|
|
||||||||
Department of Histology, University of Pennsylvania, Philadelphia, Pennsylvania 19104
| |
ABSTRACT |
|---|
|
|
|---|
The cysteine-rich protein 61 (Cyr61) is a signaling molecule with functions in cell migration, adhesion, and proliferation. This protein is encoded by an immediate early gene whose expression is mainly induced by serum growth factors. Here we show that Cyr61 mRNA levels increase sharply in response to cyclic mechanical stretch applied to cultured bladder smooth muscle cells. Stretch-induced changes of Cyr61 transcripts were transient and accompanied by an increase of the encoded protein that localized mainly to the cytoplasm and nucleus of the cells. With the use of pharmacological agents that interfere with known signaling pathways, we show that transduction mechanisms involving protein kinase C and phosphatidylinositol 3-kinase activation partly blocked stretch-induced Cyr61 gene expression. Selective inhibition of Rho kinase pathways altered this stretch effect as well. Meanwhile, using inhibitors of the actin cytoskeleton, we show that Cyr61 gene expression is sensitive to mechanisms that sense actin dynamics. These results establish the regulation of Cyr61 gene by mechanical stretch and provide clues to the key signaling molecules involved in this process.
smooth muscle cells; signal transduction
| |
INTRODUCTION |
|---|
|
|
|---|
IN SEVERAL CHRONIC pathological conditions ranging from hypertension and excess pulmonary ventilation to bladder-obstructive disorders, mechanical strain plays a major role in triggering a pathological hypertrophy/hyperplasia and abnormal extracellular matrix deposition, especially in the muscle compartments (6, 40, 48). Those changes lead ultimately to important clinical consequences, including physiological insufficiencies and organ failure. Whereas the deleterious effects of chronic mechanical stresses are well established, the molecular mechanisms by which the mechanical stimulation affects cell function are still poorly understood.
Investigating the effect(s) of mechanical forces has been made possible by culturing cells on artificial flexible substrates (e.g., an elastic membrane) and applying defined, stepwise, or cyclic strain to the substrate, thus imparting approximately the same strain to the cells (28, 47). With the use of cultured smooth muscle cells and well-defined in vitro mechanical devices, we and others (7, 12, 29) have shown that mechanical forces modulate cell shape, growth, and synthetic phenotype. These changes are achieved mainly through the activation of specific transducing pathways and reprogramming of gene expression. For instance, mechanical stimulation of muscle cells changes skeletal fibers from fast to slow or slow to fast types, which involves turning entire sets of muscle-specific genes on or off (38). However, the full repertoire of strain-inducible genes is incompletely defined, and the biological significance of specific gene alterations is, as yet, an unresolved issue.
Cyr61, a cysteine-rich and heparin-binding protein, belongs to the CCN family [cysteine-rich 61/connective tissue growth factor (CTGF)/nephroblastoma overexpressed] (reviewed in Ref. 26). This emerging new family of proteins is characterized by a high degree of amino acid sequence homology and includes Cyr61, CTGF, Nov (nephroblastoma overexpressed), elm-1, cop-1, and wisp-3. These proteins are organized into conserved modular domains that share similarities with insulin-like growth factor binding proteins, von Willebrand factor type C repeat, thrombospondin type I repeat, and growth factor cysteine knots. In addition, each of these proteins possesses an amino-terminal signal peptide, indicating that they are secreted proteins. Their overall functions are thought to be the result of either combinatorial or independent actions of their domains.
Cyr61 and CTGF, the most extensively studied members of this family,
were originally identified in 3T3 fibroblasts and human umbilical vein
endothelial cells, respectively, by virtue of their transcriptional
activation by serum and serum growth factors such as basic fibroblast
growth factor, platelet-derived growth factor (PDGF), and transforming
growth factor-
(2, 21, 23, 34). Studies of their
pattern of expression in vivo implicated these proteins in the
development of fibrosis and vascular diseases (2, 26). At
the molecular level, the Cyr61 recombinant protein was able to support
adhesion, migration, and mitogenesis of human skin fibroblasts through
integrins
6
1,
v
5, and
v
3,
respectively (10, 14). Cyr61 also upregulates the
expression of matrix metalloproteinases 1 and 3 and promotes biological
processes such as wound healing, angiogenesis, homeostasis, and
thrombosis (14, 36). Stable transfection of Cyr61 cDNA in
MCF7 cells enhanced anchorage-independent cell growth in soft agar and
significantly increased their tumorigenicity when tested in a nude
mouse model, suggesting that Cyr61 promotes tumor growth
(49). The fact that Cyr61 affects a broad spectrum of
biological activities in a cell- and context-specific manner prompts us
to explore its potential regulation by mechanical forces in smooth
muscle cells and examine the underlying molecular mechanisms involved
in this process.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Reagents. Chemical inhibitors were purchased from Calbiochem (San Diego, CA). All other chemicals used were of reagent grade. Y-27632 was kindly provided by Dr. T. Kondo and A. Yoshimura (Welfide, Osaka, Japan).
Cell culture and stretching. Primary cultures of smooth muscle cells were established from fetal bovine bladders as previously described (3). Primary cultures from several animals were used in our experiments. Cells were maintained in modified medium 199 supplemented with 10% fetal bovine serum and antibiotics in a humidified atmosphere containing 5% CO2 in air at 37°C. Freshly isolated smooth muscle cells were phenotypically characterized using muscle-specific antibodies against smooth muscle actin. These cells maintain several differentiated properties in culture even after several passages. Cells between their third and tenth population doubling level were used for stretch experiments.
Mechanical stretch of the cells was performed using a device designed to apply precise and reproducible biaxial strain to type I collagen-coated Tecoflex membrane (Thermedics) on which the cells were grown. Design, calibration, and description of the equibiaxial strain system for cultured cells have been previously reported (7, 47). Typical experiments were carried out with 13 control and 13 experimental wells in which the cells were seeded at a density of 250,000 cells/well and incubated for 24 h in serum-containing medium. The medium was then removed and replaced by serum-free medium. For experimental wells, biaxial strain (0-10%) was applied by stretching the elastic membrane of the wells cyclically at a frequency of 0.3 Hz. For controls, cells were cultured in the apparatus wells under the same conditions but were not subjected to mechanical strain. After completion of the stretch regimen, control and stretched cells were pooled, divided into two samples, and processed for either RNA or protein analysis. Stretch and control apparatus wells were seeded using the same pool of cells, and analyses were carried out simultaneously and identically.Drug treatments. Cells were plated in collagen-coated wells in serum-containing medium as described above. Twentyfour hours later, the medium was replaced with serum-free medium containing drugs as indicated in the text. The cells were left in the presence of a given inhibitor at least 30 min before the application of mechanical stretch for an additional 30 min. Stock solutions of each drug were made in either aqueous solution or in DMSO and diluted to a working concentration in serum-free medium.
Cyr61 cDNA probe and antibodies.
An 886-bp cDNA fragment was amplified by PCR using total RNA from
serum-stimulated smooth muscle cells as a template together with the
primer combinations 5'CCAGCTTGTTGGCGTCTT3' and 5'TTACATTTCCCCTCCCTCCC3' (32). The PCR product was purified, cloned into the
expression vector pCRII from Invitrogen, sequenced, and used in
Northern blot analysis as a probe. Two 16-amino acid peptides (residues between 102 and 118 and 217 and 233 in the primary sequence of the
human Cyr6, GenBank accession no. AF307860) were synthesized and
purified by high-performance liquid chromatography
(Biosynthesis). Each peptide was coupled to maleimide-activated KLH
(Pierce) at a ratio of 1 mg of peptide per milligram of KLH. Antibodies
were raised in rabbits by Cocalico Biologicals (Reamstown, PA). After completion of the immunization process, the rabbits were exsanguinated, and the antibodies were purified by affinity chromatography using affinity columns from Pharmacia. Bound antibodies were eluted with 100 mM glycine and immediately neutralized with Tris base and adjusted to a
concentration of 0.4 mg/ml before storage at
20°C. Serum titer was
determined by enzyme-linked immunosorbent assay.
Northern blot hybridization. Total RNA was extracted from cells as previously described (13). A sample containing 12 µg of total RNA was fractionated by electrophoresis in 1% agarose/formaldehyde gel, transferred to Zeta-Probe nylon filters (Bio-Rad, Richmond, CA), and hybridized to Cyr61-radiolabeled cDNA probe. A specific probe for CTGF was radiolabeled as well and hybridized to the filters that were stripped according the manufacturer's instructions (Bio-Rad). Total RNA loading and transfer were evaluated by probing with a glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA probe. The filters were analyzed by phosphorimaging, and hybridization signals were quantified to determine the relative amounts of mRNA (Molecular Dynamics). The mRNA levels were analyzed in duplicate samples and normalized to equivalent values for GAPDH to compensate for loading and transfer.
Immunohistochemistry and immunoblotting. For Western blot analysis, lysates from stretched and control unstretched cells were prepared by harvesting the cells in 0.1% Triton X-100 lysis buffer as previously described (8). Protein concentration was determined by using the Bradford protein assay (Bio-Rad). Protein samples (30 µg) were separated by 10% SDS-polyacrylamide gel, transferred to nitrocellulose membrane, and Western blot analysis was performed using Cyr61 antibody. Immunodetection was performed using enhanced chemiluminescence (Amersham).
For immunohistochemistry analysis, cells were fixed with 3.7% formaldehyde in PBS and permeabilized with 0.5% Triton X-100 to allow the antibody binding to both extra- and intracellular antigen. Cells were incubated for 24 h with a 1:200 dilution of anti-Cyr61 antibody. Cells were then washed with PBS, and the immunodetection was then performed with a goat anti-rabbit IgG-rhodamine conjugate (1:300 dilution). After a final wash, the membrane was mounted on a glass microscope slide, and the immunostaining was visualized by confocal microscopy.Nuclear protein extraction. Cells were trypsinized, pelleted by centrifugation, and resuspended in ice-cold sucrose buffer containing 0.1% Triton X-100 to lyse the cells (5). When lysis was complete, the preparations were washed several times with lysis buffer to remove the cytoplasm and debris. The purity of nuclei preparations was verified by microscopic examination. These purified nuclear fractions were further extracted and subjected to Western blot analysis as described above.
| |
RESULTS |
|---|
|
|
|---|
Cultured smooth muscle cells were first subjected to a 5% cyclic
equibiaxial strain at a frequency of 0.3 Hz for various periods of
time. The magnitude and the strain rate used were previously shown to
induce changes in growth and synthetic phenotype of these cells
(4, 9). Cells cultured under the same conditions but not
subjected to mechanical strain were used as controls. Northern blot
analysis of RNA (a representative experiment of which is shown in Fig.
1A) demonstrates that
Cyr61 mRNA was rapidly but transiently induced in stretched cells.
Cyr61 mRNA levels peaked after 1 h of stretching and decayed to
undetectable levels thereafter. Mechanical stretch of 1-h duration
resulted in a five- to ninefold increase of Cyr61 mRNA, as determined
by phosphorimager scanning of the hybridization signals (Fig.
1B). In contrast, the application of mechanical stretch
decreased the CTGF mRNA levels. However, this decrease was also seen in
control cells cultured under static conditions for the same period of
time, indicating lack of the proper effect of mechanical stretch on
CTGF gene expression (data not shown). Furthermore, we examined the
effects of strain magnitude by applying strains of 1.5, 2.5, 5, or
7.5% to the cells for 30 min and assessing the mRNA levels of Cyr61
and CTGF. As shown in Fig. 1C, mechanical stretch-induced
Cyr61 gene expression was positively correlated with the magnitude of
the mechanical strain. The minimal strain required to trigger this
response was 2.5%. The CTGF mRNA levels were decreased in stretched
cells to nearly the same extent regardless of the strain magnitude
used.
|
To determine whether stretch-induced changes in Cyr61 mRNAs caused
corresponding changes in protein levels, we performed Western blot
analyses using specific monoclonal antibodies raised against selected
immunogenic peptides of Cyr61. The polyclonal antibody reacted well
with the bovine protein extract and recognized an ~42-kDa protein
band in both stretched and control cell lysates (Fig.
2A). The application of
mechanical stretch induced a nearly 3.5-fold increase of Cyr61 band
intensity after 1 or 2 h of stretching, as determined by
densitometric measurements (Fig. 2B). Analyses of
conditioned medium from stretched cells failed to detect Cyr61 protein
in the supernatant (data not shown).
|
The cellular localization and distribution of the Cyr61 protein was
examined by immunohistochemistry in stretched (5% strain, 1 h)
and control nonstretched cells as described in MATERIALS AND
METHODS. As shown in Fig.
3A, the immunostaining of
stretched smooth muscle cells was mainly localized intracellularly
within the cytoplasm and the nucleus. The detected immunohistochemical signal was blocked either when the primary antibody was omitted or when
the Cyr61 antigen but not an irrelevant antigen was added to block the
primary antibody binding (data not shown). To further investigate the
nuclear localization of Cyr61, cells were subjected to mechanical
stretch for 1 h, and their nuclei were extracted as previously
described (5). The protein content of nuclear preparations
from stretched and unstretched cells was analyzed by Western blotting.
As shown in Fig. 3B, a major Cyr61 band was detected in the
nuclear extract of stretched cells, confirming the nuclear localization
of Cyr61 in the cells.
|
To determine the signal transduction pathways that couple Cyr61
gene induction to mechanical stimulation, we treated the cells with
various pharmacological inhibitors of known signaling cascades before the application of mechanical stretch. Total RNA was extracted and analyzed for Cyr61 mRNA levels. Pretreatment of the cells with
either losartan or aminoguanidine, which block angiotensin type I
receptor and nitric oxide synthase, respectively, did not affect Cyr61
gene responsiveness to mechanical stretch (data not shown).
Representative experiments using inhibitors that consistently affected
Cyr61 mRNA levels are shown in Fig.
4A. Either calphostin C, a
specific protein kinase C (PKC) inhibitor, or wortmannin, a
phosphatidylinositol 3-kinase inhibitor, induced a nearly 45% decrease
of Cyr61 mRNA levels in stretched cells but did not completely abrogate
the gene expression. The agents bis-indolyl maleimide and quercetin,
other specific inhibitors of PKC and phosphatidylinositol 3-kinase,
respectively, were equally effective inhibitors of stretch-induced Cyr61 gene expression (data not shown). Additionally, when added to the
cells simultaneously, the effects of PKC and phosphatidylinositol 3-kinase inhibitors were not additive, suggesting that PKC and phosphatidylinositol 3-kinase are potentially involved in the same
signaling pathway.
|
We further tested the effects the agents GGTI-298 and FTI-277, which inhibit prenylation of some signaling proteins, including those belonging to the small G proteins of the Ras superfamily (27). Protein prenylation is required for the proper subcellular localization and function of these proteins. Treatment of the cells with GGTI-298 (20 µM), a reagent that inhibits protein geranylgeranylation, completely blocked stretched-increased Cyr61 mRNA levels (shown in Fig. 4A). In contrast, FTI-277 (20 µM), a reagent that blocks protein farnesylation, did not affect the expression of Cyr61 gene in stretched cells. These inhibitors were used at concentrations that selectively blocked the prenylation and function of small G proteins like N-Ras, lamin B, or Rho (24, 27). This indicates that signaling proteins whose biological activity requires the addition of geranylgeranyl groups play a crucial role in stretch regulation of Cyr61 mRNA levels.
Because the small G proteins of the Rho family such as RhoA are prominent members of the geranylgeranylated protein group, we tested the effects of Y-27632, a specific inhibitor of RhoA-dependent activation of Rho kinase signaling pathways, on Cyr61 gene expression (19). As shown in Fig. 4B, addition of this agent to the cells dose dependently reduced the levels of Cyr61 mRNA in stretched cells. When Y-27632 was used at a concentration of 0.2 µM, the Cyr61 mRNA levels were decreased by 25%. When the concentration used was 20 µM, Cyr61 mRNA levels were further reduced by 55% (P < 0.05). This implicates the RhoA pathways in stretch-induced Cyr61 gene activation.
Previous studies have suggested that RhoA activation regulates gene
expression through its effects on the actin cytoskeleton (42). Therefore, to test whether mechanical stretch
regulates Cyr61 gene through actin dynamics, we treated the cells with
latrunculin B, a toxin that disrupts actin polymerization by binding
and sequestration of G-actin monomers, before the application of
mechanical stretch. As shown in Fig.
5A, latrunculin B treatment
(0.5 µM) of the cells dramatically attenuated (
45%)
stretch-induced Cyr61 mRNA levels (P < 0.05). Because
of its effects on the actin cytoskeleton, treatment of the cells with
latrunculin B seemed to alter cell shape momentarily but reversibly
(after 8 h), indicating that this drug was not overtly cytotoxic
(data not shown). Moreover, to further test whether Cyr61 gene
transcription was sensitive to actin dynamics, we treated the cells
with jasplakinolide, a toxin known to increase actin polymerization by
severing F-actin, creating new nucleation sites that support actin
polymerization. As shown in Fig. 5B, jasplakinolide
treatment (0.5 µM) increased Cyr61 transcription threefold
(P < 0.05). This indicates that Cyr61 gene expression
is directly regulated by mechanisms that sense actin dynamics in smooth
muscle cells. Additionally, pretreatment of the cells with inhibitors
such as calphostin C (50 ng/ml), wortmanin (20 µM), or Y-27632 (20 µM) did not significantly alter jasplakinolide-induced Cyr61 gene
expression (Fig. 5C). Thus actin polymerization alone is
sufficient to induce Cyr61 gene expression and does not require other
cooperating signaling molecules such as PKC, phosphatidylinositol
3-kinase, or Rho-associated kinase. Similarly, latrunculin B treatment
of the cells did not block jasplakinolide-induced Cyr61 gene
expression, consistent with the fact that the two drugs target
different types of actin (data not shown).
|
| |
DISCUSSION |
|---|
|
|
|---|
The present study demonstrates that Cyr61 gene expression in cultured bladder smooth muscle cells is inducible by mechanical stretch. Increases of Cyr61 gene expression occurred rapidly after the application of stretch. The message levels were increased five- to ninefold after 30 min and 1 h of mechanical stretching and became undetectable thereafter, reflecting a transient response analogous to that of immediate early genes, i.e., c-fos and egr-1 (11, 29). The reestablishment of basal levels might be indicative of an adaptive mechanism in which compensatory signaling pathways are activated to allow Cyr61 gene transcription to return to normal levels. The strain magnitude tested (between 2.5 and 7.5%) caused no apparent cell detachment or damage, indicating that stretch-induced Cyr61 gene response was not the result of cell injury. We also showed that while the mRNA levels of Cyr61 gene were increased, those of CTGF, another member of the Cyr61 family, were not affected by mechanical stretch, indicating that stretch-induced Cyr61 mRNA is a selective process. In fact, although Cyr61 and CTGF were shown to behave in a similar manner in that both were simultaneously induced by several serum growth factors, subtle differences exist between them (26). For example, CTGF was shown to be mitogenic by itself, whereas Cyr61 has no intrinsic mitogenic activity but augments growth factor-induced DNA synthesis; Cyr61 was shown to stimulate chemotaxis, whereas CTGF stimulates both chemotaxis and chemokinesis; and, although both Cyr61 and CTGF are extracellular matrix-associated molecules, only CTGF was shown to be secreted in the culture medium. Together, these observations suggest that the expression profile of Cyr61 gene is stimulus specific and might confer phenotypic specificity to the cellular response.
Stretch-induced increases in Cyr61 mRNA levels resulted in increased protein expression that was detected by Western blot in the cell lysates after 1 h and for up to 4 h of mechanical stretching. The persistent increase of the Cyr61 protein in cells, despite an early waning in its mRNA levels, suggests a higher stabilization of the protein in stretched cells. These results corroborate other data indicating that the half-life of the newly synthesized Cyr61 in serum-stimulated 3T3 fibroblasts ranged from 30 min to several hours (20).
We determined the cellular localization of the protein by immunohistochemical analyses. The immunostaining in stretched cells was mainly localized intracellularly within the cytoplasm and the nucleus. Previous studies have shown that Cyr61 immunoreactivity was detected both intracellularly and extracellularly in smooth muscle of placental tissue (20). On the basis of structural considerations, the nuclear localization of Cyr61 was surprising, since the primary sequence does not contain a classic nuclear localization signal found in proteins, such as transcription factors, that translocate to the nucleus. In fact, the presence of a peptide signal in the amino-terminal region and the multidomain structure of the protein suggest that the protein is targeted for secretion. Nevertheless, the presence of Cyr61 in the nucleus, while intriguing in its own right, is reminiscent of other examples of proteins found in the nucleus, despite their lack of a nuclear localization signal. The growing list of such polypeptides includes Nov (another member of the Cyr61 family), epidermal growth factors, PDGF, fibroblast growth factors, angiogenin, and parathyroid hormone-related peptide (16, 37). These proteins are thought to elicit their biological effects in a bifunctional manner: both indirectly through interaction with cell surface receptor linked to conventional signal transduction pathways as well as through direct association with the nuclei of target cells. The biological significance of nuclear targeting of these secretory proteins remains to be determined. In most instances, a number of hypotheses have been put forward regarding transcriptional regulation, translational control, and/or mRNA transport. Thus the detection of Cyr61 in the nuclei of smooth muscle cells opens new prospects as to the biological role of this protein.
In the next step in the analysis of Cyr61 gene activation, we sought to determine the signal transduction pathways required for the response to mechanical stretch. We employed various intracellular inhibitors of known signaling molecules to define the signaling pathways implicated in stretch regulation of Cyr61 gene expression. Inhibitors that interfere with signaling through phospholipase C, cAMP, or mitogen-activated protein kinase (ERK1/2) did not affect the response of Cyr61 gene to stretch (data not shown). Conversely, specific inhibitors of PKC and phosphatidylinositol 3-kinase, used either separately or in combination, partially impaired (~45%) stretch-mediated increased expression of Cyr61 gene. In agreement with our results, O'Brien et al. (34) have shown that activators of PKC such as 12-O-tetradecanoylphorbol 13-acetate induces Cyr61 gene expression while Pendurthi et al. (36) showed that phosphatidylinositol 3-kinase inhibitors completely abrogated the expression Cyr61 gene in response to thrombin or cofactor VIIa stimulation in WI-38 fibroblast. Thus, there are, seemingly, multiple regulatory pathways that may control, possibly independently, the expression of Cyr61 gene. In our model, mechanical stretch signals, in part, through the activation of two signaling pathways (those involving PKC activation and phosphatidylinositol 3-kinase) that could merge and/or overlap downstream.
Additionally, by using specific inhibitors that interfere with protein prenylation, which is required for numerous signaling protein activation and translocation to the plasmic membrane (27, 44), we found that the mechanical stretch-induced Cyr61 gene was completely suppressed (~96%) by inhibiting the subgroup of proteins that require geranylgeranylation (i.e., Rho family proteins). In contrast, inhibiting the proteins that require farnesylation (such as N-Ras) had no effect. These results indicate that one or more geranylgeranylated proteins is a key player in Cyr61 gene response to mechanical forces and that those of the Rho family of proteins are very likely candidates. Interestingly, numerous studies have shown that Rho proteins were activated in mechanically stretched smooth muscle and shear-stressed endothelial cells (30, 35). Mechanical stretch of vascular smooth muscle cells induces activation and translocation of RhoA to the membrane at a level comparable to that of known RhoA stimulators such as endothelin, angiotensin II, and lysophosphatidic acid (33). Several putative stretch-sensing structures mediate Rho activation, including growth factor receptors (i.e., receptor tyrosine kinases), G protein-coupled receptors, and integrins (22, 29). These membrane receptors may either independently or coordinately regulate the activity of Rho. The data presented in Fig. 4B indicate that the selective inhibition of RhoA and its associated kinase p160 ROCK using the Y-27632 inhibitor significantly reduced the mRNA levels of Cyr61 (P < 0.05). This suggests that mechanical stretch signals to Cyr61 gene expression through Rho-dependent activation of Rho-associated kinase.
It is well known that RhoA-dependent activation of Rho kinase induces
actin polymerization and stress fiber formation in many cell types,
including smooth muscle cells (1, 44). Rho-associated kinase phosphorylates and inactivates the myosin-binding subunit of
myosin light chain phosphatase, thereby inhibiting myosin light chain
dephosphorylation. As a result, the phosphorylated form of myosin light
chain accumulates, leading to contraction of the actomyosin-based
cytoskeleton of smooth muscle. Our data indicated that drug-induced
modulation of the actin cytoskeleton affected Cyr61 gene expression.
Treatment of the cells with the drug latrunculin B, which inhibits
actin polymerization, markedly impaired stretch-induced Cyr61 gene
transcription. This supports a model in which RhoA-mediated increase in
actin polymerization promotes specific gene expression. Previous
studies have shown that several immediate early genes, including
c-fos and smooth muscle cell-specific genes, were activated through RhoA proteins and were sensitive to actin dynamics (35, 42). A plausible explanation to such a regulation
suggests a model whereby, in the absence of Rho-induced actin
polymerization, G-actin inhibits transcription factors such as
serum-response factor (SRF) or nuclear factor (NF)-
B, either
directly or by sequestering cofactors required for their activation
(31, 46). Activation of such trans-acting
factors and their translocation to the nucleus is required for the
activation of their targeted genes. In agreement with this, the Cyr61
gene promoter contains several trans-acting factor-binding
sites including those for SRF, AP-1, and NF-
B (25).
Whether stretch activation of Cyr61 gene requires activation of such
trans-acting factors remains to be elucidated. Future work
will be directed toward defining the transcriptional and/or
posttranscriptional requirements for stretch-induced Cyr61 gene
expression and understanding the role of actin dynamics in such activation.
Overall, our study demonstrates that induction of Cyr61 gene expression is not under the control of serum growth factors only, as shown in previous reports, but is also regulated by mechanical stimuli, thus extending the biological context of Cyr61 gene activation. Induced Cyr61 gene response to stretch is not unique to cells from the bladder tissue but is also shared by lamina propria fibroblasts and smooth muscle cells from other tissues such as the aorta (data not shown). However, only a modest 2- to 2.5-fold increase of Cyr61 mRNA levels was observed in these cells compared with a 5- to 9-fold increase in bladder smooth muscle cells when subjected to the same stretch regimen. Whether these differences represent intrinsic properties of bladder smooth muscle cells and what the biological significance of this may be will require further investigation. Nevertheless, the utilization of various pharmacological inhibitors disclosed a net effect of signaling through PKC, phosphatidylinositol 3-kinase, and Rho-associated kinase in stretch-induced Cyr61 gene expression. The different degree of inhibition observed by a given inhibitor may reflect either the difference of the contribution of each signaling molecule to the gene expression or a potential complex and interdependent signaling networks involved. Indeed, a key component of the downstream pathway of either PKC or phosphatidylinositol 3-kinase is the actin cytoskeleton (17, 22, 43). The importance of the latter in relaying PKC and phosphatidylinositol 3-kinase signals has been reported and may play a role in mediating Cyr61 gene activation. Studies have shown that direct activation of PKC isoforms by phorbol ester has dramatic effects on the assembly and disassembly of the F-actin network, and there is abundant evidence showing an isoenzyme-specific translocation to the F-actin components of the cytoskeleton in intact cells (18, 41). Alternatively, either PKC or phosphatidylinositol 3-kinase may affect reorganization of the actin cytoskeleton and gene expression through their interaction with Rho proteins, although activation of PKC and/or phosphatidylinositol 3-kinase can be either upstream or downstream of the Rho family, depending on the system (39, 45). The precise complex mechanism underlying cross talk between these signaling molecules and the actin cytoskeleton and its impact on stretch-induced Cyr61 gene expression is yet to be determined. On the other hand, the ability of jasplakinolide-mediated actin polymerization to induce, on its own, Cyr61 gene expression supports a model in which selective and specific gene expression is controlled by changes in G- and F-actin levels in the cells. Such a regulatory mechanism has been demonstrated for a subset of SRF target genes such as SRF itself and vinculin (42).
Finally, the upregulation of Cyr61 gene expression by mechanical strain
may have pathophysiologically relevant implications in vivo. Several
pathological conditions that result from increased mechanical strain
such as hypertension, bladder outlet obstruction, atherosclerosis, and
acute respiratory distress syndrome, are characterized by
hypertrophy/hyperplasia, fibrosis, and/or modulation phenotypic of
smooth muscle cells (6, 15, 42). Therefore, on the basis
of currently known biological activities of the Cyr61 recombinant
protein, we anticipate that increased Cyr61 protein levels in highly
stressed tissues likely play a major role as an early marker and a
potent effector of the remodeling process in smooth muscle compartments
(14, 26). Cyr61 may participate in such a process by
stimulating, in either a direct or indirect fashion, cell migration,
attachment, and/or proliferation. Moreover, both the Cyr61 gene
expression pattern and its regulatory mechanism (as demonstrated by its
gene responsiveness to either actin dynamics or RhoA signaling, a
critical mechanism for regulation of smooth muscle cell
differentiation) seem to be similar to those of prohypertrophic molecules, i.e., SRF and
-actin (31, 42). Therefore,
Cyr61 is a potential early molecular signal of smooth muscle cell
differentiation and may be involved in the activation of specific
features of their hypertrophic response in pathological conditions.
Accordingly, a detailed study of the functional significance of Cyr61
gene activation in stress-related pathologies is warranted.
| |
ACKNOWLEDGEMENTS |
|---|
This study was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-02685 (to B. Chaqour) and a complement from DK-45419.
| |
FOOTNOTES |
|---|
Present address of I. Tamura: Dept. of Biochemistry, Osaka Dental School, Osaka, Japan.
Address for reprint requests and other correspondence: B. Chaqour, Dept. of Histology, Univ. of Pennsylvania, 416 Levy Research Bldg., 4001 Spruce St., Philadelphia, PA 19104 (E-mail: chaqour{at}biochem.dental.upenn.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 8 May 2001; accepted in final form 13 June 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Amano, M,
Chihara K,
Kimura K,
Fukata N,
Nakamura Y,
Matsuura Y,
and
Kaibuchi K.
Formation of actin stress fibers and focal adhesions enhanced by Rho kinases.
Science
275:
1308-1311,
1997
2.
Babic, AM,
Kireeva ML,
Kolesnikova TV,
and
Lau LF.
Cyr61, a product of a growth factor-inducible immediate early gene, promotes angiogenesis and tumor growth.
Proc Natl Acad Sci USA
95:
6355-6360,
1998
3.
Baskin, LS,
Howard P,
Duckett JW,
Snyder HM,
and
Macarak EJ.
Bladder smooth muscle cells in culture: I. Identification and characterization.
J Urol
149:
190-197,
1993[Web of Science][Medline].
4.
Baskin, LS,
Howard PS,
and
Macarak EJ.
Effect of physical forces on bladder smooth muscle and urothelial cell matrix synthesis.
J Urol
150:
601-607,
1993[Web of Science][Medline].
5.
Bellon, G,
Chaqour B,
Monboisse JC,
and
Borel JP.
Glutamine increases collagen gene expression in fibroblast cultures.
Biochim Biophys Acta
1268:
311-323,
1995[Medline].
6.
Brading, AF.
Alterations in the physiological properties of urinary bladder smooth muscle caused by bladder emptying against an obstruction.
Scand J Urol Nephrol Suppl
184:
51-58,
1997[Medline].
7.
Chaqour, B,
Howard P,
and
Macarak EJ.
Identification of stretch sensitive genes by means of a two-arbitrary primer-based mRNA differential display approach.
Mol Cell Biochem
197:
87-96,
1999[Web of Science][Medline].
8.
Chaqour, B,
Richards CF,
Howard PS,
and
Macarak EJ.
Mechanical stretch induces platelet-activating factor receptor gene expression through the NF-
B transcription factor.
J Mol Cell Cardiol
31:
1345-1355,
1999[Web of Science][Medline].
9.
Chaqour B, Han JS, Tamura I, and Macarak E. Mechanical regulation
of IGF-I and IGF-binding protein gene transcription in bladder smooth
muscle cells. J Cell Biochem. In press.
10.
Chen, N,
Chen CC,
and
Lau LF.
Adhesion of human skin fibroblasts to Cyr61 is mediated through integrin
6
1 and cell surface heparan sulfate proteoglycans.
J Biol Chem
275:
24953-24961,
2000
11.
Chien, S,
Li S,
and
Shyy YJ.
Effects of mechanical forces on signal transduction and gene expression in endothelial cells.
Hypertension
31:
163-169,
1998.
12.
Chiquet, M.
Regulation of extracellular matrix gene expression by mechanical stress.
Matrix Biol
18:
417-426,
1999[Web of Science][Medline].
13.
Chomczynski, P,
and
Sacchi N.
Single step method of RNA isolation by acid-phenol-chloroform extraction.
Anal Biochem
162:
156-159,
1987[Web of Science][Medline].
14.
Grzeszkiewicz, TM,
Kirschling DJ,
Chen N,
and
Lau LF.
CYR61 stimulates human skin fibroblast migration through integrin
v
5 and enhances mitogenesis through integrin
v
3 independent of its carboxy-terminal domain.
J Biol Chem
276:
21943-21950,
2001
15.
Hunter, JJ,
and
Chien KR.
Mechanisms of disease: signaling pathways for cardiac hypertrophy and failure.
N Engl J Med
34:
1276-1283,
1999.
16.
Jans, DA,
and
Hassan G.
Nuclear targeting by growth factors, cytokines and their receptors: a role in signaling?
Bioessays
20:
400-411,
1999.
17.
Keenan, C,
and
Kelleher D.
Protein kinase C and the cytoskeleton.
Cell Signal
10:
225-232,
1998[Web of Science][Medline].
18.
Kiley, SC,
Kaken S,
Whelan R,
and
Parker PJ.
Intracellular targeting of protein kinase C isoenzymes: functional implications.
Biochem Soc Trans
23:
601-605,
1995[Web of Science][Medline].
19.
Kimura, K.
Regulation of myosin phosphatase by Rho and Rho-associated kinase (Rho-kinase).
Science
273:
245-248,
1996[Abstract].
20.
Kireeva, ML,
Latinkic BV,
Kolesnikova TV,
Chen CC,
Yang GP,
Abler AS,
and
Lau LF.
Cyr61 and Fisp12 are both ECM-associated signaling molecules: activities, metabolism and localization during development.
Exp Cell Res
233:
63-77,
1998.
21.
Kireeva, ML,
Mo FE,
Yang GP,
and
Lau LF.
Cyr61, a product of a growth factor-inducible immediate early gene, promotes cell proliferation, migration and adhesion.
Mol Cell Biol
16:
1326-1334,
1996[Abstract].
22.
Kjoller, L,
and
Hall A.
Signaling to Rho GTPases.
Exp Cell Res
253:
166-179,
1999[Web of Science][Medline].
23.
Kolesnikova, TV,
and
Lau LF.
Human Cyr61-mediated enhancement of bFGF-induced DNA synthesis in human umbilical vein endothelial cells.
Oncogene
16:
747-754,
1998[Web of Science][Medline].
24.
Kucich, U,
Rosenbloom J,
Shen G,
Abrams WR,
Blaskovich MA,
Hamilton AD,
Ohkanda J,
Sebti SM,
and
Rosenbloom J.
Requirement for geranylgeranyl transferase I and acyl transferase in the TGF-
-stimulated pathway leading to elastin mRNA stabilization.
Biochem Biophys Res Commun
252:
111-116,
1998[Web of Science][Medline].
25.
Latinkic, BV,
O'Brien TP,
and
Lau LF.
Promoter function and structure of the growth factor-inducible immediate early gene cyr61.
Nucleic Acids Res
19:
3261-3267,
1990
26.
Lau, LF,
and
Lam SC.
The CCN family of angiogenic regulators: the integrin connection.
Exp Cell Res
248:
44-57,
1999[Web of Science][Medline].
27.
Lerner, E,
Qian Y,
Blaskovitch MA,
Fossum R,
Vigt A,
Sun J,
Cox A,
Hamilton AD,
and
Sebti SM.
Ras CAAX peptidomimetic FTI-277 selectively blocks oncogenic Ras signaling by inducing cytoplasmic accumulation of inactive Ras-Raf complexes.
J Biol Chem
270:
26802-26806,
1995
28.
Leung, DY,
Glagov S,
and
Mathews MB.
Cyclic stretching stimulates synthesis of matrix components by arterial smooth muscle cells in vitro.
Science
191:
475-477,
1976
29.
Li, C,
and
Xu Q.
Mechanical stress-initiated signal transductions in vascular smooth muscle cells.
Cell Signal
12:
435-445,
2000[Web of Science][Medline].
30.
Li, S,
Chen B,
Azuma N,
Hu HL,
Wu SZ,
Sumpio BE,
Shyy JY,
and
Chien S.
Distinct roles for the small GTPases Cdc42 and Rho in endothelial responses to shear stress.
J Clin Invest
103:
1141-1150,
1999[Web of Science][Medline].
31.
Mack, CP,
Somlyo AV,
Hautmann M,
Somlyo AP,
and
Owens GK.
Smooth muscle differentiation marker gene expression is regulated by RhoA-mediated actin polymerization.
J Biol Chem
276:
341-347,
2001
32.
Martinerie, C,
Viegas-Pequignot E,
Nguyen VC,
and
Perbal B.
Chromosomal mapping and expression of the human cyr61 gene in tumor cells from the nervous system.
Mol Pathol
50:
310-316,
1997
33.
Numaguchi, K,
Satoru E,
Yamakawa T,
Motley ED,
and
Inagami T.
Mechano-transduction of rat aortic vascular smooth muscle cells requires RhoA and intact actin filaments.
Circ Res
85:
5-11,
1999
34.
O'Brien, TP,
Yang GP,
Sanders L,
and
Lau LF.
Expression of Cyr61, a growth factor inducible immediate-early gene.
Mol Cell Biol
10:
3569-3577,
1990
35.
Owens, GK.
Role of mechanical strain in regulation of differentiation of vascular smooth muscle cells.
Circ Res
79:
1054-1055,
1996
36.
Pendurthi, UR,
Allen KE,
Ezban M,
Mohan M,
and
Rao LV.
Factor VIIa and thrombin induce the expression of Cyr61 and connective tissue growth factor, extracellular matrix signaling proteins that could act as possible downstream mediators in factor VIIa tissue factor-induced signal transduction.
J Biol Chem
275:
14632-14641,
2000
37.
Perbal, B.
Nuclear localization of NOVH protein: a potential role for NOV in the regulation of gene expression.
Mol Pathol
52:
84-91,
1999[Abstract].
38.
Pette, D,
and
Staron RS.
Mammalian skeletal muscle fiber type transitions.
Int Rev Cytol
170:
143-223,
1997[Medline].
39.
Ren, XD,
and
Schwartz MA.
Regulation of inositol lipid kinases by Rho and Rac.
Curr Opin Genet Dev
8:
3-67,
1998.
40.
Schaub, MC,
Hefti MA,
Harder BA,
and
Eppenberger HM.
Various hypertrophic stimuli induce distinct phenotypes in cardiomyocytes.
J Mol Med
75:
901-920,
1997[Web of Science][Medline].
41.
Slater, SJ,
Stagliano BA,
Seiz JL,
Curry JP,
Milano SK,
Gergich KJ,
and
Stubbs CD.
Effects of ethanol on protein kinase C activity induced by filamentous actin.
Biochim Biophys Acta
1544:
207-216,
2001[Medline].
42.
Sotiropoulos, A,
Gineitis D,
Copeland J,
and
Treisman R.
Signal-regulated activation of serum response factor is mediated by changes in actin dynamics.
Cell
98:
159-169,
1999[Web of Science][Medline].
43.
Tolias, KF,
Cantley LC,
and
Carpenter CL.
Rho family GTPases bind phosphoinositide kinases.
J Biol Chem
270:
17656-17659,
1995
44.
Van Aelst, L,
and
D'Souza-Schorey C.
Rho GTPases and signaling network.
Genes Dev
11:
2295-2322,
1997
45.
Wang, P,
and
Bitar K.
RhoA regulates sustained smooth muscle contraction through cytoskeletal reorganization of HSP27.
Am J Physiol Gastrointest Liver Physiol
275:
G1454-G1462,
1998
46.
Wei, L,
Zhou W,
Croissant JD,
Johansen FE,
Prywes R,
Balasubramanyam A,
and
Schwartz RJ.
RhoA signaling via serum response factor plays an obligatory role in myogenic differentiation.
J Biol Chem
273:
30287-30294,
1998
47.
Winston, FK,
Macarak EJ,
Gorfien SF,
and
Thibault LE.
A system to reproduce and quantify the biomechanical environment of the cell.
J Appl Physiol
67:
397-405,
1989
48.
Wyncoll, DL,
and
Evans TW.
Acute respiratory distress syndrome.
Lancet
354:
497-501,
1999[Web of Science][Medline].
49.
Xie, D,
Miller CW,
O'Kelly J,
Nakachi K,
Sakashita A,
Said JW,
Gornbein J,
and
Koeffler HP.
Breast cancer: Cyr61 is over-expressed, estrogen inducible and associated with more advanced disease.
J Biol Chem
276:
14187-14194,
2001
This article has been cited by other articles:
![]() |
A. S. Dobroff, H. Wang, V. O. Melnikova, G. J. Villares, M. Zigler, L. Huang, and M. Bar-Eli Silencing cAMP-response Element-binding Protein (CREB) Identifies CYR61 as a Tumor Suppressor Gene in Melanoma J. Biol. Chem., September 18, 2009; 284(38): 26194 - 26206. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hanna, H. Liu, J. Amir, Y. Sun, S. W. Morris, M. A. Q. Siddiqui, L. F. Lau, and B. Chaqour Mechanical Regulation of the Proangiogenic Factor CCN1/CYR61 Gene Requires the Combined Activities of MRTF-A and CREB-binding Protein Histone Acetyltransferase J. Biol. Chem., August 21, 2009; 284(34): 23125 - 23136. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Yang, J. Amir, H. Liu, and B. Chaqour Mechanical strain activates a program of genes functionally involved in paracrine signaling of angiogenesis Physiol Genomics, December 12, 2008; 36(1): 1 - 14. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. T. Walsh, J. Radeff-Huang, R. Matteo, A. Hsiao, S. Subramaniam, D. Stupack, and J. H. Brown Thrombin receptor and RhoA mediate cell proliferation through integrins and cysteine-rich protein 61 FASEB J, November 1, 2008; 22(11): 4011 - 4021. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Kivela, H. Kyrolainen, H. Selanne, P. V. Komi, H. Kainulainen, and V. Vihko A single bout of exercise with high mechanical loading induces the expression of Cyr61/CCN1 and CTGF/CCN2 in human skeletal muscle J Appl Physiol, October 1, 2007; 103(4): 1395 - 1401. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Chaqour, R. Yang, and Q. Sha Mechanical Stretch Modulates the Promoter Activity of the Profibrotic Factor CCN2 through Increased Actin Polymerization and NF-{kappa}B Activation J. Biol. Chem., July 21, 2006; 281(29): 20608 - 20622. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Zhou, D. J. Herrick, J. Rosenbloom, and B. Chaqour Cyr61 mediates the expression of VEGF, {alpha}v-integrin, and {alpha}-actin genes through cytoskeletally based mechanotransduction mechanisms in bladder smooth muscle cells J Appl Physiol, June 1, 2005; 98(6): 2344 - 2354. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Adam, S. H. Eaton, C. Estrada, A. Nimgaonkar, S.-C. Shih, L. E. H. Smith, I. S. Kohane, D. Bagli, and M. R. Freeman Mechanical stretch is a highly selective regulator of gene expression in human bladder smooth muscle cells Physiol Genomics, December 15, 2004; 20(1): 36 - 44. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-W. Chen, M. J. Hubal, E. P. Hoffman, P. D. Thompson, and P. M. Clarkson Molecular responses of human muscle to eccentric exercise J Appl Physiol, December 1, 2003; 95(6): 2485 - 2494. [Abstract] [Full Text] |
||||
![]() |
K. Sawai, K. Mori, M. Mukoyama, A. Sugawara, T. Suganami, M. Koshikawa, K. Yahata, H. Makino, T. Nagae, Y. Fujinaga, et al. Angiogenic Protein Cyr61 is Expressed by Podocytes in Anti-Thy-1 Glomerulonephritis J. Am. Soc. Nephrol., May 1, 2003; 14(5): 1154 - 1163. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Thiruchelvam, P. Nyirady, D. M. Peebles, C. H. Fry, P. M. Cuckow, and A. S. Woolf Urinary Outflow Obstruction Increases Apoptosis and Deregulates Bcl-2 and Bax Expression in the Fetal Ovine Bladder Am. J. Pathol., April 1, 2003; 162(4): 1271 - 1282. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Chaqour, C. Whitbeck, J.-S. Han, E. Macarak, P. Horan, P. Chichester, and R. Levin Cyr61 and CTGF are molecular markers of bladder wall remodeling after outlet obstruction Am J Physiol Endocrinol Metab, October 1, 2002; 283(4): E765 - E774. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Inoue, K. Matsuda, M. Itoh, H. Kawaguchi, H. Tomoike, T. Aoyagi, R. Nagai, M. Hori, Y. Nakamura, and T. Tanaka Osteopenia and male-specific sudden cardiac death in mice lacking a zinc transporter gene, Znt5 Hum. Mol. Genet., July 15, 2002; 11(15): 1775 - 1784. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |