracellular store depletion in the activation of AVP-induced cation currents in A7r5 cells, protocols were used that had previously been shown to activate store-operated channels in other preparations (7). Infusion of InsP3 (100 µM) in a Ca2+-free 10 mM EGTA pipette solution did not change the holding current (n = 9). Similarly, no current activation could be obtained in solutions containing 100 nM free Ca2+ buffered with 10 mM EGTA (n = 12; Fig. 7A). However, after 5 min of InsP3 infusion, 10 of the 19 cells tested responded to AVP with activation of cation currents. Likewise, passive depletion of internal Ca2+ stores by addition of the sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA) inhibitor thapsigargin (1 µM; n = 3) did not result in activation of a cation current in A7r5 cells (data not shown). Current activation was not impaired by infusion of the InsP3 receptor antagonist heparin (5 mg/ml) for 5 min before AVP application (n = 4; Fig. 7B). Infusion of cells with high Ca2+ (10 µM) revealed that the cation conductance in A7r5 cells was not Ca2+ activated (n = 7; Fig. 7C). In four cells, AVP was able to induce current activation after 5 min of 10 µM Ca2+ infusion.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 7.   Whole cell currents recorded at -60 mV in 200 µM [Ca2+]o. A: infusion of inositol 1,4,5-trisphosphate (InsP3, 100 µM) did not evoke any measurable current in A7r5 smooth muscle cells, whereas the subsequent addition of vasopressin (100 nM) to the bath solution stimulated a noisy inward current. B: when Ca2+ release from internal stores was prevented by infusion of the InsP3 receptor blocker heparin (5 mg/ml), vasopressin (100 nM) was still able to activate cation currents. C: infusion of 10 µM Ca2+ did not activate any current; it did not prevent current activation by subsequent addition of vasopressin (100 nM).

The TRPC3/6/7 subfamily of TRP channels was shown to be directly activated by DAG (17, 30, 33), whereas TRPC4 and -5 are unresponsive to the lipid (39). To assess the role of DAG in cation current activation in A7r5 cells, the membrane-permeant DAG analog OAG was added to the extracellular solution during whole cell recordings. As shown in Fig. 8, A and B, OAG evoked cation currents (n = 45 of 53) with I-V relations identical to those of AVP- and AlF<UP><SUB>4</SUB><SUP>−</SUP></UP>-induced currents. Comparison of the amplitudes of the current responses elicited by different OAG concentrations indicated that responses close to maximum were obtained at a concentration of 100 µM. Responses evoked by 10 µM OAG only reached 30 ± 3% (n = 4) of the amplitudes observed on subsequent application of 100 µM OAG (data not shown). Raising the OAG concentration from 100 µM to 500 µM resulted in no further increase (n = 6 of 8) or a slight increase (n = 2 of 8) in response amplitude (data not shown). Because OAG concentrations above 100 µM rendered recordings increasingly unstable, 100 µM OAG was routinely used.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 8.   A: whole cell currents recorded at -60 mV in 200 µM [Ca2+]o. 1-Oleoyl-2-acetyl-sn-glycerol (OAG; 100 µM) activated a current with a doubly rectifying I-V relation (B). Inward currents could be inhibited by removal of Na+ and Ca2+ from the external solution. B: I-V relations obtained during (gray trace) or before and after (black traces) removal of external Na+ and Ca2+. C and D: whole cell currents at -60 mV in 200 µM [Ca2+]o. Addition of flufenamate (FFA; 100 µM) enhanced currents elicited by infusion of AlF<UP><SUB>4</SUB><SUP>−</SUP></UP> (C) or application of OAG (100 µM; D).

As for AVP-induced currents, the amplitudes of the currents activated by 100 µM OAG were highly variable, ranging from 0.1 to 8.9 pA/pF at -60 mV and 200 µM [Ca2+]o. The mean peak current density in response to 100 µM OAG was 1.4 ± 0.3 pA/pF (n = 36), a value smaller than, but not statistically significant from, that for AVP-induced currents under identical conditions.

To investigate whether the OAG-stimulated current accounts for all or only part of the AVP-induced current increase, we measured OAG-induced currents followed by the addition of AVP and vice versa. In both cases, the second substance was applied after the response to the first substance had reached its peak. When AVP was applied after OAG, three of seven cells showed no further increase in current on AVP application. The remaining four cells showed a very small increase in current amplitude that did not exceed the peak response to the preceding OAG application (data not shown). When OAG was applied after AVP, some cells showed no additional effect upon OAG application (n = 5 of 11), others displayed a very small increase in current (n = 4 of 11), and two cells exhibited a substantial increase in current amplitude that well exceeded the peak response to the preceding AVP application (data not shown).

We then tested for an involvement of PKC in AVP-induced Ca2+ entry. In fura 2 experiments, preincubation with PMA (500 nM) for several minutes reduced the response amplitudes to AVP applied subsequently (data not shown). PMA alone did not increase [Ca2+]i in A7r5 cells. Hence, activation of PKC, rather than activating Ca2+ influx, inhibits AVP-induced Ca2+ entry. Together, these data support a contribution of the TRPC3/6/7 subfamily of TRP channels to cation currents in A7r5 smooth muscle cells.

AA [100 (n = 8), 50 (n = 5), 20 (n = 2), and 10 (n = 8) µM] was tested for its ability to induce currents in A7r5 cells (data not shown). Experiments were complicated by the fact that AA rendered recordings unstable, leading to loss of the cell between 10 s and 4 min after application. AA did not activate a cation current with a doubly rectifying I-V relation in any of the cells tested.

Effect of FFA on Cation Currents

The nonspecific cation channel blocker FFA has been shown to reversibly enhance currents mediated by murine (m)TRPC6, whereas currents mediated by mTRPC3 and mTRPC7 were inhibited by the drug (18). To discriminate between the members of the TRPC3/6/7 subfamily that may be involved in agonist-induced cation currents in A7r5 cells, the effect of FFA on these currents was studied. FFA (100 µM) increased cation currents induced by infusion of AlF<UP><SUB>4</SUB><SUP>−</SUP></UP> (n = 7; Fig. 8C) or by application of OAG (n = 10 of 13; Fig. 8D) or AVP (n = 4 of 5; data not shown). The remaining cells did not show any change in current levels on application of FFA. Stimulatory effects similar to those of FFA on AVP-induced currents were observed with niflumic acid (100 µM; n = 3 of 4).

Northern Hybridization Analysis

To identify the TRP channels expressed in A7r5 cells, we studied the expression of mRNA for TRPC1-7. By Northern hybridization analysis, we found that TRPC6 mRNA was abundantly expressed in A7r5 smooth muscle cells. Transcripts for TRPC2, -3, -4, -5, and -7 could not be detected in these cells, although prominent signals were present in the controls (Fig. 9). In contrast, expression of TRPC1 mRNA was detectable in A7r5 cells (Fig. 9). Detection of TRPC1 was only possible after purification of mRNA from the total RNA used in all other experiments. When total RNA was used, only blurred signals were obtained in A7r5 cells and in controls (data not shown). With purified mRNA, distinct bands were observed in brain and A7r5 cells (Fig. 9).


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 9.   Autoradiographs of Northern blot hybridization with cDNA probes derived from rat transient receptor potential channels (TRPC)1-7. mRNA for TRPC1 and TRPC6, but not for TRPC2, TRPC3, TRPC4, TRPC5, or TRPC7, could be detected in A7r5 smooth muscle cells. RNA isolated from rat brain served as a positive control. For TRPC2, no mRNA expression could be detected in brain. In this case, RNA purified from the rat vomeronasal organ (VNO) was used as a control. GAPDH,glyceraldehyde-3-phosphate dehydrogenase.

For all autoradiographs except that for TRPC2 expression, rat brain RNA served as a positive control. In the case of TRPC2 expression analysis, no signal was detected in rat brain, and thus RNA derived from the rat VNO, in which abundant expression was described previously (27), was used as a positive control.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

In the present study, we provide evidence for the involvement of TRP channels in AVP-induced nonselective cation currents in A7r5 smooth muscle cells. In light of the combined Ca2+ imaging, electrophysiological, and molecular biological data, we suggest that TRPC6 is a candidate molecular component of the channels mediating these currents.

A number of observations support this conclusion. AVP-induced nonselective cation currents in A7r5 cells were found to display a characteristic doubly rectifying I-V relationship that resembles the I-V relationship described for recombinantly expressed human (h)TRPC3/6 (17, 24), mTRPC7 (33), and mTRPC4/5 (39, 41). In contrast, currents mediated by TRPC1 show a linear I-V relation (28, 40, 49). Activation of the cation current was shown to be dependent on PLC activation. However, neither InsP3 nor elevated [Ca2+]i directly activated the current. Likewise, store depletion protocols failed to activate the current. Current activation was also unaffected by infusion of heparin, ruling out an involvement of InsP3 receptors. Comparable PLC-dependent but store depletion-independent activation mechanisms have been described for mTRPC4/5 (34, 39, 41), hTRPC3/6 (17), and mTRPC7 (33). An important feature of the cation current in A7r5 cells that supports the involvement of TRPCs and provides a pointer to the TRPC isoforms that may be involved is its activation by the membrane-permeant DAG analog OAG. The effects of OAG on A7r5 cells seem to be direct and not mediated by subsequent activation of PKC. PKC-independent activation of TRP channels by application of DAG analogs is a characteristic feature of the TRPC3/6/7 subfamily of TRP channels (17, 33) not shared with the TRPC4/5 subfamily (39).

The fact that in the majority of cells tested AVP- and OAG-induced currents were not additive supports the notion that they are mediated by the same channels. Considering that both substances exert their effect at different sites of the signal transduction cascade leading to current activation (OAG presumably much more distally than AVP), it is not surprising that small additive current increases were seen in some experiments. Furthermore, the fact that only OAG applied after AVP but not vice versa could in rare cases (n = 2 of 11) substantially increase current levels supports the idea that current activation by OAG is more direct than activation by AVP. Hence, we conclude that the AVP-induced current does not consist of components other than those that can be elicited by the application of OAG.

The susceptibility of the cation currents in A7r5 cells to block by lanthanides also supports an involvement of the TRPC3/6/7 subfamily (11, 33) rather than the TRPC4/5 subfamily, for which La3+ has been shown to potentiate currents in two studies (39, 41) but not in another (34). Hence, similarities in the electrophysiological properties and the activation mechanism of recombinantly expressed TRPC3/6/7 and the AVP-induced currents in A7r5 smooth muscle cells strongly suggest that one or more of these TRP channel isoforms is likely to be a molecular component of the endogenous cation channel expressed in A7r5 smooth muscle cells.

Interestingly, the cation currents observed in A7r5 cells were reversibly enhanced by FFA, an inhibitor of most nonspecific cation channels that was recently shown to selectively increase currents mediated by mTRPC6 but to inhibit currents mediated by the other two members of the TRPC3/6/7 subfamily (18). This finding provides a pointer to the possible involvement of TRPC6 in agonist-induced cation currents in A7r5 cells.

The involvement of TRPC6 is also strongly supported by the molecular biological data provided in the present study. Northern hybridization analysis demonstrated that, of the structurally related isoforms TRPC3, -6, and -7 that respond to DAG, only mRNA coding for TRPC6 is expressed in A7r5 cells. In addition to TRPC6, TRPC1 mRNA was present, whereas mRNA for isoforms TRPC2, -4, and -5 was not detectable. By analogy with the transmembrane topology of voltage-gated Na+ and Ca2+ channels, which have four linked domains of six transmembrane segments, it is likely that TRPCs form homo- or heterotetramers. From the data on TRPC isoform expression, together with the activation of currents by OAG and the potentiating effect of FFA, it is likely that the AVP-activated, TRP-like cation channels in A7r5 cells are formed by homomers of TRPC6 or possibly heteromers of TRPC1 and TRPC6. To date, however, there is no evidence that heteromultimerization of TRPC1 and -6 can occur. Furthermore, the electrophysiological properties of the AVP-induced currents in A7r5 smooth muscle cells presented here are strikingly similar to those of currents observed in cells heterologously overexpressing TRPC6 alone, in which homomultimers are presumably formed. For other TRPC isoforms, TRPC1 and TRPC4/5 (41) or TRPC1 and TRPC3 (28), heteromultimers show markedly different current properties compared with homomultimers. On the other hand, a role for TRPC1 alone in cation channel formation in A7r5 cells is unlikely because the electrophysiological properties of TRPC1, i.e., its linear I-V relationship (28, 40, 49) and low single-channel conductance (49), as well as its store depletion-dependent activation mechanism (48, 49), are inconsistent with the properties of the nonselective cation currents in A7r5 cells described in this study.

Interestingly, the current observed in A7r5 smooth muscle cells exhibits a dual dependence on [Ca2+]o. The current is partially inhibited by [Ca2+]o in the physiological range, and the amplitude increases when [Ca2+]o is decreased. On the other hand, complete removal of external Ca2+ does not further potentiate the currents but rather leads to a decrease of the amplitude of inward currents. A similar complex dependence of agonist-evoked cation currents on [Ca2+]o has been reported for norepinephrine-evoked currents in rabbit portal vein smooth muscle cells (14, 18). For recombinant TRP channels, a potentiating effect of decreasing [Ca2+]o has been described for hTRPC1 (28, 40, 49) hTRPC3 (28), and mTRPC7 (33). In contrast, current responses in mTRPC4/5-expressing cells were shown to be increased when extracellular [Ca2+] was raised above physiological levels (34, 39). Likewise, a potentiation of currents mediated by recombinant mTRPC6 in Ca2+-containing versus Ca2+-free solutions was described recently (18).

Although we cannot provide a reliable direct demonstration that the cation channels that mediate the AVP response are permeable to Ca2+, because of the inhibition of cation currents by Ca2+ and other divalent cations, similarities in the properties of the AVP-induced Ca2+ signal and the cation currents suggest that they are mediated by the same channel. Both responses are transient, and they have similar time courses. Previous studies showed that AVP-induced Ca2+ entry in A7r5 cells has two components, a capacitative component and a noncapacitative component (4, 5). The current observed in the present study most closely resembles the latter component, both in its insensitivity to store depletion and in its sensitivity to Gd3+. Like noncapacitative Ca2+ entry, the cation current is inhibited by 100 µM Gd3+ but not by 1 µM Gd3+, which completely and irreversibly inhibits the capacitative component (4). Like Iwasawa et al. (20), we could not detect any additional current component that would correspond to capacitative Ca2+ entry in our A7r5 cells under any of the experimental conditions used. Because the identification of a store-operated current component was not the main focus of our study, we did not try experimental protocols commonly used to reveal store-operated currents like ICRAC. We cannot, therefore, rule out the existence of an additional store-operated current. In our hands, the nonselective cation current was activated by OAG, but we could not demonstrate current activation by AA. This contrasts with the results of Broad et al. (4), who showed that the noncapacitative Ca2+ entry pathway was activated by AA.

The activation of nonselective cation currents by AVP in A7r5 smooth muscle cells has been described in a number of previous studies (19, 20, 25, 32, 43). In all but one early study by Nakajima et al. (32), the currents presented show linear I-V relationships. In this early study by Nakajima et al. (32), however, the reported I-V relation of the AVP-induced current was very similar to that described in the present study. Under the conditions used in our study, we never observed AVP-induced currents with linear I-V relations. Furthermore, one study (19) suggests that several types of nonselective cation channels are activated in A7r5 cells in response to endothelin-1. From our experiments, we have no evidence for multiple components of the cation currents in A7r5 cells. The reasons for the described differences are unclear. Interestingly, other properties of the current or Ca2+ entry pathway, including PLC-dependent but store depletion-independent activation (25, 32), single-channel conductance (32), inhibition by di- and trivalent cations and SKF-96365 (19, 25, 32), and negative feedback of PKC activation (4, 21), are essentially consistent with our findings.

The AVP-induced cation currents in A7r5 cells described in this study show a striking similarity to receptor-activated cation currents in smooth muscle cells from the rabbit portal vein (4, 14-16, 21). These similarities include, for example, I-V relation shape, single-channel conductance, dual dependence on [Ca2+]o and [Sr2+]o, and PKC-independent activation by OAG. During the preparation of this manuscript, Inoue et al. (18) provided convincing evidence that TRPC6 shows similar properties to, and is an important component of, norepinephrine-stimulated cation channels in smooth muscle cells. In contrast to A7r5 cells, portal vein cells, however, also show significant levels of mRNA for TRPC3 and TRPC4. Given these findings and our own results, it can be concluded that TRPC6 plays an important role in agonist-stimulated nonselective cation currents both in vascular smooth muscle cells from portal vein and in muscle cells derived from the embryonic aorta. It will be interesting to determine whether an involvement of TRPC6 in agonist-stimulated Ca2+ influx is a general feature of vascular smooth muscle cells or is restricted to certain vessel types.


    ACKNOWLEDGEMENTS

We thank Inge Reinsch and Sabina Naranjo Kuchta for excellent technical assistance and Dr. Torsten Schöneberg and Dr. Angela Schulz for helpful comments on Northern hybridization. We are grateful to Dr. Stephan Klug for providing the rat tissues.


    FOOTNOTES

S. Jung is a scholar of the Studienstiftung des deutschen Volkes e.V. This work was supported by grants from the Deutsche Forschungsgemeinschaft (FG341) and Fonds der Chemischen Industrie.

Address for reprint requests and other correspondence: T. Plant, Institut für Pharmakologie, Freie Universität Berlin, Thielallee 69-73, 14195 Berlin, Germany (E-mail: tplant{at}zedat.fu-berlin.de).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

First published November 14, 2001; 10.1152/ajpcell.00283.2001

Received 22 June 2001; accepted in final form 12 October 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Balzer, M, Lintschinger B, and Groschner K. Evidence for a role of Trp proteins in the oxidative stress-induced membrane conductances of porcine aortic endothelial cells. Cardiovasc Res 42: 543-549, 1999.

2.   Barritt, GJ. Receptor-activated Ca2+ inflow in animal cells: a variety of pathways tailored to meet different intracellular Ca2+ signalling requirements. Biochem J 337: 153-169, 1999.

3.   Berridge, MJ. Inositol trisphosphate and calcium signalling. Nature 361: 315-325, 1993.

4.   Broad, LM, Cannon TR, and Taylor CW. A non-capacitative pathway activated by arachidonic acid is the major Ca2+ entry mechanism in rat A7r5 smooth muscle cells stimulated with low concentrations of vasopressin. J Physiol (Lond) 517: 121-134, 1999.

5.   Byron, K, and Taylor CW. Vasopressin stimulation of Ca2+ mobilization, two bivalent cation entry pathways and Ca2+ efflux in A7r5 rat smooth muscle cells. J Physiol (Lond) 485: 455-468, 1995.

6.   Fasolato, C, Innocenti B, and Pozzan T. Receptor-activated Ca2+ influx: how many mechanisms for how many channels? Trends Pharmacol Sci 15: 77-83, 1994.

7.   Fasolato, C, and Nilius B. Store depletion triggers the calcium release-activated calcium current (ICRAC) in macrovascular endothelial cells: a comparison with Jurkat and embryonic kidney cell lines. Pflügers Arch 436: 69-74, 1998.

8.   Gardner, JD, and Benoit JN. Effects of capacitative calcium entry on agonist-induced calcium transients in A7r5 vascular smooth muscle cells. J Biomed Sci 7: 304-310, 2000.

9.   Golovina, VA, Platoshyn O, Bailey CL, Wang J, Limsuwan A, Sweeney M, Rubin LJ, and Yuan JX. Upregulated TRP and enhanced capacitative Ca2+ entry in human pulmonary artery myocytes during proliferation. Am J Physiol Heart Circ Physiol 280: H746-H755, 2001.

10.   Groschner, K, Hingel S, Lintschinger B, Balzer M, Romanin C, Zhu X, and Schreibmayer W. Trp proteins form store-operated channels in human vascular endothelial cells. FEBS Lett 437: 101-106, 1998.

11.   Halaszovich, CR, Zitt C, Jüngling E, and Lückhoff A. Inhibition of TRP3 channels by lanthanides. Block from the cytosolic side of the plasma membrane. J Biol Chem 275: 37423-37428, 2000.

12.   Hamill, OP, Marty A, Neher E, Sakmann B, and Sigworth FJ. Improved patch-clamp techniques for high-resolution current recording from cells and cell-free membrane patches. Pflügers Arch 391: 85-100, 1981.

13.   Harteneck, C, Plant TD, and Schultz G. From worm to man: three subfamilies of TRP channels. Trends Neurosci 23: 159-166, 2000.

14.   Helliwell, RM, and Large WA. Dual effect of external Ca2+ on noradrenaline-activated cation current in rabbit portal vein smooth muscle cells. J Physiol (Lond) 492: 75-88, 1996.

15.   Helliwell, RM, and Large WA. alpha 1-Adrenoceptor activation of a non-selective cation current in rabbit portal vein by 1,2-diacyl-sn-glycerol. J Physiol (Lond) 499: 417-428, 1997.

16.   Helliwell, RM, and Large WA. Facilitatory effect of Ca2+ on the noradrenaline-evoked cation current in rabbit portal vein smooth muscle cells. J Physiol (Lond) 512: 731-741, 1998.

17.   Hofmann, T, Obukhov AG, Schaefer M, Harteneck C, Gudermann T, and Schultz G. Direct activation of human TRPC6 and TRPC3 channels by diacylglycerol. Nature 397: 259-263, 1999.

18.   Inoue, R, Okada T, Onoue H, Hara Y, Shimizu S, Naitoh S, Ito Y, and Mori Y. The transient receptor potential protein homologue TRP6 is the essential component of vascular alpha 1-adrenoceptor-activated Ca2+-permeable cation channel. Circ Res 88: 325-332, 2001.

19.   Iwamuro, Y, Miwa S, Minowa T, Enoki T, Zhang XF, Ishikawa M, Hashimoto N, and Masaki T. Activation of two types of Ca2+-permeable nonselective cation channel by endothelin-1 in A7r5 cells. Br J Pharmacol 124: 1541-1549, 1998.

20.   Iwasawa, K, Nakajima T, Hazama H, Goto A, Shin WS, Toyo-oka T, and Omata M. Effects of extracellular pH on receptor-mediated Ca2+ influx in A7r5 rat smooth muscle cells: involvement of two different types of channel. J Physiol (Lond) 503: 237-251, 1997.

21.   Kaplan-Albuquerque, N, and Di Salvo J. Protein kinase C: modulation of vasopressin-induced calcium influx and release in A7r5 vascular smooth muscle cells. Arch Biochem Biophys 359: 209-214, 1998.

22.   Kiselyov, K, Mignery GA, Zhu MX, and Muallem S. The N-terminal domain of the IP3 receptor gates store-operated hTrp3 channels. Mol Cell 4: 423-429, 1999.

23.   Kiselyov, K, Xu X, Mozhayeva G, Kuo T, Pessah I, Mignery G, Zhu X, Birnbaumer L, and Muallem S. Functional interaction between InsP3 receptors and store-operated Htrp3 channels. Nature 396: 478-482, 1998.

24.   Kiselyov, KI, Shin DM, Wang Y, Pessah IN, Allen PD, and Muallem S. Gating of store-operated channels by conformational coupling to ryanodine receptors. Mol Cell 6: 421-431, 2000.

25.   Krautwurst, D, Degtiar VE, Schultz G, and Hescheler J. The isoquinoline derivative LOE 908 selectively blocks vasopressin-activated nonselective cation currents in A7r5 aortic smooth muscle cells. Naunyn Schmiedebergs Arch Pharmacol 349: 301-307, 1994.

26.   Li, HS, Xu XZ, and Montell C. Activation of a TRPC3-dependent cation current through the neurotrophin BDNF. Neuron 24: 261-273, 1999.

27.   Liman, ER, Corey DP, and Dulac C. TRP2: a candidate transduction channel for mammalian pheromone sensory signaling. Proc Natl Acad Sci USA 96: 5791-5796, 1999.

28.   Lintschinger, B, Balzer-Geldsetzer M, Baskaran T, Graier WF, Romanin C, Zhu MX, and Groschner K. Coassembly of Trp1 and Trp3 proteins generates diacylglycerol- and Ca2+-sensitive cation channels. J Biol Chem 275: 27799-27805, 2000.

29.   Liu, X, Wang W, Singh BB, Lockwich T, Jadlowiec J, O'Connell B, Wellner R, Zhu MX, and Ambudkar IS. Trp1, a candidate protein for the store-operated Ca2+ influx mechanism in salivary gland cells. J Biol Chem 275: 3403-3411, 2000.

30.   McKay, RR, Szymeczek-Seay CL, Lievremont JP, Bird GS, Zitt C, Jüngling E, Lückhoff A, and Putney JW. Cloning and expression of the human transient receptor potential 4 (TRP4) gene: localization and functional expression of human TRP4 and TRP3. Biochem J 351: 735-746, 2000.

31.   Moore, TM, Brough GH, Babal P, Kelly JJ, Li M, and Stevens T. Store-operated calcium entry promotes shape change in pulmonary endothelial cells expressing Trp1. Am J Physiol Lung Cell Mol Physiol 275: L574-L582, 1998.

32.   Nakajima, T, Hazama H, Hamada E, Wu SN, Igarashi K, Yamashita T, Seyama Y, Omata M, and Kurachi Y. Endothelin-1 and vasopressin activate Ca2+-permeable non-selective cation channels in aortic smooth muscle cells: mechanism of receptor-mediated Ca2+ influx. J Mol Cell Cardiol 28: 707-722, 1996.

33.   Okada, T, Inoue R, Yamazaki K, Maeda A, Kurosaki T, Yamakuni T, Tanaka I, Shimizu S, Ikenaka K, Imoto K, and Mori Y. Molecular and functional characterization of a novel mouse transient receptor potential protein homologue TRP7. Ca2+-permeable cation channel that is constitutively activated and enhanced by stimulation of G protein-coupled receptor. J Biol Chem 274: 27359-27370, 1999.

34.   Okada, T, Shimizu S, Wakamori M, Maeda A, Kurosaki T, Takada N, Imoto K, and Mori Y. Molecular cloning and functional characterization of a novel receptor-activated TRP Ca2+ channel from mouse brain. J Biol Chem 273: 10279-10287, 1998.

35.   Parekh, AB, and Penner R. Store depletion and calcium influx. Physiol Rev 77: 901-930, 1997.

36.   Philipp, S, Hambrecht J, Braslavski L, Schroth G, Freichel M, Murakami M, Cavalié A, and Flockerzi V. A novel capacitative calcium entry channel expressed in excitable cells. EMBO J 17: 4274-4282, 1998.

37.   Philipp, S, Trost C, Warnat J, Rautmann J, Himmerkus N, Schroth G, Kretz O, Nastainczyk W, Cavalié A, Hoth M, and Flockerzi V. TRP4 (CCE1) protein is part of native calcium release-activated Ca2+-like channels in adrenal cells. J Biol Chem 275: 23965-23972, 2000.

38.   Putney, JW, Jr. Capacitative Calcium Entry. Georgetown, TX: Landes, 1997.

39.   Schaefer, M, Plant TD, Obukhov AG, Hofmann T, Gudermann T, and Schultz G. Receptor-mediated regulation of the nonselective cation channels TRPC4 and TRPC5. J Biol Chem 275: 17517-17526, 2000.

40.   Sinkins, WG, Estacion M, and Schilling WP. Functional expression of TrpC1: a human homologue of the Drosophila Trp channel. Biochem J 331: 331-339, 1998.

41.   Strübing, C, Krapivinsky G, Krapivinsky L, and Clapham DE. TRPC1 and TRPC5 form a novel cation channel in mammalian brain. Neuron 29: 645-655, 2001.

42.   Vannier, B, Peyton M, Boulay G, Brown D, Qin N, Jiang M, Zhu X, and Birnbaumer L. Mouse trp2, the homologue of the human trpc2 pseudogene, encodes mTrp2, a store depletion-activated capacitative Ca2+ entry channel. Proc Natl Acad Sci USA 96: 2060-2064, 1999.

43.   Van Renterghem, C, Romey G, and Lazdunski M. Vasopressin modulates the spontaneous electrical activity in aortic cells (line A7r5) by acting on three different types of ionic channels. Proc Natl Acad Sci USA 85: 9365-9369, 1988.

44.   Van Rossum, DB, Patterson RL, Ma HT, and Gill DL. Ca2+ entry mediated by store depletion, S-nitrosylation, and TRP3 channels. Comparison of coupling and function. J Biol Chem 275: 28562-28568, 2000.

45.   Warnat, J, Philipp S, Zimmer S, Flockerzi V, and Cavalié A. Phenotype of a recombinant store-operated channel: highly selective permeation of Ca2+. J Physiol (Lond) 518: 631-638, 1999.

46.   Wu, X, Babnigg G, and Villereal ML. Functional significance of human trp1 and trp3 in store-operated Ca2+ entry in HEK-293 cells. Am J Physiol Cell Physiol 278: C526-C536, 2000.

47.   Xu, SZ, and Beech DJ. TrpC1 is a membrane-spanning subunit of store-operated Ca2+ channels in native vascular smooth muscle cells. Circ Res 88: 84-87, 2001.

48.   Zhu, X, Jiang M, Peyton M, Boulay G, Hurst R, Stefani E, and Birnbaumer L. trp, A novel mammalian gene family essential for agonist-activated capacitative Ca2+ entry. Cell 85: 661-671, 1996.

49.   Zitt, C, Zobel A, Obukhov AG, Harteneck C, Kalkbrenner F, Lückhoff A, and Schultz G. Cloning and functional expression of a human Ca2+-permeable cation channel activated by calcium store depletion. Neuron 16: 1189-1196, 1996.


Am J Physiol Cell Physiol 282(2):C347-C359
0363-6143/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
Circ. Res.Home page
R. Inoue, L. J. Jensen, Z. Jian, J. Shi, L. Hai, A. I. Lurie, F. H. Henriksen, M. Salomonsson, H. Morita, Y. Kawarabayashi, et al.
Synergistic Activation of Vascular TRPC6 Channel by Receptor and Mechanical Stimulation via Phospholipase C/Diacylglycerol and Phospholipase A2/{omega}-Hydroxylase/20-HETE Pathways
Circ. Res., June 19, 2009; 104(12): 1399 - 1409.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
J. Abramowitz and L. Birnbaumer
Physiology and pathophysiology of canonical transient receptor potential channels
FASEB J, February 1, 2009; 23(2): 297 - 328.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
K. Smedlund and G. Vazquez
Involvement of Native TRPC3 Proteins in ATP-Dependent Expression of VCAM-1 and Monocyte Adherence in Coronary Artery Endothelial Cells
Arterioscler Thromb Vasc Biol, November 1, 2008; 28(11): 2049 - 2055.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
N. Da Silva, C. E. Herron, K. Stevens, C. A. B. Jollimore, S. Barnes, and M. E. M. Kelly
Metabotropic Receptor-Activated Calcium Increases and Store-Operated Calcium Influx in Mouse Muller Cells
Invest. Ophthalmol. Vis. Sci., July 1, 2008; 49(7): 3065 - 3073.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. K. Fellner and W. J. Arendshorst
Angiotensin II-stimulated Ca2+ entry mechanisms in afferent arterioles: role of transient receptor potential canonical channels and reverse Na+/Ca2+ exchange
Am J Physiol Renal Physiol, January 1, 2008; 294(1): F212 - F219.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. J. Sandoval, J. P. Riquelme, M. D. Carretta, J. L. Hancke, M. A. Hidalgo, and R. A. Burgos
Store-operated calcium entry mediates intracellular alkalinization, ERK1/2, and Akt/PKB phosphorylation in bovine neutrophils
J. Leukoc. Biol., November 1, 2007; 82(5): 1266 - 1277.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
K. K. Henderson and K. L. Byron
Vasopressin-induced vasoconstriction: two concentration-dependent signaling pathways
J Appl Physiol, April 1, 2007; 102(4): 1402 - 1409.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
L. I. Brueggemann, C. J. Moran, J. A. Barakat, J. Z. Yeh, L. L. Cribbs, and K. L. Byron
Vasopressin stimulates action potential firing by protein kinase C-dependent inhibition of KCNQ5 in A7r5 rat aortic smooth muscle cells
Am J Physiol Heart Circ Physiol, March 1, 2007; 292(3): H1352 - H1363.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
J. Nasman, G. Bart, K. Larsson, L. Louhivuori, H. Peltonen, and K. E. O. Akerman
The Orexin OX1 Receptor Regulates Ca2+ Entry via Diacylglycerol-Activated Channels in Differentiated Neuroblastoma Cells.
J. Neurosci., October 18, 2006; 26(42): 10658 - 10666.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
R. N. Carter, G. Tolhurst, G. Walmsley, M. Vizuete-Forster, N. Miller, and M. P. Mahaut-Smith
Molecular and electrophysiological characterization of transient receptor potential ion channels in the primary murine megakaryocyte
J. Physiol., October 1, 2006; 576(1): 151 - 162.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
H.-W. Cheng, A.F. James, R.R. Foster, J.C. Hancox, and D.O. Bates
VEGF Activates Receptor-Operated Cation Channels in Human Microvascular Endothelial Cells
Arterioscler Thromb Vasc Biol, August 1, 2006; 26(8): 1768 - 1776.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
R. Inoue, L. J. Jensen, J. Shi, H. Morita, M. Nishida, A. Honda, and Y. Ito
Transient Receptor Potential Channels in Cardiovascular Function and Disease
Circ. Res., July 21, 2006; 99(2): 119 - 131.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
X.-R. Yang, M.-J. Lin, L. S. McIntosh, and J. S. K. Sham
Functional expression of transient receptor potential melastatin- and vanilloid-related channels in pulmonary arterial and aortic smooth muscle
Am J Physiol Lung Cell Mol Physiol, June 1, 2006; 290(6): L1267 - L1276.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
M. Estacion, W. G. Sinkins, S. W. Jones, M. A. B. Applegate, and W. P. Schilling
Human TRPC6 expressed in HEK 293 cells forms non-selective cation channels with limited Ca2+ permeability
J. Physiol., April 15, 2006; 572(2): 359 - 377.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
M. T. Kim, B. J. Kim, J. H. Lee, S. C. Kwon, D. S. Yeon, D. K. Yang, I. So, and K. W. Kim
Involvement of calmodulin and myosin light chain kinase in activation of mTRPC5 expressed in HEK cells
Am J Physiol Cell Physiol, April 1, 2006; 290(4): C1031 - C1040.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
B. Kumar, K. Dreja, S.S. Shah, A. Cheong, S.-Z. Xu, P. Sukumar, J. Naylor, A. Forte, M. Cipollaro, D. McHugh, et al.
Upregulated TRPC1 Channel in Vascular Injury In Vivo and Its Role in Human Neointimal Hyperplasia
Circ. Res., March 3, 2006; 98(4): 557 - 563.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Dietrich, M. Mederos y Schnitzler, M. Gollasch, V. Gross, U. Storch, G. Dubrovska, M. Obst, E. Yildirim, B. Salanova, H. Kalwa, et al.
Increased Vascular Smooth Muscle Contractility in TRPC6-/- Mice
Mol. Cell. Biol., August 15, 2005; 25(16): 6980 - 6989.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S. A. Reading, S. Earley, B. J. Waldron, D. G. Welsh, and J. E. Brayden
TRPC3 mediates pyrimidine receptor-induced depolarization of cerebral arteries
Am J Physiol Heart Circ Physiol, May 1, 2005; 288(5): H2055 - H2061.
[Abstract] [Full Text] [PDF]


Home page
JGPHome page
K.-h. Cheung, G. P.H. Leung, M. C.T. Leung, W. W.C. Shum, W.-l. Zhou, and P. Y.D. Wong
Cell-cell Interaction Underlies Formation of Fluid in the Male Reproductive Tract of the Rat
J. Gen. Physiol., April 25, 2005; 125(5): 443 - 454.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
A. B. Parekh and J. W. Putney Jr.
Store-Operated Calcium Channels
Physiol Rev, April 1, 2005; 85(2): 757 - 810.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
E Rousseau, M. Cloutier, C. Morin, and S. Proteau
Capsazepine, a vanilloid antagonist, abolishes tonic responses induced by 20-HETE on guinea pig airway smooth muscle
Am J Physiol Lung Cell Mol Physiol, March 1, 2005; 288(3): L460 - L470.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
J. Shi, E. Mori, Y. Mori, M. Mori, J. Li, Y. Ito, and R. Inoue
Multiple regulation by calcium of murine homologues of transient receptor potential proteins TRPC6 and TRPC7 expressed in HEK293 cells
J. Physiol., December 1, 2004; 561(2): 415 - 432.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. Zhang, C. V. Remillard, I. Fantozzi, and J. X.-J. Yuan
ATP-induced mitogenesis is mediated by cyclic AMP response element-binding protein-enhanced TRPC4 expression and activity in human pulmonary artery smooth muscle cells
Am J Physiol Cell Physiol, November 1, 2004; 287(5): C1192 - C1201.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
F. Mercier, C. Morin, M. Cloutier, S. Proteau, J. Rokach, W. S. Powell, and E. Rousseau
5-Oxo-ETE regulates tone of guinea pig airway smooth muscle via activation of Ca2+ pools and Rho-kinase pathway
Am J Physiol Lung Cell Mol Physiol, October 1, 2004; 287(4): L631 - L640.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
D. J. Beech, K. Muraki, and R. Flemming
Non-selective cationic channels of smooth muscle and the mammalian homologues of Drosophila TRP
J. Physiol., September 15, 2004; 559(3): 685 - 706.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M.-J. Lin, G. P.H. Leung, W.-M. Zhang, X.-R. Yang, K.-P. Yip, C.-M. Tse, and J. S.K. Sham
Chronic Hypoxia-Induced Upregulation of Store-Operated and Receptor-Operated Ca2+ Channels in Pulmonary Arterial Smooth Muscle Cells: A Novel Mechanism of Hypoxic Pulmonary Hypertension
Circ. Res., September 3, 2004; 95(5): 496 - 505.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
J. W. Putney Jr.
Store-Operated Calcium Channels: How Do We Measure Them, and Why Do We Care?
Sci. Signal., July 27, 2004; 2004(243): pe37 - pe37.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
L. G. Babich, C.-Y. Ku, H. W.J. Young, H. Huang, M. R. Blackburn, and B. M. Sanborn
Expression of Capacitative Calcium TrpC Proteins in Rat MyometriumDuring Pregnancy
Biol Reprod, April 1, 2004; 70(4): 919 - 924.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
T. M. Pocock, R. R. Foster, and D. O. Bates
Evidence of a role for TRPC channels in VEGF-mediated increased vascular permeability in vivo
Am J Physiol Heart Circ Physiol, March 1, 2004; 286(3): H1015 - H1026.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Dietrich, M. Mederos y Schnitzler, J. Emmel, H. Kalwa, T. Hofmann, and T. Gudermann
N-Linked Protein Glycosylation Is a Major Determinant for Basal TRPC3 and TRPC6 Channel Activity
J. Biol. Chem., November 28, 2003; 278(48): 47842 - 47852.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
Y. V. Bobkov and B. W. Ache
Calcium Sensitivity of a Sodium-Activated Nonselective Cation Channel in Lobster Olfactory Receptor Neurons
J Neurophysiol, November 1, 2003; 90(5): 2928 - 2940.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. Cloutier, S. Campbell, N. Basora, S. Proteau, M. D. Payet, and E. Rousseau
20-HETE inotropic effects involve the activation of a nonselective cationic current in airway smooth muscle
Am J Physiol Lung Cell Mol Physiol, September 1, 2003; 285(3): L560 - L568.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. Poteser, I. Wakabayashi, C. Rosker, M. Teubl, R. Schindl, N. M. Soldatov, C. Romanin, and K. Groschner
Crosstalk Between Voltage-Independent Ca2+ Channels and L-Type Ca2+ Channels in A7r5 Vascular Smooth Muscle Cells at Elevated Intracellular pH: Evidence for Functional Coupling Between L-Type Ca2+ Channels and a 2-APB-Sensitive Cation Channel
Circ. Res., May 2, 2003; 92(8): 888 - 896.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
Y. M. Lee, B. J. Kim, H. J. Kim, D. K. Yang, M. H. Zhu, K. P. Lee, I. So, and K. W. Kim
TRPC5 as a candidate for the nonselective cation channel activated by muscarinic stimulation in murine stomach
Am J Physiol Gastrointest Liver Physiol, April 1, 2003; 284(4): G604 - G616.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
O. Mignen, J. L. Thompson, and T. J. Shuttleworth
Ca2+ Selectivity and Fatty Acid Specificity of the Noncapacitative, Arachidonate-regulated Ca2+ (ARC) Channels
J. Biol. Chem., March 14, 2003; 278(12): 10174 - 10181.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
Y. Yu, M. Sweeney, S. Zhang, O. Platoshyn, J. Landsberg, A. Rothman, and J. X.-J. Yuan
PDGF stimulates pulmonary vascular smooth muscle cell proliferation by upregulating TRPC6 expression
Am J Physiol Cell Physiol, February 1, 2003; 284(2): C316 - C330.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/2/C347    most recent
00283.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (121)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jung, S.
Right arrow Articles by Plant, T. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jung, S.
Right arrow Articles by Plant, T. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online