Am J Physiol Cell Physiol Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 282: C172-C182, 2002. First published September 5, 2001; doi:10.1152/ajpcell.00048.2001
0363-6143/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/1/C172    most recent
00048.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (21)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McKaig, B. C.
Right arrow Articles by Mahida, Y. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McKaig, B. C.
Right arrow Articles by Mahida, Y. R.
Vol. 282, Issue 1, C172-C182, January 2002

Differential expression of TGF-beta isoforms by normal and inflammatory bowel disease intestinal myofibroblasts

B. C. McKaig1, K. Hughes1, P. J. Tighe2, and Y. R. Mahida1

Divisions of 1 Gastroenterology and 2 Immunology, University Hospital, Nottingham NG7 2UH, United Kingdom


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

First published September 5, 2001; 10.1152/ajpcell. 00048.2001.---Intestinal strictures are frequent in Crohn's disease but not ulcerative colitis. We investigated the expression of transforming growth factor (TGF)-beta isoforms by isolated and cultured primary human intestinal myofibroblasts and the responsiveness of these cells and intestinal epithelial cells to TGF-beta isoforms. Normal intestinal myofibroblasts released predominantly TGF-beta 3 and ulcerative colitis myofibroblasts expressed both TGF-beta 1 and TGF-beta 3, whereas in myofibroblast cultures from fibrotic Crohn's disease tissue, there was significantly lower expression of TGF-beta 3 but enhanced release of TGF-beta 2. These distinctive patterns of TGF-beta isoform release were sustained through several myofibroblast passages. Proliferation of Crohn's disease myofibroblasts was significantly greater than that of myofibroblasts derived from normal and ulcerative colitis tissue. In contrast to cells from normal and ulcerative colitis tissue, neutralization of the three TGF-beta isoforms did not affect the proliferation of Crohn's disease intestinal myofibroblasts. Studies on the effect of recombinant TGF-beta isoforms on epithelial restitution and proliferation suggest that TGF-beta 2 may be the least effective of the three isoforms in intestinal wound repair. In conclusion, the enhanced release of TGF-beta 2 but reduced expression of TGF-beta 3 by Crohn's disease intestinal myofibroblasts, together with their enhanced proliferative capacity, may lead to the development of intestinal strictures.

fibrosis; wound repair


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

THE CLINICAL COURSE of ulcerative colitis and Crohn's disease is marked by periodic relapses and remissions. During periods of active disease, the intestinal mucosa is infiltrated with acute and chronic inflammatory cells whose products result in destruction of extracellular matrix and epithelial ulceration (26). Resolution of inflammatory activity is associated with reparative processes that facilitate tissue remodeling, which restores normal intestinal mucosal architecture. Although repair processes in patients with ulcerative colitis are often effective in restoring a normal mucosal architecture during quiescence, stricture formation frequently occurs in patients with Crohn's disease (14, 28), usually associated with epithelial ulceration. The reasons for these disparate outcomes of tissue repair in Crohn's disease and ulcerative colitis remain unknown.

The processes of intestinal mucosal repair and regeneration involve a complex series of interactions between the surface epithelial cells and cell populations in the lamina propria. Repair of superficial ulcers in the normal intestinal mucosa occurs by a sequence of events, initially characterized by a process designated restitution, in which viable cells at the wound edge migrate to reestablish epithelial continuity and barrier function (12, 18, 30, 43). This process can be complete within minutes to hours, depending on the extent of epithelial injury. Cell proliferation over the subsequent 24-48 h allows the replacement of the lost epithelial cells. It is likely that epithelial restitution in vivo involves complex interaction between epithelial cells and the underlying lamina propria cells, which may occur via the basement membrane or pores within it (23, 26). Intestinal subepithelial myofibroblasts are present immediately subjacent to the basement membrane and close to the basal surface of epithelial cells (16, 17, 21, 42). In this position, the myofibroblasts may be capable of regulating a number of epithelial functions such as epithelial restitution (29), barrier function (3), and electrolyte transport (4, 15). Some of the myofibroblast-mediated effects on epithelial cells have been shown to be mediated by transforming growth factor (TGF)-beta (3, 29).

TGF-beta exists in three highly conserved isoforms, designated TGF-beta 1, TGF-beta 2, and TGF-beta 3. They are synthesized and secreted as biologically inactive propeptide molecules, which require processing to the mature 12-kDa polypeptide dimers (24). The three mature isoforms of TGF-beta bind to specific transmembrane receptors, TGF-beta receptor type I and type II, to target genes via the SMAD family of signal transducing proteins (25).

The majority of in vitro studies on the biological activities of TGF-beta have focused on TGF-beta 1 and have demonstrated its major role in intestinal epithelial restitution (9) and deposition of extracellular matrix proteins (5, 31). However, the three isoforms of TGF-beta are distributed in specific spatial and temporal patterns in the tissues of developing and adult mammals, implying distinct biological activities in vivo (40). Indeed, targeted disruption of each of the three TGF-beta isoform genes results in mice with distinct phenotypes (34, 36, 39). Studies investigating the repair of rat cutaneous wounds demonstrated that TGF-beta 1 and TGF-beta 2 promote excessive deposition of extracellular matrix proteins that lead to scarring (37). In contrast, exogenous application of TGF-beta 3 to these wounds reduced extracellular matrix protein deposition and scarring (38). Moreover, recent in vitro studies demonstrated distinct biological activities of the different isoforms of TGF-beta (20).

Myofibroblasts have been shown to be important in the repair and remodeling of many different types of tissue after injury and inflammation (8, 32). In addition to their effects on epithelial cells, normal intestinal myofibroblasts also have been shown to express a number of extracellular matrix proteins (21). In this study, we have assessed the production of TGF-beta isoforms by intestinal myofibroblasts isolated from patients with ulcerative colitis and Crohn's disease as well as control subjects. The biological activities of the individual TGF-beta isoforms on epithelial and myofibroblast proliferation and epithelial restitution also have been investigated.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Cell culture. Human normal, ulcerative colitis, and Crohn's disease myofibroblasts were isolated from colonic resection specimens. Normal colonic mucosal samples (n = 5) were obtained >5 cm from the tumor margin of specimens resected for carcinoma. Inflammatory bowel disease mucosal specimens were obtained from patients with active ulcerative colitis (n = 4) and fibrosed colonic Crohn's disease (n = 4). In addition, primary cultures of myofibroblasts were isolated from one patient with ulcerative colitis from both histologically normal (ascending colon) and histologically inflamed (sigmoid colon) areas of the colectomy specimen and from one patient with Crohn's disease from histologically normal colon and histologically fibrosed areas of the colonic resection specimen.

Myofibroblasts were isolated as previously described (21). In brief, the mucosal samples were completely denuded of epithelial cells (23) by three 30-min periods of incubation (at 37°C) in 1 mmol/l EDTA (Sigma). The deepithelialized mucosal samples were subsequently cultured (at 37°C in 5% CO2) in RPMI 1640 (GIBCO) containing 10% FCS (GIBCO). Cells in suspension were removed after every 24- to 72-h culture period, and the denuded tissue was maintained in culture for up to 6 wk.

Established colonies of myofibroblasts were cultured in DMEM (GIBCO) supplemented with 10% FCS, 1% nonessential amino acids (GIBCO), penicillin (100 U/ml), and streptomycin (0.1 mg/ml). Cells were passaged using 0.1% (wt/vol) trypsin-0.2% (vol/wt) EDTA in a 1:3 to 1:4 split ratio. Studies were carried out on myofibroblasts at passages 2-6. Studies were also performed using the same primary myofibroblast cultures at later passage.

Myofibroblast-conditioned medium (MFCM) for all samples was obtained from subconfluent monolayers of myofibroblasts (seeded in 24-well plates at 2 × 104/well) cultured in 0.1% FCS-DMEM for 24 h. Conditioned medium was centrifuged (2,000 rpm for 10 min), filtered (0.2 µm), and then stored at -70°C.

Protein concentration in the culture supernatant was assessed using the Bradford-Lowry assay (6), and equivalent MFCM protein concentrations were used in all comparative experiments.

Characterization of intestinal myofibroblasts. All isolated intestinal myofibroblasts were characterized with immunohistochemistry and transmission electron microscopy. Mouse monoclonal antibodies to alpha -smooth muscle actin (A2547), vimentin (V6630), and desmin (D1033) (all from Sigma; 1:20 dilution) were used.

Myofibroblasts were grown on glass coverslips and fixed with acetone before immunoperoxidase staining with the Vectastain ABC peroxidase kit. After incubation with the primary antibody diluted in blocking solution (PBS + 10% FCS) at 4°C for 14-18 h, the cells were further washed with PBS (3×) and incubated with biotinylated goat anti-mouse immunoglobulin (Ig)G at room temperature for 30 min. After three further washes in PBS, the coverslips were incubated with avidin-biotinylated horseradish peroxidase complex for 30 min. Peroxidase activity was developed with diaminobenzidine tetrahydrochloride, followed by nuclear counterstaining of all the cells present with hematoxylin and eosin (Sigma).

Western blot analysis. Myofibroblast monolayers were lysed in PBS by rapid freeze-thawing three times, and the lysates were separated by sodium dodecyl sulfate (SDS)-PAGE with 7.5% acrylamide gel (19) and transferred onto nitrocellulose membrane (Hybond-N; Amersham International). After incubation with tris(hydroxymethyl)aminomethane (Tris)-buffered saline containing Tween 20, immunostaining was performed with mouse monoclonal anti-alpha -smooth muscle actin antibody (A2547), biotinylated secondary anti-mouse antibody, and avidin-biotin-horseradish peroxidase complex and developed with diaminobenzidine tetrahydrochloride according to the manufacturer's instructions (Vectastain Elite ABC kit; Vector Laboratories).

TGF-beta bioassay. Because TGF-beta is secreted in precursor form, which requires processing to the bioactive mature form, it was critical that a bioassay be used to determine the bioactive form present in the supernatant samples. Therefore, the presence of bioactive TGF-beta in MFCM was assessed by a validated specific bioassay based on the ability of TGF-beta to inhibit the proliferation of the mink lung epithelial cell line Mv1Lu [European Collection of Animal Cell Cultures (ECACC); Porton Down, UK; Refs. 7, 22, 29, and 35].

Latent TGF-beta present in MFCM was activated by the addition of concentrated HCl to pH 2, and the medium was left to stand at room temperature for 60 min, followed by neutralization with NaOH (10 M) and HEPES (to a final concentration of 16 mmol/l).

Mv1Lu cells (in 0.2% FCS-DMEM) were seeded at 5 × 104 cells/well in 24-well cell culture plates (Nunc). Four hours after cells were seeded, acid-treated and untreated MFCM and standardized concentrations of recombinant (r)TGF-beta 1, -beta 2, or -beta 3 (R&D Systems) were added and incubated for 20 h at 37°C (95% O2-5% CO2). After 20 h, [3H]thymidine (1 µCi/well; Amersham International) was added, and incubation continued for an additional 4 h. The cells were then fixed with methanol-acetic acid (3:1), washed twice with 80% methanol, and lysed with 1 M NaOH. Uptake of [3H]thymidine was determined using an LKB (Wallac, Milton Keynes, UK) beta counter. From the standard curves obtained, the concentration of total and biologically active TGF-beta present in MFCM could be interpolated.

The contribution of each TGF-beta isoform to total bioactivity was assessed using an Mv1Lu bioassay performed in the presence or absence of TGF-beta isoform-specific monoclonal antibodies (1 µg/ml; R&D Systems). Before these experiments, the specificity of each TGF-beta isoform-specific antibody was investigated in our bioassay. rTGF-beta 1, -beta 2, or - beta 3 (50 pg/ml; R&D Systems) in the presence or absence of neutralizing antibodies to TGF-beta 1, - beta 2, or - beta 3 (1 µg/ml; R&D Systems) was incubated for 2 h at 37°C in 0.1% FCS-DMEM before application to Mv1Lu cells. Mouse IgG (1 µg/ml; Serotec) was used as control.

Myofibroblast proliferation assays. Subconfluent (50-70%) monolayers of human intestinal myofibroblasts isolated from normal, ulcerative colitis, and Crohn's disease resection specimens (as described in Cell culture) were incubated with 0.1% FCS-DMEM for 24 h. The medium was then replaced with either 0.1% or 1% FCS-DMEM, and the cells were incubated for a further 24 h. [3H]thymidine (1 µCi/well) was added for the final 4 h. Cells were subsequently fixed with methanol-acetic acid (3:1 vol:vol) at room temperature for 1 h, washed twice with 80% methanol, and lysed with 1 M NaOH. Uptake of [3H]thymidine was determined with an LKB (Wallac) beta counter. Myofibroblast proliferation assays were performed in the presence or absence of neutralizing antibodies to TGF-beta 1, -beta 2, or -beta 3 and also pan-specific TGF-beta antibody (1 µg/ml; R&D Systems).

Myofibroblast cell counts, viability, and protein assays. To corroborate the proliferation assays, subconfluent monolayers of human intestinal myofibroblasts were incubated with 0.1% FCS-DMEM for 24 h, incubated for 5 min with 0.1% trypsin (Sigma), and harvested by gentle pipetting. Cells were centrifuged at 800 rpm for 5 min and resuspended in equal volumes of 0.1% FCS-DMEM and 0.04% trypan blue and counted in a hemocytometer.

Myofibroblast cell protein was extracted by scraping the cells into 10 mM EDTA, 50 mM Tris · HCl (pH 7.4), 150 mM NaCl, 1% Triton X-100, and 0.1% SDS containing protease inhibitors (2 mM N-ethylmaleimide, 2 mg/ml aprotinin, 4 mg/ml pepstatin, 10 mg/ml leupeptin, and 2 mM phenylmethylsulfonyl fluoride). Extracts were cleared by centrifugation at 10,000 rpm for 15 min. Protein concentration was then determined with the Bradford-Lowry assay (6).

Epithelial cell wounding (restitution) assays. The nontransformed rat small intestinal epithelial cell line IEC-6 was obtained from the ECACC and studied at passages 26-31. The cells were maintained in DMEM supplemented with 5% FCS, 2 mM glutamine, 100 U/ml penicillin, 0.1 mg/ml streptomycin, and insulin (final concentration 4 µg/ml; Sigma).

Wound assays were performed in multiples of six, using a previously described method (27) with modification. Confluent monolayers of IEC-6 cells in six-well tissue culture plates (Nunc) were wounded under microscopic vision using a razor blade and a Gilson p2 pipette tip. Cells were washed three times with fresh medium (0.1% FCS-DMEM), and the wounded monolayers were further cultured in fresh medium (0.1% FCS-DMEM) in the presence or absence of human rTGF-beta 1, -beta 2, or -beta 3 (5 ng/ml; R&D Systems).

Migration of IEC-6 cells was assessed in a blinded fashion by the determination of the mean number of cells found across the wound border in a standardized wound area (9). Wound areas were standardized by taking photographs at 100-fold magnification with an inverted microscope (Olympus CK-2) and an Olympus OM-1 camera. Experiments were performed in quadruplicate.

Epithelial cell proliferation assays. IEC-6 cells were seeded onto 24-well plates (Nunc) at 5 × 104 cells/well and incubated in 0.1% FCS-DMEM. They were subsequently incubated for 24 h in 0.1% FCS-DMEM in the presence or absence of rTGF-beta 1, -beta 2, or -beta 3 (5 ng/ml; R&D). Cells were pulsed for the final 4 h of incubation with [3H]thymidine (1 µCi/well), and proliferation was determined as described in Myofibroblast proliferation assays.

RNA isolation and reverse transcription. RNA was isolated from myofibroblasts with an RNeasy RNA extraction kit (QIAGEN) and reverse-transcribed using a Ready-To-Go T-Primed first-strand reaction kit (Pharmacia Biotech, Brussels, Belgium). Reverse transcription to cDNA was performed in buffered solution containing dATP, dCTP, dGTP, dTTP, and FPLCpure murine reverse transcriptase, RNA guard (porcine), RNase/DNase-free BSA, and Not I-d(T)18 primer (5'-d[AACTGGAAGAATTCGCGGCCGCAGGAAT18]-3') according to the manufacturer's instructions.

Polymerase chain reaction. The following reaction mixture was added to 1 µl of the cDNA product: 5 µl of 5× enzyme buffer [300 mM Tris · HCl, 75 mM (NH4)2SO4, 2.5 mM Mg2+, pH 8.5; Invitrogen, San Diego, CA], 1 µl of 5 mM dNTPs (Pharmacia Biotech), 1 µl of 1 U/µl AmpliTaq Gold (Perkin Elmer, Foster City, CA), 0.25 µl of 0.1% Tween 20, and sterile water to a final reaction volume of 25 µl. The following primer pairs were used (to a final concentration of 5 µM): 1) 5'-CCAACTATTGCTTCAGCTCCA-3' (sense) and 5'- TTATGCTGGTTGTACAGGGC-3' (antisense) to amplify 196-bp TGF-beta 1 product, 2) 5'-CTGGAGCATGCCCGTATTTA-3' (sense) and 5'-TTTGGTCTTGCCACTTTTCC-3' (antisense) to amplify 233-bp human TGF-beta 2 product, 3) 5'-CCAATTACTGCTTCCGCAACT-3' (sense) and 5'-GCAGATGCTTCAGGGTTCAG-3' (antisense) to amplify 211-bp human TGF-beta 3 product, 4) 5'-TACAGTGTTTCTGCCACCTCTGT-3' (sense) and 5'-CCTGTTTTTGAAGATGGTGCACA-3' (antisense) to amplify 177-bp human TGF-beta receptor I product, 5) 5'-CACTGTCCACTTGTGACAACC-3' (sense) and 5'-CGGTCGTCCTCCAGGATGATGG-3' (antisense) to amplify a 503-bp TGF-beta receptor II product, and 6) 5'-GACCAGTCAACAGGGGACAT-3' (sense) and 5'-AGGTTTCTACCAGTTCCAGC-3' (antisense) to amplify a 160-bp constitutive hypoxanthine phosphatidyl ribosyltransferase (HPRT) product.

Amplification was performed with a Progene thermocycler (Techne). PCR commenced with "hot start" at 94°C for 10 min followed by 35 cycles consisting of denaturation at 94°C for 60 s, annealing at 54°C for 60 s, extension at 72°C for 90 s, and completion at 72°C for 20 min. For amplification of TGF-beta receptor types I and II and HPRT, annealing was at 59°C for 60 s and extension at 72°C for 120 s.

PCR products were analyzed by adding 3 µl of gel loading buffer (Sigma) to 6 µl of PCR product, electrophoresed on a 1% agarose gel, and stained with ethidium bromide (Sigma). The specificity of RT-PCR was confirmed by DNA sequence analysis of the PCR products.

Statistical analysis. Results are expressed as means ± SE. Statistical analyses were performed using one-way ANOVA and Student's t-test; P values <0.05 were taken as statistically significant.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Characterization of intestinal myofibroblasts. Immunohistochemical studies of normal, ulcerative colitis, and Crohn's disease intestinal myofibroblasts showed typical myofibroblast features in that all cells expressed alpha -smooth muscle actin and vimentin and were weakly positive for desmin (Fig. 1). There did not appear to be any differences in the immunohistochemical expression of alpha -smooth muscle actin, vimentin, or desmin when normal, ulcerative colitis, and Crohn's disease myofibroblasts were directly compared. Western blot analysis, although confirming the expression of alpha -smooth muscle actin (Fig. 2), raises the possibility of a slight reduction in the expression of this protein by Crohn's disease intestinal myofibroblasts compared with those isolated from normal mucosal samples. Transmission electron micrographs (Fig. 3) showed no ultrastructural differences between the normal and inflammatory bowel disease myofibroblasts, with all cultures displaying longitudinally arranged bundles of microfilament, well-developed rough endoplasmic reticulum, and intercellular gap junctions, characteristic ultrastructural features of intestinal myofibroblasts (21, 32). The cultures obtained were pure myofibroblast monolayers, with no evidence of any contaminating lamina propria or epithelial cells.


View larger version (127K):
[in this window]
[in a new window]
 
Fig. 1.   Normal (A), ulcerative colitis (UC; B), and Crohn's disease (CD; C) intestinal myofibroblasts express alpha -smooth muscle actin and vimentin. Immunohistochemical staining of normal, UC, and CD intestinal myofibroblasts demonstrated prominent expression of alpha -smooth muscle actin (alpha -SMA) and vimentin but weaker staining with desmin, characteristic features of intestinal myofibroblasts. There were no significant differences in the pattern of antibody staining among normal, UC, and CD myofibroblasts.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 2.   Expression of alpha -SMA in lysates of normal (lanes 1 and 2) and CD (lanes 3 and 4) intestinal myofibroblasts (single cultures). Western blot analysis was performed after electrophoresis of 17 (lane 1), 34 (lane 2), 12 (lane 3), and 24 (lane 4) µg/lane of myofibroblast protein lysates.



View larger version (114K):
[in this window]
[in a new window]
 
Fig. 3.   Transmission electron micrographs of isolated and cultured CD intestinal myofibroblasts. Characteristic features shown include longitudinally arranged bundles of microfilament (arrows) and rough endoplasmic reticulum (asterisks). B is at higher magnification than A.

Normal, ulcerative colitis, and Crohn's disease intestinal myofibroblasts all maintained their immunohistochemical characteristics despite prolonged culture and passage (to at least passage 10) or prolonged culture in 0.1% FCS-DMEM.

Myofibroblast TGF-beta isoform mRNA expression. Isolated myofibroblast cultures from normal, ulcerative colitis, and Crohn's disease tissues were assessed for the expression of TGF-beta 1, -beta 2, and -beta 3 mRNA. All the myofibroblast cultures from the three different types of tissue expressed mRNA transcripts for all three human isoforms of TGF-beta (Fig. 4). The identity of PCR products was confirmed by DNA sequence analysis (not shown). Although the RT-PCR studies suggest that there may be increased expression of TGF-beta 1 transcripts in all of the myofibroblast cultures, quantification of TGF-beta isoform mRNA was not performed because there is no direct relationship between expression of transcripts and TGF-beta isoform bioactivity. The latter, which is predominantly controlled at the posttranslational level (24), was studied in detail.


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 4.   Myofibroblasts derived from normal, UC, and CD tissue express mRNA transcripts for transforming growth factor (TGF)-beta 1, -beta 2, and -beta 3. RNA was isolated from confluent monolayers of cells and reverse transcribed. Relevant transcripts were amplified by PCR using designed primers and electrophoresed on a 1% agarose gel. DNA 100-bp markers are shown in the left lane. Specificity of TGF-beta PCR products was determined by DNA sequence analysis.

Expression of TGF-beta bioactivity. TGF-beta is secreted as an inactive propeptide, which can be processed to the mature form by acid treatment (24). Studies on acid-treated (followed by neutralization) and untreated MFCM showed that most of the TGF-beta in conditioned medium of normal, ulcerative colitis, and Crohn's disease myofibroblasts was in the biologically active form (Fig. 5).


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 5.   Normal, UC, and CD myofibroblasts secrete predominantly bioactive TGF-beta . Myofibroblast-conditioned medium (MFCM) was obtained after 24-h culture of monolayers of myofibroblasts, and the presence of bioactive TGF-beta was determined with Mv1Lu bioassay in both acid-treated and untreated samples. TGF-beta was present in MFCM collected from normal, UC, and CD myofibroblasts predominantly in the bioactive form. There was no significant difference in the total TGF-beta bioactivity released by normal, UC, and CD intestinal myofibroblasts (n = 4 experiments).

These initial studies provided an estimate of the aggregate effects in the Mv1Lu bioassay of all three isoforms of TGF-beta . To determine the relative contributions of the individual isoforms, the effect of selective blockade using isoform-specific antibodies was investigated. Before such studies, the specificity of the antibodies used was demonstrated by abrogation of the bioactivity of rTGF-beta 1, -beta 2, and -beta 3 only by the corresponding isoform-specific antibody (Fig. 6). No effect was seen when mouse IgG was used as a nonspecific control (data not shown).


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 6.   TGF-beta 1, -beta 2, and -beta 3 isoform monoclonal antibody specificity. After addition of isoform-specific neutralizing antibody, there is selective abrogation of TGF-beta bioactivity due to the corresponding recombinant (r) protein. No cross-reactivity was observed between the antibodies (n = 3 experiments).

After incubation of the isoform-specific antibodies with conditioned medium collected from early passages (2-4) of isolated and cultured intestinal myofibroblasts, the concentration of each TGF-beta isoform was deduced. The results shown in Fig. 7 represent the TGF-beta bioactivity attributable to each TGF-beta isoform in normal, ulcerative, and Crohn's disease MFCM. Normal myofibroblasts secreted predominantly TGF-beta 3 (396.25 ± 146.92 pg/ml) but much less TGF-beta 1 (77.75 ± 59.7 pg/ml; P < 0.01 vs. TGF-beta 3) and TGF-beta 2 (28.25 ± 23.8 pg/ml; P < 0.01 vs. TGF-beta 3). The primary myofibroblast cultures maintained their distinct patterns of TGF-beta isoform expression despite prolonged culture and over numerous passages (Table 1).


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 7.   Differential expression of TGF-beta isoforms by normal, UC, and CD myofibroblasts. Myofibroblast cultures (at passages 2-6) obtained from normal (total of 8 separate cultures), UC (total of 6 separate cultures), and fibrotic CD (total of 7 separate cultures) mucosal samples were studied. The concentration of each isoform of TGF-beta (expressed as means ± SE) in MFCM was deduced from the degree of inhibition of total TGF-beta bioactivity by isoform-specific neutralizing antibodies (see Fig. 6). Normal myofibroblasts predominantly secrete TGF-beta 3. In contrast, UC myofibroblasts secrete significantly more TGF-beta 1 (*P < 0.001) but a reduced amount of TGF-beta 3 (P < 0.05). Compared with normal myofibroblasts, CD myofibroblasts secrete significantly increased levels of TGF-beta 1 and -beta 2 (**P < 0.03 and P < 0.005, respectively) but secrete significantly reduced levels of TGF-beta 3 (#P < 0.04).


                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Intestinal myofibroblasts maintain TGF-beta isoform expression over several passages

Compared with normal myofibroblasts there was a significant increase in TGF-beta 1 secreted by myofibroblasts obtained from mucosa with active ulcerative colitis (336 ± 113.4 vs. 77.8 ± 59.7 pg/ml; P < 0.001). However, the ulcerative colitis myofibroblasts also secreted high concentrations of TGF-beta 3 but not TGF-beta 2 (Fig. 7).

Myofibroblasts isolated from histologically normal colonic mucosa from a colectomy specimen with distal ulcerative colitis expressed levels of TGF-beta isoform bioactivity similar to those expressed by myofibroblasts derived from the actively inflamed mucosal samples from the same colon (Table 1). These distinct patterns of TGF-beta isoform bioactivity expressed by myofibroblasts from ulcerative colitis mucosal samples were maintained despite prolonged culture and passage (Table 1).

In contrast to normal and ulcerative colitis myofibroblasts, Crohn's disease myofibroblasts secreted significantly reduced levels of TGF-beta 3 (172 ± 42.7 vs. 396.2 ± 146.9 and 256 ± 55.5 pg/ml, respectively; P < 0.04) but higher levels of TGF-beta 2 (158.9 ± 103.5 vs. 28.2 ± 23.8 and 21.6 ± 34.2 pg/ml, respectively; P < 0.01). Crohn's disease myofibroblasts also released more TGF-beta 1 bioactivity than normal myofibroblasts (159.7 ± 68.8 and 77.8 ± 59.7 pg/ml; P < 0.03).

Myofibroblasts isolated from histologically normal colonic mucosa from a resection specimen containing a short Crohn's stricture expressed levels of TGF-beta isoform bioactivity similar to those expressed by myofibroblasts derived from the fibrosed mucosal sample from the same colon (Table 1). As observed with normal and ulcerative colitis myofibroblasts, Crohn's disease myofibroblasts maintained a consistent profile of TGF-beta isoform bioactivity over several passages (Table 1).

Proliferation of myofibroblasts. Proliferation of subconfluent cultures of myofibroblasts (in 0.1% FCS-DMEM) was assessed by incorporation of [3H]thymidine, cell counts, and cell lysate protein concentration after 24-h culture periods. Myofibroblasts isolated from fibrotic Crohn's disease tissue proliferated more rapidly than such cells derived from normal or ulcerative colitis tissue [incorporation of [3H]thymidine expressed as disintegrations per min (dpm): 10,824.4 ± 2,086.1 vs. 4,461.8 ± 1,026.0 and 4,249.4 ± 1,938.3, respectively (P < 0.001); number of cells × 104/ml: 6.05 ± 1.37 vs. 3.19 ± 0.76 and 2.84 ± 0.42, respectively (P < 0.04); cell lysate protein concentration (µg/ml): 5.6 ± 0.46 vs. 3.22 ± 0.81 and 4.08 ± 0.77, respectively (P < 0.03); Fig. 8]. The greater proliferative capacity of Crohn's disease myofibroblasts also was seen when the cells were cultured in the presence of 1% FCS (Fig. 8A).


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 8.   Increased proliferation of CD myofibroblasts. CD myofibroblasts have increased basal levels of proliferation compared with both normal and UC myofibroblasts. A: increased [3H]thymidine incorporation in CD myofibroblasts incubated with both 0.1% and 1% FCS-DMEM vs. normal and UC (*P < 0.01; n = 6); dpm, disintegrations per minute. B: increased CD myofibroblast cell count vs. normal and UC (#P = 0.02, *P = 0.04, respectively; n = 6). C: increased CD myofibroblast cell lysate protein concentration vs. normal and UC (#P = 0.02, *P = 0.03, respectively; n = 6).

After neutralization of individual TGF-beta isoforms using specific neutralizing antibodies, the proliferation of both normal and ulcerative colitis intestinal myofibroblasts increased significantly (P < 0.01). In contrast, the proliferation of Crohn's disease intestinal myofibroblasts was unaffected by neutralization either of individual isoforms of TGF-beta or of all three isoforms with a pan-specific antibody (Fig. 9).


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 9.   Neutralization of TGF-beta does not influence proliferation of CD myofibroblasts. In contrast to both normal and UC myofibroblasts, neutralization of each isoform of TGF-beta has no significant effect on the proliferation of CD myofibroblasts. Proliferation assessed by [3H]thymidine incorporation; data presented as change in proliferation compared with medium-only control (n = 4 experiments).

Expression of TGF-beta receptors I and II by human intestinal myofibroblasts. Myofibroblasts derived from normal, ulcerative colitis, and Crohn's disease intestinal mucosal samples all expressed mRNA transcripts for both TGF-beta receptor type I and type II (Fig. 10).


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 10.   Expression of TGF-beta receptor type I and II mRNA. Normal (lanes 2-4), UC (lanes 5-7), and CD (lanes 8-10) intestinal myofibroblasts express mRNA transcripts for TGF-beta receptor type I (lanes 3, 6, and 9) and type II (lanes 4, 7, and 10); 100-bp DNA markers are shown in lane 1; and hypoxanthine phosphatidyl ribosyltransferase transcripts are shown in lanes 2, 5, and 8. The transcripts were amplified using specific primers and electrophoresed on a 1% agarose gel.

Effect of TGF-beta isoforms on epithelial restitution and proliferation. Epithelial restitution was studied in wounded monolayers of IEC-6 cells (29). All three isoforms of rTGF-beta significantly induced migration of epithelial cells across the wound edge (P < 0.01) and significantly reduced IEC-6 proliferation (P < 0.001), i.e., promoted epithelial restitution.

Of the three isoforms, TGF-beta 1 was the most effective in inducing the migration of epithelial cells across the wound edge and TGF-beta 2 was the least active (Fig. 11). In contrast, TGF-beta 2 was the most effective inhibitor of IEC-6 epithelial proliferation and TGF-beta 3 had the least inhibitory activity (Fig. 12).


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 11.   TGF-beta 2 is the least effective isoform in promoting epithelial cell restitution. All 3 TGF-beta isoforms significantly enhanced epithelial restitution in wounded IEC-6 monolayers. However, TGF-beta 1 and TGF-beta 3 were significantly more effective than TGF-beta 2 (*P < 0.04 vs. TGF-beta 1 and -beta 3; n = 4).



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 12.   TGF-beta 3 is the least effective inhibitor of epithelial cell proliferation. All 3 isoforms of TGF-beta significantly reduced the proliferation of the epithelial cell line IEC-6 compared with control. TGF-beta 1 and -beta 2 reduced proliferation significantly more than TGF-beta 3 (*P < 0.01 vs. TGF-beta 1 and -beta 2; n = 4 experiments).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

There is increasing evidence that myofibroblasts play a role in the maintenance of normal homeostasis and contribute to wound repair in many tissues, including the intestinal mucosa (8, 33). These functions of myofibroblasts appear to be mediated through secreted products such as cytokines and metabolites of arachidonic acid that exert paracrine effects on other mucosal cell populations (33). We recently (21, 44) developed techniques for primary culture of human intestinal and gastric myofibroblasts from fresh mucosal specimens. These cells retain their phenotypic characteristics despite prolonged culture and passage (21), and recent studies demonstrated the capacity of normal intestinal myofibroblasts to enhance epithelial restitution (29) and barrier function and to regulate chloride secretion (3). These functions of the myofibroblasts are mediated via secretion of TGF-beta and products of cyclooxygenase enzymes.

In the present study, we have shown that there are functional differences among normal, ulcerative colitis, and Crohn's disease primary intestinal myofibroblasts as illustrated by the distinct profiles of secreted TGF-beta isoforms. Cultures of intestinal myofibroblasts derived from normal mucosal samples of different individuals secreted predominantly TGF-beta 3, whereas myofibroblasts isolated from mucosa affected by active ulcerative colitis produced both TGF-beta 1 and TGF-beta 3. By contrast, myofibroblasts isolated from mucosa with fibrotic Crohn's disease secreted significantly less TGF-beta 3 but increased levels of TGF-beta 2. These distinctive patterns of TGF-beta isoform release by normal, ulcerative colitis, and Crohn's disease intestinal myofibroblasts were sustained through several passages, suggesting that these differences are independent of the local inflammatory or fibrotic milieu surrounding these cells in vivo. Support for this conclusion is provided by studies on myofibroblasts isolated from uninflamed and inflamed mucosal samples obtained from a colectomy specimen with active ulcerative colitis (in which mucosal inflammation was confined to the distal half of the colon) and studies on myofibroblasts isolated from fibrosed and nonfibrosed Crohn's disease mucosal samples. Clearly, further studies must be performed on such cells to confirm our findings. Additionally, studies of myofibroblasts isolated from inflamed (nonfibrosed) Crohn's disease tissue would be of considerable interest and importance. Further evidence of differences between these cells is the finding of increased expression of keratinocyte growth factor by myofibroblasts isolated from ulcerative colitis mucosa compared with control and Crohn's disease mucosa (2).

Previous studies demonstrated increased synthesis of collagen type III, in response to TGF-beta 1, by fibroblast-like cells isolated from Crohn's disease strictures (41). The expression of TGF-beta 1 in mucosal samples with active inflammatory bowel disease also has been studied, and TGF-beta 1 has been shown to be expressed in significant amounts in the lamina propria, especially in the subepithelial region, where myofibroblasts are also prominent (1, 21). Additionally, TGF-beta 1, -beta 2, -beta 3 and their receptors have been shown to be upregulated in fibrotic Crohn's disease mucosal tissue samples, with a more pronounced increase in TGF-beta 1 and -beta 3 (10). Our studies suggest that myofibroblasts derived from Crohn's disease tissue would preferentially secrete TGF-beta 1 and -beta 2, with reduced secretion of TGF-beta 3. The apparent differences between our study and that of Di Miola et al. (10) could be explained by differing methodological approaches (ex vivo and in vitro conditions) and also by the presence of numerous other cell populations present in mucosal tissue samples in the latter study, which may influence TGF-beta isoform expression. TGF-beta isoforms and their receptors also have been studied in human acute pancreatitis (11).

Ours is the first study to demonstrate differential expression of the three TGF-beta isoforms by myofibroblasts derived from ulcerative colitis and Crohn's disease mucosal samples. To determine the potential functional significance of our findings, we investigated the effect of the individual isoforms of TGF-beta on proliferation of myofibroblasts and epithelial cells, on epithelial restitution, and on the ability of the myofibroblasts themselves to respond in an autocrine manner to the TGF-beta isoforms secreted.

In the presence of medium containing 0.1% or 1% FCS, fibrotic Crohn's disease myofibroblasts proliferated more rapidly than myofibroblasts from normal and ulcerative colitis tissue. Moreover, neutralization of TGF-beta isoform bioactivity did not affect the proliferation of Crohn's disease myofibroblasts but enhanced the growth of myofibroblasts derived from normal and ulcerative colitis mucosal samples. These latter studies suggest that the enhanced proliferative capacity of Crohn's disease myofibroblasts may be due to their unresponsiveness to the constitutively expressed TGF-beta .

TGF-beta isoforms bind to transmembrane TGF-beta receptor types I and II, leading to the formation of a receptor complex and phosphorylation of the type I receptor (25). The latter then phosphorylates receptor-regulated SMAD, which leads to the transduction of signals to target genes via other members of the SMAD family of proteins. To investigate further the lack of response of the Crohn's disease myofibroblasts to constitutive TGF-beta isoforms, we examined the expression of TGF-beta receptor types I and II. All myofibroblast cultures derived from normal, Crohn's disease, and ulcerative colitis tissue were shown to express mRNA transcripts for both type I and type II receptors, suggesting that Crohn's disease myofibroblasts are potentially capable of binding TGF-beta isoforms. Further studies are required to confirm this and to determine subsequently whether the Crohn's disease myofibroblasts are unable to propagate downstream signals.

Studies on epithelial restitution showed that of the three TGF-beta isoforms, TGF-beta 2 is the least effective in inducing the migration of epithelial cells across the wound edge. TGF-beta 2 also was the most effective inhibitor of epithelial proliferation, with TGF-beta 3 having the least effect. Although caution should be exercised in extrapolating in vitro data to the situation in vivo, these studies demonstrate the potential functional significance of the differential expression of TGF-beta isoforms by normal and inflammatory bowel disease intestinal myofibroblasts.

Repair of epithelial wounds occurs initially by restitution, and subsequent cell proliferation allows replacement of lost epithelial cells. Our studies suggest that TGF-beta 3 may be most effective in inducing epithelial wound repair because of its ability to enhance restitution but is the least effective of the three isoforms of TGF-beta in inhibiting epithelial proliferation. By contrast, TGF-beta 2 is likely to be the least effective of the three isoforms in mediating epithelial wound repair. The enhanced expression of TGF-beta 2 by Crohn's disease myofibroblasts may therefore be responsible for persistent epithelial ulceration often seen in Crohn's disease (13). Such ulceration may allow luminal microbial and other products access into the lamina propria, thereby stimulating myofibroblasts, macrophages, and lymphocytes.

Studies examining the repair of rat cutaneous wounds have demonstrated that TGF-beta 1 and -beta 2 have a predominantly profibrotic effect, whereas TGF-beta 3 induces repair without fibrosis, implying its ability to inhibit the profibrogenic effects of TGF-beta 1 and -beta 2 (31, 34, 37, 38). The differential expression of TGF-beta isoforms by normal and inflammatory bowel disease intestinal myofibroblasts could substantially influence the nature of the reparative processes. Because of the predominant expression of TGF-beta 3, normal intestinal myofibroblasts would be expected to mediate epithelial wound repair without fibrosis. Although ulcerative colitis myofibroblasts release significant amounts of TGF-beta 1, their ability also to express large amounts of TGF-beta 3 would be expected to allow rapid epithelial repair in vivo without fibrosis. In contrast, the reduced expression of TGF-beta 3 but enhanced release of TGF-beta 2 by Crohn's disease myofibroblasts may not only mediate suboptimal epithelial wound repair but also lead to excess deposition of extracellular matrix. Thus we postulate that the distinct profile of TGF-beta isoforms expressed by Crohn's disease intestinal myofibroblasts and the enhanced proliferative capacity of these cells are important determinants in the development of intestinal strictures in this disease.


    ACKNOWLEDGEMENTS

We are grateful for the helpful advice received from Dr. D. K. Podolsky in preparation of this manuscript.


    FOOTNOTES

This work was funded by the Medical Research Council (Clinical Training Fellowship to B. C. McKaig and Programme Grant) and a project grant from the National Association for Colitis and Crohn's Disease.

Address for reprint requests and other correspondence: Y. R. Mahida, Div. of Gastroenterology, University Hospital, Nottingham NG7 2UH, UK.

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 1 February 2001; accepted in final form 30 August 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Babyatsky, MW, Rossiter G, and Podolsky DK. Expression of transforming growth factors alpha and beta in colonic mucosa in inflammatory bowel disease. Gastroenterology 110: 975-984, 1996.

2.   Bajaj-Elliott, M, Breese E, Poulsom R, Fairclough PD, and MacDonald TT. Keratinocyte growth factor in inflammatory bowel disease: increased mRNA transcripts in ulcerative colitis compared with Crohn's disease in biopsies and isolated mucosal myofibroblasts. Am J Pathol 151: 1469-1476, 1997.

3.   Beltinger, J, McKaig BC, Makh S, Stack WA, Hawkey CJ, and Mahida YR. Human colonic subepithelial myofibroblasts modulate transepithelial resistance and secretory response. Am J Physiol Cell Physiol 277: C271-C279, 1999.

4.   Berschneider, HM, and Powell DW. Fibroblasts modulate intestinal secretory responses to inflammatory mediators. J Clin Invest 89: 484-494, 1990.

5.   Border, WA, and Noble NA. Transforming growth factor beta in tissue fibrosis. N Engl J Med 331: 1286-1292, 1994.

6.   Bradford, MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein dye binding. Anal Biochem 72: 248-254, 1976.

7.   Danielpour, D, Dart LL, Flanders KC, Roberts AB, and Sporn MB. Immunodetection and quantitation of the two forms of transforming growth factor-beta (TGF-beta 1 and TGF-beta 2) secreted by cells in culture. J Cell Physiol 138: 79-86, 1989.

8.   Desmouliere, A, and Gabbiani G. The Molecular and Cellular Biology of Wound Repair. New York: Plenum, 1996, p. 391-423.

9.   Dignass, AU, and Podolsky DK. Cytokine modulation of intestinal epithelial cell restitution: central role of transforming growth factor beta . Gastroenterology 105: 1323-1332, 1993.

10.   Di Miola, FF, Friess H, Scheuren A, Sebastiano P, Graber H, Egger B, Zimmermann A, Korc M, and Buchler MW. Transforming growth factor-beta s and their signaling receptors are coexpressed in Crohn's disease. Ann Surg 229: 67-75, 1999.

11.   Friess, H, Lu Z, Riesle E, Uhl W, Brundler AM, Horvath L, Gold L, Korc M, and Buchler MW. Enhanced expression of TGF-betas and their receptors in human acute pancreatitis. Ann Surg 227: 95-104, 1998.

12.   Goke, M, Zuk A, and Podolsky DK. Regulation and function of extracellular matrix in intestinal epithelial restitution in vitro. Am J Physiol Gastrointest Liver Physiol 271: G729-G740, 1996.

13.   Goldblum, JR, and Petras RE. Histopathology of Crohn's disease. In: Inflammatory Bowel Diseases (3rd ed.). London: Churchill Livingston, 1997, p. 311-319.

14.   Graham, MF, Diegelmann RF, Elson CO, Lindblad WJ, Gotschalk N, Gay S, and Gay R. Collagen content and types in the intestinal strictures of Crohn's disease. Gastroenterology 94: 257-265, 1988.

15.   Hinterleitner, TA, Saada JI, Berschneider HM, Powell DW, and Valentich JD. IL-1 stimulates intestinal myofibroblast COX gene expression and augments activation of Cl- secretion in T84 cells. Am J Physiol Cell Physiol 271: C1262-C1268, 1996.

16.   Kaye, GI, Lane N, and Pascal RR. Colonic pericryptal fibroblastic sheath: replication, migration and cytodifferentiation of a mesenchymal cell system in adult tissue. II. Fine structural aspects of normal rabbit and human colon. Gastroenterology 54: 852-865, 1968.

17.   Komuro, T, and Hashimoto Y. Three dimensional structure of the rat intestinal wall (mucosa and submucosa). Arch Histol Cytol 255: 343-351, 1990.

18.   Lacy, ER. Epithelial restitution in the gastrointestinal tract. J Clin Gastroenterol 10: 72-77, 1988.

19.   Laemmli, UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 277: 680-684, 1970.

20.   Li, J, Foitzik K, Calautti E, Baden H, Doestchman T, and Dotto GP. TGF-beta 3, but not TGF-beta 1, protects keratinocytes against 12-O-tetradecanoylphorbol-13-acetate-induced cell death in vitro and in vivo. J Biol Chem 274: 4213-4219, 1999.

21.   Mahida, YR, Beltinger J, Makh S, Goke M, Gray T, Podolsky DK, and Hawkey CJ. Adult human colonic subepithelial myofibroblasts express extracellular matrix proteins and cyclooxygenase-1 and -2. Am J Physiol Gastrointest Liver Physiol 273: G1341-G1348, 1997.

22.   Mahida, YR, Djelloul S, Atfi A, Ciacci C, Debeaumont M, Chevalier S, Gespach C, and Podolsky DK. Resistance to TGFbeta in SV40 large T-immortalized rat intestinal epithelial cells is associated with down-regulation of TGFbeta type I receptor. Int J Oncol 9: 365-374, 1996.

23.   Mahida, YR, Galvin AM, Gray T, Makh S, McAlindon ME, Sewell HF, and Podolsky DK. Migration of human intestinal lamina propria lymphocytes, macrophages and eosinophils following the loss of surface epithelial cells. Clin Exp Immunol 109: 377-386, 1997.

24.   Massague, J. The transforming growth factor-beta family. Annu Rev Cell Biol 6: 597-641, 1990.

25.   Massague, J. TGFbeta signal transduction. Annu Rev Biochem 67: 753-791, 1998.

26.   McAlindon, ME, Gray T, Galvin A, Sewell HF, Podolsky DK, and Mahida YR. Differential lamina propria cell migration via basement membrane pores of inflammatory bowel disease mucosa. Gastroenterology 115: 841-848, 1998.

27.   McCormack, SA, Viar MJ, and Johnson LR. Migration of IEC-6 cells: a model for mucosal healing. Am J Physiol Gastrointest Liver Physiol 263: G426-G435, 1992.

28.   McKaig, BC, and Mahida YR. Inflammatory Bowel Disease: Clinical Diagnosis and Management. London: Martin Dunitz, 2000, p. 35-49.

29.   McKaig, BC, Makh S, Hawkey CJ, Podolsky DK, and Mahida YR. Normal human colonic subepithelial myofibroblasts enhance epithelial migration (restitution) via TGF-beta 3. Am J Physiol Gastrointest Liver Physiol 276: G1087-G1093, 1999.

30.   Nusrat, A, Delp C, and Madara JL. Intestinal epithelial restitution. J Clin Invest 93: 2056-2065, 1994.

31.   O'Kane, S, and Ferguson MJ. Transforming growth factor betas and wound healing. Int J Biochem Cell Biol 29: 63-78, 1997.

32.   Powell, DW, Mifflin RC, Valentich JD, Crowe SE, Saadi JI, and West AB. Myofibroblasts. I. Paracrine cells important in health and disease. Am J Physiol Cell Physiol 277: C1-C19, 1999.

33.   Powell, DW, Mifflin RC, Valentich JD, Crowe SE, Saadi JI, and West AB. Myofibroblasts. II. Intestinal subepithelial myofibroblasts. Am J Physiol Cell Physiol 277: C183-C201, 1999.

34.   Proetzel, G, Pawlowski SA, Wiles MV, Yin M, Boivin GP, Howles P, Ding J, Ferguson MWJ, and Doetschman T. Transforming growth factor-beta 3 is required for secondary palate fusion. Nat Genet 11: 409-414, 1995.

35.   Sanfilippo, L, Li CKF, Seth R, Baldwin TJ, Menozzi MG, and Mahida YR. Bacteroides fragilis enterotoxin induces the expression of IL-8 and transforming growth factor-beta (TGF-beta ) by human colonic epithelial cells. Clin Exp Immunol 119: 456-463, 2000.

36.   Sanford, LP, Ormsby I, Gittenberger-de Groot AC, Sariola D, Friedman R, Boivin GP, Cardell EL, and Doetschman T. TGF-beta 2 knockout mice have multiple developmental defects that are nonoverlapping with other TGFbeta knockout phenotypes. Development 124: 2659-2670, 1997.

37.   Shah, M, Foreman DM, and Ferguson MJ. Neutralising antibody to TGF-beta 1, 2 reduces cutaneous scarring in adult rodents. J Cell Sci 107: 1137-1157, 1994.

38.   Shah, M, Foreman DM, and Ferguson MJ. Neutralisation of TGF-beta 1 and TGF-beta 2 or exogenous addition of TGF-beta 3 to cutaneous rat wounds reduces scarring. J Cell Sci 108: 985-1002, 1995.

39.   Shull, MM, Ormsby I, Kier AB, Pawlowski S, Diebold RJ, Yin M, Allen R, Sidman C, Proetzel G, Calvin D, Annunziata N, and Doetschman T. Targeted disruption of the mouse transforming growth factor-beta 1 gene results in multifocal inflammatory disease. Nature 359: 693-699, 1992.

40.   Sporn, MB, and Roberts AB. The transforming growth factor-betas: past, present, and future. Ann NY Acad Sci 593: 1-6, 1990.

41.   Stallmach, A, Schuppan D, Riese HH, Matthes H, and Riecken EO. Increased collagen type III synthesis by fibroblasts isolated from strictures of patients with Crohn's disease. Gastroenterology 102: 1920-1929, 1992.

42.   Valentich, JD, and Powell DW. Intestinal subepithelial myofibroblasts and mucosal immunophysiology. Curr Opin Gastroenterol 10: 645-651, 1994.

43.   Waller, DA, Thomas NW, and Self TJ. Epithelial restitution in the large intestine of the rat following insult with bile salts. Virchows Arch 414: 77-81, 1988.

44.   Wu, KC, Jackson LM, Galvin AM, Gray T, Hawkey CJ, and Mahida YR. Phenotypic and functional characterisation of myofibroblasts, macrophages, and lymphocytes migrating out of the human gastric lamina propria following the loss of epithelial cells. Gut 44: 323-330, 1999.


Am J Physiol Cell Physiol 282(1):C172-C182
0363-6143/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
GutHome page
A Di Sabatino, C L Jackson, K M Pickard, M Buckley, L Rovedatti, N A B Leakey, L Picariello, P Cazzola, G Monteleone, F Tonelli, et al.
Transforming growth factor {beta} signalling and matrix metalloproteinases in the mucosa overlying Crohn's disease strictures
Gut, June 1, 2009; 58(6): 777 - 789.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
D. Peiris, I. Pacheco, C. Spencer, and R. J. MacLeod
The extracellular calcium-sensing receptor reciprocally regulates the secretion of BMP-2 and the BMP antagonist Noggin in colonic myofibroblasts
Am J Physiol Gastrointest Liver Physiol, March 1, 2007; 292(3): G753 - G766.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
P. Brun, I. Castagliuolo, V. D. Leo, A. Buda, M. Pinzani, G. Palu, and D. Martines
Increased intestinal permeability in obese mice: new evidence in the pathogenesis of nonalcoholic steatohepatitis
Am J Physiol Gastrointest Liver Physiol, February 1, 2007; 292(2): G518 - G525.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
F Rieder, J Brenmoehl, S Leeb, J Scholmerich, and G Rogler
Wound healing and fibrosis in intestinal disease
Gut, January 1, 2007; 56(1): 130 - 139.
[Full Text] [PDF]


Home page
JDRHome page
J. Sodek, A. P. Batista Da Silva, and R. Zohar
Osteopontin and Mucosal Protection
Journal of Dental Research, May 1, 2006; 85(5): 404 - 415.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
B. A. Vallance, M. I. Gunawan, B. Hewlett, P. Bercik, C. Van Kampen, F. Galeazzi, P. J. Sime, J. Gauldie, and S. M. Collins
TGF-{beta}1 gene transfer to the mouse colon leads to intestinal fibrosis
Am J Physiol Gastrointest Liver Physiol, July 1, 2005; 289(1): G116 - G128.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
C Bourgier, V Haydont, F Milliat, A Francois, V Holler, P Lasser, J Bourhis, D Mathe, and M-C Vozenin-Brotons
Inhibition of Rho kinase modulates radiation induced fibrogenic phenotype in intestinal smooth muscle cells through alteration of the cytoskeleton and connective tissue growth factor expression
Gut, March 1, 2005; 54(3): 336 - 343.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
F Bataille, F Klebl, P Rummele, J Schroeder, S Farkas, P-J Wild, A Furst, F Hofstadter, J Scholmerich, H Herfarth, et al.
Morphological characterisation of Crohn's disease fistulae
Gut, September 1, 2004; 53(9): 1314 - 1321.
[Abstract] [Full Text] [PDF]


Home page
JBJSHome page
A. M. Ettema, P. C. Amadio, C. Zhao, L. E. Wold, and K.-N. An
A Histological and Immunohistochemical Study of the Subsynovial Connective Tissue in Idiopathic Carpal Tunnel Syndrome
J. Bone Joint Surg. Am., July 1, 2004; 86(7): 1458 - 1466.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
S. Bamba, A. Andoh, H. Yasui, J. Makino, S. Kim, and Y. Fujiyama
Regulation of IL-11 expression in intestinal myofibroblasts: role of c-Jun AP-1- and MAPK-dependent pathways
Am J Physiol Gastrointest Liver Physiol, August 8, 2003; 285(3): G529 - G538.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
B. C. McKaig, D. McWilliams, S. A. Watson, and Y. R. Mahida
Expression and Regulation of Tissue Inhibitor of Metalloproteinase-1 and Matrix Metalloproteinases by Intestinal Myofibroblasts in Inflammatory Bowel Disease
Am. J. Pathol., April 1, 2003; 162(4): 1355 - 1360.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/1/C172    most recent
00048.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (21)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McKaig, B. C.
Right arrow Articles by Mahida, Y. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McKaig, B. C.
Right arrow Articles by Mahida, Y. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online