Am J Physiol Cell Physiol Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 281: C1881-C1888, 2001;
0363-6143/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zernecke, A.
Right arrow Articles by Weber, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zernecke, A.
Right arrow Articles by Weber, C.
Vol. 281, Issue 6, C1881-C1888, December 2001

Combined modulation of the mesangial machinery for monocyte recruitment by inhibition of NF-kappa B

Alma Zernecke1, Kim S. C. Weber1, and Christian Weber1,2

1 Institute for Prevention of Cardiovascular Disease, Ludwig-Maximilians Universität München, D-80336 Munich, and 2 Department of Molecular Cardiovascular Research, University Hospital Aachen, D-52074 Aachen, Germany


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The activation of nuclear factor-kappa B (NF-kappa B) is required for the induction of many of the adhesion molecules and chemokines involved in the inflammatory leukocyte recruitment to the kidney. Here we studied the effects of NF-kappa B inhibition on the machinery crucial for monocyte infiltration of the glomerulus during inflammation. In mesangial cells (MC), the protease inhibitors MG-132 and N-alpha -tosyl-L-lysine chloromethyl ketone or adenoviral overexpression of Ikappa B-alpha prevented the complete Ikappa B-alpha degradation following tumor necrosis factor-alpha (TNF-alpha ) stimulation. This resulted in a marked inhibition of TNF-alpha -induced expression of mRNA and protein for the immunoglobulin molecules intracellular adhesion molecule-1 and vascular cell adhesion molecule-1 and the chemokines growth-related oncogene-alpha , monocyte chemoattractant protein-1, interleukin-8, or fractalkine in MC. Finally, the inhibition of Ikappa B-alpha degradation or Ikappa B-alpha overexpression suppressed the chemokine-induced transendothelial monocyte chemotaxis toward MC and the chemokine-triggered firm adhesion of monocytic cells to MC. The inhibition of NF-kappa B by pharmacological intervention or gene transfer may present a multimodal approach to control the machinery propagating inflammatory recruitment of monocytes during glomerular disease.

N-alpha -tosyl-L-lysine chloromethyl ketone; MG-132; adenovirus; adhesion molecules; chemokines; nuclear factor-kappa B


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

MONOCYTE ADHESION AND EMIGRATION involves sequential and overlapping interactions of signal molecules and is fundamental to the inflammatory response. Whereas monocyte rolling is mediated by selectins and their selectin counterreceptors, firm adhesion crucially depends on the binding of beta 1- and beta 2-integrins to their endothelial ligands vascular cell adhesion molecule-1 (VCAM-1) and intracellular adhesion molecule-1 (ICAM-1) as well as immobilized chemokines. Subsequent exposure to chemokine gradients may then be responsible for transendothelial migration (3, 6, 9, 22, 28, 32, 36).

In various models of renal diseases, mesangial cells (MC) have been implicated in glomerular leukocyte recruitment. MC are myofibroblast-like cells that, together with the extracellular matrix, form the specialized pericapillary tissue in the glomerulus and thus contribute to the regulation of ultrafiltration and microcirculation (7, 13, 26, 27). Various inflammatory stimuli have been demonstrated to increase the expression of the immunoglobulin gene superfamily members ICAM-1 and VCAM-1 (7, 14, 21), CC-chemokines monocyte chemoattractant molecule-1 (MCP-1) and RANTES, and CXC-chemokines interleukin (IL)-8 and growth-related oncogene-alpha (GRO-alpha ) (27). We have recently shown that GRO-alpha and IL-8, induced by tumor necrosis factor-alpha (TNF-alpha ), are immobilized to proteoglycans on the MC surface and MCP-1 and IL-8 are secreted into the soluble phase, while the constitutive expression of the CX3C chemokine fractalkine was not significantly induced (38). Monocyte adhesion to activated MC involved beta 1- and beta 2-integrins, the GRO-alpha and IL-8 receptor CXCR2, and fractalkine. In contrast, the transendothelial migration of monocytes toward MC was mediated by the MCP-1 receptor CCR2 while CXCR2 played a minor role (38).

The nuclear factor-kappa B (NF-kappa B)/Rel transcription factor family has been shown to play a pivotal role for the activation and induction of adhesion molecules and chemokines in MC by regulating expression at the level of gene transcription (17). In resting cells, inactive NF-kappa B forms a complex with its cytoplasmic inhibitor Ikappa B-alpha , which retains the NF-kappa B complex in the cytoplasm by masking its nuclear localization sequence. Upon stimulation, Ikappa B-alpha is phosphorylated, ubiquitinated, and subsequently degraded via the proteosome pathway (11, 18, 24, 30). The proteosome is localized in the cytoplasm and nucleus, forming a 26S complex, and contains a 20S proteolytic core responsible for the degradation and turnover of proteins (27). Unbound from its inhibitor, the NF-kappa B heterodimer translocates to the nucleus, where it binds to the promoter motifs of NF-kappa B-dependent genes that include ICAM-1, VCAM-1, MCP-1, and other proinflammatory molecules.

The inhibition of NF-kappa B activation has been suggested to be of use in suppressing the inflammatory response in vitro but also in animal models of renal disease (17). Given the central role of MC in promoting leukocyte infiltration during glomerular disease, we were prompted to investigate the potential function of NF-kappa B as a central mediator of glomerular leukocyte recruitment. In this study, we were able to demonstrate that inhibition of Ikappa B-alpha degradation by the protease inhibitors N-alpha -tosyl-L-lysine chloromethyl ketone (TLCK) and MG-132 or adenovirus-mediated Ikappa B-alpha overexpression in MC impaired the upregulation of adhesion molecule and chemokine expression in MC in response to TNF-alpha . This was associated with decreased firm adhesion of monocytic cells to activated MC and transendothelial migration of monocytes toward stimulated MC. Thus these data demonstrate that modulation of NF-kappa B activity may be a potential target in the control of glomerular leukocyte infiltration.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Cell culture and reagents. Primary human MC (Clonetics) were used at passages 3-9 and cultured in basal MC medium (Clonetics), supplemented with 5% FCS and 50 mg/ml of gentamicin (GIBCO BRL). Mono Mac 6 cells (from Dr H. W. Ziegler-Heitbrock) were maintained as described (33, 40). Human umbilical vein endothelial cells (HUVEC) were used at passages 2-4 and grown in low serum PromoCell medium (33). Reagents were from Sigma Chemical unless otherwise stated.

Overexpression of adenoviral-encoded Ikappa B-alpha . Construction of the adenoviral vector encoding for Ikappa B-alpha (rAd.Ikappa B-alpha ; a kind gift from Dr. R. de Martin, Vienna International Research Center), and infection was performed as previously described (37). Briefly, subconfluent MC were washed with phosphate-buffered saline (PBS) and incubated with the adenovirus in PBS for 30 min at 37°C, washed, and then cultured for 48 h. An equivalent infection with a control adenoviral vector (8) encoding green fluorescence protein (rAd.GFP) was performed at different multiplicities of infection (MOI). GFP expression was analyzed by flow cytometry as described (8), and the most effective transduction rate was achieved at a MOI of 300. Overexpression of Ikappa B-alpha may induce apoptosis in TNF-alpha -activated MC by suppressing induction of inhibitor of apoptosis proteins (29); however, cell viability was determined to be >95% under all conditions.

Western blot analysis. Cells were left untreated, pretreated for 2 h with TLCK (50 µM) or MG-132 (20 µM) or transfected with Ikappa B-alpha , left in culture for 48 h, and then activated with TNF-alpha (100 U/ml, 20 min). Cells were lysed in sample buffer containing protease inhibitors, and lysates were separated by 12.5% SDS-PAGE. Proteins were transferred to nitrocellulose membranes and reacted with a monoclonal antibody (MAb) to Ikappa B-alpha (Santa Cruz Biotechnology). Blots were developed using chemiluminescence (ECL, Amersham).

Flow cytometry. Confluent MC were trypsinized, washed, and reacted with saturating concentrations of MAb for 30 min on ice, washed and stained with fluorescein isothiocyanate (FITC)-conjugated IgG (Boehringer Mannheim), and washed and analyzed in a FACScan (Becton Dickinson) (34, 35).

RT-PCR. Total RNA was isolated by phenol/chloroform/isoamylalcohol extraction, and cDNA was reverse transcribed from 2 µg of RNA. PCR was performed, and PCR products were analyzed by agarose gel electrophoresis and quantitated by HPLC as described (33, 34). Primer sequences were as published for ICAM-1, VCAM-1, beta -actin (34), GRO-alpha , MCP-1 (35), and fractalkine (4), and were TACTCCAAACCTTTCCACCC (IL-8 sense) and AACTTCTCCACAACCCTCTG (IL-8 antisense).

Quantification of protein. The concentration of MCP-1 and GRO-alpha protein present in the MC supernatants was determined using a sandwich ELISA (R&D Systems) performed according to the manufacturer's protocols. IL-8 concentrations were measured using antibodies from R&D Systems, following their protocol for a double-ligand ELISA.

Immunofluorescence. MC were grown to confluence on glass coverslips. Cells were fixed in 3.7% formaldehyde, and coverslips were incubated for 2 h at RT with 10% heat-inactivated human serum in PBS to block nonspecific binding. The cells were incubated with the primary antibody for 30 min at RT, washed, and then incubated with FITC-conjugated IgG for 30 min at RT. Coverslips were allowed to air dry and were then mounted with Mowiol. During inspection and analysis using a Leica DMRBE fluorescence microscope with a ×100 oil-immersion objective, images were recorded on Kodak 400ASA film.

Monocyte adhesion on MC in shear flow. Laminar flow assays were performed as previously described (16, 23, 32). MC were grown to confluence in 35-mm petri dishes that were assembled as the lower wall in a parallel wall flow chamber and mounted on the stage of an Olympus IMT-2 inverted microscope with ×20 and ×40 phase-contrast objectives. Mono Mac 6 cells (106/ml) suspended in Hanks' balanced salt solution containing 10 mmol/l HEPES, pH 7.4, 0.5% human serum albumin, 1 mmol/l Mg2+, and 1 mmol/l Ca2+ (added shortly before the assay) were kept in a heating block at 37°C during assays and perfused into the flow chamber at a rate of 1.5 dyn/cm2 for 5 min. The number of firmly adherent cells after 5 min was quantitated in multiple fields (at least 5/experiment) by analysis of images, recorded with a long integration JVC 3CCD video camera and a JVC SR L 900 E video recorder, and expressed as cells/mm2. The type of adhesion analyzed was restricted to primary, i.e., direct interactions of monocytes with endothelium. Consistent with findings using a similar flow chamber (16), secondary attachment to already adherent monocytes, which is mediated by L-selectin and results in the formation of linear strings (1), occurred only sporadically at 1.5 dyn/cm2, accounting for a very small component of total interactions. Data are expressed as means ± SD, and statistical significance was determined by analysis of variance.

Chemotaxis assays. HUVEC were grown on 6.5-mm Transwell inserts (Costar, 8-µm pore size). Otherwise, inserts were untreated. MC were grown to confluence in the bottom chamber of the 24-well plate. Transwells were inserted, and monocytes in assay medium (RPMI 1640, medium 199, 0.5% human serum albumin) were added to the top chamber. A dilution of cells served as a measure of input. Cells were allowed to transmigrate for 2 h. Input and migrated cells were counted by flow cytometry with light scatter gates for monocytes.

Statistics. Statistical significance was determined by analysis of variance, and differences with P < 0.05 were considered to be significant.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

TLCK, MG-132, or Ikappa B-alpha overexpression inhibits TNF-alpha -induced degradation of Ikappa B-alpha in MC. Activation and nuclear translocation of NF-kappa B requires phosphorylation, ubiquitination, and subsequent degradation of its cytoplasmic inhibitor Ikappa B-alpha via the Ikappa B kinase and the proteosome pathway (11, 18, 24, 30). To confirm the effects of protease inhibitors on TNF-alpha -induced Ikappa B-alpha degradation in MC, Ikappa B-alpha protein was detected by immunoblotting. Unstimulated MC displayed a basal level of Ikappa B-alpha , which is almost completely degraded after TNF-alpha stimulation for 20 min (Fig. 1A). MC were pretreated with TLCK (11) or the proteosome inhibitor MG-132 (24) for 2 h and were then challenged with TNF-alpha for 20 min in the continuing presence of the inhibitors. This prevented TNF-alpha -induced Ikappa B-alpha degradation, although TLCK appeared to be less effective (Fig. 1A). Adenoviral overexpression of Ikappa B-alpha in HUVEC has been shown to prevent complete Ikappa B-alpha degradation induced by TNF-alpha (35). To investigate whether adenoviral gene transfer of Ikappa B-alpha exerts similar protective effects on Ikappa B-alpha in MC, Western blotting of transfected MC with adenoviral-encoded Ikappa B-alpha was performed. Overexpression of Ikappa B-alpha in MC, but not infection with the control adenoviral vector rAd.GFP, increased basal levels of Ikappa B-alpha (Fig. 1B) and prevented complete Ikappa B-alpha degradation in response to TNF-alpha stimulation, as opposed to untreated MC (Fig. 1A). These data suggest that TLCK and MG-132 treatment of MC and cytoplasmic Ikappa B-alpha overexpression potently inhibit the TNF-alpha -induced initiation of NF-kappa B activation in MC.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 1.   A and B: expression of Ikappa B-alpha in mesangial cells (MC). Confluent MC were left untreated, pretreated with N-alpha -tosyl-L-lysine chloromethyl ketone (TLCK; 50 µM) or MG-132 (20 µM) for 2 h, or infected with adenoviral vector encoding for Ikappa B-alpha (rAd.Ikappa B-alpha ) or encoding green fluorescence protein (rAd.GFP) 48 h before the experiment, and/or stimulated with tumor necrosis factor-alpha (TNF-alpha ) (100 U/ml) for 20 min (A) or left untreated (B). Cell lysates were analyzed by Western Blot using a monoclonal antibody (MAb) to Ikappa B-alpha . The high efficiency of Ikappa B-alpha overexpression (B) required different sensitivities of detection. Shown is a representative experiment.

Inhibition of NF-kappa B reduces mRNA expression of inflammatory proteins induced by TNF-alpha . NF-kappa B translocated to the nucleus binds to promoter regions of NF-kappa B-dependent genes, regulating the transcriptional activity of many adhesion molecules and chemokines involved in monocyte adhesion and transmigration (17). To assess the effects of inhibited Ikappa B-alpha degradation on transcriptional activity, RT-PCR with subsequent HPLC quantification was performed. As previously described, TNF-alpha stimulation of MC for 4 h markedly upregulated mRNA levels of the adhesion molecules ICAM-1 and VCAM-1 and the chemokines MCP-1, IL-8, and GRO-alpha , but only slightly increased mRNA levels of fractalkine (Fig. 2). Pretreatment of MC with TLCK or MG-132 or rAd.Ikappa B-alpha overexpression, but not infection with the control adenoviral vector rAd.GFP, inhibited this upregulation in mRNA transcripts (Fig. 2). MG-132, which exerted stronger inhibitory effects on Ikappa B-alpha degradation than TLCK or Ikappa B-alpha overexpression, also more effectively blocked transcriptional activation of adhesion molecules and chemokines (Fig. 2). Thus inhibition of Ikappa B-alpha degradation is paralleled by impaired transcriptional upregulation of adhesion molecules and chemokines in response to TNF-alpha stimulation.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 2.   Adhesion molecule and chemokine mRNA expression is reduced by TLCK or MG-132 pretreatment or infection with rAd.Ikappa B-alpha but not rAd.GFP. Cells were left untreated, pretreated with TLCK (50 µM) or MG-132 (20 µM) for 2 h, or infected with rAd.Ikappa B-alpha or rAd.GFP, and/or stimulated with TNF-alpha (100 U/ml) for 4 h. RT-PCR was performed using specific primers for intracellular adhesion molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM-1), growth-related oncogene-alpha (GRO-alpha ), monocyte chemoattractant protein-1 (MCP-1), interleukin (IL)-8, fractalkine, and beta -actin. Quantification was performed by HPLC analysis, and mRNA expression was reported as the percentage of beta -actin. Data are means ± SD of at least 3 independent experiments.

TNF-alpha -induced surface expression of MC adhesion molecules is inhibited by TLCK, MG-132, or overexpression of Ikappa B-alpha . To investigate whether suppression of transcriptional activity was associated with decreased surface protein expression of the immunoglobulin family members ICAM-1 and VCAM-1, flow cytometry was performed. As previously shown, MC express basal levels of ICAM-1 and low levels of VCAM-1 (Fig. 3), and adhesion molecule expression was markedly increased after TNF-alpha treatment for 4 h (Fig. 3). In parallel with mRNA expression of transcripts, pretreatment of MC with TLCK or MG-132 almost completely inhibited the TNF-alpha -induced upregulation of ICAM-1 and VCAM-1 (Fig. 3, A-D). Similarly, rAd.Ikappa B-alpha transfection of MC inhibited the TNF-alpha -induced increase of ICAM-1 and VCAM-1 surface expression (Fig. 3, E and F).


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 3.   Adhesion molecule surface expression is decreased by TLCK or MG-132 pretreatment or infection with rAd.Ikappa B-alpha . MC were left untreated, pretreated with TLCK (A and B) or MG-132 (C and D) for 2 h, or infected with rAd.Ikappa B-alpha (E and F), and/or stimulated with TNF-alpha (100 U/ml) for 4 h and analyzed by flow cytometry. Untreated cells (dotted lines), TNF-alpha -stimulated MC (solid lines), and MC pretreated with TLCK (50 µM) or MG-132 (20 µM) or infected with rAd.Ikappa B-alpha (bold lines) were stained with MAb to ICAM-1 or VCAM-1 cells. Shown is a representative experiment.

TNF-alpha -induced expression of GRO-alpha , MCP-1, and IL-8 is inhibited by TLCK, MG-132, or overexpression of Ikappa B-alpha . We have previously shown that TNF-alpha stimulation of MC induces the immobilization of GRO-alpha and IL-8 on the MC surface via heparan proteoglycan binding, whereas MCP-1 but also IL-8 are secreted as soluble proteins (38). We investigated effects of TLCK, MG-132, and Ikappa B-alpha overexpression on the TNF-alpha -induced chemokine expression. Immunofluorescence staining of MC with specific antibodies was used to detect surface-associated proteins. As previously described, TNF-alpha stimulation of MC for 4 h induced the surface association of GRO-alpha and IL-8 (Fig. 4A, not shown), which was inhibited by preincubation of MC with TLCK, MG-132, or Ikappa B-alpha overexpression (Fig. 4A, data not shown). Chemokines secreted as soluble proteins into the supernatants were measured by ELISA. Compared with untreated MC, supernatants of TNF-alpha -stimulated MC revealed increased amounts of soluble GRO-alpha , and foremost MCP-1 and IL-8. Pretreatment of MC with TLCK and mostly MG-132 or transduction of MC with the Ikappa B-alpha adenovirus inhibited the secretion of chemokines induced by TNF-alpha (Fig. 4B, not shown). These results indicate that by preventing Ikappa B-alpha degradation and NF-kappa B-dependent transcription of adhesion molecules and chemokines, TLCK, MG-132, and cytoplasmic Ikappa B-alpha overexpression prevented the expression of adhesion molecules and inhibited chemokine secretion and immobilization on the MC surface in response to TNF-alpha .


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 4.   Chemokine surface presentation and secretion into the supernatants is decreased by TLCK or MG-132 treatment. MC were left untreated, pretreated with TLCK (50 µM) or MG-132 (20 µM), and/or stimulated with TNF-alpha (100 U/ml) for 4 h. A: immunofluorescence staining of MC was performed with MAb to GRO-alpha . Shown are representative images. B: MCP-1, IL-8, and GRO-alpha in supernatants were quantitated by ELISA. Data represent means ± SD from 3 experiments performed in duplicate.

Transmigration toward stimulated MC. To further investigate the effects of TLCK, MG-132, or Ikappa B-alpha transfection on transmigration of monocytes, two-chamber transmigration assays were performed. Monocytes added to the top chamber were allowed to transmigrate across HUVEC grown on inserts toward untreated or TNF-alpha -stimulated MC for 2 h. TNF-alpha stimulation elicited a twofold increase in the number of transmigrated cells compared with untreated cells, and pretreatment of MC with TLCK or MG-132 or Ikappa B-alpha overexpression of MC substantially inhibited the TNF-alpha -induced transmigration (Fig. 5A, not shown).


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 5.   Adhesion of Mono Mac 6 cells to and transmigration of monocytes toward TNF-alpha -stimulated MC under flow conditions is decreased by pretreatment of MC with TLCK or MG-132 or infection with rAd.Ikappa B-alpha but not with rAd.GFP. A: peripheral blood mononuclear cells were allowed to transmigrate across filters seeded with confluent human umbilical vein endothelial cells toward MC were left untreated, pretreated with TLCK (50 µM) or MG-132 (20 µM) for 2 h, and/or stimulated with TNF-alpha (100 U/ml) for 4 h in the bottom chamber for 2 h. Migrated monocytes were counted by flow cytometry with appropriate light scatter gates. Data are expressed as means ± SD of at least 3 independent experiments. B: confluent MC were left untreated, pretreated with TLCK (50 µM) or MG-132 (20 µM) for 2 h, or infected with rAd.Ikappa B-alpha or rAd.GFP 48 h before the experiment, and/or stimulated with TNF-alpha (100 U/ml) for 4 h. Mono Mac 6 cells were perfused at a constant flow rate of 1.5 dyn/cm2, and the firm arrest of cells was determined by counting the number of Mono Mac 6 cells attached per field after a 5-min period and expressed as cells/mm2. Data are means ± SD of at least 3 independent experiments.

Monocyte adhesion to TNF-alpha -stimulated MC. Glomerular monocyte infiltration occurs during the pathogenesis of numerous kidney diseases, and MC have been critically involved through expression of adhesion molecules and chemokines (7, 12, 20, 21, 26, 27). We have recently shown that monocyte adhesion to activated MC is mediated by the beta 2- and alpha 4-integrins interacting with ICAM-1 and VCAM-1 on MC, that the GRO-alpha receptor CXCR2 contributes to firm monocyte arrest on stimulated MC, and that a gradient of soluble MCP-1 predominantly mediates transmigration of monocytes toward MC (38). To study whether pretreatment of MC with TLCK, MG-132, or Ikappa B-alpha overexpression also impairs the TNF-alpha -induced adhesion of monocytic cells to stimulated MC, as a result of reduced expression of adhesion molecules and chemokines, monocyte adhesion was studied under flow conditions as a measure of firm arrest. Monocytic Mono Mac 6 cells, which express a similar array of adhesion molecules and chemokine receptors as monocytes (40), were perfused over MC at a constant shear rate of 1.5 dyn/cm2, and after a period of accumulation, the number of firmly attached cells was determined. Compared with untreated MC, TNF-alpha treatment markedly increased the number of firmly adherent Mono Mac 6 cells. Preincubation of MC with TLCK or MG-132, as well as Ikappa B-alpha overexpression but not infection with the control adenoviral vector rAd.GFP before TNF-alpha stimulation, significantly inhibited the number of cells firmly attached and reduced the monocyte adhesion to almost background level (Fig. 5B). These data show that inhibited adhesion molecule and chemokine expression after TLCK, MG-132, and Ikappa B-alpha overexpression is associated with a decrease in firm monocyte adhesion to stimulated MC and also inhibited the TNF-alpha -induced transmigration of monocytes toward stimulated MC.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

NF-kappa B is a family of dimeric proteins that belongs to the Rel family. The Rel homology domain determines dimerization, nuclear localization, and binding to the kappa B element in the promoter and enhancer regions of many target genes (18). These include genes encoding for adhesion molecules and chemokines and cytokines that are involved in the inflammatory and proliferative responses of MC (17). NF-kappa B activation has been investigated and confirmed to occur in vitro through well-known inducers of NF-kappa B such as TNF-alpha , IL-1beta , and immunoglobulin proteins and in vivo in several animal models of renal disease such as antiglomerular basement membrane or immune complex nephritis (17). Moreover, inhibitors of NF-kappa B activation such as pyrrolidine dithiocarbamate, corticoids, antioxidants, or angiotensin-converting enzyme inhibitors have been shown to prevent the activation of NF-kappa B and subsequent mRNA expression of several adhesion molecules and chemokines (2, 15, 17, 25, 27).

In this study, we investigated possible effects of TLCK, MG-132, and Ikappa B-alpha overexpression on the NF-kappa B-dependent adhesion molecules ICAM-1 and VCAM-1 and the chemokines GRO-alpha , MCP-1, and IL-8, and subsequently on monocyte recruitment to MC. TLCK, an irreversible inhibitor of serine proteases, has been shown to inhibit Ikappa B-alpha degradation and NF-kappa B activation in endothelial cells (11). MG-132 has been described to inhibit the proteolytic activity of the 20S and 26S proteosomal complex, thus blocking proteosomal Ikappa B-alpha degradation and reducing the accumulation of NF-kappa B in the nucleus (24). Associated with decreased expression of adhesion molecules and chemokines in endothelial cells, the activation of NF-kappa B has been suggested to be a critical target for therapeutic intervention (24). Ectopic expression of Ikappa B-alpha in endothelial cells, achieved by recombinant adenoviral transfection, has been shown to prevent NF-kappa B activation, and, correspondingly reduced expression of adhesion molecules and chemokines, thus inhibiting monocyte recruitment to activated endothelium (35). Although adenoviral gene transfer itself may result in an inflammatory response and antigenicity (15), localized applications have been demonstrated to be feasible in the kidney (5, 39) and glomerular cells (10) and may be of potential use in limiting the inflammatory response in designated areas.

We have shown that in MC inhibition of Ikappa B-alpha degradation by the inhibitor of trypsin TLCK, the proteosome inhibitor MG-132 and overexpression of the cytoplasmic NF-kappa B inhibitor Ikappa B-alpha can reduce the TNF-alpha -induced transcriptional upregulation and surface expression or secretion of adhesion molecules and chemokines. In functionally relevant systems, this was associated with a decrease in adhesion and transmigration of monocytes on stimulated MC.

To interfere with early signaling events in response to TNF-alpha , cells must be exposed to MG-132 either before or simultaneously with TNF-alpha , as has been shown for E-selectin expression on endothelial cells (24). Pretreatment of MC for 2 h before TNF-alpha challenge almost completely inhibited the TNF-alpha -induced degradation of Ikappa B-alpha and abolished the TNF-alpha -induced increase in expression of the adhesion molecules ICAM-1 and VCAM-1 and the chemokines GRO-alpha , MCP-1, and IL-8. TLCK pretreatment of MC compared with MG-132 exerted weaker inhibitory effects, but still effectively prevented the TNF-alpha -elicited Ikappa B-alpha degradation and reduced adhesion molecule and chemokine expression. In MC transfection with adenoviral-encoded Ikappa B-alpha , TNF-alpha stimulation decreased the levels of Ikappa B-alpha slightly, but it remained markedly higher than in TNF-alpha -treated cells and also reduced adhesion molecule and chemokine expression. Ikappa B-alpha expressed by adenoviral gene transfer may be phosphorylated and subsequently degraded, but as observed with lipopolysaccharide stimulation (37), the overwhelming proportion of Ikappa B-alpha could not be processed. This may, in part, be due to the presence of the nuclear localization sequence, but may also reflect a high efficiency of infection by the adenovirus.

Leukocyte adhesion was shown to involve the beta 2- and alpha 4-integrins interacting with ICAM-1 and VCAM-1, respectively (16, 28). Moreover, we have demonstrated that a combination of MAb blocking alpha 4- and beta 2-integrins inhibited monocyte adhesion on stimulated MC in shear flow (38). Thus effects of TLCK, MG-132, and overexpression of Ikappa B-alpha on monocyte adhesion are likely to be at least in part due to the reduced expression of ICAM-1 and VCAM-1 on MC. Inhibition of NF-kappa B suppressed the production of the chemokines GRO-alpha , MCP-1, and IL-8 in TNF-alpha -stimulated MC. GRO-alpha and IL-8 can be immobilized on the surface of activated MC by heparan proteoglycans, and through this, have been demonstrated to be critically involved in firm monocyte adhesion on activated MC, while MCP-1 but also IL-8 were secreted as soluble molecules, thus establishing and maintaining a chemokine gradient required for triggering subsequent transmigration (38). We were able to show that the TNF-alpha -induced immobilization of GRO-alpha and IL-8 on the MC surface was almost abolished by preincubation of MC with TLCK, MG-132, or Ikappa B-alpha overexpression, and, similarly, secretion of MCP-1 and IL-8 from activated MC was markedly inhibited by TLCK, MG-132, and Ikappa B-alpha transfection. In addition to the reduction of adhesion molecule expression, the marked decrease in GRO-alpha and IL-8 surface association could be responsible for the inhibition of monocyte arrest seen in MC preincubated with TLCK, MG-132, and transfected with Ikappa B-alpha . Because the impaired secretion of chemokines could be responsible for reduced transmigration, our data provide a mechanistic clue of the pluripotent effects of this concept on the machinery for glomerular monocyte recruitment.


    ACKNOWLEDGEMENTS

The authors thank Prof. P. C. Weber for continuous support, T. Rubic, B. Zimmer, and P. Weinert for expert help, and R. de Martin for adenoviral work. This work fulfills, in part, the requirements for the doctoral thesis of A. Zernecke.


    FOOTNOTES

This work was supported by Deutsche Forschungsgemeinschaft Grants WE1913/1-2 and GRK 438.

Address for reprint requests and other correspondence: C. Weber, Dept. of Molecular Cardiovascular Research, Univ. Hospital Aachen, Pauwelsstrasse 30, D-52074 Aachen, Germany.

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 2 March 2001; accepted in final form 1 August 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Alon, R, Fuhlbrigge RC, Finger EB, and Springer TA. Interactions through L-selectin between leukocytes and adherent leukocytes nucleate rolling adhesions on selectins and VCAM-1 in shear flow. J Cell Biol 135: 849-865, 1996[Abstract/Free Full Text].

2.   Auwardt, RB, Mudge SJ, Chen CG, and Power DA. Regulation of nuclear factor-kappa B by corticosteroids in rat mesangial cells. J Am Soc Nephrol 9: 1620-1628, 1998[Abstract].

3.   Baggiolini, M. Chemokines and leukocyte traffic. Nature 392: 565-568, 1998[Medline].

4.   Bazan, JF, Bacon KB, Hardiman G, Wang W, Soo K, Rossi D, Greaves DR, Zlotnik A, and Schall TJ. A new class of membrane-bound chemokine with a CX3C motif. Nature 385: 640-644, 1997[Medline].

5.   Benigni, A, Tomasoni S, Lutz J, Amuchastegui S, Capogrossi MC, and Remuzzi G. Nonviral and viral gene transfer to the kidney in the context of transplantation. Nephron 85: 307-316, 2000[Web of Science][Medline].

6.   Campbell, JJ, Hedrick J, Zlotnik A, Siani MA, Thompson DA, and Butcher EC. Chemokines and the arrest of lymphocytes rolling under flow conditions. Science 279: 381-384, 1998[Abstract/Free Full Text].

7.   Dal Canton, A. Adhesion molecules in renal disease. Kidney Int 48: 1687-1696, 1995[Web of Science][Medline].

8.   De Martin, R, Raidl M, Hofer E, and Binder BR. Adenovirus-mediated expression of green fluorescent protein. Gene Ther 4: 493-495, 1997[Web of Science][Medline].

9.   Gerszten, RE, Garcia-Zepeda EA, Lim YC, Yoshida M, Ding HA, Gimbrone MA, Jr, Luster AD, Luscinskas FW, and Rosenzweig A. MCP-1 and IL-8 trigger firm adhesion of monocytes to vascular endothelium under flow conditions. Nature 398: 718-723, 1999[Medline].

10.   Heikkila, P, Parpala T, Lukkarinen O, Weber M, and Tryggvason K. Adenovirus-mediated gene transfer into kidney glomeruli using an ex vivo and in vivo kidney perfusion system--- first steps towards gene therapy of Alport syndrome. Gene Ther 3: 21-27, 1996[Web of Science][Medline].

11.   Henkel, T, Machleidt T, Alkalay I, Kronke M, Ben-Neriah Y, and Baeuerle PA. Rapid proteolysis of Ikappa B-alpha is necessary for activation of transcription factor NF-kappa B. Nature 365: 182-185, 1993[Medline].

12.   Hooke, DH, Hancock WW, Gee DC, Kraft N, and Atkins RC. Monoclonal antibody analysis of glomerular hypercellularity in human glomerulonephritis. Clin Nephrol 22: 163-168, 1984[Web of Science][Medline].

13.   Inkyo-Hayasaka, K, Sakai T, Jobayashi N, Shirato I, and Tomino Y. Three-dimensional analysis of the whole mesangium in the rat. Kidney Int 50: 672-683, 1996[Web of Science][Medline].

14.   Khachigian, LM, Collins T, and Fries JWU Nuclear factor-kappa B mediates induction of vascular cell adhesion molecule-1 in glomerular mesangial cells. Biochem Biophys Res Commun 206: 462-467, 1995[Web of Science][Medline].

15.   Khachigian, LM, Collins T, and Fries JWU N-acetyl cysteine blocks mesangial VCAM-1 and NF-kappa B expression in vivo. Am J Pathol 151: 1225-1229, 1997[Abstract].

16.   Kukreti, S, Konstantopoulos K, Smith CW, and McIntire LV. Molecular mechanisms of monocyte adhesion to interleukin-1beta -stimulated endothelial cells under physiologic flow conditions. Blood 89: 4104-4111, 1997[Abstract/Free Full Text].

17.   Massy, ZA, Guijarro C, O'Donnell MP, Kim Y, Kashtan CE, Egido J, Kasiske BL, and Keane WF. The central role of nuclear factor-kappa B in mesangial cell activation. Kidney Int 71, Suppl: S76-S79, 1999.

18.   Mercurio, F, and Manning AM. Multiple signals converging on NF-kappa B. Curr Opin Cell Biol 11: 226-232, 1999[Web of Science][Medline].

19.   Newman, KD, Dunn PF, Owens JW, Schulick AH, Virmani R, Sukhova G, Libby P, and Dichek DA. Adenovirus-mediated gene transfer into normal rabbit arteries results in prolonged vascular cell activation, inflammation, and neointimal hyperplasia. J Clin Invest 96: 2955-2965, 1995.

20.   Nolasco, FE, Cameron JS, Hartley B, Coelho A, Hildreth G, and Reuben R. Intraglomerular T cells and monocytes in nephritis: study with monoclonal antibodies. Kidney Int 31: 1160-1166, 1987[Web of Science][Medline].

21.   Pai, R, Bassa B, Kirschenbaum MA, and Kamanna VS. TNF-alpha stimulates monocyte adhesion to glomerular mesangial cells. The role of intercellular adhesion molecule-1 gene expression and protein kinases. J Immunol 156: 2571-2579, 1996[Abstract].

22.   Peled, A, Grabovsky V, Habler L, Sandbank J, Arenzana-Seisdedos F, Petit I, Ben-Hur H, Lapidot T, and Alon R. The chemokine SDF-1 stimulates integrin-mediated arrest of CD34+ cells on vascular endothelium under shear flow. J Clin Invest 104: 1199-1211, 1999[Web of Science][Medline].

23.   Piali, L, Weber C, LaRosa G, Mackay CR, Springer TA, Clark-Lewis I, and Moser B. The chemokine receptor CXCR3 mediates rapid and shear-resistant adhesion-induction of effector T lymphocytes by the chemokines IP10 and Mig. Eur J Immunol 28: 961-972, 1998[Web of Science][Medline].

24.   Read, MA, Neish AS, Luscinskas FW, Palombella VJ, Maniatis T, and Collins T. The proteasome pathway is required for cytokine-induced endothelial-leukocyte adhesion molecule expression. Immunity 2: 493-506, 1995[Web of Science][Medline].

25.   Sakurai, H, Shigemori N, Hisada Y, Ishizuka T, Kawashima K, and Sugita T. Suppression of NF-kappa B and AP-1 activation by glucocorticoids in experimental glomerulonephritis in rats: molecular mechanisms of anti-nephritic action. Biochim Biophys Acta 1362: 252-262, 1997[Medline].

26.   Schlöndorff, D. Roles of the mesangium in glomerular function. Kidney Int 49: 1583-1585, 1996[Web of Science][Medline].

27.   Segerer, S, Nelson PJ, and Schlöndorff D. Chemokines, chemokine receptors, and renal disease: from basic science to pathophysiologic and therapeutic studies. J Am Soc Nephrol 11: 152-176, 2000[Abstract/Free Full Text].

28.   Springer, TA. Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm. Cell 76: 301-314, 1994[Web of Science][Medline].

29.   Stehlik, C, de Martin R, Kumabashiri I, Schmid JA, Binder BR, and Lipp J. Nuclear factor (NF)-kappa B-regulated X-chromosome-linked IAP gene expression protects endothelial cells from tumor necrosis factor-alpha -induced apoptosis. J Exp Med 188: 211-216, 1998[Abstract/Free Full Text].

30.   Traenckner, EB, Wilk S, and Baeuerle PA. A proteasome inhibitor prevents activation of NF-kappa B and stabilizes a newly phosphorylated form of Ikappa B-alpha that is still bound to NF-kappa B. EMBO J 13: 5433-5441, 1994[Web of Science][Medline].

31.   Weber, C, Aepfelbacher M, Haag H, Ziegler-Heitbrock HW, and Weber PC. Tumor necrosis factor induces enhanced responses to platelet-activating factor and differentiation in human monocytic Mono Mac 6 cells. Eur J Immunol 23: 852-859, 1993[Web of Science][Medline].

32.   Weber, C, Alon R, Moser B, and Springer TA. Sequential regulation of alpha 4beta 1 and alpha 5beta 1 integrin avidity by CC chemokines in monocytes: implications for transendothelial chemotaxis. J Cell Biol 134: 1063-1073, 1996[Abstract/Free Full Text].

33.   Weber, C, Erl W, Pietsch A, Strobel M, Ziegler-Heitbrock HW, and Weber PC. Antioxidants inhibit monocyte adhesion by suppressing nuclear factor-kappa B mobilization and induction of vascular cell adhesion molecule-1 in endothelial cells stimulated to generate radicals. Arterioscler Thromb 14: 1665-1673, 1994[Abstract/Free Full Text].

34.   Weber, C, Erl W, Pietsch A, and Weber PC. Aspirin inhibits nuclear factor-kappa B mobilization and monocyte adhesion in stimulated human endothelial cells. Circulation 91: 1914-1917, 1995[Abstract/Free Full Text].

35.   Weber, KS, Draude G, Erl W, de Martin R, and Weber C. Monocyte arrest and transmigration on inflamed endothelium in shear flow is inhibited by adenovirus-mediated gene transfer of Ikappa B-alpha . Blood 93: 3685-3693, 1999[Abstract/Free Full Text].

36.   Weber, KS, von Hundelshausen P, Clark-Lewis I, Weber PC, and Weber C. Differential immobilization and hierarchical involvement of chemokines in monocyte arrest and transmigration on inflamed endothelium in shear flow. Eur J Immunol 29: 700-712, 1999[Web of Science][Medline].

37.   Wrighton, CJ, Hofer-Warbinek R, Moll T, Eytner R, Bach FH, and de Martin R. Inhibition of endothelial cell activation by adenovirus-mediated expression of Ikappa B-alpha , an inhibitor of the transcription factor NF-kappa B. J Exp Med 183: 1013-1022, 1996[Abstract/Free Full Text].

38.   Zernecke, A, Weber KS, Erwig LP, Kluth DC, Schroppel B, Rees AJ, and Weber C. Combinatorial model of chemokine involvement in glomerular monocyte recruitment: role of CXC chemokine receptor 2 in infiltration during nephrotoxic nephritis. J Immunol 166: 5755-5762, 2001[Abstract/Free Full Text].

39.   Zhu, G, Nicolson AG, Cowley BD, Rosen S, and Sukhatme VP. In vivo adenovirus-mediated gene transfer into normal and cystic rat kidneys. Gene Ther 3: 298-304, 1996[Web of Science][Medline].

40.   Ziegler-Heitbrock, HW, Thiel E, Futterer A, Herzog V, Wirtz A, and Riethmuller G. Establishment of a human cell line (Mono Mac 6) with characteristics of mature monocytes. Int J Cancer 41: 456-461, 1988[Web of Science][Medline].


Am J Physiol Cell Physiol 281(6):C1881-C1888
0363-6143/01 $5.00 Copyright © 2001 the American Physiological Society




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zernecke, A.
Right arrow Articles by Weber, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zernecke, A.
Right arrow Articles by Weber, C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online