|
|
||||||||
isoforms by
normal and inflammatory bowel disease intestinal myofibroblasts
Divisions of 1 Gastroenterology and 2 Immunology, University Hospital, Nottingham NG7 2UH, United Kingdom
| |
ABSTRACT |
|---|
|
|
|---|
First published
September 5, 2001; 10.1152/ajpcell. 00048.2001.
Intestinal
strictures are frequent in Crohn's disease but not ulcerative colitis.
We investigated the expression of transforming growth factor (TGF)-
isoforms by isolated and cultured primary human intestinal
myofibroblasts and the responsiveness of these cells and intestinal
epithelial cells to TGF-
isoforms. Normal intestinal myofibroblasts
released predominantly TGF-
3 and ulcerative colitis
myofibroblasts expressed both TGF-
1 and
TGF-
3, whereas in myofibroblast cultures from fibrotic
Crohn's disease tissue, there was significantly lower expression of
TGF-
3 but enhanced release of TGF-
2.
These distinctive patterns of TGF-
isoform release were sustained
through several myofibroblast passages. Proliferation of Crohn's
disease myofibroblasts was significantly greater than that of
myofibroblasts derived from normal and ulcerative colitis tissue. In
contrast to cells from normal and ulcerative colitis tissue,
neutralization of the three TGF-
isoforms did not affect the
proliferation of Crohn's disease intestinal myofibroblasts. Studies on
the effect of recombinant TGF-
isoforms on epithelial restitution
and proliferation suggest that TGF-
2 may be the least effective of the three isoforms in intestinal wound repair. In conclusion, the enhanced release of TGF-
2 but reduced
expression of TGF-
3 by Crohn's disease intestinal
myofibroblasts, together with their enhanced proliferative capacity,
may lead to the development of intestinal strictures.
fibrosis; wound repair
| |
INTRODUCTION |
|---|
|
|
|---|
THE CLINICAL COURSE of ulcerative colitis and Crohn's disease is marked by periodic relapses and remissions. During periods of active disease, the intestinal mucosa is infiltrated with acute and chronic inflammatory cells whose products result in destruction of extracellular matrix and epithelial ulceration (26). Resolution of inflammatory activity is associated with reparative processes that facilitate tissue remodeling, which restores normal intestinal mucosal architecture. Although repair processes in patients with ulcerative colitis are often effective in restoring a normal mucosal architecture during quiescence, stricture formation frequently occurs in patients with Crohn's disease (14, 28), usually associated with epithelial ulceration. The reasons for these disparate outcomes of tissue repair in Crohn's disease and ulcerative colitis remain unknown.
The processes of intestinal mucosal repair and regeneration involve a
complex series of interactions between the surface epithelial cells and
cell populations in the lamina propria. Repair of superficial ulcers in
the normal intestinal mucosa occurs by a sequence of events, initially
characterized by a process designated restitution, in which viable
cells at the wound edge migrate to reestablish epithelial continuity
and barrier function (12, 18, 30, 43). This process can be
complete within minutes to hours, depending on the extent of epithelial
injury. Cell proliferation over the subsequent 24-48 h allows the
replacement of the lost epithelial cells. It is likely that epithelial
restitution in vivo involves complex interaction between epithelial
cells and the underlying lamina propria cells, which may occur via the
basement membrane or pores within it (23, 26). Intestinal
subepithelial myofibroblasts are present immediately subjacent to the
basement membrane and close to the basal surface of epithelial cells
(16, 17, 21, 42). In this position, the myofibroblasts may
be capable of regulating a number of epithelial functions such as
epithelial restitution (29), barrier function
(3), and electrolyte transport (4, 15). Some
of the myofibroblast-mediated effects on epithelial cells have been
shown to be mediated by transforming growth factor (TGF)-
(3,
29).
TGF-
exists in three highly conserved isoforms, designated
TGF-
1, TGF-
2, and TGF-
3.
They are synthesized and secreted as biologically inactive propeptide
molecules, which require processing to the mature 12-kDa polypeptide
dimers (24). The three mature isoforms of TGF-
bind to
specific transmembrane receptors, TGF-
receptor type I and type II,
to target genes via the SMAD family of signal transducing proteins
(25).
The majority of in vitro studies on the biological activities of
TGF-
have focused on TGF-
1 and have demonstrated its
major role in intestinal epithelial restitution (9) and
deposition of extracellular matrix proteins (5, 31).
However, the three isoforms of TGF-
are distributed in specific
spatial and temporal patterns in the tissues of developing and adult
mammals, implying distinct biological activities in vivo
(40). Indeed, targeted disruption of each of the three
TGF-
isoform genes results in mice with distinct phenotypes
(34, 36, 39). Studies investigating the repair of rat
cutaneous wounds demonstrated that TGF-
1 and TGF-
2 promote excessive deposition of extracellular
matrix proteins that lead to scarring (37). In contrast,
exogenous application of TGF-
3 to these wounds reduced
extracellular matrix protein deposition and scarring (38).
Moreover, recent in vitro studies demonstrated distinct biological
activities of the different isoforms of TGF-
(20).
Myofibroblasts have been shown to be important in the repair and
remodeling of many different types of tissue after injury and
inflammation (8, 32). In addition to their effects on epithelial cells, normal intestinal myofibroblasts also have been shown
to express a number of extracellular matrix proteins (21). In this study, we have assessed the production of TGF-
isoforms by
intestinal myofibroblasts isolated from patients with ulcerative colitis and Crohn's disease as well as control subjects. The
biological activities of the individual TGF-
isoforms on epithelial
and myofibroblast proliferation and epithelial restitution also have been investigated.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cell culture. Human normal, ulcerative colitis, and Crohn's disease myofibroblasts were isolated from colonic resection specimens. Normal colonic mucosal samples (n = 5) were obtained >5 cm from the tumor margin of specimens resected for carcinoma. Inflammatory bowel disease mucosal specimens were obtained from patients with active ulcerative colitis (n = 4) and fibrosed colonic Crohn's disease (n = 4). In addition, primary cultures of myofibroblasts were isolated from one patient with ulcerative colitis from both histologically normal (ascending colon) and histologically inflamed (sigmoid colon) areas of the colectomy specimen and from one patient with Crohn's disease from histologically normal colon and histologically fibrosed areas of the colonic resection specimen.
Myofibroblasts were isolated as previously described (21). In brief, the mucosal samples were completely denuded of epithelial cells (23) by three 30-min periods of incubation (at 37°C) in 1 mmol/l EDTA (Sigma). The deepithelialized mucosal samples were subsequently cultured (at 37°C in 5% CO2) in RPMI 1640 (GIBCO) containing 10% FCS (GIBCO). Cells in suspension were removed after every 24- to 72-h culture period, and the denuded tissue was maintained in culture for up to 6 wk. Established colonies of myofibroblasts were cultured in DMEM (GIBCO) supplemented with 10% FCS, 1% nonessential amino acids (GIBCO), penicillin (100 U/ml), and streptomycin (0.1 mg/ml). Cells were passaged using 0.1% (wt/vol) trypsin-0.2% (vol/wt) EDTA in a 1:3 to 1:4 split ratio. Studies were carried out on myofibroblasts at passages 2-6. Studies were also performed using the same primary myofibroblast cultures at later passage. Myofibroblast-conditioned medium (MFCM) for all samples was obtained from subconfluent monolayers of myofibroblasts (seeded in 24-well plates at 2 × 104/well) cultured in 0.1% FCS-DMEM for 24 h. Conditioned medium was centrifuged (2,000 rpm for 10 min), filtered (0.2 µm), and then stored at
70°C.
Protein concentration in the culture supernatant was assessed using the
Bradford-Lowry assay (6), and equivalent MFCM protein concentrations were used in all comparative experiments.
Characterization of intestinal myofibroblasts.
All isolated intestinal myofibroblasts were characterized with
immunohistochemistry and transmission electron microscopy. Mouse
monoclonal antibodies to
-smooth muscle actin (A2547), vimentin
(V6630), and desmin (D1033) (all from Sigma; 1:20 dilution) were used.
Western blot analysis.
Myofibroblast monolayers were lysed in PBS by rapid freeze-thawing
three times, and the lysates were separated by sodium dodecyl sulfate
(SDS)-PAGE with 7.5% acrylamide gel (19) and transferred onto nitrocellulose membrane (Hybond-N; Amersham International). After
incubation with tris(hydroxymethyl)aminomethane (Tris)-buffered saline containing Tween 20, immunostaining was performed with mouse
monoclonal anti-
-smooth muscle actin antibody (A2547), biotinylated secondary anti-mouse antibody, and
avidin-biotin-horseradish peroxidase complex and developed with
diaminobenzidine tetrahydrochloride according to the manufacturer's
instructions (Vectastain Elite ABC kit; Vector Laboratories).
TGF-
bioassay.
Because TGF-
is secreted in precursor form, which requires
processing to the bioactive mature form, it was critical that a
bioassay be used to determine the bioactive form present in the
supernatant samples. Therefore, the presence of bioactive TGF-
in
MFCM was assessed by a validated specific bioassay based on the ability
of TGF-
to inhibit the proliferation of the mink lung epithelial
cell line Mv1Lu [European Collection of Animal Cell Cultures (ECACC);
Porton Down, UK; Refs. 7, 22,
29, and 35].
present in MFCM was activated by the addition of
concentrated HCl to pH 2, and the medium was left to stand at room
temperature for 60 min, followed by neutralization with NaOH (10 M) and
HEPES (to a final concentration of 16 mmol/l).
Mv1Lu cells (in 0.2% FCS-DMEM) were seeded at 5 × 104 cells/well in 24-well cell culture plates (Nunc). Four
hours after cells were seeded, acid-treated and untreated MFCM and
standardized concentrations of recombinant (r)TGF-
1,
-
2, or -
3 (R&D Systems) were added and
incubated for 20 h at 37°C (95% O2-5%
CO2). After 20 h, [3H]thymidine (1 µCi/well; Amersham International) was added, and incubation continued
for an additional 4 h. The cells were then fixed with
methanol-acetic acid (3:1), washed twice with 80% methanol, and lysed
with 1 M NaOH. Uptake of [3H]thymidine was determined
using an LKB (Wallac, Milton Keynes, UK) beta counter. From the
standard curves obtained, the concentration of total and biologically
active TGF-
present in MFCM could be interpolated.
The contribution of each TGF-
isoform to total bioactivity was
assessed using an Mv1Lu bioassay performed in the presence or absence
of TGF-
isoform-specific monoclonal antibodies (1 µg/ml; R&D
Systems). Before these experiments, the specificity of each TGF-
isoform-specific antibody was investigated in our bioassay.
rTGF-
1, -
2, or -
3 (50 pg/ml; R&D Systems) in the presence or absence of neutralizing
antibodies to TGF-
1, -
2, or -
3 (1 µg/ml; R&D Systems) was incubated for 2 h at
37°C in 0.1% FCS-DMEM before application to Mv1Lu cells. Mouse IgG
(1 µg/ml; Serotec) was used as control.
Myofibroblast proliferation assays.
Subconfluent (50-70%) monolayers of human intestinal
myofibroblasts isolated from normal, ulcerative colitis, and Crohn's disease resection specimens (as described in Cell culture)
were incubated with 0.1% FCS-DMEM for 24 h. The medium
was then replaced with either 0.1% or 1% FCS-DMEM, and the cells were
incubated for a further 24 h. [3H]thymidine (1 µCi/well) was added for the final 4 h. Cells were subsequently
fixed with methanol-acetic acid (3:1 vol:vol) at room temperature for
1 h, washed twice with 80% methanol, and lysed with 1 M NaOH.
Uptake of [3H]thymidine was determined with an LKB
(Wallac) beta counter. Myofibroblast proliferation assays were
performed in the presence or absence of neutralizing antibodies to
TGF-
1, -
2, or -
3 and also
pan-specific TGF-
antibody (1 µg/ml; R&D Systems).
Myofibroblast cell counts, viability, and protein assays. To corroborate the proliferation assays, subconfluent monolayers of human intestinal myofibroblasts were incubated with 0.1% FCS-DMEM for 24 h, incubated for 5 min with 0.1% trypsin (Sigma), and harvested by gentle pipetting. Cells were centrifuged at 800 rpm for 5 min and resuspended in equal volumes of 0.1% FCS-DMEM and 0.04% trypan blue and counted in a hemocytometer.
Myofibroblast cell protein was extracted by scraping the cells into 10 mM EDTA, 50 mM Tris · HCl (pH 7.4), 150 mM NaCl, 1% Triton X-100, and 0.1% SDS containing protease inhibitors (2 mM N-ethylmaleimide, 2 mg/ml aprotinin, 4 mg/ml pepstatin, 10 mg/ml leupeptin, and 2 mM phenylmethylsulfonyl fluoride). Extracts were cleared by centrifugation at 10,000 rpm for 15 min. Protein concentration was then determined with the Bradford-Lowry assay (6).Epithelial cell wounding (restitution) assays. The nontransformed rat small intestinal epithelial cell line IEC-6 was obtained from the ECACC and studied at passages 26-31. The cells were maintained in DMEM supplemented with 5% FCS, 2 mM glutamine, 100 U/ml penicillin, 0.1 mg/ml streptomycin, and insulin (final concentration 4 µg/ml; Sigma).
Wound assays were performed in multiples of six, using a previously described method (27) with modification. Confluent monolayers of IEC-6 cells in six-well tissue culture plates (Nunc) were wounded under microscopic vision using a razor blade and a Gilson p2 pipette tip. Cells were washed three times with fresh medium (0.1% FCS-DMEM), and the wounded monolayers were further cultured in fresh medium (0.1% FCS-DMEM) in the presence or absence of human rTGF-
1, -
2, or -
3 (5 ng/ml; R&D Systems).
Migration of IEC-6 cells was assessed in a blinded fashion by the
determination of the mean number of cells found across the wound border
in a standardized wound area (9). Wound areas were
standardized by taking photographs at 100-fold magnification with an
inverted microscope (Olympus CK-2) and an Olympus OM-1 camera.
Experiments were performed in quadruplicate.
Epithelial cell proliferation assays.
IEC-6 cells were seeded onto 24-well plates (Nunc) at 5 × 104 cells/well and incubated in 0.1% FCS-DMEM. They were
subsequently incubated for 24 h in 0.1% FCS-DMEM in the presence
or absence of rTGF-
1, -
2, or
-
3 (5 ng/ml; R&D). Cells were pulsed for the final
4 h of incubation with [3H]thymidine (1 µCi/well),
and proliferation was determined as described in Myofibroblast
proliferation assays.
RNA isolation and reverse transcription. RNA was isolated from myofibroblasts with an RNeasy RNA extraction kit (QIAGEN) and reverse-transcribed using a Ready-To-Go T-Primed first-strand reaction kit (Pharmacia Biotech, Brussels, Belgium). Reverse transcription to cDNA was performed in buffered solution containing dATP, dCTP, dGTP, dTTP, and FPLCpure murine reverse transcriptase, RNA guard (porcine), RNase/DNase-free BSA, and Not I-d(T)18 primer (5'-d[AACTGGAAGAATTCGCGGCCGCAGGAAT18]-3') according to the manufacturer's instructions.
Polymerase chain reaction.
The following reaction mixture was added to 1 µl of the cDNA product:
5 µl of 5× enzyme buffer [300 mM Tris · HCl, 75 mM
(NH4)2SO4, 2.5 mM Mg2+,
pH 8.5; Invitrogen, San Diego, CA], 1 µl of 5 mM dNTPs (Pharmacia Biotech), 1 µl of 1 U/µl AmpliTaq Gold (Perkin Elmer, Foster City, CA), 0.25 µl of 0.1% Tween 20, and sterile water to a final reaction volume of 25 µl. The following primer pairs were used (to a final concentration of 5 µM): 1) 5'-CCAACTATTGCTTCAGCTCCA-3'
(sense) and 5'- TTATGCTGGTTGTACAGGGC-3' (antisense) to amplify 196-bp TGF-
1 product, 2)
5'-CTGGAGCATGCCCGTATTTA-3' (sense) and 5'-TTTGGTCTTGCCACTTTTCC-3' (antisense) to amplify 233-bp human TGF-
2 product,
3) 5'-CCAATTACTGCTTCCGCAACT-3' (sense) and
5'-GCAGATGCTTCAGGGTTCAG-3' (antisense) to amplify 211-bp human
TGF-
3 product, 4)
5'-TACAGTGTTTCTGCCACCTCTGT-3' (sense) and
5'-CCTGTTTTTGAAGATGGTGCACA-3' (antisense) to amplify 177-bp human
TGF-
receptor I product, 5) 5'-CACTGTCCACTTGTGACAACC-3' (sense) and 5'-CGGTCGTCCTCCAGGATGATGG-3' (antisense) to amplify a
503-bp TGF-
receptor II product, and 6)
5'-GACCAGTCAACAGGGGACAT-3' (sense) and 5'-AGGTTTCTACCAGTTCCAGC-3'
(antisense) to amplify a 160-bp constitutive hypoxanthine phosphatidyl
ribosyltransferase (HPRT) product.
receptor types I and II and HPRT, annealing was at 59°C for 60 s and extension at
72°C for 120 s.
PCR products were analyzed by adding 3 µl of gel loading buffer
(Sigma) to 6 µl of PCR product, electrophoresed on a 1% agarose gel,
and stained with ethidium bromide (Sigma). The specificity of RT-PCR
was confirmed by DNA sequence analysis of the PCR products.
Statistical analysis. Results are expressed as means ± SE. Statistical analyses were performed using one-way ANOVA and Student's t-test; P values <0.05 were taken as statistically significant.
| |
RESULTS |
|---|
|
|
|---|
Characterization of intestinal myofibroblasts.
Immunohistochemical studies of normal, ulcerative colitis, and Crohn's
disease intestinal myofibroblasts showed typical myofibroblast features
in that all cells expressed
-smooth muscle actin and vimentin and
were weakly positive for desmin (Fig. 1).
There did not appear to be any differences in the immunohistochemical
expression of
-smooth muscle actin, vimentin, or desmin when normal,
ulcerative colitis, and Crohn's disease myofibroblasts were directly
compared. Western blot analysis, although confirming the expression of
-smooth muscle actin (Fig. 2), raises
the possibility of a slight reduction in the expression of this protein
by Crohn's disease intestinal myofibroblasts compared with those
isolated from normal mucosal samples. Transmission electron micrographs
(Fig. 3) showed no ultrastructural
differences between the normal and inflammatory bowel disease
myofibroblasts, with all cultures displaying longitudinally arranged
bundles of microfilament, well-developed rough endoplasmic reticulum,
and intercellular gap junctions, characteristic ultrastructural features of intestinal myofibroblasts (21, 32). The
cultures obtained were pure myofibroblast monolayers, with no evidence of any contaminating lamina propria or epithelial cells.
|
|
|
Myofibroblast TGF-
isoform mRNA
expression.
Isolated myofibroblast cultures from normal, ulcerative colitis, and
Crohn's disease tissues were assessed for the expression of
TGF-
1, -
2, and -
3 mRNA.
All the myofibroblast cultures from the three different types of tissue
expressed mRNA transcripts for all three human isoforms of TGF-
(Fig. 4). The identity of PCR products
was confirmed by DNA sequence analysis (not shown). Although the
RT-PCR studies suggest that there may be increased expression of
TGF-
1 transcripts in all of the myofibroblast cultures, quantification of TGF-
isoform mRNA was not performed because there
is no direct relationship between expression of transcripts and TGF-
isoform bioactivity. The latter, which is predominantly controlled at
the posttranslational level (24), was studied in detail.
|
Expression of TGF-
bioactivity.
TGF-
is secreted as an inactive propeptide, which can be processed
to the mature form by acid treatment (24). Studies on acid-treated (followed by neutralization) and untreated MFCM showed that most of the TGF-
in conditioned medium of normal, ulcerative colitis, and Crohn's disease myofibroblasts was in the biologically active form (Fig. 5).
|
. To determine the
relative contributions of the individual isoforms, the effect of
selective blockade using isoform-specific antibodies was investigated.
Before such studies, the specificity of the antibodies used was
demonstrated by abrogation of the bioactivity of rTGF-
1,
-
2, and -
3 only by the corresponding
isoform-specific antibody (Fig. 6). No
effect was seen when mouse IgG was used as a nonspecific control (data
not shown).
|
isoform was deduced. The results shown in Fig.
7 represent the TGF-
bioactivity
attributable to each TGF-
isoform in normal, ulcerative, and
Crohn's disease MFCM. Normal myofibroblasts secreted predominantly TGF-
3 (396.25 ± 146.92 pg/ml) but
much less TGF-
1 (77.75 ± 59.7 pg/ml;
P < 0.01 vs. TGF-
3) and
TGF-
2 (28.25 ± 23.8 pg/ml; P < 0.01 vs. TGF-
3). The primary myofibroblast cultures maintained their distinct patterns of TGF-
isoform expression despite prolonged culture and over numerous passages (Table
1).
|
|
1 secreted by myofibroblasts obtained from mucosa with active ulcerative colitis (336 ± 113.4 vs. 77.8 ± 59.7 pg/ml; P < 0.001). However, the ulcerative colitis
myofibroblasts also secreted high concentrations of
TGF-
3 but not TGF-
2 (Fig. 7).
Myofibroblasts isolated from histologically normal colonic mucosa from
a colectomy specimen with distal ulcerative colitis expressed levels of
TGF-
isoform bioactivity similar to those expressed by
myofibroblasts derived from the actively inflamed mucosal samples from
the same colon (Table 1). These distinct patterns of TGF-
isoform
bioactivity expressed by myofibroblasts from ulcerative colitis mucosal
samples were maintained despite prolonged culture and passage (Table
1).
In contrast to normal and ulcerative colitis myofibroblasts, Crohn's
disease myofibroblasts secreted significantly reduced levels of
TGF-
3 (172 ± 42.7 vs. 396.2 ± 146.9 and
256 ± 55.5 pg/ml, respectively; P < 0.04) but
higher levels of TGF-
2 (158.9 ± 103.5 vs.
28.2 ± 23.8 and 21.6 ± 34.2 pg/ml, respectively;
P < 0.01). Crohn's disease myofibroblasts also
released more TGF-
1 bioactivity than normal
myofibroblasts (159.7 ± 68.8 and 77.8 ± 59.7 pg/ml;
P < 0.03).
Myofibroblasts isolated from histologically normal colonic mucosa from
a resection specimen containing a short Crohn's stricture expressed
levels of TGF-
isoform bioactivity similar to those expressed by
myofibroblasts derived from the fibrosed mucosal sample from the same
colon (Table 1). As observed with normal and ulcerative colitis
myofibroblasts, Crohn's disease myofibroblasts maintained a
consistent profile of TGF-
isoform bioactivity over several
passages (Table 1).
Proliferation of myofibroblasts.
Proliferation of subconfluent cultures of myofibroblasts (in 0.1%
FCS-DMEM) was assessed by incorporation of [3H]thymidine,
cell counts, and cell lysate protein concentration after 24-h culture
periods. Myofibroblasts isolated from fibrotic Crohn's disease tissue
proliferated more rapidly than such cells derived from normal or
ulcerative colitis tissue [incorporation of
[3H]thymidine expressed as disintegrations per min (dpm):
10,824.4 ± 2,086.1 vs. 4,461.8 ± 1,026.0 and 4,249.4 ± 1,938.3, respectively (P < 0.001); number of
cells × 104/ml: 6.05 ± 1.37 vs. 3.19 ± 0.76 and 2.84 ± 0.42, respectively (P < 0.04);
cell lysate protein concentration (µg/ml): 5.6 ± 0.46 vs.
3.22 ± 0.81 and 4.08 ± 0.77, respectively
(P < 0.03); Fig. 8].
The greater proliferative capacity of Crohn's disease myofibroblasts also was seen when the cells were cultured in the presence of 1% FCS
(Fig. 8A).
|
isoforms using specific
neutralizing antibodies, the proliferation of both normal and
ulcerative colitis intestinal myofibroblasts increased significantly (P < 0.01). In contrast, the proliferation of Crohn's
disease intestinal myofibroblasts was unaffected by neutralization
either of individual isoforms of TGF-
or of all three isoforms with a pan-specific antibody (Fig. 9).
|
Expression of TGF-
receptors I and
II by human intestinal myofibroblasts.
Myofibroblasts derived from normal, ulcerative colitis, and Crohn's
disease intestinal mucosal samples all expressed mRNA transcripts for
both TGF-
receptor type I and type II (Fig.
10).
|
Effect of TGF-
isoforms on epithelial restitution
and proliferation.
Epithelial restitution was studied in wounded monolayers of IEC-6 cells
(29). All three isoforms of rTGF-
significantly induced
migration of epithelial cells across the wound edge (P < 0.01) and significantly reduced IEC-6 proliferation
(P < 0.001), i.e., promoted epithelial restitution.
1 was the most effective in
inducing the migration of epithelial cells across the wound edge and TGF-
2 was the least active (Fig.
11). In contrast, TGF-
2
was the most effective inhibitor of IEC-6 epithelial proliferation and
TGF-
3 had the least inhibitory activity (Fig.
12).
|
|
| |
DISCUSSION |
|---|
|
|
|---|
There is increasing evidence that myofibroblasts play a role in
the maintenance of normal homeostasis and contribute to wound repair in
many tissues, including the intestinal mucosa (8, 33).
These functions of myofibroblasts appear to be mediated through
secreted products such as cytokines and metabolites of arachidonic acid
that exert paracrine effects on other mucosal cell populations
(33). We recently (21, 44) developed
techniques for primary culture of human intestinal and gastric
myofibroblasts from fresh mucosal specimens. These cells retain their
phenotypic characteristics despite prolonged culture and passage
(21), and recent studies demonstrated the capacity of
normal intestinal myofibroblasts to enhance epithelial restitution
(29) and barrier function and to regulate chloride
secretion (3). These functions of the myofibroblasts are
mediated via secretion of TGF-
and products of cyclooxygenase enzymes.
In the present study, we have shown that there are functional
differences among normal, ulcerative colitis, and Crohn's disease primary intestinal myofibroblasts as illustrated by the distinct profiles of secreted TGF-
isoforms. Cultures of intestinal
myofibroblasts derived from normal mucosal samples of different
individuals secreted predominantly TGF-
3, whereas
myofibroblasts isolated from mucosa affected by active ulcerative
colitis produced both TGF-
1 and TGF-
3. By
contrast, myofibroblasts isolated from mucosa with fibrotic Crohn's
disease secreted significantly less TGF-
3 but increased
levels of TGF-
2. These distinctive patterns of TGF-
isoform release by normal, ulcerative colitis, and Crohn's disease intestinal myofibroblasts were sustained through several passages, suggesting that these differences are independent of the local inflammatory or fibrotic milieu surrounding these cells in vivo. Support for this conclusion is provided by studies on myofibroblasts isolated from uninflamed and inflamed mucosal samples obtained from a
colectomy specimen with active ulcerative colitis (in which mucosal
inflammation was confined to the distal half of the colon) and studies
on myofibroblasts isolated from fibrosed and nonfibrosed Crohn's
disease mucosal samples. Clearly, further studies must be performed on
such cells to confirm our findings. Additionally, studies of
myofibroblasts isolated from inflamed (nonfibrosed) Crohn's disease
tissue would be of considerable interest and importance. Further
evidence of differences between these cells is the finding of increased
expression of keratinocyte growth factor by myofibroblasts isolated
from ulcerative colitis mucosa compared with control and Crohn's
disease mucosa (2).
Previous studies demonstrated increased synthesis of collagen type III,
in response to TGF-
1, by fibroblast-like cells isolated from Crohn's disease strictures (41). The expression of
TGF-
1 in mucosal samples with active inflammatory bowel
disease also has been studied, and TGF-
1 has been shown
to be expressed in significant amounts in the lamina propria,
especially in the subepithelial region, where myofibroblasts are also
prominent (1, 21). Additionally, TGF-
1,
-
2, -
3 and their receptors have been
shown to be upregulated in fibrotic Crohn's disease mucosal tissue
samples, with a more pronounced increase in TGF-
1 and
-
3 (10). Our studies suggest that
myofibroblasts derived from Crohn's disease tissue would
preferentially secrete TGF-
1 and -
2, with
reduced secretion of TGF-
3. The apparent differences
between our study and that of Di Miola et al. (10) could
be explained by differing methodological approaches (ex vivo and in
vitro conditions) and also by the presence of numerous other cell
populations present in mucosal tissue samples in the latter study,
which may influence TGF-
isoform expression. TGF-
isoforms and
their receptors also have been studied in human acute pancreatitis
(11).
Ours is the first study to demonstrate differential expression of the
three TGF-
isoforms by myofibroblasts derived from ulcerative
colitis and Crohn's disease mucosal samples. To determine the
potential functional significance of our findings, we investigated the
effect of the individual isoforms of TGF-
on proliferation of
myofibroblasts and epithelial cells, on epithelial restitution, and on
the ability of the myofibroblasts themselves to respond in an autocrine
manner to the TGF-
isoforms secreted.
In the presence of medium containing 0.1% or 1% FCS, fibrotic
Crohn's disease myofibroblasts proliferated more rapidly than myofibroblasts from normal and ulcerative colitis tissue. Moreover, neutralization of TGF-
isoform bioactivity did not affect the proliferation of Crohn's disease myofibroblasts but enhanced the growth of myofibroblasts derived from normal and ulcerative colitis mucosal samples. These latter studies suggest that the enhanced proliferative capacity of Crohn's disease myofibroblasts may be due to
their unresponsiveness to the constitutively expressed TGF-
.
TGF-
isoforms bind to transmembrane TGF-
receptor types I and II,
leading to the formation of a receptor complex and phosphorylation of
the type I receptor (25). The latter then phosphorylates receptor-regulated SMAD, which leads to the transduction of signals to
target genes via other members of the SMAD family of proteins. To
investigate further the lack of response of the Crohn's disease myofibroblasts to constitutive TGF-
isoforms, we examined the expression of TGF-
receptor types I and II. All myofibroblast cultures derived from normal, Crohn's disease, and ulcerative colitis
tissue were shown to express mRNA transcripts for both type I and type
II receptors, suggesting that Crohn's disease myofibroblasts are
potentially capable of binding TGF-
isoforms. Further studies are
required to confirm this and to determine subsequently whether the
Crohn's disease myofibroblasts are unable to propagate downstream signals.
Studies on epithelial restitution showed that of the three TGF-
isoforms, TGF-
2 is the least effective in inducing the
migration of epithelial cells across the wound edge.
TGF-
2 also was the most effective inhibitor of
epithelial proliferation, with TGF-
3 having the least
effect. Although caution should be exercised in extrapolating in vitro
data to the situation in vivo, these studies demonstrate the potential
functional significance of the differential expression of TGF-
isoforms by normal and inflammatory bowel disease intestinal myofibroblasts.
Repair of epithelial wounds occurs initially by restitution, and
subsequent cell proliferation allows replacement of lost epithelial
cells. Our studies suggest that TGF-
3 may be most effective in inducing epithelial wound repair because of its ability to
enhance restitution but is the least effective of the three isoforms of
TGF-
in inhibiting epithelial proliferation. By contrast, TGF-
2 is likely to be the least effective of the three
isoforms in mediating epithelial wound repair. The enhanced expression of TGF-
2 by Crohn's disease myofibroblasts may
therefore be responsible for persistent epithelial ulceration often
seen in Crohn's disease (13). Such ulceration may allow
luminal microbial and other products access into the lamina propria,
thereby stimulating myofibroblasts, macrophages, and lymphocytes.
Studies examining the repair of rat cutaneous wounds have demonstrated
that TGF-
1 and -
2 have a predominantly
profibrotic effect, whereas TGF-
3 induces repair without
fibrosis, implying its ability to inhibit the profibrogenic effects of
TGF-
1 and -
2 (31, 34, 37,
38). The differential expression of TGF-
isoforms by normal
and inflammatory bowel disease intestinal myofibroblasts could
substantially influence the nature of the reparative processes. Because
of the predominant expression of TGF-
3, normal
intestinal myofibroblasts would be expected to mediate epithelial wound
repair without fibrosis. Although ulcerative colitis myofibroblasts
release significant amounts of TGF-
1, their ability also
to express large amounts of TGF-
3 would be expected to
allow rapid epithelial repair in vivo without fibrosis. In contrast,
the reduced expression of TGF-
3 but enhanced release of
TGF-
2 by Crohn's disease myofibroblasts may not only
mediate suboptimal epithelial wound repair but also lead to excess
deposition of extracellular matrix. Thus we postulate that the distinct
profile of TGF-
isoforms expressed by Crohn's disease intestinal
myofibroblasts and the enhanced proliferative capacity of these cells
are important determinants in the development of intestinal strictures
in this disease.
| |
ACKNOWLEDGEMENTS |
|---|
We are grateful for the helpful advice received from Dr. D. K. Podolsky in preparation of this manuscript.
| |
FOOTNOTES |
|---|
This work was funded by the Medical Research Council (Clinical Training Fellowship to B. C. McKaig and Programme Grant) and a project grant from the National Association for Colitis and Crohn's Disease.
Address for reprint requests and other correspondence: Y. R. Mahida, Div. of Gastroenterology, University Hospital, Nottingham NG7 2UH, UK.
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 1 February 2001; accepted in final form 30 August 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Babyatsky, MW,
Rossiter G,
and
Podolsky DK.
Expression of transforming growth factors alpha and beta in colonic mucosa in inflammatory bowel disease.
Gastroenterology
110:
975-984,
1996.
2.
Bajaj-Elliott, M,
Breese E,
Poulsom R,
Fairclough PD,
and
MacDonald TT.
Keratinocyte growth factor in inflammatory bowel disease: increased mRNA transcripts in ulcerative colitis compared with Crohn's disease in biopsies and isolated mucosal myofibroblasts.
Am J Pathol
151:
1469-1476,
1997.
3.
Beltinger, J,
McKaig BC,
Makh S,
Stack WA,
Hawkey CJ,
and
Mahida YR.
Human colonic subepithelial myofibroblasts modulate transepithelial resistance and secretory response.
Am J Physiol Cell Physiol
277:
C271-C279,
1999.
4.
Berschneider, HM,
and
Powell DW.
Fibroblasts modulate intestinal secretory responses to inflammatory mediators.
J Clin Invest
89:
484-494,
1990.
5.
Border, WA,
and
Noble NA.
Transforming growth factor beta in tissue fibrosis.
N Engl J Med
331:
1286-1292,
1994.
6.
Bradford, MM.
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein dye binding.
Anal Biochem
72:
248-254,
1976.
7.
Danielpour, D,
Dart LL,
Flanders KC,
Roberts AB,
and
Sporn MB.
Immunodetection and quantitation of the two forms of transforming growth factor-
(TGF-
1 and TGF-
2) secreted by cells in culture.
J Cell Physiol
138:
79-86,
1989.
8.
Desmouliere, A,
and
Gabbiani G.
The Molecular and Cellular Biology of Wound Repair. New York: Plenum, 1996, p. 391-423.
9.
Dignass, AU,
and
Podolsky DK.
Cytokine modulation of intestinal epithelial cell restitution: central role of transforming growth factor
.
Gastroenterology
105:
1323-1332,
1993.
10.
Di Miola, FF,
Friess H,
Scheuren A,
Sebastiano P,
Graber H,
Egger B,
Zimmermann A,
Korc M,
and
Buchler MW.
Transforming growth factor-
s and their signaling receptors are coexpressed in Crohn's disease.
Ann Surg
229:
67-75,
1999.
11.
Friess, H,
Lu Z,
Riesle E,
Uhl W,
Brundler AM,
Horvath L,
Gold L,
Korc M,
and
Buchler MW.
Enhanced expression of TGF-betas and their receptors in human acute pancreatitis.
Ann Surg
227:
95-104,
1998.
12.
Goke, M,
Zuk A,
and
Podolsky DK.
Regulation and function of extracellular matrix in intestinal epithelial restitution in vitro.
Am J Physiol Gastrointest Liver Physiol
271:
G729-G740,
1996.
13.
Goldblum, JR,
and
Petras RE.
Histopathology of Crohn's disease.
In: Inflammatory Bowel Diseases (3rd ed.). London: Churchill Livingston, 1997, p. 311-319.
14.
Graham, MF,
Diegelmann RF,
Elson CO,
Lindblad WJ,
Gotschalk N,
Gay S,
and
Gay R.
Collagen content and types in the intestinal strictures of Crohn's disease.
Gastroenterology
94:
257-265,
1988.
15.
Hinterleitner, TA,
Saada JI,
Berschneider HM,
Powell DW,
and
Valentich JD.
IL-1 stimulates intestinal myofibroblast COX gene expression and augments activation of Cl
secretion in T84 cells.
Am J Physiol Cell Physiol
271:
C1262-C1268,
1996.
16.
Kaye, GI,
Lane N,
and
Pascal RR.
Colonic pericryptal fibroblastic sheath: replication, migration and cytodifferentiation of a mesenchymal cell system in adult tissue. II. Fine structural aspects of normal rabbit and human colon.
Gastroenterology
54:
852-865,
1968.
17.
Komuro, T,
and
Hashimoto Y.
Three dimensional structure of the rat intestinal wall (mucosa and submucosa).
Arch Histol Cytol
255:
343-351,
1990.
18.
Lacy, ER.
Epithelial restitution in the gastrointestinal tract.
J Clin Gastroenterol
10:
72-77,
1988.
19.
Laemmli, UK.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
277:
680-684,
1970.
20.
Li, J,
Foitzik K,
Calautti E,
Baden H,
Doestchman T,
and
Dotto GP.
TGF-
3, but not TGF-
1, protects keratinocytes against 12-O-tetradecanoylphorbol-13-acetate-induced cell death in vitro and in vivo.
J Biol Chem
274:
4213-4219,
1999.
21.
Mahida, YR,
Beltinger J,
Makh S,
Goke M,
Gray T,
Podolsky DK,
and
Hawkey CJ.
Adult human colonic subepithelial myofibroblasts express extracellular matrix proteins and cyclooxygenase-1 and -2.
Am J Physiol Gastrointest Liver Physiol
273:
G1341-G1348,
1997.
22.
Mahida, YR,
Djelloul S,
Atfi A,
Ciacci C,
Debeaumont M,
Chevalier S,
Gespach C,
and
Podolsky DK.
Resistance to TGF
in SV40 large T-immortalized rat intestinal epithelial cells is associated with down-regulation of TGF
type I receptor.
Int J Oncol
9:
365-374,
1996.
23.
Mahida, YR,
Galvin AM,
Gray T,
Makh S,
McAlindon ME,
Sewell HF,
and
Podolsky DK.
Migration of human intestinal lamina propria lymphocytes, macrophages and eosinophils following the loss of surface epithelial cells.
Clin Exp Immunol
109:
377-386,
1997.
24.
Massague, J.
The transforming growth factor-beta family.
Annu Rev Cell Biol
6:
597-641,
1990.
25.
Massague, J.
TGF
signal transduction.
Annu Rev Biochem
67:
753-791,
1998.
26.
McAlindon, ME,
Gray T,
Galvin A,
Sewell HF,
Podolsky DK,
and
Mahida YR.
Differential lamina propria cell migration via basement membrane pores of inflammatory bowel disease mucosa.
Gastroenterology
115:
841-848,
1998.
27.
McCormack, SA,
Viar MJ,
and
Johnson LR.
Migration of IEC-6 cells: a model for mucosal healing.
Am J Physiol Gastrointest Liver Physiol
263:
G426-G435,
1992.
28.
McKaig, BC,
and
Mahida YR.
Inflammatory Bowel Disease: Clinical Diagnosis and Management. London: Martin Dunitz, 2000, p. 35-49.
29.
McKaig, BC,
Makh S,
Hawkey CJ,
Podolsky DK,
and
Mahida YR.
Normal human colonic subepithelial myofibroblasts enhance epithelial migration (restitution) via TGF-
3.
Am J Physiol Gastrointest Liver Physiol
276:
G1087-G1093,
1999.
30.
Nusrat, A,
Delp C,
and
Madara JL.
Intestinal epithelial restitution.
J Clin Invest
93:
2056-2065,
1994.
31.
O'Kane, S,
and
Ferguson MJ.
Transforming growth factor betas and wound healing.
Int J Biochem Cell Biol
29:
63-78,
1997.
32.
Powell, DW,
Mifflin RC,
Valentich JD,
Crowe SE,
Saadi JI,
and
West AB.
Myofibroblasts. I. Paracrine cells important in health and disease.
Am J Physiol Cell Physiol
277:
C1-C19,
1999.
33.
Powell, DW,
Mifflin RC,
Valentich JD,
Crowe SE,
Saadi JI,
and
West AB.
Myofibroblasts. II. Intestinal subepithelial myofibroblasts.
Am J Physiol Cell Physiol
277:
C183-C201,
1999.
34.
Proetzel, G,
Pawlowski SA,
Wiles MV,
Yin M,
Boivin GP,
Howles P,
Ding J,
Ferguson MWJ,
and
Doetschman T.
Transforming growth factor-
3 is required for secondary palate fusion.
Nat Genet
11:
409-414,
1995.
35.
Sanfilippo, L,
Li CKF,
Seth R,
Baldwin TJ,
Menozzi MG,
and
Mahida YR.
Bacteroides fragilis enterotoxin induces the expression of IL-8 and transforming growth factor-beta (TGF-
) by human colonic epithelial cells.
Clin Exp Immunol
119:
456-463,
2000.
36.
Sanford, LP,
Ormsby I,
Gittenberger-de Groot AC,
Sariola D,
Friedman R,
Boivin GP,
Cardell EL,
and
Doetschman T.
TGF-
2 knockout mice have multiple developmental defects that are nonoverlapping with other TGF
knockout phenotypes.
Development
124:
2659-2670,
1997.
37.
Shah, M,
Foreman DM,
and
Ferguson MJ.
Neutralising antibody to TGF-
1, 2 reduces cutaneous scarring in adult rodents.
J Cell Sci
107:
1137-1157,
1994.
38.
Shah, M,
Foreman DM,
and
Ferguson MJ.
Neutralisation of TGF-
1 and TGF-
2 or exogenous addition of TGF-
3 to cutaneous rat wounds reduces scarring.
J Cell Sci
108:
985-1002,
1995.
39.
Shull, MM,
Ormsby I,
Kier AB,
Pawlowski S,
Diebold RJ,
Yin M,
Allen R,
Sidman C,
Proetzel G,
Calvin D,
Annunziata N,
and
Doetschman T.
Targeted disruption of the mouse transforming growth factor-
1 gene results in multifocal inflammatory disease.
Nature
359:
693-699,
1992.
40.
Sporn, MB,
and
Roberts AB.
The transforming growth factor-betas: past, present, and future.
Ann NY Acad Sci
593:
1-6,
1990.
41.
Stallmach, A,
Schuppan D,
Riese HH,
Matthes H,
and
Riecken EO.
Increased collagen type III synthesis by fibroblasts isolated from strictures of patients with Crohn's disease.
Gastroenterology
102:
1920-1929,
1992.
42.
Valentich, JD,
and
Powell DW.
Intestinal subepithelial myofibroblasts and mucosal immunophysiology.
Curr Opin Gastroenterol
10:
645-651,
1994.
43.
Waller, DA,
Thomas NW,
and
Self TJ.
Epithelial restitution in the large intestine of the rat following insult with bile salts.
Virchows Arch
414:
77-81,
1988.
44.
Wu, KC,
Jackson LM,
Galvin AM,
Gray T,
Hawkey CJ,
and
Mahida YR.
Phenotypic and functional characterisation of myofibroblasts, macrophages, and lymphocytes migrating out of the human gastric lamina propria following the loss of epithelial cells.
Gut
44:
323-330,
1999.
This article has been cited by other articles:
![]() |
A Di Sabatino, C L Jackson, K M Pickard, M Buckley, L Rovedatti, N A B Leakey, L Picariello, P Cazzola, G Monteleone, F Tonelli, et al. Transforming growth factor {beta} signalling and matrix metalloproteinases in the mucosa overlying Crohn's disease strictures Gut, June 1, 2009; 58(6): 777 - 789. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Peiris, I. Pacheco, C. Spencer, and R. J. MacLeod The extracellular calcium-sensing receptor reciprocally regulates the secretion of BMP-2 and the BMP antagonist Noggin in colonic myofibroblasts Am J Physiol Gastrointest Liver Physiol, March 1, 2007; 292(3): G753 - G766. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Brun, I. Castagliuolo, V. D. Leo, A. Buda, M. Pinzani, G. Palu, and D. Martines Increased intestinal permeability in obese mice: new evidence in the pathogenesis of nonalcoholic steatohepatitis Am J Physiol Gastrointest Liver Physiol, February 1, 2007; 292(2): G518 - G525. [Abstract] [Full Text] [PDF] |
||||
![]() |
F Rieder, J Brenmoehl, S Leeb, J Scholmerich, and G Rogler Wound healing and fibrosis in intestinal disease Gut, January 1, 2007; 56(1): 130 - 139. [Full Text] [PDF] |
||||
![]() |
J. Sodek, A. P. Batista Da Silva, and R. Zohar Osteopontin and Mucosal Protection Journal of Dental Research, May 1, 2006; 85(5): 404 - 415. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Vallance, M. I. Gunawan, B. Hewlett, P. Bercik, C. Van Kampen, F. Galeazzi, P. J. Sime, J. Gauldie, and S. M. Collins TGF-{beta}1 gene transfer to the mouse colon leads to intestinal fibrosis Am J Physiol Gastrointest Liver Physiol, July 1, 2005; 289(1): G116 - G128. [Abstract] [Full Text] [PDF] |
||||
![]() |
C Bourgier, V Haydont, F Milliat, A Francois, V Holler, P Lasser, J Bourhis, D Mathe, and M-C Vozenin-Brotons Inhibition of Rho kinase modulates radiation induced fibrogenic phenotype in intestinal smooth muscle cells through alteration of the cytoskeleton and connective tissue growth factor expression Gut, March 1, 2005; 54(3): 336 - 343. [Abstract] [Full Text] [PDF] |
||||
![]() |
F Bataille, F Klebl, P Rummele, J Schroeder, S Farkas, P-J Wild, A Furst, F Hofstadter, J Scholmerich, H Herfarth, et al. Morphological characterisation of Crohn's disease fistulae Gut, September 1, 2004; 53(9): 1314 - 1321. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Ettema, P. C. Amadio, C. Zhao, L. E. Wold, and K.-N. An A Histological and Immunohistochemical Study of the Subsynovial Connective Tissue in Idiopathic Carpal Tunnel Syndrome J. Bone Joint Surg. Am., July 1, 2004; 86(7): 1458 - 1466. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bamba, A. Andoh, H. Yasui, J. Makino, S. Kim, and Y. Fujiyama Regulation of IL-11 expression in intestinal myofibroblasts: role of c-Jun AP-1- and MAPK-dependent pathways Am J Physiol Gastrointest Liver Physiol, August 8, 2003; 285(3): G529 - G538. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. McKaig, D. McWilliams, S. A. Watson, and Y. R. Mahida Expression and Regulation of Tissue Inhibitor of Metalloproteinase-1 and Matrix Metalloproteinases by Intestinal Myofibroblasts in Inflammatory Bowel Disease Am. J. Pathol., April 1, 2003; 162(4): 1355 - 1360. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |