Am J Physiol Cell Physiol AJP: Lung Cellular and Molecular Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 281: C2020-C2028, 2001;
0363-6143/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Amberg, G. C.
Right arrow Articles by Sanders, K. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Amberg, G. C.
Right arrow Articles by Sanders, K. M.
Vol. 281, Issue 6, C2020-C2028, December 2001

Regulation of A-type potassium channels in murine colonic myocytes by phosphatase activity

Gregory C. Amberg, Sang Don Koh, Brian A. Perrino, William J. Hatton, and Kenton M. Sanders

Department of Physiology and Cell Biology, University of Nevada School of Medicine, Reno, Nevada 89557


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

A rapidly inactivating K+ current (A-type current) participates in the regulation of colonic muscle excitability. We found 19-pS K+ channels in cell-attached patches of murine colonic myocytes that activated and inactivated with kinetics similar to the A-type current. The A-type current in colonic myocytes is regulated by Ca2+/calmodulin-dependent protein kinase II. Therefore, we studied regulation of the 19-pS K+ channels by Ca2+-dependent phosphorylation/dephosphorylation. The rates of inactivation of ensemble-averaged currents resulting from 19-pS K+ channels were increased by the calmodulin antagonist W-7. Inhibitors of calcineurin, cyclosporin A and FK-506, slowed the inactivation of the 19-pS K+ channels. Okadaic acid, an inhibitor of the calcineurin/inhibitor-1/protein phosphatase 1 cascade, also slowed inactivation of the 19-pS K+ channels. Polymerase chain reaction detected transcripts encoding calcineurin A in isolated colonic smooth muscle cells, and immunohistochemical studies demonstrated specific expression of calcineurin A-like immunoreactivity in colonic muscle tissues and in colonic myocytes. These data, when considered with previous findings, suggest that Ca2+-dependent phosphorylation/dephosphorylation regulates the A-type current in murine colonic smooth muscle cells.

calcineurin; calcium/calmodulin-dependent protein kinase II; gastrointestinal motility


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

CALCIUM ACTION POTENTIAL COMPLEXES riding on the crests of slow waves are characteristic of the rhythmic electrical activity of colonic smooth muscles of mouse and human (2, 13, 19). The responses of colonic smooth muscle cells to slow wave depolarizations are modulated by the K+ currents present in the myocytes (see, e.g., Ref. 11). We showed (13) that a rapidly inactivating, 4-aminopyridine (4-AP)-sensitive K+ current (A-type current) is an important regulator of electrical activity in the murine proximal colon. This current has properties reminiscent of the Kv4 family of K+ channels, but the molecular identity of the A-type current is unknown at present. We reported previously (12) that the A-type current in colonic myocytes is regulated by Ca2+/calmodulin-dependent protein kinase II (CaMKII). Dialysis of cells with autothiophosphorylated CaMKII slowed the inactivation kinetics of the A-type current, and CaMKII inhibitors increased the rate of inactivation in a reciprocal fashion.

A-type currents are thought to participate in regulation of the interspike period between action potentials in cells that undergo repetitive firing (5, 9, 14). Although previous work examined the effects of Ca2+-dependent phosphorylation on the kinetics of A-type current channels (10, 12, 16, 20, 22), little is currently known about the regulation of A-type currents by phosphatases in smooth muscle.

In the present study we have examined the role of Ca2+-dependent dephosphorylation on the inactivation kinetics of the channels likely to be responsible for the A-type current in colonic myocytes. We hypothesize that Ca2+-dependent dephosphorylation via the activity of calcineurin, a Ca2+-dependent protein phosphatase, will have effects opposite to those of CaMKII (i.e., phosphatase activity speeds inactivation whereas phosphatase inhibition would tend to slow inactivation). We have also investigated the expression of calcineurin in colonic myocytes using the polymerase chain reaction (PCR) and immunohistochemical techniques. If this hypothesis is correct, the phosphorylation/dephosphorylation balance, both modulated by Ca2+, will determine the kinetic and functional properties of the A-type current in vivo.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Preparation of isolated myocytes. Smooth muscle cells were prepared from the tunica muscularis of colons removed from BALB/c mice. Briefly, mice were anesthetized with chloroform and killed by cervical dislocation. After death, the proximal colon was removed and opened along the longitudinal axis. The resulting sheets were pinned out in a Sylgard-lined dish and washed with Ca2+-free phosphate-buffered saline (PBS) containing (in mM) 125 NaCl, 5.36 KCl, 15.5 NaOH, 0.336 Na2HPO4, 0.44 KH2PO4, 10 glucose, 2.9 sucrose, and 11 HEPES, adjusted to pH 7.4 with Tris. Mucosa and submucosa were removed with fine-tipped forceps. The Institutional Animal Care and Use Committee approved the housing and protocols for the killing of animals.

Pieces of muscle were incubated in a Ca2+-free solution (see above) supplemented with 4 mg/ml fatty acid-free bovine serum albumin (BSA; Sigma), 20 U/ml papain (Sigma), 270 U/ml collagenase (Worthington Biochemical), and 1 mM dithiothreitol (Sigma); tissue was incubated at 37°C in this enzyme solution for 8-12 min and then washed with Ca2+-free solution. Tissue pieces were gently agitated to create a cell suspension. Dispersed cells were stored at 4°C in Ca2+-free solution supplemented with minimum essential medium for suspension culture (S-MEM; Sigma) and (in mM) 0.5 CaCl2, 0.5 MgCl2, 4.17 NaHCO3, and 10 HEPES, adjusted to pH 7.4 with Tris. Experiments were performed at room temperature within 6 h of dispersing cells. Aliquots of cells were pipetted into a perfused recording chamber mounted on an inverted microscope. The cells were allowed to adhere to the glass bottom of the chamber for 5 min before recording.

The resulting myocytes were from both the longitudinal and the circular smooth muscle layers. Because the circular layer is thicker than the longitudinal layer, it is likely that the majority of the cells were from the circular layer. As described previously (13), we found no significant differences in the inactivation kinetics and pharmacology of isolated longitudinal and circular myocytes.

Voltage-clamp studies. Cell-attached voltage-clamp experiments were used to record single-channel membrane currents from colonic myocytes. Amphotericin-perforated whole cell recordings were used to record macroscopic current. All experiments were performed at room temperature (25°C). Currents were amplified with an Axopatch 200B (Axon Instruments). The currents were digitized with a DigiData 1200 A/D converter (Axon Instruments), and data were recorded and stored on-line using pCLAMP 6 software (Axon Instruments). Single-channel data were filtered at 0.5 kHz, and whole cell data were filtered at 1 kHz. For single-channel recordings, linear leak and capacitance current was removed by null (no open channels) trace subtraction. Ensemble-averaged currents were generated from 60 test traces; exponential decays were fit with either a monoexponential [I(t) = A1 × e(-t/tau 1) + Ainfinity ] or a double exponential [I(t)=A1 × e(-t/tau 1) + A2 × e(-t/tau 2) + Ainfinity ] as determined by goodness of fit, where I is current, t is time, A1 and A2 are the amplitudes of the exponential terms for time constants of inactivation (tau ) tau 1 and tau 2, and Ainfinity is the constant representing the steady-state current level. Although variability was observed among cells, the time constants of inactivation did not differ significantly under control conditions (i.e., before drug addition) between the treatment groups (P > 0.05).

For recording K+ channel currents in cell-attached patches, the bath solution contained (in mM) 140 KCl, 1 EGTA, 0.61 CaCl2, and 10 HEPES, adjusted to pH 7.4 with Tris. In these experiments the pipette solution contained (in mM) 5 KCl, 135 NaCl, 2 MnCl2, 10 glucose, 1.2 MgCl2, and 10 HEPES, adjusted to pH 7.4 with Tris with no added calcium. For experiments performed under symmetric K+ conditions (140 mM/140 mM), the bath solution (as above) also served as the pipette solution. For whole cell recordings, the myocytes were bathed in a Ca2+-free solution containing (in mM) 5 KCl, 135 NaCl, 2 MnCl2, 10 glucose, 1.2 MgCl2, 10 HEPES, and 5 tetraethylammonium chloride (TEA), adjusted to pH 7.4 with Tris. In these experiments, the pipette solution contained (in mM) 140 KCl, 0.5 EGTA, and 5 HEPES, adjusted to pH 7.2 with Tris. Amphotericin B (90 mg/ml; Sigma) was dissolved in DMSO, sonicated, and diluted in the pipette solution to give a final concentration of 270 µg/ml. W-7, okadaic acid (Oka; Calbiochem), cyclosporin A (CSA; Sigma), and FK-506 (Fujisawa) were dissolved in DMSO, and the desired concentrations were obtained by further dilution in the extracellular solution. These agents were applied after completion of control recordings by exchanging the external solution in a continuous fashion. The final concentration of DMSO was <0.05%. In control experiments, 0.05% DMSO had no effect on A-type K+ currents of murine colonic myocytes (n = 10).

Isolation of RNA from murine circular smooth muscle cells and RT-PCR. Murine colonic circular smooth muscle cells were isolated as described in Preparation of isolated myocytes. Cells were allowed to settle in a glass-bottomed chamber located on an inverted microscope. Individual myocytes were selected by the same criteria used during electrophysiological experiments (elongated, spindle-shaped cells, 100-500 µm long, 5-10 µm in diameter) and aspirated into large-bore pipettes (tip diameters >10 µm). After 60 smooth muscle cells were collected, the contents of the pipette were expelled into RNase-free tubes, frozen in liquid nitrogen, and stored at -70°C.

Total RNA was prepared from collected colonic myocytes using SNAP Total RNA isolation kits (Invitrogen) according to the manufacturer's instructions, including the use of polyinosinic acid (20 µg) as an RNA carrier. First-strand cDNA was prepared from the RNA preparations using the SuperScript II reverse transcriptase kit (GIBCO-BRL); 500 µg/µl of oligo(dT) primers and random oligonucleotides were used together to reverse transcribe the RNA sample.

The cDNA reverse transcription products were amplified with calcineurin-specific primers by PCR. The oligonucleotides 5'CGAGGATTCTCTCCACCACAT3' and 5'TGCGGTGTTCAGAGAATTGA3' were used to amplify a 131-base pair product of the calcineurin A beta -subunit. The oligonucleotides 5'ACGGTGGTTTGTCTCCAGAGA3' and 5'GAGTGAAATGTTCCTGAGTCTT3' were used to amplify a 153-base pair product of the calcineurin A alpha -subunit. The reaction volumes for PCR were 25 µl, including 5 µl of cDNA. Hot-start PCR was used, and the DNA was amplified by 40 cycles of 94°C (30 s), 60°C (1 min), and 72°C (30 s), followed by 1 cycle of 72°C (5 min). Aliquots of the PCR reactions were analyzed by 1% agarose gel electrophoresis and visualized by SYBR Green I (Molecular Probes) fluorescence. PCR amplification products were extracted, and identities were confirmed by sequencing. As a control, PCR primers specific for beta -actin (V01217) nucleotides 2383-2402 and 3071-3091 were used to establish that the cDNA prepared was nongenomic. The beta -actin-specific primers amplified only the intronless amplification product from all cDNA samples, indicating that these preparations were free of genomic DNA contamination (data not shown).

Immunohistochemistry. Mouse proximal colon was collected and flushed with PBS, pH 7.4. The tissues were fixed with paraformaldehyde (4%) in PBS for 20 min. The fixed sections of colon were cryoprotected in increasing gradients of sucrose in PBS (5%, 10%, and 15%) for 30 min each and in 20% sucrose in PBS overnight. Tissue was then embedded in Tissue Tek embedding medium (Miles) and 20% sucrose in PBS (1:2, vol/vol) and rapidly frozen in isopentane precooled in liquid nitrogen. Cryosections were cut at 8 µm on a cryotome (Leica CM 3050); endogenous peroxide was quenched by incubation in 1% hydrogen peroxide in PBS for 15 min. The sections were then blocked in 1% BSA containing 0.1% Triton X-100 for 1 h at room temperature. Excess blocking serum was removed, and sections were incubated with 1:100 primary antibody (anti-calcineurin A or anti-calcineurin B) for 24 h at 4°C. The anti-calcineurin A antibody is a rabbit polyclonal antibody (a gift from Dr. Kohji Fukunaga, Kumamoto University School of Medicine, Kumamoto, Japan; Ref. 15). The anti-calcineurin B antibody is a rabbit polyclonal antibody from Affinity Bioreagents. Biotinylated goat anti-rabbit immunoglobulin and horseradish peroxidase-conjugated anti-biotin antibody were then applied to the sections for 30 min at room temperature. The sections were washed twice between each step. Peroxidase activity was visualized by applying 3,3'-diaminobenzidine containing 0.05% hydrogen peroxidase for 4-8 min at room temperature. The sections were rinsed in tap water, dehydrated, cleared, and mounted with coverslips. Two negative control sections were incorporated for each antibody and were processed as above except that primary antibodies were substituted with 1) PBS and 2) antibody that had been preabsorbed (2 h at room temperature) with purified full-length recombinant calcineurin A (17) and calcineurin B (B. A. Perrino, unpublished data). Slides were viewed and photomicrographs were made using a Nikon eclipse E600 microscope incorporating Normarski optics.

Statistical methods. Data are reported as means ± SE, and n refers to the number of patches from which recordings were made. Statistical significance was evaluated by Student's paired t-test or one-way analysis of variance. P values <0.05 were considered significant.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Calmodulin antagonism increases rate of inactivation of 19-pS K+ conductance with properties similar to that of whole cell A-type current. In a previous study (12) we showed that CaMKII regulates the A-type K+ current in colonic myocytes. The cell-attached configuration of the patch-clamp technique was used to identify single-channel currents that might contribute to the A-type K+ current observed in whole cell recordings. In these experiments we used external solutions containing 100 nM Ca2+ and pipette solutions containing 2 mM Mn2+ to minimize Ca2+-activated K+ currents (see METHODS for other solution components). Membrane patches were held at -80 mV and stepped for 4 s to various test potentials. Depolarization transiently activated single K+ currents. Unitary currents were recorded in symmetric (140 mM/140 mM) and asymmetric (5 mM/140 mM) K+ gradients. In symmetric K+ gradients the currents reversed at ~0 mV and had a single-channel conductance of 19 ± 1 pS (Fig. 1B; n = 3). Outward currents observed in asymmetric K+ (5 mM/140 mM) gradients increased in amplitude as a function of depolarization in a nonlinear fashion. The current-voltage relationship was well fit with the Goldman-Hodgkin-Katz equation for the K+ gradient. The extrapolated reversal potential with an asymmetric K+ gradient was approximately -80 mV, close to the calculated equilibrium potential (EK) for the solutions used (Fig. 1; n = 5). The presence of 2 mM Mn2+ in the pipette solution had no effect on the K+ channels (n = 20). Channel "rundown" was not observed in cell-attached control recordings lasting >30 min.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 1.   Current-voltage relationship of 19-pS K+ channels in colonic myocytes. A: single-channel currents recorded from a colonic myocyte with the cell-attached patch-clamp technique. Membrane potential was stepped for 4 s from -80 mV to potentials between -20 and +60 mV in 20-mV increments under asymmetric K+ gradients. Dashed lines indicate open channels; solid lines indicate closed channels. B: single-channel current as a function of voltage under asymmetric (open circle ) and symmetric () K+ gradients. SE bars are included at all points. The asymmetric K+ data were fit with the Goldman-Hodgkin-Katz (GHK) equation; the symmetric K+ data were fit by linear regression.

As a further test of whether the 19-pS K+ channels might contribute to the A-type current in colonic myocytes, we tested the effects of 4-AP and TEA ions. 4-AP (5 mM) reduced single-channel open probability by decreasing mean open time, and inclusion of 10 mM TEA in the pipette solution was without effect (data not shown). The sensitivity of these channels to 4-AP and their relative lack of sensitivity to TEA are consistent with the pharmacology of the A-type current in colonic myocytes (13).

We also tested the effects of blocking Ca2+/calmodulin-dependent enzymes on the A-type K+ current to develop a further means of relating the 19-pS single-channel conductance to the A-type current. For these experiments we used W-7, which inhibits the activity of CaMKII by blocking its activation by Ca2+/calmodulin (1). Ensemble-averaged currents representing 60 test steps to 0 mV are shown in Fig. 2. W-7 exposure resulted in a reduction in peak current by 34.6 ± 7.3% (P < 0.05, n = 5). The ensemble-averaged currents were fit with a double exponential with time constants of inactivation comprised of fast (tau F) and slow (tau S) components (tau F = 99 ± 28 ms and tau S = 750 ± 14 ms). These values are similar to those measured in whole cell currents under similar conditions (i.e., tau F = 60 ± 6 ms and tau S = 1,207 ± 104 ms; n = 3; Fig. 2C, inset). W-7 (10 µM) increased the rate of inactivation of the 19-pS K+ channels, and ensemble-averaged currents were fit with a double exponential having time constants of 49 ± 8 and 561 ± 23 ms (P < 0.05 for both values; n = 5). Examination of the amplitudes of each component of inactivation revealed that W-7 reduced the amplitude of the slow component by 60.7 ± 10.9% (P < 0.05, n = 5). The amplitude of the fast component was unchanged (P > 0.05, n = 5). These findings indicate that the proportion of total inactivation from the fast component was increased by W-7 from 42 ± 2.5% to 61 ± 5% (P < 0.05; n = 5) via a reduction in the contribution by the slow component. The effects of W-7 were apparent 5 min after exposure and were partially reversed by a 20-min washout period. Thus the kinetics of the 19-pS channels, their sensitivity to K+ channel inhibitors, and the increase in the rate of inactivation in response to W-7 suggest that the 19-pS channels contribute to the A-type current recorded under whole cell conditions.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 2.   W-7 speeds inactivation of 19-pS K+ channels. A and B: single-channel currents recorded from a colonic myocyte with the cell-attached patch technique before (A) and after (B) W-7 (10 µM; 5-min application). The patch potential was stepped for 4 s from -80 to 0 mV. Dashed lines indicate open channels; solid lines indicate closed channels. C: ensemble-averaged single-channel currents from 1 cell before (control) and after W-7. Solid lines represent the best exponential fit for the inactivation before and in response to W-7. Inset: for comparison to whole cell responses (see, e.g., Ref. 12), a whole cell perforated-patch recording in the presence of tetraethylammonium chloride (TEA; 5 mM) before and after W-7 (10 µM) is shown. Cell was stepped from -80 to 0 mV. D: summary of inactivation time constants (tau ) from ensemble-averaged single K+ channel recordings from 5 colonic myocytes. *Significant difference from control (P < 0.05). tau F, fast component; tau S, slow component.

Inhibition of calcineurin by CSA and FK-506 removes the fast component of inactivation of 19-pS K+ channels in isolated murine myocytes. After characterizing the effects of W-7 on the 19-pS inactivating K+ channels, we examined regulation of these channels by Ca2+-dependent dephosphorylation by calcineurin. Calcineurin is inhibited by the immunosuppressant CSA (see, e.g., Ref. 18). In these experiments using the experimental conditions described above, depolarization to 0 mV activated K+ channels that inactivated with tau F of 94 ± 38 ms and tau S of 938 ± 196 ms, with the fast component contributing to 36 ± 4% of total inactivation. CSA (1 µM) reduced the peak current by 47.2 ± 5.8% (P < 0.05, n = 5). CSA also eliminated tau f such that the inactivation was fit with a single exponential (tau CSA = 1,076 ± 363 ms) that was not significantly different from the second (slow) phase of inactivation under control conditions (Fig. 3; P > 0.05; n = 5). Furthermore, the amplitude of tau CSA was not significantly different from that of tau S under control conditions (P > 0.05, n = 5). In agreement with this finding, previous studies (12) showed that intracellular application of activated CaMKII results in whole cell A-type currents fit by a single slow time constant. The effects of CSA developed within 15 min, and washout periods >20 min were ineffective in producing reversal of the effects. These experiments suggest that calcineurin is active in murine colonic myocytes and that inhibition of calcineurin activity has effects similar to application of CaMKII.


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 3.   Cyclosporin A (CSA) slows inactivation of 19-pS K+ channels. A and B: single-channel currents recorded from a colonic myocyte with the cell-attached patch technique before (A) and after (B) CSA (1 µM; 15-min application). The patch potential was stepped for 4 s from -80 to 0 mV. Dashed lines indicate open channels; solid lines indicate closed channels. C: ensemble-averaged single-channel currents from 1 cell before and after CSA. Solid lines represent the best exponential fit for the inactivation before and in response to CSA. D: summary of inactivation time constants from ensemble-averaged single K+ channel recordings from 5 colonic myocytes. tau CSA, tau  after CSA.

The macrolide antibiotic FK-506 also inhibits calcineurin, but by a different mechanism than that of CSA. FK-506 (1 µM) reduced peak current by 24.4 ± 7.3% (P < 0.05; n = 5). The decrease in peak current by FK-506 was significantly less than that observed with CSA (P < 0.05, n = 5). FK-506 also changed the inactivation kinetics of the 19-pS channels from a double exponential decay with tau f = 146 ± 47 ms (representing 48 ± 9% of the total inactivation) and tau s = 1,552 ± 397 ms to a single exponential with a time constant tau FK-506 = 829 ± 139 ms (Fig. 4; n = 5). The ensemble-averaged currents observed after FK-506 were fit by a single exponential; however, tau FK-506 was significantly smaller than tau s in the control recordings (P < 0.05; n = 5). As with CSA, FK-506 resulted in a slow component of inactivation with an amplitude that was not significantly different from the amplitude of tau S under control conditions (P > 0.05, n = 5). The effects of FK-506 were observed within 15 min and were not appreciably reversible with washout. These data show that inhibition of calcineurin by two structurally unrelated compounds results in slowing of the inactivation of the 19-pS K+ channels.


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 4.   FK-506 slows inactivation of 19-pS K+ channels. A and B: single-channel currents recorded from a colonic myocyte with the cell-attached patch technique before (A) and after (B) FK-506 (1 µM; 15-min application). The patch potential was stepped for 4 s from -80 to 0 mV. Dashed lines indicate open channels; solid lines indicate closed channels. C: ensemble-averaged single-channel currents from 1 cell before and after FK-506. Solid lines represent the best exponential fit for the inactivation before and in response to FK-506. D: summary of inactivation time constants from ensemble-averaged single K+ channel recordings from 5 colonic myocytes. tau FK506, tau  after FK-506. *Significant difference from control tau S (P < 0.05).

Inhibition of protein phosphatase 1 by Oka removes the fast component of inactivation of 19-pS K+ channels in isolated murine myocytes. Calcineurin activity is known to activate protein phosphatase 1 (PP1) by dephosphorylation of PP1 inhibitory peptide inhibitor-1 (see, e.g., Ref. 4). It is therefore possible that the effects of CSA and FK-506 on the 19-pS K+ channels occur via a decrease in calcineurin-mediated PP1 activation. Oka, an inhibitor of PP1, was used to test this hypothesis. Under control conditions, inactivations of ensemble-averaged currents due to the 19-pS channels were fit with double exponentials with fast (tau F = 142 ± 58 ms; 43 ± 5% total inactivation) and slow (tau S = 1,283 ± 200 ms) components. Addition of Oka (100 nM) reduced peak current by 36.0 ± 11.8.% (P < 0.05, n = 5). The decrease in peak current by Oka was not significantly different from that observed with CSA (P > 0.05, n = 5). As with CSA and FK-506, Oka exposure caused an elimination of tau f, leaving a single slow time constant of 958 ± 95 ms (Fig. 5). The amplitude and tau  value of single exponential decay observed after exposure to Oka was not significantly different from the second (slow) phase of inactivation under control conditions (P > 0.05; n = 5). Oka showed a time course similar to that seen with the inhibitors of calcineurin (effects within 15 min), and the effects were not reversible with washout. Oka concentrations of <= 10 nM were without effect (not shown). For comparative purposes, a summary of tau  values and their respective amplitudes is given in Table 1.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 5.   Okadaic acid (Oka) slows inactivation of 19-pS K+ channels. A and B: single-channel currents recorded from a colonic myocyte with the cell-attached patch technique before (A) and after (B) Oka (100 nM; 15-min application). The patch potential was stepped for 4 s from -80 to 0 mV. Dashed lines indicate open channels; solid lines indicate closed channels. C: ensemble-averaged single-channel currents from 1 cell before and after Oka. Solid lines represent the best exponential fit for the inactivation before and in response to Oka. D: summary of inactivation time constants from ensemble-averaged single K+ channel recordings from 5 colonic myocytes. tau Oka, tau  after Oka.


                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Time constants of inactivation of 19pS K+ channels in control conditions and after application of calmodulin or phosphatase inhibitors

Expression of calcineurin by murine proximal colonic myocytes. RT-PCR was used to determine whether mRNA encoding calcineurin isoforms was expressed in murine proximal colonic myocytes. Primers specific for the alpha - and beta -subunits of calcineurin A amplified transcripts from isolated colonic myocytes of 131 and 153 base pairs for each primer, respectively (not shown). Transcript identity was confirmed by sequence analysis of the RT-PCR products.

Antibodies raised against specific epitopes of calcineurin A and B were used to assess calcineurin A-like and calcineurin B-like immunoreactivity in the murine proximal colon. Calcineurin A-like immunoreactivity was observed within individual myocytes of the longitudinal and circular muscle layers of the external muscularis (Fig. 6, A and B). Intense immunoreactivity is also found within the enteric ganglia. In contrast to calcineurin A, calcineurin B-like immunoreactivity was not resolved in smooth muscle cells. Cells within the enteric ganglia and fibers within the muscle layers were immunopositive for calcineurin B (Fig. 6, C and D). Immunoreactivity was not observed in control sections in which primary antibodies were omitted or in sections in which primary antibodies were preabsorbed with purified recombinant full-length calcineurin A or B (not shown).


View larger version (132K):
[in this window]
[in a new window]
 
Fig. 6.   Calcineurin A-like and calcineurin B-like immunoreactivity in murine proximal colon (hematoxylin counterstain). A: calcineurin A-like immunoreactivity (in brown) exhibited within both the longitudinal and circular muscle layers of the external muscularis and more intense staining of enteric ganglia within the deep muscular plexus of the submucosa and in the myenteric plexus between the circular and longitudinal muscle layers (arrows). Scale bar, 50 µm. B: higher magnification of calcineurin A-like immunoreactivity (in brown) exhibited within individual smooth muscle cells of both the longitudinal and circular muscle layers of the external muscularis (arrowheads) and more intense staining of enteric ganglia within the myenteric plexus between the circular and longitudinal muscle layers (arrow). Scale bar, 20 µm. C: calcineurin-B like immunoreactivity (in brown) exhibited within enteric ganglia within the deep muscular plexus of the submucosa and in the myenteric plexus between the circular and longitudinal muscle layers (arrows). Little or no immunoreactivity is seen within the longitudinal and circular muscle layers of the external muscularis; however, note immunoreactivity within nerve fiber bundles coursing through the circular muscle layer (arrowheads). Scale bar, 50 µm. D: higher magnification of calcineurin B-like immunoreactivity (in brown) exhibited within the myenteric plexus (enteric ganglia) between the circular and longitudinal muscle layers and within a nerve fiber bundle (arrow). Also evident is the lack of immunoreactivity within individual smooth muscle cells of both the longitudinal and circular muscle layers of the external muscularis. Scale bar, 20 µm. cm, Circular muscularis; lm, longitudinal muscularis; eg, enteric ganglia.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

In previous studies of murine colonic myocytes we identified (13) an A-type K+ current that displays rapid activation (tens of milliseconds) and inactivation (hundreds of milliseconds). This current serves to dampen excitability and generation of action potentials in intact strips of colon muscle and could be a factor in the maintenance of the phasic nature of contractions in colonic motility. Although the molecular nature of this current is unknown, qualitative PCR amplification of mRNA isolated from these cells suggests that the Kv4 family isoforms could be responsible for the conductance (13). Previous studies found no evidence for expression of Kv1.4 in murine colonic myocytes (13). During characterization of the A-type current, it was noted that the kinetics of inactivation were affected by Ca2+ buffering. Subsequent examination of this phenomenon revealed that CaMKII activity slowed current inactivation (12). Because of the importance of the A-type current in modulating excitability in colonic muscles (see, e.g., Ref. 13), regulation of this current via protein phosphorylation might play an important role in Ca2+-dependent regulation of gastrointestinal motility.

In the present study we identified 19-pS K+ channels that may underlie macroscopic whole cell A-type currents in colonic myocytes. These channels rapidly inactivated with kinetics similar to those of the A-type current and were blocked by 4-AP, whereas TEA was without effect. From previous studies showing regulation of the A-type current by CaMKII, we hypothesized that antagonism of calmodulin activation of CaMKII activity would increase the rate of inactivation of the channels responsible for the A-type current. Inclusion of W-7 in the bathing solution increased the rate of inactivation of the 19-pS K+ channels by reducing the time constants of inactivation and increasing the relative contribution of the fast component of inactivation by reducing the amplitude of the slow component. W-7 also caused a decrease in peak current, which is consistent with the observed increase in the rate of inactivation. Similar regulation of the A-type current occurred under whole cell conditions, and others have shown that A-type currents in atrial myocytes (in which calmodulin was antagonized with calmidazolium; Ref. 22) and in Drosophila photoreceptors (in which W-7 was used; Ref. 16) are regulated in a similar manner. Together, our data suggest that the 19-pS K+ channels we observed contribute to macroscopic A-type currents in colonic myocytes.

To further characterize the 19-pS K+ channel, and to continue our investigation of Ca2+-dependent regulation of the electrical activity of colonic smooth muscle, we examined the effects of inhibition of Ca2+-dependent dephosphorylation on the kinetics of inactivation of the A-type current in colonic myocytes. Preliminary experiments to investigate this question performed in the whole cell configuration proved to be problematic. We observed, in agreement with previous reports (3, 23), that contaminating outward currents were enhanced by exposure of cells to phosphatase inhibitors. Furthermore, treatment with phosphatase inhibitors also produced changes in the resting current at a holding potential equal to the calculated EK (e.g., -80 mV), suggesting that currents other than K+ currents can be activated in response to phosphatase inhibition. These observations are not surprising considering the wide range of cellular substrates of protein phosphatases. In light of the problems of current isolation in whole cell experiments, we investigated regulation by Ca2+-dependent phosphatases of K+ current at the single-channel level to reduce contamination. Additionally, responses to test potentials of 0 mV were used to eliminate contamination from nonselective cation currents.

Calcineurin is a ubiquitous multifunctional Ca2+/calmodulin-dependent protein phosphatase found extensively in neurons. Previous work using immunofluorescence microscopy of single smooth muscle cells has shown that calcineurin is present in rabbit stomach smooth muscle (8). We confirmed the expression of calcineurin in gastrointestinal muscles with RT-PCR to identify mRNA transcripts encoding calcineurin A in isolated smooth muscle cells of the murine colon. We examined calcineurin expression at the protein level by immunohistochemical methods and found that calcineurin-like immunoreactivity was also specifically localized within colonic myocytes. Calcineurin A-like immunoreactivity, but not calcineurin B-like immunoreactivity, was found in circular and longitudinal colonic myocytes. Of additional interest not directly related to the present study, we also found that enteric neurons expressed calcineurin A and B isoforms.

CSA disrupts calcineurin activity by interacting with the endogenous protein cyclophilin to form a calcineurin-inhibitory complex (see, e.g., Ref. 18). Inhibition of Ca2+-dependent phosphorylation (via inhibition of calmodulin or CaMKII) was shown to increase the rate of inactivation of the A-type current (Ref. 12 and this study). Therefore, we hypothesized that inhibition of dephosphorylation by calcineurin might have opposite effects. Regulation of A-type currents by this mechanism was demonstrated previously in HEK-293 cells expressing the fast-inactivating Shaker-related K+ channel Kv1.4 (20). Before CSA exposure, the kinetics of inactivation of the 19-pS K+ channels was best fit with a double exponential having fast and slow components. Inclusion of CSA resulted in an inactivation pattern consisting of a single slow time constant that was not significantly different from the slow time constant under control conditions. Furthermore, the amplitude of the slow component of inactivation was not significantly different from that of the control slow component of inactivation. These data suggest that the fast mode of inactivation is inhibited by protein phosphorylation.

To strengthen our conclusion about the involvement of calcineurin in regulation of the 19-pS K+ channels, we tested a structurally unrelated compound, FK-506, which inhibits calcineurin by a mechanism different from that of CSA. FK-506 forms a calcineurin-inhibitory complex with the endogenous protein FKBP12 (18). The effects of FK-506 were qualitatively the same as observed with CSA (i.e., inactivation of 19-pS K+ was slowed as a result of the removal of the fast time constant). There were, however, slight differences in the effects of these compounds. FK-506 also caused a small but significant reduction in the slow time constant, in contrast to the effects of CSA. The decrease in peak current caused by FK-506 was also less than that observed with CSA. Previous experiments showed that FK-506 can affect inactivating K+ currents of cardiac myocytes by a mechanism unrelated to inhibition of calcineurin (6, 7). In our studies, FK-506 had effects on K+ channel inactivation kinetics qualitatively similar to those of CSA, suggesting that effects unrelated to calcineurin inhibition (i.e., direct FKBP12 modulation) were unlikely.

Calcineurin is known to modulate the activity of PP1 (see, e.g., Ref. 4). Calcineurin activates PP1 by dephosphorylating the inhibitory protein inhibitor-1. As a result, dephosphorylation events downstream of calcineurin could be mediated by PP1. This cascade renders PP1 activity partially dependent on intracellular calcium. Oka, an inhibitor of PP1, was shown to slow inactivation kinetics of expressed A-type K+ currents in HEK-293 cells and native A-type current in atrial myocytes (Refs. 20 and 22, respectively). We found that, like CSA and FK-506, Oka also decreased peak current and slowed the inactivation kinetics of the 19-pS K+ channels by removing the fast time component of inactivation. The amplitude and time constant of the slow component of inactivation were not affected by Oka. It should be noted that exposures of 30 min were required for the effects of Oka on the A-type current of atrial myocytes (22). We were able to resolve significant effects within 15-min exposures to Oka. Protein phosphatase 2A (PP2A) is also inhibited at the concentration of Oka used in our experiments; however, we found no effect of 10 nM Oka. This suggests that inhibition of PP2A (which occurs at much lower concentrations than inhibition of PP1; Ref. 21) does not play a substantial role in the regulation of 19-pS K+ channels. Together, our observations suggest that protein dephosphorylation-dependent regulation may be mainly due to the calcineurin-dependent activation of PP1 rather than a direct effect of calcineurin on the 19-pS K+ channels, although some regulation by direct action of calcineurin cannot be entirely excluded at the present time.


    ACKNOWLEDGEMENTS

The authors are grateful to Rebecca L. Walker for the isolated murine colonic myocyte cDNA and to Dr. James Kenyon for valuable comments about the data and manuscript.


    FOOTNOTES

This project was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-41315.

Address for reprint requests and other correspondence: K. M. Sanders, Dept. of Physiology and Cell Biology, Univ. of Nevada School of Medicine, Reno, NV 89557 (E-mail: kent{at}physio.unr.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 22 January 2001; accepted in final form 9 August 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Benitez-King, G, Rios A, Martinez A, and Anton-Tay F. In vitro inhibition of Ca2+/calmodulin-dependent kinase II activity by melatonin. Biochim Biophys Acta 1290: 191-196, 1996[Medline].

2.   Bywater, RA, Small RC, and Taylor GS. Neurogenic slow depolarizations and rapid oscillations in the membrane potential of circular muscle of mouse colon. J Physiol (Lond) 413: 505-519, 1989[Abstract/Free Full Text].

3.   Carl, A, Kenyon JL, Uemura D, Fusetani N, and Sanders KM. Regulation of Ca2+-activated K+ channels by protein kinase A and phosphatase inhibitors. Am J Physiol Cell Physiol 261: C387-C392, 1991[Abstract/Free Full Text].

4.   Cohen, P. The structure and regulation of protein phosphatases. Annu Rev Biochem 58: 453-508, 1989[Web of Science][Medline].

5.   Connor, JA, and Stevens CF. Voltage clamp studies of a transient outward membrane current in gastropod neural somata. J Physiol (Lond) 213: 21-30, 1971[Abstract/Free Full Text].

6.   DuBell, WH, Gaa ST, Lederer WJ, and Rogers TB. Independent inhibition of calcineurin and K+ currents by the immunosuppressant FK-506 in rat ventricle. Am J Physiol Heart Circ Physiol 275: H2041-H2052, 1998[Abstract/Free Full Text].

7.   DuBell, WH, Lederer WJ, and Rogers TB. K+ currents responsible for repolarization in mouse ventricle and their modulation by FK-506 and rapamycin. Am J Physiol Heart Circ Physiol 278: H886-H897, 2000[Abstract/Free Full Text].

8.   Fraser, ED, and Walsh MP. Dephosphorylation of calponin by type 2B protein phosphatase. Biochemistry 34: 9151-9158, 1995[Medline].

9.   Hille, B. Ionic Channels of Excitable Membranes. Sunderland, MA: Sinauer, 1992, p. 116-121.

10.   Hoger, JH, Walter AE, Vance D, Yu L, Lester HA, and Davidson N. Modulation of a cloned mouse brain potassium channel. Neuron 6: 227-236, 1991[Web of Science][Medline].

11.   Horowitz, B, Ward SM, and Sanders KM. Cellular and molecular basis for electrical rhythmicity in gastrointestinal muscles. Annu Rev Physiol 61: 19-43, 1999[Web of Science][Medline].

12.   Koh, SD, Perrino BA, Hatton WJ, Kenyon JL, and Sanders KM. Novel regulation of the A-type K+ current in murine proximal colon by calcium-calmodulin-dependent protein kinase II. J Physiol (Lond) 517: 75-84, 1999[Abstract/Free Full Text].

13.   Koh, SD, Ward SM, Dick GM, Epperson A, Bonner HP, Sanders KM, Horowitz B, and Kenyon JL. Contribution of delayed rectifier potassium currents to the electrical activity of murine colonic smooth muscle. J Physiol (Lond) 515: 475-487, 1999[Abstract/Free Full Text].

14.   McCormick, DA, and Huguenard JR. A model of the electrophysiological properties of thalamocortical relay neurons. J Neurophysiol 68: 1384-1400, 1992[Abstract/Free Full Text].

15.   Morioka, M, Fukunaga K, Yasugawa S, Nagahiro S, Ushio Y, and Miyamoto E. Regional and temporal alterations in Ca2+/calmodulin-dependent protein kinase II and calcineurin in the hippocampus of rat brain after transient forebrain ischemia. J Neurochem 58: 1798-1809, 1992[Web of Science][Medline].

16.   Peretz, A, Abitbol I, Sobko A, Wu CF, and Attali B. A Ca2+/calmodulin-dependent protein kinase modulates Drosophila photoreceptor K+ currents: a role in shaping the photoreceptor potential. J Neurosci 18: 9153-9162, 1998[Abstract/Free Full Text].

17.   Perrino, BA, Fong YL, Brickey DA, Saitoh Y, Ushio Y, Fukunaga K, Miyamoto E, and Soderling TR. Characterization of the phosphatase activity of a baculovirus-expressed calcineurin A isoform. J Biol Chem 267: 15965-15969, 1992[Abstract/Free Full Text].

18.   Perrino, BA, and Soderling TR. Biochemistry and pharmacology of calmodulin-regulated phosphatase calcineurin. In: Calmodulin and Signal Transduction, edited by Watterson DM, and Van Eldik LJ.. San Diego, CA: Academic, 1998, p. 169-236.

19.   Rae, MG, Fleming N, McGregor DB, Sanders KM, and Keef KD. Control of motility patterns in the human colonic circular muscle layer by pacemaker activity. J Physiol (Lond) 510: 309-320, 1998[Abstract/Free Full Text].

20.   Roeper, J, Lorra C, and Pongs O. Frequency-dependent inactivation of mammalian A-type K+ channel Kv1.4 regulated by Ca2+/calmodulin-dependent protein kinase. J Neurosci 17: 3379-3391, 1997[Abstract/Free Full Text].

21.   Stemmer, P, and Klee CB. Serine/threonine phosphatases in the nervous system. Curr Opin Neurobiol 1: 53-64, 1991[Medline].

22.   Tessier, S, Karczewski P, Krause EG, Pansard Y, Acar C, Lang-Lazdunski M, Mercadier JJ, and Hatem SN. Regulation of the transient outward K+ current by Ca2+/calmodulin-dependent protein kinases II in human atrial myocytes. Circ Res 85: 810-819, 1999[Abstract/Free Full Text].

23.   Wilson, AJ, Jabr RI, and Clapp LH. Calcium modulation of vascular smooth muscle ATP-sensitive K+ channels: role of protein phosphatase-2B. Circ Res 87: 1019-1025, 2000[Abstract/Free Full Text].


Am J Physiol Cell Physiol 281(6):C2020-C2028
0363-6143/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
Physiol. Rev.Home page
S. G. Birnbaum, A. W. Varga, L.-L. Yuan, A. E. Anderson, J. D. Sweatt, and L. A. Schrader
Structure and Function of Kv4-Family Transient Potassium Channels
Physiol Rev, July 1, 2004; 84(3): 803 - 833.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
M. Prasad and R. K. Goyal
Differential modulation of voltage-dependent K+ currents in colonic smooth muscle by oxidants
Am J Physiol Cell Physiol, March 1, 2004; 286(3): C671 - C682.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Cell Physiol.Home page
G. C. Amberg, S. D. Koh, Y. Imaizumi, S. Ohya, and K. M. Sanders
A-type potassium currents in smooth muscle
Am J Physiol Cell Physiol, March 1, 2003; 284(3): C583 - C595.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
S. Ohya and B. Horowitz
Differential transcriptional expression of Ca2+ BP superfamilies in murine gastrointestinal smooth muscles
Am J Physiol Gastrointest Liver Physiol, December 1, 2002; 283(6): G1290 - G1297.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
G. C Amberg, S. D. Koh, W. J Hatton, K. J Murray, K. Monaghan, B. Horowitz, and K. M Sanders
Contribution of Kv4 channels toward the A-type potassium current in murine colonic myocytes
J. Physiol., October 15, 2002; 544(2): 403 - 415.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
G. C Amberg, S. A Baker, S. D. Koh, W. J Hatton, K. J Murray, B. Horowitz, and K. M Sanders
Characterization of the A-type potassium current in murine gastric antrum
J. Physiol., October 15, 2002; 544(2): 417 - 428.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Amberg, G. C.
Right arrow Articles by Sanders, K. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Amberg, G. C.
Right arrow Articles by Sanders, K. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online