Am J Physiol Cell Physiol Information on EB 2010
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 281: C1524-C1532, 2001;
0363-6143/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (19)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tamura, I.
Right arrow Articles by Chaqour, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tamura, I.
Right arrow Articles by Chaqour, B.
Vol. 281, Issue 5, C1524-C1532, November 2001

Regulation of Cyr61 gene expression by mechanical stretch through multiple signaling pathways

Isao Tamura, Joel Rosenbloom, Edward Macarak, and Brahim Chaqour

Department of Histology, University of Pennsylvania, Philadelphia, Pennsylvania 19104


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The cysteine-rich protein 61 (Cyr61) is a signaling molecule with functions in cell migration, adhesion, and proliferation. This protein is encoded by an immediate early gene whose expression is mainly induced by serum growth factors. Here we show that Cyr61 mRNA levels increase sharply in response to cyclic mechanical stretch applied to cultured bladder smooth muscle cells. Stretch-induced changes of Cyr61 transcripts were transient and accompanied by an increase of the encoded protein that localized mainly to the cytoplasm and nucleus of the cells. With the use of pharmacological agents that interfere with known signaling pathways, we show that transduction mechanisms involving protein kinase C and phosphatidylinositol 3-kinase activation partly blocked stretch-induced Cyr61 gene expression. Selective inhibition of Rho kinase pathways altered this stretch effect as well. Meanwhile, using inhibitors of the actin cytoskeleton, we show that Cyr61 gene expression is sensitive to mechanisms that sense actin dynamics. These results establish the regulation of Cyr61 gene by mechanical stretch and provide clues to the key signaling molecules involved in this process.

smooth muscle cells; signal transduction


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

IN SEVERAL CHRONIC pathological conditions ranging from hypertension and excess pulmonary ventilation to bladder-obstructive disorders, mechanical strain plays a major role in triggering a pathological hypertrophy/hyperplasia and abnormal extracellular matrix deposition, especially in the muscle compartments (6, 40, 48). Those changes lead ultimately to important clinical consequences, including physiological insufficiencies and organ failure. Whereas the deleterious effects of chronic mechanical stresses are well established, the molecular mechanisms by which the mechanical stimulation affects cell function are still poorly understood.

Investigating the effect(s) of mechanical forces has been made possible by culturing cells on artificial flexible substrates (e.g., an elastic membrane) and applying defined, stepwise, or cyclic strain to the substrate, thus imparting approximately the same strain to the cells (28, 47). With the use of cultured smooth muscle cells and well-defined in vitro mechanical devices, we and others (7, 12, 29) have shown that mechanical forces modulate cell shape, growth, and synthetic phenotype. These changes are achieved mainly through the activation of specific transducing pathways and reprogramming of gene expression. For instance, mechanical stimulation of muscle cells changes skeletal fibers from fast to slow or slow to fast types, which involves turning entire sets of muscle-specific genes on or off (38). However, the full repertoire of strain-inducible genes is incompletely defined, and the biological significance of specific gene alterations is, as yet, an unresolved issue.

Cyr61, a cysteine-rich and heparin-binding protein, belongs to the CCN family [cysteine-rich 61/connective tissue growth factor (CTGF)/nephroblastoma overexpressed] (reviewed in Ref. 26). This emerging new family of proteins is characterized by a high degree of amino acid sequence homology and includes Cyr61, CTGF, Nov (nephroblastoma overexpressed), elm-1, cop-1, and wisp-3. These proteins are organized into conserved modular domains that share similarities with insulin-like growth factor binding proteins, von Willebrand factor type C repeat, thrombospondin type I repeat, and growth factor cysteine knots. In addition, each of these proteins possesses an amino-terminal signal peptide, indicating that they are secreted proteins. Their overall functions are thought to be the result of either combinatorial or independent actions of their domains.

Cyr61 and CTGF, the most extensively studied members of this family, were originally identified in 3T3 fibroblasts and human umbilical vein endothelial cells, respectively, by virtue of their transcriptional activation by serum and serum growth factors such as basic fibroblast growth factor, platelet-derived growth factor (PDGF), and transforming growth factor-beta (2, 21, 23, 34). Studies of their pattern of expression in vivo implicated these proteins in the development of fibrosis and vascular diseases (2, 26). At the molecular level, the Cyr61 recombinant protein was able to support adhesion, migration, and mitogenesis of human skin fibroblasts through integrins alpha 6beta 1, alpha vbeta 5, and alpha vbeta 3, respectively (10, 14). Cyr61 also upregulates the expression of matrix metalloproteinases 1 and 3 and promotes biological processes such as wound healing, angiogenesis, homeostasis, and thrombosis (14, 36). Stable transfection of Cyr61 cDNA in MCF7 cells enhanced anchorage-independent cell growth in soft agar and significantly increased their tumorigenicity when tested in a nude mouse model, suggesting that Cyr61 promotes tumor growth (49). The fact that Cyr61 affects a broad spectrum of biological activities in a cell- and context-specific manner prompts us to explore its potential regulation by mechanical forces in smooth muscle cells and examine the underlying molecular mechanisms involved in this process.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Reagents. Chemical inhibitors were purchased from Calbiochem (San Diego, CA). All other chemicals used were of reagent grade. Y-27632 was kindly provided by Dr. T. Kondo and A. Yoshimura (Welfide, Osaka, Japan).

Cell culture and stretching. Primary cultures of smooth muscle cells were established from fetal bovine bladders as previously described (3). Primary cultures from several animals were used in our experiments. Cells were maintained in modified medium 199 supplemented with 10% fetal bovine serum and antibiotics in a humidified atmosphere containing 5% CO2 in air at 37°C. Freshly isolated smooth muscle cells were phenotypically characterized using muscle-specific antibodies against smooth muscle actin. These cells maintain several differentiated properties in culture even after several passages. Cells between their third and tenth population doubling level were used for stretch experiments.

Mechanical stretch of the cells was performed using a device designed to apply precise and reproducible biaxial strain to type I collagen-coated Tecoflex membrane (Thermedics) on which the cells were grown. Design, calibration, and description of the equibiaxial strain system for cultured cells have been previously reported (7, 47). Typical experiments were carried out with 13 control and 13 experimental wells in which the cells were seeded at a density of 250,000 cells/well and incubated for 24 h in serum-containing medium. The medium was then removed and replaced by serum-free medium. For experimental wells, biaxial strain (0-10%) was applied by stretching the elastic membrane of the wells cyclically at a frequency of 0.3 Hz. For controls, cells were cultured in the apparatus wells under the same conditions but were not subjected to mechanical strain. After completion of the stretch regimen, control and stretched cells were pooled, divided into two samples, and processed for either RNA or protein analysis. Stretch and control apparatus wells were seeded using the same pool of cells, and analyses were carried out simultaneously and identically.

Drug treatments. Cells were plated in collagen-coated wells in serum-containing medium as described above. Twentyfour hours later, the medium was replaced with serum-free medium containing drugs as indicated in the text. The cells were left in the presence of a given inhibitor at least 30 min before the application of mechanical stretch for an additional 30 min. Stock solutions of each drug were made in either aqueous solution or in DMSO and diluted to a working concentration in serum-free medium.

Cyr61 cDNA probe and antibodies. An 886-bp cDNA fragment was amplified by PCR using total RNA from serum-stimulated smooth muscle cells as a template together with the primer combinations 5'CCAGCTTGTTGGCGTCTT3' and 5'TTACATTTCCCCTCCCTCCC3' (32). The PCR product was purified, cloned into the expression vector pCRII from Invitrogen, sequenced, and used in Northern blot analysis as a probe. Two 16-amino acid peptides (residues between 102 and 118 and 217 and 233 in the primary sequence of the human Cyr6, GenBank accession no. AF307860) were synthesized and purified by high-performance liquid chromatography (Biosynthesis). Each peptide was coupled to maleimide-activated KLH (Pierce) at a ratio of 1 mg of peptide per milligram of KLH. Antibodies were raised in rabbits by Cocalico Biologicals (Reamstown, PA). After completion of the immunization process, the rabbits were exsanguinated, and the antibodies were purified by affinity chromatography using affinity columns from Pharmacia. Bound antibodies were eluted with 100 mM glycine and immediately neutralized with Tris base and adjusted to a concentration of 0.4 mg/ml before storage at -20°C. Serum titer was determined by enzyme-linked immunosorbent assay.

Northern blot hybridization. Total RNA was extracted from cells as previously described (13). A sample containing 12 µg of total RNA was fractionated by electrophoresis in 1% agarose/formaldehyde gel, transferred to Zeta-Probe nylon filters (Bio-Rad, Richmond, CA), and hybridized to Cyr61-radiolabeled cDNA probe. A specific probe for CTGF was radiolabeled as well and hybridized to the filters that were stripped according the manufacturer's instructions (Bio-Rad). Total RNA loading and transfer were evaluated by probing with a glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA probe. The filters were analyzed by phosphorimaging, and hybridization signals were quantified to determine the relative amounts of mRNA (Molecular Dynamics). The mRNA levels were analyzed in duplicate samples and normalized to equivalent values for GAPDH to compensate for loading and transfer.

Immunohistochemistry and immunoblotting. For Western blot analysis, lysates from stretched and control unstretched cells were prepared by harvesting the cells in 0.1% Triton X-100 lysis buffer as previously described (8). Protein concentration was determined by using the Bradford protein assay (Bio-Rad). Protein samples (30 µg) were separated by 10% SDS-polyacrylamide gel, transferred to nitrocellulose membrane, and Western blot analysis was performed using Cyr61 antibody. Immunodetection was performed using enhanced chemiluminescence (Amersham).

For immunohistochemistry analysis, cells were fixed with 3.7% formaldehyde in PBS and permeabilized with 0.5% Triton X-100 to allow the antibody binding to both extra- and intracellular antigen. Cells were incubated for 24 h with a 1:200 dilution of anti-Cyr61 antibody. Cells were then washed with PBS, and the immunodetection was then performed with a goat anti-rabbit IgG-rhodamine conjugate (1:300 dilution). After a final wash, the membrane was mounted on a glass microscope slide, and the immunostaining was visualized by confocal microscopy.

Nuclear protein extraction. Cells were trypsinized, pelleted by centrifugation, and resuspended in ice-cold sucrose buffer containing 0.1% Triton X-100 to lyse the cells (5). When lysis was complete, the preparations were washed several times with lysis buffer to remove the cytoplasm and debris. The purity of nuclei preparations was verified by microscopic examination. These purified nuclear fractions were further extracted and subjected to Western blot analysis as described above.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Cultured smooth muscle cells were first subjected to a 5% cyclic equibiaxial strain at a frequency of 0.3 Hz for various periods of time. The magnitude and the strain rate used were previously shown to induce changes in growth and synthetic phenotype of these cells (4, 9). Cells cultured under the same conditions but not subjected to mechanical strain were used as controls. Northern blot analysis of RNA (a representative experiment of which is shown in Fig. 1A) demonstrates that Cyr61 mRNA was rapidly but transiently induced in stretched cells. Cyr61 mRNA levels peaked after 1 h of stretching and decayed to undetectable levels thereafter. Mechanical stretch of 1-h duration resulted in a five- to ninefold increase of Cyr61 mRNA, as determined by phosphorimager scanning of the hybridization signals (Fig. 1B). In contrast, the application of mechanical stretch decreased the CTGF mRNA levels. However, this decrease was also seen in control cells cultured under static conditions for the same period of time, indicating lack of the proper effect of mechanical stretch on CTGF gene expression (data not shown). Furthermore, we examined the effects of strain magnitude by applying strains of 1.5, 2.5, 5, or 7.5% to the cells for 30 min and assessing the mRNA levels of Cyr61 and CTGF. As shown in Fig. 1C, mechanical stretch-induced Cyr61 gene expression was positively correlated with the magnitude of the mechanical strain. The minimal strain required to trigger this response was 2.5%. The CTGF mRNA levels were decreased in stretched cells to nearly the same extent regardless of the strain magnitude used.


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 1.   Effect of cyclic mechanical stretch on Cyr61 mRNA levels in bladder smooth muscle cells. A: bladder smooth muscle cells were subjected to mechanical stretch (5% strain, 0.3 Hz) for the indicated time periods. Total RNA was prepared from the cells and subjected to Northern blot analysis using a specific DNA probe for Cyr61 as described in MATERIALS AND METHODS. For comparison, blots were stripped and reprobed for connective tissue growth factor (CTGF) mRNA. To control for equal RNA loading, the blot was hybridized with a specific glyceraldehyde-3-phosphate dehydrogenase (GAPDH) DNA probe. B: graphical representation of the results of phosphorimage scans of the hybridization signals. The values are normalized to those of the GAPDH signals and represent means ± SE (n = 4). C: cells were subjected to different strain magnitudes for 30 min, and the mRNAs for Cyr61 and CTGF were analyzed by Northern blot as described above.

To determine whether stretch-induced changes in Cyr61 mRNAs caused corresponding changes in protein levels, we performed Western blot analyses using specific monoclonal antibodies raised against selected immunogenic peptides of Cyr61. The polyclonal antibody reacted well with the bovine protein extract and recognized an ~42-kDa protein band in both stretched and control cell lysates (Fig. 2A). The application of mechanical stretch induced a nearly 3.5-fold increase of Cyr61 band intensity after 1 or 2 h of stretching, as determined by densitometric measurements (Fig. 2B). Analyses of conditioned medium from stretched cells failed to detect Cyr61 protein in the supernatant (data not shown).


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 2.   Effects of cyclic stretch on Cyr61 protein expression in smooth muscle cells. A: cells were stretched for the indicated time periods as described in Fig. 1. Thirty micrograms of total proteins from cell lysates were fractionated by SDS-PAGE, transferred to a nylon membrane, and incubated with Cyr61 antibody (1:200). Immunodetection was performed by enhanced chemiluminescence. B: densitometric scans of the chemiluminescent band of Cyr61 was performed, and the values were normalized to the control value. Values represent means ± SE (n = 3).

The cellular localization and distribution of the Cyr61 protein was examined by immunohistochemistry in stretched (5% strain, 1 h) and control nonstretched cells as described in MATERIALS AND METHODS. As shown in Fig. 3A, the immunostaining of stretched smooth muscle cells was mainly localized intracellularly within the cytoplasm and the nucleus. The detected immunohistochemical signal was blocked either when the primary antibody was omitted or when the Cyr61 antigen but not an irrelevant antigen was added to block the primary antibody binding (data not shown). To further investigate the nuclear localization of Cyr61, cells were subjected to mechanical stretch for 1 h, and their nuclei were extracted as previously described (5). The protein content of nuclear preparations from stretched and unstretched cells was analyzed by Western blotting. As shown in Fig. 3B, a major Cyr61 band was detected in the nuclear extract of stretched cells, confirming the nuclear localization of Cyr61 in the cells.


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 3.   Immunolocalization of Cyr61 in smooth muscle cells. A: control nonstretched and 1-h stretched cells were fixed with formaldehyde, permeabilized with detergent, and incubated with anti-Cyr61 antibodies. The immunostaining was revealed with an anti-rabbit IgG-rhodamine conjugate and visualized by confocal microscopy (magnification ×40). B: nuclei were prepared from control unstretched (C) and stretched (S) cells, and their protein content was analyzed for the Cyr61 protein expression by Western blot as described in MATERIALS AND METHODS.

To determine the signal transduction pathways that couple Cyr61 gene induction to mechanical stimulation, we treated the cells with various pharmacological inhibitors of known signaling cascades before the application of mechanical stretch. Total RNA was extracted and analyzed for Cyr61 mRNA levels. Pretreatment of the cells with either losartan or aminoguanidine, which block angiotensin type I receptor and nitric oxide synthase, respectively, did not affect Cyr61 gene responsiveness to mechanical stretch (data not shown). Representative experiments using inhibitors that consistently affected Cyr61 mRNA levels are shown in Fig. 4A. Either calphostin C, a specific protein kinase C (PKC) inhibitor, or wortmannin, a phosphatidylinositol 3-kinase inhibitor, induced a nearly 45% decrease of Cyr61 mRNA levels in stretched cells but did not completely abrogate the gene expression. The agents bis-indolyl maleimide and quercetin, other specific inhibitors of PKC and phosphatidylinositol 3-kinase, respectively, were equally effective inhibitors of stretch-induced Cyr61 gene expression (data not shown). Additionally, when added to the cells simultaneously, the effects of PKC and phosphatidylinositol 3-kinase inhibitors were not additive, suggesting that PKC and phosphatidylinositol 3-kinase are potentially involved in the same signaling pathway.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 4.   Effects of mechanical stretch on Cyr61 gene expression in the presence of pharmacological inhibitors of known signaling pathways. A: cells were preincubated for 30 min with either calphostin C (50 ng/ml), wortmannin (20 µM), a combination of both calphostin C and wortmannin, FTI-277 (10 nM), or GGTI-298 (10 nM) before the application of a 5% cyclic stretch for 30 min. Northern blots of RNA derived from the treated and control untreated cells were performed to assess the transcript levels of Cyr61 as described in MATERIALS AND METHODS. Shown is the percentage of the relative increase in mRNA levels. B: cells were incubated with the indicated concentrations of the inhibitor Y-27632 before the application of mechanical stretch as described above. The mRNA levels for Cyr61 were determined by Northern blot analysis. Values are means ± SE (n = 3).

We further tested the effects the agents GGTI-298 and FTI-277, which inhibit prenylation of some signaling proteins, including those belonging to the small G proteins of the Ras superfamily (27). Protein prenylation is required for the proper subcellular localization and function of these proteins. Treatment of the cells with GGTI-298 (20 µM), a reagent that inhibits protein geranylgeranylation, completely blocked stretched-increased Cyr61 mRNA levels (shown in Fig. 4A). In contrast, FTI-277 (20 µM), a reagent that blocks protein farnesylation, did not affect the expression of Cyr61 gene in stretched cells. These inhibitors were used at concentrations that selectively blocked the prenylation and function of small G proteins like N-Ras, lamin B, or Rho (24, 27). This indicates that signaling proteins whose biological activity requires the addition of geranylgeranyl groups play a crucial role in stretch regulation of Cyr61 mRNA levels.

Because the small G proteins of the Rho family such as RhoA are prominent members of the geranylgeranylated protein group, we tested the effects of Y-27632, a specific inhibitor of RhoA-dependent activation of Rho kinase signaling pathways, on Cyr61 gene expression (19). As shown in Fig. 4B, addition of this agent to the cells dose dependently reduced the levels of Cyr61 mRNA in stretched cells. When Y-27632 was used at a concentration of 0.2 µM, the Cyr61 mRNA levels were decreased by 25%. When the concentration used was 20 µM, Cyr61 mRNA levels were further reduced by 55% (P < 0.05). This implicates the RhoA pathways in stretch-induced Cyr61 gene activation.

Previous studies have suggested that RhoA activation regulates gene expression through its effects on the actin cytoskeleton (42). Therefore, to test whether mechanical stretch regulates Cyr61 gene through actin dynamics, we treated the cells with latrunculin B, a toxin that disrupts actin polymerization by binding and sequestration of G-actin monomers, before the application of mechanical stretch. As shown in Fig. 5A, latrunculin B treatment (0.5 µM) of the cells dramatically attenuated (-45%) stretch-induced Cyr61 mRNA levels (P < 0.05). Because of its effects on the actin cytoskeleton, treatment of the cells with latrunculin B seemed to alter cell shape momentarily but reversibly (after 8 h), indicating that this drug was not overtly cytotoxic (data not shown). Moreover, to further test whether Cyr61 gene transcription was sensitive to actin dynamics, we treated the cells with jasplakinolide, a toxin known to increase actin polymerization by severing F-actin, creating new nucleation sites that support actin polymerization. As shown in Fig. 5B, jasplakinolide treatment (0.5 µM) increased Cyr61 transcription threefold (P < 0.05). This indicates that Cyr61 gene expression is directly regulated by mechanisms that sense actin dynamics in smooth muscle cells. Additionally, pretreatment of the cells with inhibitors such as calphostin C (50 ng/ml), wortmanin (20 µM), or Y-27632 (20 µM) did not significantly alter jasplakinolide-induced Cyr61 gene expression (Fig. 5C). Thus actin polymerization alone is sufficient to induce Cyr61 gene expression and does not require other cooperating signaling molecules such as PKC, phosphatidylinositol 3-kinase, or Rho-associated kinase. Similarly, latrunculin B treatment of the cells did not block jasplakinolide-induced Cyr61 gene expression, consistent with the fact that the two drugs target different types of actin (data not shown).


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 5.   Effects of drug-induced modulation of actin polymerization on Cyr61 gene expression. A: cells were preincubated with 0.5 µM latrunculin B (LtB) for 30 min before the application of a 5% cyclic stretch for 30 min. The mRNA levels of Cyr61 were assessed as described previously. B: cells cultured in regular culture flasks were incubated with 0.5 µM jasplakinolide (Jaspk). After 30 min of incubation, cells were harvested and processed for total RNA extraction and Cyr61 mRNA level measurements as described in MATERIALS AND METHODS. C: cells cultured in regular flasks were treated with 0.5 µM jasplakinolide in the presence of either calphostin C (Calph.), wortmannin (Wort.), or Y-27632. After 30 min of incubation with the drugs, cells were processed for total RNA extraction, and Cyr61 mRNA levels were determined as previously described. Values are means ± SE (n = 3).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The present study demonstrates that Cyr61 gene expression in cultured bladder smooth muscle cells is inducible by mechanical stretch. Increases of Cyr61 gene expression occurred rapidly after the application of stretch. The message levels were increased five- to ninefold after 30 min and 1 h of mechanical stretching and became undetectable thereafter, reflecting a transient response analogous to that of immediate early genes, i.e., c-fos and egr-1 (11, 29). The reestablishment of basal levels might be indicative of an adaptive mechanism in which compensatory signaling pathways are activated to allow Cyr61 gene transcription to return to normal levels. The strain magnitude tested (between 2.5 and 7.5%) caused no apparent cell detachment or damage, indicating that stretch-induced Cyr61 gene response was not the result of cell injury. We also showed that while the mRNA levels of Cyr61 gene were increased, those of CTGF, another member of the Cyr61 family, were not affected by mechanical stretch, indicating that stretch-induced Cyr61 mRNA is a selective process. In fact, although Cyr61 and CTGF were shown to behave in a similar manner in that both were simultaneously induced by several serum growth factors, subtle differences exist between them (26). For example, CTGF was shown to be mitogenic by itself, whereas Cyr61 has no intrinsic mitogenic activity but augments growth factor-induced DNA synthesis; Cyr61 was shown to stimulate chemotaxis, whereas CTGF stimulates both chemotaxis and chemokinesis; and, although both Cyr61 and CTGF are extracellular matrix-associated molecules, only CTGF was shown to be secreted in the culture medium. Together, these observations suggest that the expression profile of Cyr61 gene is stimulus specific and might confer phenotypic specificity to the cellular response.

Stretch-induced increases in Cyr61 mRNA levels resulted in increased protein expression that was detected by Western blot in the cell lysates after 1 h and for up to 4 h of mechanical stretching. The persistent increase of the Cyr61 protein in cells, despite an early waning in its mRNA levels, suggests a higher stabilization of the protein in stretched cells. These results corroborate other data indicating that the half-life of the newly synthesized Cyr61 in serum-stimulated 3T3 fibroblasts ranged from 30 min to several hours (20).

We determined the cellular localization of the protein by immunohistochemical analyses. The immunostaining in stretched cells was mainly localized intracellularly within the cytoplasm and the nucleus. Previous studies have shown that Cyr61 immunoreactivity was detected both intracellularly and extracellularly in smooth muscle of placental tissue (20). On the basis of structural considerations, the nuclear localization of Cyr61 was surprising, since the primary sequence does not contain a classic nuclear localization signal found in proteins, such as transcription factors, that translocate to the nucleus. In fact, the presence of a peptide signal in the amino-terminal region and the multidomain structure of the protein suggest that the protein is targeted for secretion. Nevertheless, the presence of Cyr61 in the nucleus, while intriguing in its own right, is reminiscent of other examples of proteins found in the nucleus, despite their lack of a nuclear localization signal. The growing list of such polypeptides includes Nov (another member of the Cyr61 family), epidermal growth factors, PDGF, fibroblast growth factors, angiogenin, and parathyroid hormone-related peptide (16, 37). These proteins are thought to elicit their biological effects in a bifunctional manner: both indirectly through interaction with cell surface receptor linked to conventional signal transduction pathways as well as through direct association with the nuclei of target cells. The biological significance of nuclear targeting of these secretory proteins remains to be determined. In most instances, a number of hypotheses have been put forward regarding transcriptional regulation, translational control, and/or mRNA transport. Thus the detection of Cyr61 in the nuclei of smooth muscle cells opens new prospects as to the biological role of this protein.

In the next step in the analysis of Cyr61 gene activation, we sought to determine the signal transduction pathways required for the response to mechanical stretch. We employed various intracellular inhibitors of known signaling molecules to define the signaling pathways implicated in stretch regulation of Cyr61 gene expression. Inhibitors that interfere with signaling through phospholipase C, cAMP, or mitogen-activated protein kinase (ERK1/2) did not affect the response of Cyr61 gene to stretch (data not shown). Conversely, specific inhibitors of PKC and phosphatidylinositol 3-kinase, used either separately or in combination, partially impaired (~45%) stretch-mediated increased expression of Cyr61 gene. In agreement with our results, O'Brien et al. (34) have shown that activators of PKC such as 12-O-tetradecanoylphorbol 13-acetate induces Cyr61 gene expression while Pendurthi et al. (36) showed that phosphatidylinositol 3-kinase inhibitors completely abrogated the expression Cyr61 gene in response to thrombin or cofactor VIIa stimulation in WI-38 fibroblast. Thus, there are, seemingly, multiple regulatory pathways that may control, possibly independently, the expression of Cyr61 gene. In our model, mechanical stretch signals, in part, through the activation of two signaling pathways (those involving PKC activation and phosphatidylinositol 3-kinase) that could merge and/or overlap downstream.

Additionally, by using specific inhibitors that interfere with protein prenylation, which is required for numerous signaling protein activation and translocation to the plasmic membrane (27, 44), we found that the mechanical stretch-induced Cyr61 gene was completely suppressed (~96%) by inhibiting the subgroup of proteins that require geranylgeranylation (i.e., Rho family proteins). In contrast, inhibiting the proteins that require farnesylation (such as N-Ras) had no effect. These results indicate that one or more geranylgeranylated proteins is a key player in Cyr61 gene response to mechanical forces and that those of the Rho family of proteins are very likely candidates. Interestingly, numerous studies have shown that Rho proteins were activated in mechanically stretched smooth muscle and shear-stressed endothelial cells (30, 35). Mechanical stretch of vascular smooth muscle cells induces activation and translocation of RhoA to the membrane at a level comparable to that of known RhoA stimulators such as endothelin, angiotensin II, and lysophosphatidic acid (33). Several putative stretch-sensing structures mediate Rho activation, including growth factor receptors (i.e., receptor tyrosine kinases), G protein-coupled receptors, and integrins (22, 29). These membrane receptors may either independently or coordinately regulate the activity of Rho. The data presented in Fig. 4B indicate that the selective inhibition of RhoA and its associated kinase p160 ROCK using the Y-27632 inhibitor significantly reduced the mRNA levels of Cyr61 (P < 0.05). This suggests that mechanical stretch signals to Cyr61 gene expression through Rho-dependent activation of Rho-associated kinase.

It is well known that RhoA-dependent activation of Rho kinase induces actin polymerization and stress fiber formation in many cell types, including smooth muscle cells (1, 44). Rho-associated kinase phosphorylates and inactivates the myosin-binding subunit of myosin light chain phosphatase, thereby inhibiting myosin light chain dephosphorylation. As a result, the phosphorylated form of myosin light chain accumulates, leading to contraction of the actomyosin-based cytoskeleton of smooth muscle. Our data indicated that drug-induced modulation of the actin cytoskeleton affected Cyr61 gene expression. Treatment of the cells with the drug latrunculin B, which inhibits actin polymerization, markedly impaired stretch-induced Cyr61 gene transcription. This supports a model in which RhoA-mediated increase in actin polymerization promotes specific gene expression. Previous studies have shown that several immediate early genes, including c-fos and smooth muscle cell-specific genes, were activated through RhoA proteins and were sensitive to actin dynamics (35, 42). A plausible explanation to such a regulation suggests a model whereby, in the absence of Rho-induced actin polymerization, G-actin inhibits transcription factors such as serum-response factor (SRF) or nuclear factor (NF)-kappa B, either directly or by sequestering cofactors required for their activation (31, 46). Activation of such trans-acting factors and their translocation to the nucleus is required for the activation of their targeted genes. In agreement with this, the Cyr61 gene promoter contains several trans-acting factor-binding sites including those for SRF, AP-1, and NF-kappa B (25). Whether stretch activation of Cyr61 gene requires activation of such trans-acting factors remains to be elucidated. Future work will be directed toward defining the transcriptional and/or posttranscriptional requirements for stretch-induced Cyr61 gene expression and understanding the role of actin dynamics in such activation.

Overall, our study demonstrates that induction of Cyr61 gene expression is not under the control of serum growth factors only, as shown in previous reports, but is also regulated by mechanical stimuli, thus extending the biological context of Cyr61 gene activation. Induced Cyr61 gene response to stretch is not unique to cells from the bladder tissue but is also shared by lamina propria fibroblasts and smooth muscle cells from other tissues such as the aorta (data not shown). However, only a modest 2- to 2.5-fold increase of Cyr61 mRNA levels was observed in these cells compared with a 5- to 9-fold increase in bladder smooth muscle cells when subjected to the same stretch regimen. Whether these differences represent intrinsic properties of bladder smooth muscle cells and what the biological significance of this may be will require further investigation. Nevertheless, the utilization of various pharmacological inhibitors disclosed a net effect of signaling through PKC, phosphatidylinositol 3-kinase, and Rho-associated kinase in stretch-induced Cyr61 gene expression. The different degree of inhibition observed by a given inhibitor may reflect either the difference of the contribution of each signaling molecule to the gene expression or a potential complex and interdependent signaling networks involved. Indeed, a key component of the downstream pathway of either PKC or phosphatidylinositol 3-kinase is the actin cytoskeleton (17, 22, 43). The importance of the latter in relaying PKC and phosphatidylinositol 3-kinase signals has been reported and may play a role in mediating Cyr61 gene activation. Studies have shown that direct activation of PKC isoforms by phorbol ester has dramatic effects on the assembly and disassembly of the F-actin network, and there is abundant evidence showing an isoenzyme-specific translocation to the F-actin components of the cytoskeleton in intact cells (18, 41). Alternatively, either PKC or phosphatidylinositol 3-kinase may affect reorganization of the actin cytoskeleton and gene expression through their interaction with Rho proteins, although activation of PKC and/or phosphatidylinositol 3-kinase can be either upstream or downstream of the Rho family, depending on the system (39, 45). The precise complex mechanism underlying cross talk between these signaling molecules and the actin cytoskeleton and its impact on stretch-induced Cyr61 gene expression is yet to be determined. On the other hand, the ability of jasplakinolide-mediated actin polymerization to induce, on its own, Cyr61 gene expression supports a model in which selective and specific gene expression is controlled by changes in G- and F-actin levels in the cells. Such a regulatory mechanism has been demonstrated for a subset of SRF target genes such as SRF itself and vinculin (42).

Finally, the upregulation of Cyr61 gene expression by mechanical strain may have pathophysiologically relevant implications in vivo. Several pathological conditions that result from increased mechanical strain such as hypertension, bladder outlet obstruction, atherosclerosis, and acute respiratory distress syndrome, are characterized by hypertrophy/hyperplasia, fibrosis, and/or modulation phenotypic of smooth muscle cells (6, 15, 42). Therefore, on the basis of currently known biological activities of the Cyr61 recombinant protein, we anticipate that increased Cyr61 protein levels in highly stressed tissues likely play a major role as an early marker and a potent effector of the remodeling process in smooth muscle compartments (14, 26). Cyr61 may participate in such a process by stimulating, in either a direct or indirect fashion, cell migration, attachment, and/or proliferation. Moreover, both the Cyr61 gene expression pattern and its regulatory mechanism (as demonstrated by its gene responsiveness to either actin dynamics or RhoA signaling, a critical mechanism for regulation of smooth muscle cell differentiation) seem to be similar to those of prohypertrophic molecules, i.e., SRF and alpha -actin (31, 42). Therefore, Cyr61 is a potential early molecular signal of smooth muscle cell differentiation and may be involved in the activation of specific features of their hypertrophic response in pathological conditions. Accordingly, a detailed study of the functional significance of Cyr61 gene activation in stress-related pathologies is warranted.


    ACKNOWLEDGEMENTS

This study was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-02685 (to B. Chaqour) and a complement from DK-45419.


    FOOTNOTES

Present address of I. Tamura: Dept. of Biochemistry, Osaka Dental School, Osaka, Japan.

Address for reprint requests and other correspondence: B. Chaqour, Dept. of Histology, Univ. of Pennsylvania, 416 Levy Research Bldg., 4001 Spruce St., Philadelphia, PA 19104 (E-mail: chaqour{at}biochem.dental.upenn.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 8 May 2001; accepted in final form 13 June 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Amano, M, Chihara K, Kimura K, Fukata N, Nakamura Y, Matsuura Y, and Kaibuchi K. Formation of actin stress fibers and focal adhesions enhanced by Rho kinases. Science 275: 1308-1311, 1997[Abstract/Free Full Text].

2.   Babic, AM, Kireeva ML, Kolesnikova TV, and Lau LF. Cyr61, a product of a growth factor-inducible immediate early gene, promotes angiogenesis and tumor growth. Proc Natl Acad Sci USA 95: 6355-6360, 1998[Abstract/Free Full Text].

3.   Baskin, LS, Howard P, Duckett JW, Snyder HM, and Macarak EJ. Bladder smooth muscle cells in culture: I. Identification and characterization. J Urol 149: 190-197, 1993[Web of Science][Medline].

4.   Baskin, LS, Howard PS, and Macarak EJ. Effect of physical forces on bladder smooth muscle and urothelial cell matrix synthesis. J Urol 150: 601-607, 1993[Web of Science][Medline].

5.   Bellon, G, Chaqour B, Monboisse JC, and Borel JP. Glutamine increases collagen gene expression in fibroblast cultures. Biochim Biophys Acta 1268: 311-323, 1995[Medline].

6.   Brading, AF. Alterations in the physiological properties of urinary bladder smooth muscle caused by bladder emptying against an obstruction. Scand J Urol Nephrol Suppl 184: 51-58, 1997[Medline].

7.   Chaqour, B, Howard P, and Macarak EJ. Identification of stretch sensitive genes by means of a two-arbitrary primer-based mRNA differential display approach. Mol Cell Biochem 197: 87-96, 1999[Web of Science][Medline].

8.   Chaqour, B, Richards CF, Howard PS, and Macarak EJ. Mechanical stretch induces platelet-activating factor receptor gene expression through the NF-kappa B transcription factor. J Mol Cell Cardiol 31: 1345-1355, 1999[Web of Science][Medline].

9.  Chaqour B, Han JS, Tamura I, and Macarak E. Mechanical regulation of IGF-I and IGF-binding protein gene transcription in bladder smooth muscle cells. J Cell Biochem. In press.

10.   Chen, N, Chen CC, and Lau LF. Adhesion of human skin fibroblasts to Cyr61 is mediated through integrin alpha 6beta 1 and cell surface heparan sulfate proteoglycans. J Biol Chem 275: 24953-24961, 2000[Abstract/Free Full Text].

11.   Chien, S, Li S, and Shyy YJ. Effects of mechanical forces on signal transduction and gene expression in endothelial cells. Hypertension 31: 163-169, 1998.

12.   Chiquet, M. Regulation of extracellular matrix gene expression by mechanical stress. Matrix Biol 18: 417-426, 1999[Web of Science][Medline].

13.   Chomczynski, P, and Sacchi N. Single step method of RNA isolation by acid-phenol-chloroform extraction. Anal Biochem 162: 156-159, 1987[Web of Science][Medline].

14.   Grzeszkiewicz, TM, Kirschling DJ, Chen N, and Lau LF. CYR61 stimulates human skin fibroblast migration through integrin alpha vbeta 5 and enhances mitogenesis through integrin alpha vbeta 3 independent of its carboxy-terminal domain. J Biol Chem 276: 21943-21950, 2001[Abstract/Free Full Text].

15.   Hunter, JJ, and Chien KR. Mechanisms of disease: signaling pathways for cardiac hypertrophy and failure. N Engl J Med 34: 1276-1283, 1999.

16.   Jans, DA, and Hassan G. Nuclear targeting by growth factors, cytokines and their receptors: a role in signaling? Bioessays 20: 400-411, 1999.

17.   Keenan, C, and Kelleher D. Protein kinase C and the cytoskeleton. Cell Signal 10: 225-232, 1998[Web of Science][Medline].

18.   Kiley, SC, Kaken S, Whelan R, and Parker PJ. Intracellular targeting of protein kinase C isoenzymes: functional implications. Biochem Soc Trans 23: 601-605, 1995[Web of Science][Medline].

19.   Kimura, K. Regulation of myosin phosphatase by Rho and Rho-associated kinase (Rho-kinase). Science 273: 245-248, 1996[Abstract].

20.   Kireeva, ML, Latinkic BV, Kolesnikova TV, Chen CC, Yang GP, Abler AS, and Lau LF. Cyr61 and Fisp12 are both ECM-associated signaling molecules: activities, metabolism and localization during development. Exp Cell Res 233: 63-77, 1998.

21.   Kireeva, ML, Mo FE, Yang GP, and Lau LF. Cyr61, a product of a growth factor-inducible immediate early gene, promotes cell proliferation, migration and adhesion. Mol Cell Biol 16: 1326-1334, 1996[Abstract].

22.   Kjoller, L, and Hall A. Signaling to Rho GTPases. Exp Cell Res 253: 166-179, 1999[Web of Science][Medline].

23.   Kolesnikova, TV, and Lau LF. Human Cyr61-mediated enhancement of bFGF-induced DNA synthesis in human umbilical vein endothelial cells. Oncogene 16: 747-754, 1998[Web of Science][Medline].

24.   Kucich, U, Rosenbloom J, Shen G, Abrams WR, Blaskovich MA, Hamilton AD, Ohkanda J, Sebti SM, and Rosenbloom J. Requirement for geranylgeranyl transferase I and acyl transferase in the TGF-beta -stimulated pathway leading to elastin mRNA stabilization. Biochem Biophys Res Commun 252: 111-116, 1998[Web of Science][Medline].

25.   Latinkic, BV, O'Brien TP, and Lau LF. Promoter function and structure of the growth factor-inducible immediate early gene cyr61. Nucleic Acids Res 19: 3261-3267, 1990[Abstract/Free Full Text].

26.   Lau, LF, and Lam SC. The CCN family of angiogenic regulators: the integrin connection. Exp Cell Res 248: 44-57, 1999[Web of Science][Medline].

27.   Lerner, E, Qian Y, Blaskovitch MA, Fossum R, Vigt A, Sun J, Cox A, Hamilton AD, and Sebti SM. Ras CAAX peptidomimetic FTI-277 selectively blocks oncogenic Ras signaling by inducing cytoplasmic accumulation of inactive Ras-Raf complexes. J Biol Chem 270: 26802-26806, 1995[Abstract/Free Full Text].

28.   Leung, DY, Glagov S, and Mathews MB. Cyclic stretching stimulates synthesis of matrix components by arterial smooth muscle cells in vitro. Science 191: 475-477, 1976[Abstract/Free Full Text].

29.   Li, C, and Xu Q. Mechanical stress-initiated signal transductions in vascular smooth muscle cells. Cell Signal 12: 435-445, 2000[Web of Science][Medline].

30.   Li, S, Chen B, Azuma N, Hu HL, Wu SZ, Sumpio BE, Shyy JY, and Chien S. Distinct roles for the small GTPases Cdc42 and Rho in endothelial responses to shear stress. J Clin Invest 103: 1141-1150, 1999[Web of Science][Medline].

31.   Mack, CP, Somlyo AV, Hautmann M, Somlyo AP, and Owens GK. Smooth muscle differentiation marker gene expression is regulated by RhoA-mediated actin polymerization. J Biol Chem 276: 341-347, 2001[Abstract/Free Full Text].

32.   Martinerie, C, Viegas-Pequignot E, Nguyen VC, and Perbal B. Chromosomal mapping and expression of the human cyr61 gene in tumor cells from the nervous system. Mol Pathol 50: 310-316, 1997[Abstract/Free Full Text].

33.   Numaguchi, K, Satoru E, Yamakawa T, Motley ED, and Inagami T. Mechano-transduction of rat aortic vascular smooth muscle cells requires RhoA and intact actin filaments. Circ Res 85: 5-11, 1999[Abstract/Free Full Text].

34.   O'Brien, TP, Yang GP, Sanders L, and Lau LF. Expression of Cyr61, a growth factor inducible immediate-early gene. Mol Cell Biol 10: 3569-3577, 1990[Abstract/Free Full Text].

35.   Owens, GK. Role of mechanical strain in regulation of differentiation of vascular smooth muscle cells. Circ Res 79: 1054-1055, 1996[Free Full Text].

36.   Pendurthi, UR, Allen KE, Ezban M, Mohan M, and Rao LV. Factor VIIa and thrombin induce the expression of Cyr61 and connective tissue growth factor, extracellular matrix signaling proteins that could act as possible downstream mediators in factor VIIa tissue factor-induced signal transduction. J Biol Chem 275: 14632-14641, 2000[Abstract/Free Full Text].

37.   Perbal, B. Nuclear localization of NOVH protein: a potential role for NOV in the regulation of gene expression. Mol Pathol 52: 84-91, 1999[Abstract].

38.   Pette, D, and Staron RS. Mammalian skeletal muscle fiber type transitions. Int Rev Cytol 170: 143-223, 1997[Medline].

39.   Ren, XD, and Schwartz MA. Regulation of inositol lipid kinases by Rho and Rac. Curr Opin Genet Dev 8: 3-67, 1998.

40.   Schaub, MC, Hefti MA, Harder BA, and Eppenberger HM. Various hypertrophic stimuli induce distinct phenotypes in cardiomyocytes. J Mol Med 75: 901-920, 1997[Web of Science][Medline].

41.   Slater, SJ, Stagliano BA, Seiz JL, Curry JP, Milano SK, Gergich KJ, and Stubbs CD. Effects of ethanol on protein kinase C activity induced by filamentous actin. Biochim Biophys Acta 1544: 207-216, 2001[Medline].

42.   Sotiropoulos, A, Gineitis D, Copeland J, and Treisman R. Signal-regulated activation of serum response factor is mediated by changes in actin dynamics. Cell 98: 159-169, 1999[Web of Science][Medline].

43.   Tolias, KF, Cantley LC, and Carpenter CL. Rho family GTPases bind phosphoinositide kinases. J Biol Chem 270: 17656-17659, 1995[Abstract/Free Full Text].

44.   Van Aelst, L, and D'Souza-Schorey C. Rho GTPases and signaling network. Genes Dev 11: 2295-2322, 1997[Free Full Text].

45.   Wang, P, and Bitar K. RhoA regulates sustained smooth muscle contraction through cytoskeletal reorganization of HSP27. Am J Physiol Gastrointest Liver Physiol 275: G1454-G1462, 1998[Abstract/Free Full Text].

46.   Wei, L, Zhou W, Croissant JD, Johansen FE, Prywes R, Balasubramanyam A, and Schwartz RJ. RhoA signaling via serum response factor plays an obligatory role in myogenic differentiation. J Biol Chem 273: 30287-30294, 1998[Abstract/Free Full Text].

47.   Winston, FK, Macarak EJ, Gorfien SF, and Thibault LE. A system to reproduce and quantify the biomechanical environment of the cell. J Appl Physiol 67: 397-405, 1989[Abstract/Free Full Text].

48.   Wyncoll, DL, and Evans TW. Acute respiratory distress syndrome. Lancet 354: 497-501, 1999[Web of Science][Medline].

49.   Xie, D, Miller CW, O'Kelly J, Nakachi K, Sakashita A, Said JW, Gornbein J, and Koeffler HP. Breast cancer: Cyr61 is over-expressed, estrogen inducible and associated with more advanced disease. J Biol Chem 276: 14187-14194, 2001[Abstract/Free Full Text].


Am J Physiol Cell Physiol 281(5):C1524-C1532
0363-6143/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
A. S. Dobroff, H. Wang, V. O. Melnikova, G. J. Villares, M. Zigler, L. Huang, and M. Bar-Eli
Silencing cAMP-response Element-binding Protein (CREB) Identifies CYR61 as a Tumor Suppressor Gene in Melanoma
J. Biol. Chem., September 18, 2009; 284(38): 26194 - 26206.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Hanna, H. Liu, J. Amir, Y. Sun, S. W. Morris, M. A. Q. Siddiqui, L. F. Lau, and B. Chaqour
Mechanical Regulation of the Proangiogenic Factor CCN1/CYR61 Gene Requires the Combined Activities of MRTF-A and CREB-binding Protein Histone Acetyltransferase
J. Biol. Chem., August 21, 2009; 284(34): 23125 - 23136.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
R. Yang, J. Amir, H. Liu, and B. Chaqour
Mechanical strain activates a program of genes functionally involved in paracrine signaling of angiogenesis
Physiol Genomics, December 12, 2008; 36(1): 1 - 14.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
C. T. Walsh, J. Radeff-Huang, R. Matteo, A. Hsiao, S. Subramaniam, D. Stupack, and J. H. Brown
Thrombin receptor and RhoA mediate cell proliferation through integrins and cysteine-rich protein 61
FASEB J, November 1, 2008; 22(11): 4011 - 4021.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
R. Kivela, H. Kyrolainen, H. Selanne, P. V. Komi, H. Kainulainen, and V. Vihko
A single bout of exercise with high mechanical loading induces the expression of Cyr61/CCN1 and CTGF/CCN2 in human skeletal muscle
J Appl Physiol, October 1, 2007; 103(4): 1395 - 1401.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Chaqour, R. Yang, and Q. Sha
Mechanical Stretch Modulates the Promoter Activity of the Profibrotic Factor CCN2 through Increased Actin Polymerization and NF-{kappa}B Activation
J. Biol. Chem., July 21, 2006; 281(29): 20608 - 20622.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
D. Zhou, D. J. Herrick, J. Rosenbloom, and B. Chaqour
Cyr61 mediates the expression of VEGF, {alpha}v-integrin, and {alpha}-actin genes through cytoskeletally based mechanotransduction mechanisms in bladder smooth muscle cells
J Appl Physiol, June 1, 2005; 98(6): 2344 - 2354.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
R. M. Adam, S. H. Eaton, C. Estrada, A. Nimgaonkar, S.-C. Shih, L. E. H. Smith, I. S. Kohane, D. Bagli, and M. R. Freeman
Mechanical stretch is a highly selective regulator of gene expression in human bladder smooth muscle cells
Physiol Genomics, December 15, 2004; 20(1): 36 - 44.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
Y.-W. Chen, M. J. Hubal, E. P. Hoffman, P. D. Thompson, and P. M. Clarkson
Molecular responses of human muscle to eccentric exercise
J Appl Physiol, December 1, 2003; 95(6): 2485 - 2494.
[Abstract] [Full Text]


Home page
J. Am. Soc. Nephrol.Home page
K. Sawai, K. Mori, M. Mukoyama, A. Sugawara, T. Suganami, M. Koshikawa, K. Yahata, H. Makino, T. Nagae, Y. Fujinaga, et al.
Angiogenic Protein Cyr61 is Expressed by Podocytes in Anti-Thy-1 Glomerulonephritis
J. Am. Soc. Nephrol., May 1, 2003; 14(5): 1154 - 1163.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
N. Thiruchelvam, P. Nyirady, D. M. Peebles, C. H. Fry, P. M. Cuckow, and A. S. Woolf
Urinary Outflow Obstruction Increases Apoptosis and Deregulates Bcl-2 and Bax Expression in the Fetal Ovine Bladder
Am. J. Pathol., April 1, 2003; 162(4): 1271 - 1282.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
B. Chaqour, C. Whitbeck, J.-S. Han, E. Macarak, P. Horan, P. Chichester, and R. Levin
Cyr61 and CTGF are molecular markers of bladder wall remodeling after outlet obstruction
Am J Physiol Endocrinol Metab, October 1, 2002; 283(4): E765 - E774.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
K. Inoue, K. Matsuda, M. Itoh, H. Kawaguchi, H. Tomoike, T. Aoyagi, R. Nagai, M. Hori, Y. Nakamura, and T. Tanaka
Osteopenia and male-specific sudden cardiac death in mice lacking a zinc transporter gene, Znt5
Hum. Mol. Genet., July 15, 2002; 11(15): 1775 - 1784.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (19)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tamura, I.
Right arrow Articles by Chaqour, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tamura, I.
Right arrow Articles by Chaqour, B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online