|
|
||||||||
Department of Physiology and Cell Biology, University of Nevada School of Medicine, Reno, Nevada 89557
| |
ABSTRACT |
|---|
|
|
|---|
A rapidly inactivating K+ current (A-type current) participates in the regulation of colonic muscle excitability. We found 19-pS K+ channels in cell-attached patches of murine colonic myocytes that activated and inactivated with kinetics similar to the A-type current. The A-type current in colonic myocytes is regulated by Ca2+/calmodulin-dependent protein kinase II. Therefore, we studied regulation of the 19-pS K+ channels by Ca2+-dependent phosphorylation/dephosphorylation. The rates of inactivation of ensemble-averaged currents resulting from 19-pS K+ channels were increased by the calmodulin antagonist W-7. Inhibitors of calcineurin, cyclosporin A and FK-506, slowed the inactivation of the 19-pS K+ channels. Okadaic acid, an inhibitor of the calcineurin/inhibitor-1/protein phosphatase 1 cascade, also slowed inactivation of the 19-pS K+ channels. Polymerase chain reaction detected transcripts encoding calcineurin A in isolated colonic smooth muscle cells, and immunohistochemical studies demonstrated specific expression of calcineurin A-like immunoreactivity in colonic muscle tissues and in colonic myocytes. These data, when considered with previous findings, suggest that Ca2+-dependent phosphorylation/dephosphorylation regulates the A-type current in murine colonic smooth muscle cells.
calcineurin; calcium/calmodulin-dependent protein kinase II; gastrointestinal motility
| |
INTRODUCTION |
|---|
|
|
|---|
CALCIUM ACTION POTENTIAL COMPLEXES riding on the crests of slow waves are characteristic of the rhythmic electrical activity of colonic smooth muscles of mouse and human (2, 13, 19). The responses of colonic smooth muscle cells to slow wave depolarizations are modulated by the K+ currents present in the myocytes (see, e.g., Ref. 11). We showed (13) that a rapidly inactivating, 4-aminopyridine (4-AP)-sensitive K+ current (A-type current) is an important regulator of electrical activity in the murine proximal colon. This current has properties reminiscent of the Kv4 family of K+ channels, but the molecular identity of the A-type current is unknown at present. We reported previously (12) that the A-type current in colonic myocytes is regulated by Ca2+/calmodulin-dependent protein kinase II (CaMKII). Dialysis of cells with autothiophosphorylated CaMKII slowed the inactivation kinetics of the A-type current, and CaMKII inhibitors increased the rate of inactivation in a reciprocal fashion.
A-type currents are thought to participate in regulation of the interspike period between action potentials in cells that undergo repetitive firing (5, 9, 14). Although previous work examined the effects of Ca2+-dependent phosphorylation on the kinetics of A-type current channels (10, 12, 16, 20, 22), little is currently known about the regulation of A-type currents by phosphatases in smooth muscle.
In the present study we have examined the role of Ca2+-dependent dephosphorylation on the inactivation kinetics of the channels likely to be responsible for the A-type current in colonic myocytes. We hypothesize that Ca2+-dependent dephosphorylation via the activity of calcineurin, a Ca2+-dependent protein phosphatase, will have effects opposite to those of CaMKII (i.e., phosphatase activity speeds inactivation whereas phosphatase inhibition would tend to slow inactivation). We have also investigated the expression of calcineurin in colonic myocytes using the polymerase chain reaction (PCR) and immunohistochemical techniques. If this hypothesis is correct, the phosphorylation/dephosphorylation balance, both modulated by Ca2+, will determine the kinetic and functional properties of the A-type current in vivo.
| |
METHODS |
|---|
|
|
|---|
Preparation of isolated myocytes. Smooth muscle cells were prepared from the tunica muscularis of colons removed from BALB/c mice. Briefly, mice were anesthetized with chloroform and killed by cervical dislocation. After death, the proximal colon was removed and opened along the longitudinal axis. The resulting sheets were pinned out in a Sylgard-lined dish and washed with Ca2+-free phosphate-buffered saline (PBS) containing (in mM) 125 NaCl, 5.36 KCl, 15.5 NaOH, 0.336 Na2HPO4, 0.44 KH2PO4, 10 glucose, 2.9 sucrose, and 11 HEPES, adjusted to pH 7.4 with Tris. Mucosa and submucosa were removed with fine-tipped forceps. The Institutional Animal Care and Use Committee approved the housing and protocols for the killing of animals.
Pieces of muscle were incubated in a Ca2+-free solution (see above) supplemented with 4 mg/ml fatty acid-free bovine serum albumin (BSA; Sigma), 20 U/ml papain (Sigma), 270 U/ml collagenase (Worthington Biochemical), and 1 mM dithiothreitol (Sigma); tissue was incubated at 37°C in this enzyme solution for 8-12 min and then washed with Ca2+-free solution. Tissue pieces were gently agitated to create a cell suspension. Dispersed cells were stored at 4°C in Ca2+-free solution supplemented with minimum essential medium for suspension culture (S-MEM; Sigma) and (in mM) 0.5 CaCl2, 0.5 MgCl2, 4.17 NaHCO3, and 10 HEPES, adjusted to pH 7.4 with Tris. Experiments were performed at room temperature within 6 h of dispersing cells. Aliquots of cells were pipetted into a perfused recording chamber mounted on an inverted microscope. The cells were allowed to adhere to the glass bottom of the chamber for 5 min before recording. The resulting myocytes were from both the longitudinal and the circular smooth muscle layers. Because the circular layer is thicker than the longitudinal layer, it is likely that the majority of the cells were from the circular layer. As described previously (13), we found no significant differences in the inactivation kinetics and pharmacology of isolated longitudinal and circular myocytes.Voltage-clamp studies.
Cell-attached voltage-clamp experiments were used to record
single-channel membrane currents from colonic myocytes.
Amphotericin-perforated whole cell recordings were used to record
macroscopic current. All experiments were performed at room temperature
(25°C). Currents were amplified with an Axopatch 200B (Axon
Instruments). The currents were digitized with a DigiData 1200 A/D
converter (Axon Instruments), and data were recorded and stored on-line
using pCLAMP 6 software (Axon Instruments). Single-channel data were
filtered at 0.5 kHz, and whole cell data were filtered at 1 kHz. For
single-channel recordings, linear leak and capacitance current was
removed by null (no open channels) trace subtraction. Ensemble-averaged
currents were generated from 60 test traces; exponential decays were
fit with either a monoexponential [I(t) = A1 × e(
t/
1) + A
] or a double exponential
[I(t)=A1 × e(
t/
1) + A2 × e(
t/
2) + A
] as determined by goodness of fit, where I
is current, t is time, A1 and
A2 are the amplitudes of the exponential terms for time constants of inactivation (
)
1 and
2, and A
is the constant representing the
steady-state current level. Although variability was observed
among cells, the time constants of inactivation did not differ
significantly under control conditions (i.e., before drug addition)
between the treatment groups (P > 0.05).
Isolation of RNA from murine circular smooth muscle cells and
RT-PCR.
Murine colonic circular smooth muscle cells were isolated as described
in Preparation of isolated myocytes. Cells were
allowed to settle in a glass-bottomed chamber located on an inverted
microscope. Individual myocytes were selected by the same criteria used
during electrophysiological experiments (elongated, spindle-shaped
cells, 100-500 µm long, 5-10 µm in diameter) and
aspirated into large-bore pipettes (tip diameters >10 µm). After 60 smooth muscle cells were collected, the contents of the pipette were
expelled into RNase-free tubes, frozen in liquid nitrogen, and stored
at
70°C.
-subunit. The
oligonucleotides 5'ACGGTGGTTTGTCTCCAGAGA3' and
5'GAGTGAAATGTTCCTGAGTCTT3' were used to amplify a 153-base pair product
of the calcineurin A
-subunit. The reaction volumes for PCR were 25 µl, including 5 µl of cDNA. Hot-start PCR was used, and the DNA was
amplified by 40 cycles of 94°C (30 s), 60°C (1 min), and 72°C (30 s), followed by 1 cycle of 72°C (5 min). Aliquots of the PCR
reactions were analyzed by 1% agarose gel electrophoresis and
visualized by SYBR Green I (Molecular Probes) fluorescence. PCR
amplification products were extracted, and identities were confirmed by
sequencing. As a control, PCR primers specific for
-actin (V01217)
nucleotides 2383-2402 and 3071-3091 were used to establish
that the cDNA prepared was nongenomic. The
-actin-specific primers
amplified only the intronless amplification product from all cDNA
samples, indicating that these preparations were free of genomic DNA
contamination (data not shown).
Immunohistochemistry. Mouse proximal colon was collected and flushed with PBS, pH 7.4. The tissues were fixed with paraformaldehyde (4%) in PBS for 20 min. The fixed sections of colon were cryoprotected in increasing gradients of sucrose in PBS (5%, 10%, and 15%) for 30 min each and in 20% sucrose in PBS overnight. Tissue was then embedded in Tissue Tek embedding medium (Miles) and 20% sucrose in PBS (1:2, vol/vol) and rapidly frozen in isopentane precooled in liquid nitrogen. Cryosections were cut at 8 µm on a cryotome (Leica CM 3050); endogenous peroxide was quenched by incubation in 1% hydrogen peroxide in PBS for 15 min. The sections were then blocked in 1% BSA containing 0.1% Triton X-100 for 1 h at room temperature. Excess blocking serum was removed, and sections were incubated with 1:100 primary antibody (anti-calcineurin A or anti-calcineurin B) for 24 h at 4°C. The anti-calcineurin A antibody is a rabbit polyclonal antibody (a gift from Dr. Kohji Fukunaga, Kumamoto University School of Medicine, Kumamoto, Japan; Ref. 15). The anti-calcineurin B antibody is a rabbit polyclonal antibody from Affinity Bioreagents. Biotinylated goat anti-rabbit immunoglobulin and horseradish peroxidase-conjugated anti-biotin antibody were then applied to the sections for 30 min at room temperature. The sections were washed twice between each step. Peroxidase activity was visualized by applying 3,3'-diaminobenzidine containing 0.05% hydrogen peroxidase for 4-8 min at room temperature. The sections were rinsed in tap water, dehydrated, cleared, and mounted with coverslips. Two negative control sections were incorporated for each antibody and were processed as above except that primary antibodies were substituted with 1) PBS and 2) antibody that had been preabsorbed (2 h at room temperature) with purified full-length recombinant calcineurin A (17) and calcineurin B (B. A. Perrino, unpublished data). Slides were viewed and photomicrographs were made using a Nikon eclipse E600 microscope incorporating Normarski optics.
Statistical methods. Data are reported as means ± SE, and n refers to the number of patches from which recordings were made. Statistical significance was evaluated by Student's paired t-test or one-way analysis of variance. P values <0.05 were considered significant.
| |
RESULTS |
|---|
|
|
|---|
Calmodulin antagonism increases rate of inactivation of 19-pS
K+ conductance with properties similar to
that of whole cell A-type current.
In a previous study (12) we showed that CaMKII regulates
the A-type K+ current in colonic myocytes. The
cell-attached configuration of the patch-clamp technique was used to
identify single-channel currents that might contribute to the A-type
K+ current observed in whole cell recordings. In these
experiments we used external solutions containing 100 nM
Ca2+ and pipette solutions containing 2 mM Mn2+
to minimize Ca2+-activated K+ currents (see
METHODS for other solution components). Membrane patches
were held at
80 mV and stepped for 4 s to various test potentials. Depolarization transiently activated single K+
currents. Unitary currents were recorded in symmetric (140 mM/140 mM)
and asymmetric (5 mM/140 mM) K+ gradients. In symmetric
K+ gradients the currents reversed at ~0 mV and had a
single-channel conductance of 19 ± 1 pS (Fig.
1B; n = 3).
Outward currents observed in asymmetric K+ (5 mM/140 mM)
gradients increased in amplitude as a function of depolarization in a
nonlinear fashion. The current-voltage relationship was well fit with
the Goldman-Hodgkin-Katz equation for the K+ gradient. The
extrapolated reversal potential with an asymmetric K+
gradient was approximately
80 mV, close to the calculated equilibrium potential (EK) for the solutions used (Fig. 1;
n = 5). The presence of 2 mM Mn2+ in the
pipette solution had no effect on the K+ channels
(n = 20). Channel "rundown" was not observed in
cell-attached control recordings lasting >30 min.
|
F) and slow (
S) components
(
F = 99 ± 28 ms and
S = 750 ± 14 ms). These values are similar to those measured in whole
cell currents under similar conditions (i.e.,
F = 60 ± 6 ms and
S = 1,207 ± 104 ms;
n = 3; Fig. 2C, inset). W-7 (10 µM) increased the rate of inactivation of the 19-pS K+
channels, and ensemble-averaged currents were fit with a double exponential having time constants of 49 ± 8 and 561 ± 23 ms
(P < 0.05 for both values; n = 5).
Examination of the amplitudes of each component of inactivation
revealed that W-7 reduced the amplitude of the slow component by
60.7 ± 10.9% (P < 0.05, n = 5).
The amplitude of the fast component was unchanged (P > 0.05, n = 5). These findings indicate that the
proportion of total inactivation from the fast component was increased
by W-7 from 42 ± 2.5% to 61 ± 5% (P < 0.05; n = 5) via a reduction in the contribution by the
slow component. The effects of W-7 were apparent 5 min after exposure
and were partially reversed by a 20-min washout period. Thus the
kinetics of the 19-pS channels, their sensitivity to K+
channel inhibitors, and the increase in the rate of inactivation in
response to W-7 suggest that the 19-pS channels contribute to the
A-type current recorded under whole cell conditions.
|
Inhibition of calcineurin by CSA and FK-506 removes the fast
component of inactivation of 19-pS K+
channels in isolated murine myocytes.
After characterizing the effects of W-7 on the 19-pS inactivating
K+ channels, we examined regulation of these channels by
Ca2+-dependent dephosphorylation by calcineurin.
Calcineurin is inhibited by the immunosuppressant CSA (see, e.g., Ref.
18). In these experiments using the experimental
conditions described above, depolarization to 0 mV activated
K+ channels that inactivated with
F of
94 ± 38 ms and
S of 938 ± 196 ms, with the
fast component contributing to 36 ± 4% of total inactivation.
CSA (1 µM) reduced the peak current by 47.2 ± 5.8% (P < 0.05, n = 5). CSA also eliminated
f such that the inactivation was fit with a single
exponential (
CSA = 1,076 ± 363 ms) that was
not significantly different from the second (slow) phase of inactivation under control conditions (Fig.
3; P > 0.05;
n = 5). Furthermore, the amplitude of
CSA was not significantly different from that of
S under control conditions (P > 0.05, n = 5). In agreement with this finding, previous
studies (12) showed that intracellular application of
activated CaMKII results in whole cell A-type currents fit by a single
slow time constant. The effects of CSA developed within 15 min, and
washout periods >20 min were ineffective in producing reversal of the
effects. These experiments suggest that calcineurin is active in murine
colonic myocytes and that inhibition of calcineurin activity has
effects similar to application of CaMKII.
|
f = 146 ± 47 ms (representing 48 ± 9%
of the total inactivation) and
s = 1,552 ± 397 ms to a single exponential with a time constant
FK-506 = 829 ± 139 ms (Fig.
4; n = 5). The
ensemble-averaged currents observed after FK-506 were fit by a
single exponential; however,
FK-506 was significantly
smaller than
s in the control recordings
(P < 0.05; n = 5). As with CSA, FK-506
resulted in a slow component of inactivation with an amplitude that was
not significantly different from the amplitude of
S
under control conditions (P > 0.05, n = 5). The effects of FK-506 were observed within 15 min and were not
appreciably reversible with washout. These data show that inhibition of
calcineurin by two structurally unrelated compounds results in slowing
of the inactivation of the 19-pS K+ channels.
|
Inhibition of protein phosphatase 1 by Oka removes the fast
component of inactivation of 19-pS K+
channels in isolated murine myocytes.
Calcineurin activity is known to activate protein phosphatase 1 (PP1)
by dephosphorylation of PP1 inhibitory peptide inhibitor-1 (see, e.g.,
Ref. 4). It is therefore possible that the effects of CSA
and FK-506 on the 19-pS K+ channels occur via a decrease in
calcineurin-mediated PP1 activation. Oka, an inhibitor of PP1, was used
to test this hypothesis. Under control conditions, inactivations of
ensemble-averaged currents due to the 19-pS channels were fit with
double exponentials with fast (
F = 142 ± 58 ms; 43 ± 5% total inactivation) and slow (
S = 1,283 ± 200 ms) components. Addition of Oka (100 nM) reduced peak current by 36.0 ± 11.8.% (P < 0.05, n = 5). The decrease in peak current by Oka was not
significantly different from that observed with CSA (P
> 0.05, n = 5). As with CSA and FK-506, Oka exposure caused an elimination of
f, leaving a single
slow time constant of 958 ± 95 ms (Fig.
5). The amplitude and
value of single
exponential decay observed after exposure to Oka was not significantly
different from the second (slow) phase of inactivation under control
conditions (P > 0.05; n = 5). Oka
showed a time course similar to that seen with the inhibitors of
calcineurin (effects within 15 min), and the effects were not
reversible with washout. Oka concentrations of
10 nM were without
effect (not shown). For comparative purposes, a summary of
values
and their respective amplitudes is given in Table
1.
|
|
Expression of calcineurin by murine proximal colonic myocytes.
RT-PCR was used to determine whether mRNA encoding calcineurin isoforms
was expressed in murine proximal colonic myocytes. Primers specific for
the
- and
-subunits of calcineurin A amplified transcripts from
isolated colonic myocytes of 131 and 153 base pairs for each primer,
respectively (not shown). Transcript identity was confirmed by sequence
analysis of the RT-PCR products.
|
| |
DISCUSSION |
|---|
|
|
|---|
In previous studies of murine colonic myocytes we identified (13) an A-type K+ current that displays rapid activation (tens of milliseconds) and inactivation (hundreds of milliseconds). This current serves to dampen excitability and generation of action potentials in intact strips of colon muscle and could be a factor in the maintenance of the phasic nature of contractions in colonic motility. Although the molecular nature of this current is unknown, qualitative PCR amplification of mRNA isolated from these cells suggests that the Kv4 family isoforms could be responsible for the conductance (13). Previous studies found no evidence for expression of Kv1.4 in murine colonic myocytes (13). During characterization of the A-type current, it was noted that the kinetics of inactivation were affected by Ca2+ buffering. Subsequent examination of this phenomenon revealed that CaMKII activity slowed current inactivation (12). Because of the importance of the A-type current in modulating excitability in colonic muscles (see, e.g., Ref. 13), regulation of this current via protein phosphorylation might play an important role in Ca2+-dependent regulation of gastrointestinal motility.
In the present study we identified 19-pS K+ channels that may underlie macroscopic whole cell A-type currents in colonic myocytes. These channels rapidly inactivated with kinetics similar to those of the A-type current and were blocked by 4-AP, whereas TEA was without effect. From previous studies showing regulation of the A-type current by CaMKII, we hypothesized that antagonism of calmodulin activation of CaMKII activity would increase the rate of inactivation of the channels responsible for the A-type current. Inclusion of W-7 in the bathing solution increased the rate of inactivation of the 19-pS K+ channels by reducing the time constants of inactivation and increasing the relative contribution of the fast component of inactivation by reducing the amplitude of the slow component. W-7 also caused a decrease in peak current, which is consistent with the observed increase in the rate of inactivation. Similar regulation of the A-type current occurred under whole cell conditions, and others have shown that A-type currents in atrial myocytes (in which calmodulin was antagonized with calmidazolium; Ref. 22) and in Drosophila photoreceptors (in which W-7 was used; Ref. 16) are regulated in a similar manner. Together, our data suggest that the 19-pS K+ channels we observed contribute to macroscopic A-type currents in colonic myocytes.
To further characterize the 19-pS K+ channel, and to
continue our investigation of Ca2+-dependent regulation of
the electrical activity of colonic smooth muscle, we examined the
effects of inhibition of Ca2+-dependent dephosphorylation
on the kinetics of inactivation of the A-type current in colonic
myocytes. Preliminary experiments to investigate this question
performed in the whole cell configuration proved to be problematic. We
observed, in agreement with previous reports (3, 23), that
contaminating outward currents were enhanced by exposure of cells to
phosphatase inhibitors. Furthermore, treatment with phosphatase
inhibitors also produced changes in the resting current at a holding
potential equal to the calculated EK (e.g.,
80
mV), suggesting that currents other than K+ currents can be
activated in response to phosphatase inhibition. These observations are
not surprising considering the wide range of cellular substrates of
protein phosphatases. In light of the problems of current isolation in
whole cell experiments, we investigated regulation by
Ca2+-dependent phosphatases of K+ current at
the single-channel level to reduce contamination. Additionally,
responses to test potentials of 0 mV were used to eliminate
contamination from nonselective cation currents.
Calcineurin is a ubiquitous multifunctional Ca2+/calmodulin-dependent protein phosphatase found extensively in neurons. Previous work using immunofluorescence microscopy of single smooth muscle cells has shown that calcineurin is present in rabbit stomach smooth muscle (8). We confirmed the expression of calcineurin in gastrointestinal muscles with RT-PCR to identify mRNA transcripts encoding calcineurin A in isolated smooth muscle cells of the murine colon. We examined calcineurin expression at the protein level by immunohistochemical methods and found that calcineurin-like immunoreactivity was also specifically localized within colonic myocytes. Calcineurin A-like immunoreactivity, but not calcineurin B-like immunoreactivity, was found in circular and longitudinal colonic myocytes. Of additional interest not directly related to the present study, we also found that enteric neurons expressed calcineurin A and B isoforms.
CSA disrupts calcineurin activity by interacting with the endogenous protein cyclophilin to form a calcineurin-inhibitory complex (see, e.g., Ref. 18). Inhibition of Ca2+-dependent phosphorylation (via inhibition of calmodulin or CaMKII) was shown to increase the rate of inactivation of the A-type current (Ref. 12 and this study). Therefore, we hypothesized that inhibition of dephosphorylation by calcineurin might have opposite effects. Regulation of A-type currents by this mechanism was demonstrated previously in HEK-293 cells expressing the fast-inactivating Shaker-related K+ channel Kv1.4 (20). Before CSA exposure, the kinetics of inactivation of the 19-pS K+ channels was best fit with a double exponential having fast and slow components. Inclusion of CSA resulted in an inactivation pattern consisting of a single slow time constant that was not significantly different from the slow time constant under control conditions. Furthermore, the amplitude of the slow component of inactivation was not significantly different from that of the control slow component of inactivation. These data suggest that the fast mode of inactivation is inhibited by protein phosphorylation.
To strengthen our conclusion about the involvement of calcineurin in regulation of the 19-pS K+ channels, we tested a structurally unrelated compound, FK-506, which inhibits calcineurin by a mechanism different from that of CSA. FK-506 forms a calcineurin-inhibitory complex with the endogenous protein FKBP12 (18). The effects of FK-506 were qualitatively the same as observed with CSA (i.e., inactivation of 19-pS K+ was slowed as a result of the removal of the fast time constant). There were, however, slight differences in the effects of these compounds. FK-506 also caused a small but significant reduction in the slow time constant, in contrast to the effects of CSA. The decrease in peak current caused by FK-506 was also less than that observed with CSA. Previous experiments showed that FK-506 can affect inactivating K+ currents of cardiac myocytes by a mechanism unrelated to inhibition of calcineurin (6, 7). In our studies, FK-506 had effects on K+ channel inactivation kinetics qualitatively similar to those of CSA, suggesting that effects unrelated to calcineurin inhibition (i.e., direct FKBP12 modulation) were unlikely.
Calcineurin is known to modulate the activity of PP1 (see, e.g., Ref. 4). Calcineurin activates PP1 by dephosphorylating the inhibitory protein inhibitor-1. As a result, dephosphorylation events downstream of calcineurin could be mediated by PP1. This cascade renders PP1 activity partially dependent on intracellular calcium. Oka, an inhibitor of PP1, was shown to slow inactivation kinetics of expressed A-type K+ currents in HEK-293 cells and native A-type current in atrial myocytes (Refs. 20 and 22, respectively). We found that, like CSA and FK-506, Oka also decreased peak current and slowed the inactivation kinetics of the 19-pS K+ channels by removing the fast time component of inactivation. The amplitude and time constant of the slow component of inactivation were not affected by Oka. It should be noted that exposures of 30 min were required for the effects of Oka on the A-type current of atrial myocytes (22). We were able to resolve significant effects within 15-min exposures to Oka. Protein phosphatase 2A (PP2A) is also inhibited at the concentration of Oka used in our experiments; however, we found no effect of 10 nM Oka. This suggests that inhibition of PP2A (which occurs at much lower concentrations than inhibition of PP1; Ref. 21) does not play a substantial role in the regulation of 19-pS K+ channels. Together, our observations suggest that protein dephosphorylation-dependent regulation may be mainly due to the calcineurin-dependent activation of PP1 rather than a direct effect of calcineurin on the 19-pS K+ channels, although some regulation by direct action of calcineurin cannot be entirely excluded at the present time.
| |
ACKNOWLEDGEMENTS |
|---|
The authors are grateful to Rebecca L. Walker for the isolated murine colonic myocyte cDNA and to Dr. James Kenyon for valuable comments about the data and manuscript.
| |
FOOTNOTES |
|---|
This project was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-41315.
Address for reprint requests and other correspondence: K. M. Sanders, Dept. of Physiology and Cell Biology, Univ. of Nevada School of Medicine, Reno, NV 89557 (E-mail: kent{at}physio.unr.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 22 January 2001; accepted in final form 9 August 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Benitez-King, G,
Rios A,
Martinez A,
and
Anton-Tay F.
In vitro inhibition of Ca2+/calmodulin-dependent kinase II activity by melatonin.
Biochim Biophys Acta
1290:
191-196,
1996[Medline].
2.
Bywater, RA,
Small RC,
and
Taylor GS.
Neurogenic slow depolarizations and rapid oscillations in the membrane potential of circular muscle of mouse colon.
J Physiol (Lond)
413:
505-519,
1989
3.
Carl, A,
Kenyon JL,
Uemura D,
Fusetani N,
and
Sanders KM.
Regulation of Ca2+-activated K+ channels by protein kinase A and phosphatase inhibitors.
Am J Physiol Cell Physiol
261:
C387-C392,
1991
4.
Cohen, P.
The structure and regulation of protein phosphatases.
Annu Rev Biochem
58:
453-508,
1989[Web of Science][Medline].
5.
Connor, JA,
and
Stevens CF.
Voltage clamp studies of a transient outward membrane current in gastropod neural somata.
J Physiol (Lond)
213:
21-30,
1971
6.
DuBell, WH,
Gaa ST,
Lederer WJ,
and
Rogers TB.
Independent inhibition of calcineurin and K+ currents by the immunosuppressant FK-506 in rat ventricle.
Am J Physiol Heart Circ Physiol
275:
H2041-H2052,
1998
7.
DuBell, WH,
Lederer WJ,
and
Rogers TB.
K+ currents responsible for repolarization in mouse ventricle and their modulation by FK-506 and rapamycin.
Am J Physiol Heart Circ Physiol
278:
H886-H897,
2000
8.
Fraser, ED,
and
Walsh MP.
Dephosphorylation of calponin by type 2B protein phosphatase.
Biochemistry
34:
9151-9158,
1995[Medline].
9.
Hille, B.
Ionic Channels of Excitable Membranes. Sunderland, MA: Sinauer, 1992, p. 116-121.
10.
Hoger, JH,
Walter AE,
Vance D,
Yu L,
Lester HA,
and
Davidson N.
Modulation of a cloned mouse brain potassium channel.
Neuron
6:
227-236,
1991[Web of Science][Medline].
11.
Horowitz, B,
Ward SM,
and
Sanders KM.
Cellular and molecular basis for electrical rhythmicity in gastrointestinal muscles.
Annu Rev Physiol
61:
19-43,
1999[Web of Science][Medline].
12.
Koh, SD,
Perrino BA,
Hatton WJ,
Kenyon JL,
and
Sanders KM.
Novel regulation of the A-type K+ current in murine proximal colon by calcium-calmodulin-dependent protein kinase II.
J Physiol (Lond)
517:
75-84,
1999
13.
Koh, SD,
Ward SM,
Dick GM,
Epperson A,
Bonner HP,
Sanders KM,
Horowitz B,
and
Kenyon JL.
Contribution of delayed rectifier potassium currents to the electrical activity of murine colonic smooth muscle.
J Physiol (Lond)
515:
475-487,
1999
14.
McCormick, DA,
and
Huguenard JR.
A model of the electrophysiological properties of thalamocortical relay neurons.
J Neurophysiol
68:
1384-1400,
1992
15.
Morioka, M,
Fukunaga K,
Yasugawa S,
Nagahiro S,
Ushio Y,
and
Miyamoto E.
Regional and temporal alterations in Ca2+/calmodulin-dependent protein kinase II and calcineurin in the hippocampus of rat brain after transient forebrain ischemia.
J Neurochem
58:
1798-1809,
1992[Web of Science][Medline].
16.
Peretz, A,
Abitbol I,
Sobko A,
Wu CF,
and
Attali B.
A Ca2+/calmodulin-dependent protein kinase modulates Drosophila photoreceptor K+ currents: a role in shaping the photoreceptor potential.
J Neurosci
18:
9153-9162,
1998
17.
Perrino, BA,
Fong YL,
Brickey DA,
Saitoh Y,
Ushio Y,
Fukunaga K,
Miyamoto E,
and
Soderling TR.
Characterization of the phosphatase activity of a baculovirus-expressed calcineurin A isoform.
J Biol Chem
267:
15965-15969,
1992
18.
Perrino, BA,
and
Soderling TR.
Biochemistry and pharmacology of calmodulin-regulated phosphatase calcineurin.
In: Calmodulin and Signal Transduction, edited by Watterson DM,
and Van Eldik LJ.. San Diego, CA: Academic, 1998, p. 169-236.
19.
Rae, MG,
Fleming N,
McGregor DB,
Sanders KM,
and
Keef KD.
Control of motility patterns in the human colonic circular muscle layer by pacemaker activity.
J Physiol (Lond)
510:
309-320,
1998
20.
Roeper, J,
Lorra C,
and
Pongs O.
Frequency-dependent inactivation of mammalian A-type K+ channel Kv1.4 regulated by Ca2+/calmodulin-dependent protein kinase.
J Neurosci
17:
3379-3391,
1997
21.
Stemmer, P,
and
Klee CB.
Serine/threonine phosphatases in the nervous system.
Curr Opin Neurobiol
1:
53-64,
1991[Medline].
22.
Tessier, S,
Karczewski P,
Krause EG,
Pansard Y,
Acar C,
Lang-Lazdunski M,
Mercadier JJ,
and
Hatem SN.
Regulation of the transient outward K+ current by Ca2+/calmodulin-dependent protein kinases II in human atrial myocytes.
Circ Res
85:
810-819,
1999
23.
Wilson, AJ,
Jabr RI,
and
Clapp LH.
Calcium modulation of vascular smooth muscle ATP-sensitive K+ channels: role of protein phosphatase-2B.
Circ Res
87:
1019-1025,
2000
This article has been cited by other articles:
![]() |
S. G. Birnbaum, A. W. Varga, L.-L. Yuan, A. E. Anderson, J. D. Sweatt, and L. A. Schrader Structure and Function of Kv4-Family Transient Potassium Channels Physiol Rev, July 1, 2004; 84(3): 803 - 833. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Prasad and R. K. Goyal Differential modulation of voltage-dependent K+ currents in colonic smooth muscle by oxidants Am J Physiol Cell Physiol, March 1, 2004; 286(3): C671 - C682. [Abstract] [Full Text] |
||||
![]() |
G. C. Amberg, S. D. Koh, Y. Imaizumi, S. Ohya, and K. M. Sanders A-type potassium currents in smooth muscle Am J Physiol Cell Physiol, March 1, 2003; 284(3): C583 - C595. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ohya and B. Horowitz Differential transcriptional expression of Ca2+ BP superfamilies in murine gastrointestinal smooth muscles Am J Physiol Gastrointest Liver Physiol, December 1, 2002; 283(6): G1290 - G1297. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. C Amberg, S. D. Koh, W. J Hatton, K. J Murray, K. Monaghan, B. Horowitz, and K. M Sanders Contribution of Kv4 channels toward the A-type potassium current in murine colonic myocytes J. Physiol., October 15, 2002; 544(2): 403 - 415. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. C Amberg, S. A Baker, S. D. Koh, W. J Hatton, K. J Murray, B. Horowitz, and K. M Sanders Characterization of the A-type potassium current in murine gastric antrum J. Physiol., October 15, 2002; 544(2): 417 - 428. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |