|
|
||||||||
1 Institute for Molecular Bioscience and Center for Functional and Applied Genomics, and 2 Department of Biochemistry, University of Queensland, St. Lucia, 4072, Brisbane, Queensland, Australia
| |
ABSTRACT |
|---|
|
|
|---|
Drosophila slit is a secreted protein involved in midline patterning. Three vertebrate orthologs of the fly slit gene, Slit1, 2, and 3, have been isolated. Each displays overlapping, but distinct, patterns of expression in the developing vertebrate central nervous system, implying conservation of function. However, vertebrate Slit genes are also expressed in nonneuronal tissues where their cellular locations and functions are unknown. In this study, we characterized the cellular distribution and processing of mammalian Slit3 gene product, the least evolutionarily conserved of the vertebrate Slit genes, in kidney epithelial cells, using both cellular fractionation and immunolabeling. Slit3, but not Slit2, was predominantly localized within the mitochondria. This localization was confirmed using immunoelectron microscopy in cell lines and in mouse kidney proximal tubule cells. In confluent epithelial monolayers, Slit3 was also transported to the cell surface. However, we found no evidence of Slit3 proteolytic processing similar to that seen for Slit2. We demonstrated that Slit3 contains an NH2-terminal mitochondrial localization signal that can direct a reporter green fluorescent protein to the mitochondria. The equivalent region from Slit1 cannot elicit mitochondrial targeting. We conclude that Slit3 protein is targeted to and localized at two distinct sites within epithelial cells: the mitochondria, and then, in more confluent cells, the cell surface. Targeting to both locations is driven by specific NH2-terminal sequences. This is the first examination of Slit protein localization in nonneuronal cells, and this study implies that Slit3 has potentially unique functions not shared by other Slit proteins.
vertebrate Slit genes; cellular localization
| |
INTRODUCTION |
|---|
|
|
|---|
THE DROSOPHILA SLIT GENE is expressed by the midline glial cells of the developing fly and encodes a leucine-rich repeat/epidermal growth factor (EGF) repeat-containing protein that appears to be secreted from the midline glial cells. Flies deficient in slit protein display collapse and fusion of the midline together with the loss of populations of neuronal precursors (22, 23). Another fly protein, roundabout (robo), has now been shown to act as a receptor for slit. Robo is expressed on the growth cones of the developing commissural axons in the fly nervous system. These axons cross the midline once, after which an unknown chemorepellent appeared to act to prevent them from recrossing the midline. A disruption to the Robo gene caused commissural axons to cross the midline multiple times, suggesting that robo was the receptor mediating the action of the unknown chemorepellent. The slit protein appears to be the ligand for robo, and an interaction between slit and robo can result in axonal repulsion with the response dependent on density of the robo receptor on the recipient population (11).
Recently, three vertebrate orthologs of slit, Slit1, 2, and 3, have been isolated. These appear to direct cell migration, axonal guidance, and sensory axon elongation and branching (1, 8, 14, 19, 28, 29) in vertebrate models. The Slit2 protein has been shown to interact with Robo1 (1) as it does in the fly. All three known vertebrate Slit genes have been shown to be expressed in the floor plate of the developing central nervous system (CNS), the vertebrate equivalent of the Drosophila midline glial cells (7, 10, 16). Two of these, Slit2 and Slit3, are also expressed in the developing motor neurons in the ventral horn (1, 7, 10). We and others (7, 20, 30) have previously analyzed the relative expression patterns of these genes during embryonic development and have shown distinct sites of expression outside of the CNS. Both Slit2 and Slit3 are expressed during metanephric development and limb development, although with distinct patterns of expression (7, 20). Slit3 shows a lower level of expression in the spinal motor neurons of the CNS and no continued CNS expression postnatally (7). In contrast, the expression level of Slit3 is very high in kidney, skeletal muscle, and heart, both during development and postnatally.
In an attempt to dissect the relative functions of the vertebrate Slit proteins, we raised antibodies to vertebrate Slit2 and Slit3. In this report, we describe novel trafficking pathways for Slit3, which is the most evolutionarily divergent Slit ortholog with respect to Drosophila slit. Chromosomal localization of this ortholog has placed it on human chromosome 5q35.5 (16), close to the locus for the motor neuron disease arthrogryposis multiplex congenita of the neurogenic type (24). This is interesting, given the demonstrated motor neuron expression of Slit3 during murine development. However, its distinct expression pattern during development outside of the CNS prompted us to further investigate its cellular distribution and localization. In this report, we demonstrate that both Slit2 and Slit3 proteins are trafficked to the cell surface, although only Slit2 appears to be cleaved during this process. In contrast, Western blot, immunofluorescence, and electron microscopic evidence revealed that the full-length Slit3 protein is also trafficked to the mitochondria in cells in culture and normal kidney tissue. This was an unexpected observation. However, we demonstrate that this Slit3 trafficking is directed by an NH2-terminal mitochondrial localization signal.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Antibody production.
Polyclonal antibodies were raised in New Zealand White rabbits
according to standard procedures using either glutathione
S-transferase (GST) fusion proteins or conjugated peptide
epitopes. For Slit3, a GST fusion protein encompassing a portion of the
COOH-terminal end of Slit3 was constructed from the human Slit3
(hSlit3)- expressed sequence tag clone 21651 (GenBank
accession no. T65521) subcloned into pGEX-3X (Pharmacia; see Fig.
1A). Fusion protein was purified from Escherichia
coli DH5a using a glutathione affinity column according to the
manufacturer's instructions (Pharmacia). Affinity-purified GST-hSlit3
(100 ng/ml) was emulsified with 1 ml of Freund's complete adjuvant at
a ratio of 1:1 (vol/vol) and injected intramuscularly into a New
Zealand White rabbit. Two boosts of 100 ng of fusion protein emulsified
in Freund's incomplete adjuvant were administered biweekly. A
final boost was administered after 1 mo, and blood was collected by
cardiac puncture. The serum IgG fraction containing anti-slit3 was
purified using protein A-Sepharose (Sigma). For Slit2, an antipeptide
antibody was raised to amino acids 1,478-1,498 (MGEIVREAIRRQKDYASC) within the COOH-terminal end of hSlit2 (Chiron Technologies). This peptide was conjugated to diptheria toxoid protein
and used to immunize a rabbit using the procedure outlined above.
|
Construction of mammalian expression vectors. An hSlit2 expression construct was created by performing amplification of hSlit2 cDNA in two fragments from a human fetal brain library (5' end) and human fetal kidney RNA (3' end). These were sequentially subcloned into pGEM-T (Promega) and joined together using a MungI restriction site. The entire coding region was then PCR amplified and shuttled into the elongation factor promoter-containing expression construct, pEF-BOS (15), incorporating an engineered tag encoding six histidines at the 3' end of the gene. A rat mEGF5 (Slit3) cDNA was cloned into the mammalian expression vector pEF-BOS, incorporating six tandem histidine codons at the 3' end. A rat Slit3 (rSlit3) NH2-terminal targeting sequence green fluorescent protein (GFP) chimeric clone was made by subcloning the EcoRI/BglII fragment of rSlit3 from the vector pGEM-T-rSlit3 and placing it in frame with respect to the coding sequence of GFP, contained in the vector pEGFP-N1 (Promega). A similar Slit1/Slit3 chimeric gene construct was created by PCR amplifying the first 400 bp of rSlit1 using a 5' oligonucleotide containing a Kozak sequence and a 3' oligonucleotide incorporating a BglII site. This was shuttled into pGEM-rSlit3 using SpeI/BglII digestion and then shuttled into pEF-BOS hSlit3 using the XbaI site of this vector. All oligonucleotides used were synthesized by Pacific Oligos.
RT-PCR. RNA was extracted as previously described (3). Reverse transcription was performed using 1 µg of total RNA in 1× enzyme buffer, 200 ng random hexamers, 50 µM dNTPs, 10 µM dithiothreitol, and 50 units of avian myeloblastosis virus RT (Roche Biochemicals) for 1 h at 42°C. Two pairs of hSlit3 primers were employed to investigate endogenous expression of Slit3. These were Slit3-5.3 (5' TCTTTCCCATCTGGCGCTGG 3') with Slit2-3.6 (5' CGCAGCTGAATCCTTTGTCC 3') or Slit3-5.6 (5' TGCGTGGACACAATCAATGG 3') and Slit3-3.5 (5' TCCACACTGTGAAACTGCCC 3'), which produce fragments of 638 and 46 bp, respectively. Both pairs should amplify both murine and human Slit3. Slit2 was amplified using human primers flanking EGF3 (5' GCC GGA TCC AAC GTT GAT GAT TGT GAA GAT 3') and EGF5 (5' GCC GAA TTC TCA AGA AAA CTC ACA GAA CAA GCC 3'), which contained restriction enzyme sites for subsequent subcloning. Standard PCR conditions were used [20 pmol of primers, 0.2 units of Taq polymerase (Roche Biochemicals), 1× Taq buffer, and 400 nM each dNTP] with 1 min each of denaturation (94°C), annealing (58°C), and extension (72°C) for 30 cycles of amplification.
Western blot analysis. Cultured cells were suspended in PBS and lysed by boiling in SDS-PAGE loading buffer (0.125 M Tris pH 6.8, 4% SDS, 20% glycerol, 0.02% bromphenol blue, and 10% 2-mercaptoethanol). GEC, M15, and COS-1 cell lines were fractionated into light membrane, heavy membrane, and soluble fractions, as previously described (21). Cell lysates or cell fractions were subjected to electrophoresis in a 7.5% SDS-polyacrylamide gel and transferred to nitrocellulose (Pharmacia) using a Semi-Phor semi-dry transfer unit (Hoefer). Western blots were probed with the Slit3 or Slit2 antibodies for 1 to 2 h at room temperature in 1% skim milk powder in PBS, followed by 3× 10-min washes in the same buffer without primary antibody. Detection was performed using a goat anti-rabbit antibody conjugated to horseradish peroxidase as the secondary antibody (Promega). Visualization was by enhanced chemiluminescence (Amersham).
Cell culture and immunofluorescence staining. Cell lines were cultured in DMEM (GIBCO BRL) with 10% heat-inactivated fetal calf serum (FCS), 10 mM L-glutamine, and 10 mM penicillin/streptomycin or 1:1 DMEM/F-12 (GIBCO BRL) with the same additives. For assays of protein secretion, COS cells were cultured in OptiMEM (GIBCO BRL) without FCS. For transfection and immunofluorescence, cells were seeded onto coverslips in six-well plates. Cells were grown overnight before transient transfection using Lipofectamine (Life Technologies) or Fugene (Roche Biochemicals). Immunofluorescence was typically performed after 2 days of protein expression. For analysis of endogenous protein, cells were seeded onto glass coverslips in 10-cm dishes and grown for 2 to 3 days before immunofluorescence. In both cases, cells were fixed in 4% paraformaldehyde in PBS, pH 7.4, for 30 min. After being washed with PBS, cells were permeabilized in 0.25% Triton X-100 in PBS for 5 min and then washed and blocked in 0.5% BSA in PBS before incubation with the primary antibody. This was followed by three washes with 0.5% BSA and the secondary antibody. After being washed, coverslips were mounted on slides with Vector Shield (Vector Laboratories, Burlingame, CA). For mitochondrial staining, cells in culture were incubated in 160 nM of MitoTracker (Molecular Probes) in DMEM for 30 min before being fixed and immunostained. For GFP visualization, cells were only fixed and washed. For visualization of endoplasmic reticulum (ER), the rabbit polyclonal KDDD antibody developed by Huovilla et al. was used (9). Secondary antibodies were Cy5-conjugated goat anti-rabbit (red), Bodipy-conjugated anti-rabbit (green), and Bodipy-conjugated anti-mouse IgG (green) (Molecular Probes). Rabbit polyclonals were visualized with either red or green, depending on whether MitoTracker (a red dye) was being used. For trafficking studies, brefeldin A was added to a final concentration of 5 µg/ml and cycloheximide at 10 µM.
Immunoelectron microscopy of M15 cells and kidney tissue. Cultured M15 cells were fixed for 2 h at room temperature with 4% paraformaldehyde in 0.1 M phosphate buffer, pH 7.4, with 0.2 M sucrose. Fixed cells were scraped from the dish, washed in PBS, resuspended twice in 10% gelatin (Merck), and solidified at 4°C. Small blocks were infused with polyvinyl propylene (PVP)/sucrose overnight and then frozen onto cryostubs in liquid nitrogen. For kidney tissue, a female Wistar rat was killed with an overdose of sodium pentobarbitone, and the organs were perfused in situ with 4% paraformaldehyde in 0.1 M phosphate buffer plus 0.2 M sucrose via cardiac puncture. Small blocks of kidney were then excised, infused with PVP/sucrose overnight, and cryosectioned. Ultrathin cryosectioning was performed using standard methods (26). Subsequent immunogold labeling was performed essentially as described (25) by floating grids sequentially on primary antibody and then protein A-gold diluted in PBS/BSA. Finally, grids were stained with uranyl acetate/methylcellulose. Sections were viewed on a JEOL 1010 electron microscope at 80 kV.
| |
RESULTS AND DISCUSSION |
|---|
|
|
|---|
Distribution of Slit3 in membrane fractions. Antibodies raised to Slit3 (Fig. 1A) and Slit2 were analyzed by Western blotting on whole cell lysates from COS cells transiently transfected with mammalian expression constructs containing either full-length rSlit3 (pEF-rMEGF5), hSlit2 (pEF-hslit2), or vector only (pEF). The Slit3 antibody recognized a 200-kDa protein in whole cell lysates expressing rSlit3, but this antibody failed to detect a protein in cells transfected with hSlit2 or with vector only (Fig. 1B). The same 200-kDa protein band was recognized by an antibody directed against the His6 tag present within the rSlit3 construct transfected into the cells (Fig. 1B). The Slit2 antibody also detected a 200-kDa protein in cells transfected with hSlit2 (Fig. 1B) but not rSlit3. Hence, these antibodies were ortholog specific.
These antibodies were used for Western blotting on cellular membrane fractions. Cells were fractionated into light membrane, heavy membrane, and soluble fractions (21). Previous studies have shown that these light membrane fractions are enriched in plasma membrane, and the heavy membrane fraction contains the mitochondria and nucleus. Transfected COS cells expressed the full-length 200-kDa Slit3 protein predominantly in the heavy membrane fraction, with a small amount in the light membrane fraction (Fig. 1C). Slit3 was not detected in the soluble fraction. RT-PCR was used to establish which cell lines expressed endogenous Slit2 and Slit3. Chinese hamster ovary cells (CHO), NIH/3T3, HeLa, and the SV40-transformed mesonephric mouse cell line M15, were found to express both Slit2 and Slit3. GEC4, a human glomerular epithelial cell line, expressed Slit3 but not Slit2. COS cells were also found to express Slit3 endogenously, despite the lack of detectable full-length protein in untransfected cells. The only cell line tested that did not express Slit3 was the human embryonic kidney cell line, HEK-293. In M15 and GEC4 cells, endogenous full-length (200 kDa) Slit3 protein was also found predominantly in the heavy membrane fraction (Fig. 1D). Hence, both overexpressed (transfected) and endogenous Slit3 proteins are consistently present in heavy membrane fractions of the cells. This localization in M15 and GEC4 also verifies that the Slit3 antibody can recognize both human and mouse Slit3. The Slit3 antibody also weakly recognized smaller proteins in the light membrane (82 kDa) and soluble fractions (100 kDa) and strongly detected smaller proteins in the heavy membrane (65-70 kDa) fractions in M15, GEC4, and COS cell lines, even before transfection (Fig. 1, C and D). These could represent proteolytic products of Slit3, as have previously been reported for Slit2 (1) or shorter Slit3.Localization of Slit3 to mitochondria.
The localization of Slit2 and Slit3 proteins was investigated by
immunofluorescence (Figs. 1 and 2). The
Slit2 antibody gave a widespread, faintly reticular staining throughout
the cells (Fig. 1E), which was similar in appearance to the
ER distribution of protein disulfide isomerase (data not shown), as
assessed using the KDDD antibody (9). In
contrast, the Slit3 antibody revealed a distinct, highly reticular
staining pattern originating from the perinuclear area of the cell
(Fig. 1F). This specific pattern varied from
reticular to more punctate, depending on cell density (Fig. 1,
F and J, and Fig. 2B), but was
suggestive in all cases of mitochondrial staining. This staining was
abolished by preadsorption of the Slit3 antibody with the purified
immunogen (Fig. 1G), and specific staining was not observed
with preimmune serum (Fig. 1H) or in HEK-293 cells
(Fig. 1I). No antibodies were available to test for
the localization of Slit1 protein. Endogenous Slit3 protein within the
HeLa (Fig. 1J) and M15 (Figs. 2B and
4A) cell lines also appeared in a reticular cytoplasmic
pattern with the Slit3 antibody. The mitochondrial vital dye
MitoTracker was then used to stain M15 cells colabeled with the Slit3
antibody. This revealed significant colocalization of endogenous Slit3
with mitochondria (Fig. 2, A-C). This seemed to
be particularly apparent in newly divided cells (Fig. 2,
A-C). M15 cells were also transfected with His-tagged rSlit3 to perform simultaneous staining with the Slit3 antibody and an anti-His tag monoclonal antibody (Fig. 2,
D-F). The two antibodies showed staining of the
same structures, confirming the specificity of the Slit3 antibody. CHO
cells were then transfected with the His-tagged rSlit3 construct, and
immunofluorescence was performed using the anti-His tag antibody, which
was colocalized with MitoTracker (Fig. 2, G-I).
In this case, merged images indicated significant but not total
colocalization. The noncoincident His staining, which resembled ER
staining, is likely to represent a biosynthetic pool of overexpressed
protein. Together, these images suggest that Slit3 is localized within
mitochondria in endogenous-expressing cells.
|
Ultrastructural localization of Slit3.
To investigate Slit3 localization at the ultrastructural level,
ultrathin cryosections of fixed, subconfluent M15 cells were labeled by
the immunogold labeling method (25). Gold particles indicating Slit3 labeling were found over mitochondria (Fig.
3, A and B). There
was no specific labeling of other organelles or membranes. Table
1 shows that although the gold labeling
is somewhat sparse, it is indicative of specific mitochondrial
labeling. Immunogold labeling was also carried out on tissue sections.
Previously, Northern analysis of human adult tissue showed that Slit3
is not expressed in the brain postnatally, but showed high levels of expression in the kidney, skeletal muscle, and heart (7).
All of these tissues are rich in mitochondria. Slit3 gold labeling was
concentrated within mitochondria of the proximal tubule cells (Fig. 3,
C and D and Table 1). However, additional gold
particles were detected within the ER (Fig. 3D) and
decorated the basolateral plasma membrane of these cells (Fig.
3C). Together, the results of immunofluorescence and
immunogold labeling demonstrate that Slit3 localizes to mitochondria in
both kidney cell lines and in cells of adult kidney. Electron
microscopy clearly shows that Slit3 is associated with the
mitochondrial membranes and on the cristae. Additional labeling of
Slit3 on plasma membranes, particularly in kidney tissue, led us to
further investigate delivery of Slit3 to the cell surface.
|
|
Slit3 protein does traffic to the plasma membrane in confluent
cells.
While electron microscopy verified the mitochondrial localization of
Slit3, it also revealed plasma membrane labeling. Hence, the
localization of Slit3 protein in confluent M15 cells was also investigated. M15 is a mouse mesonephric cell line (12)
that has a mesenchymal morphology until grown at high confluence, when it undergoes an epithelial transition (unpublished observation). Slit3
staining was thus compared in subconfluent M15 cultures and in
confluent cultures of epithelial-like cells. While a distinct mitochondrial localization was detected in nonconfluent M15 cells (Fig.
4A), Slit3 protein was then
seen to progressively accumulate along the plasma membrane as these
cells established confluent "lawns" of cells (Fig. 4B).
Slit3 protein can thus move to the plasma membrane and may do so in a
manner dictated by the state of differentiation or development. Even in
confluent cells, some of the Slit3 protein is still found in the
mitochondria, suggesting that this protein is targeted to and resides
at two distinct compartments within cells. The targeting of Slit3 to
mitochondria and to the plasma membrane might occur independently or as
sequential steps in one main pathway. To examine the trafficking of
Slit3, M15 cells at confluence were treated with brefeldin A, which
disrupts the Golgi complex and inhibits transport through the secretory pathway (6, 17). The initial localization of Slit3 in
these cells was both along the plasma membrane and in the mitochondria (Fig. 4C). After brefeldin A treatment, cells showed
dispersed Golgi staining, and, while Slit3 staining in the mitochondria appeared unaffected, staining at the plasma membrane was diminished (Fig. 4D). This result suggests that trafficking to the two
compartments differs in kinetics and/or route. Brefeldin A sensitivity
serves as preliminary evidence to suggest that Slit3 reaches the plasma membrane via traffic through the Golgi complex and the secretory pathway. The mechanism of transport to the mitochondria is unknown. Slit3 staining within the mitochondria and at the plasma membrane persisted in M15 cells treated with cycloheximide to block protein synthesis (Fig. 4E), further indicating that Slit3 resides
at both locations and reinforcing the hypothesis that it is targeted to
two separate, permanent locations.
|
Slit3 has a mitochondrial targeting sequence.
The localization and fate of newly synthesized protein in the secretory
pathway is first dictated by NH2-terminal sequence signals.
Our analysis of all human and rat Slit proteins using SignalP
(http://genome.cbs.dtu.dk/htbin/nth-webface) indicates that they all
contain an NH2-terminal signal peptide, suggesting that
they are translated into the ER and presumably then move through the
secretory pathway. Mitochondrial proteins encoded by nuclear genes
require trafficking across the mitochondrial membrane. Successful
passage across the mitochondrial membrane also appears to require an
NH2-terminal targeting sequence that is cleaved upon
mitochondrial import (18). Although there is no clear
consensus for such a mitochondrial targeting sequence, there are
various characteristics that can be used to recognize likely targeting
sequences, including a paucity of acidic residues, a high level of
basic and hydroxylated amino acids, and an overall positive isoelectric
point (pI) (4, 5). Analysis of all three known vertebrate
slit proteins suggests that the far NH2-terminal end of
these proteins is significantly less homologous than the leucine-rich-repeat and EGF-repeat regions of these proteins (Fig. 5A). However, all three
are reasonably poor in acidic residues in this region (Fig.
5A). Sequence analysis of the Slit proteins using the MITO
PROTII program
(http://macinsearch.com/infomac2/science/mito-prot-ii-1b.html) (4) was used to search for a mitochondrial
localization signal. The results of this analysis suggested that both
rat and human Slit3 have a >91% probability of export to the
mitochondria (Fig. 5B). Drosophila slit and rat
and human Slit2 proteins had a lower, but significant, probability of
this localization (76-83%). In contrast, rat and human Slit1
showed a much lower probability (20-25%), primarily due to an
increase in the number of NH2-terminal acidic residues, a
low overall pI, a cleavage site predicted to be closer to the start
codon, and a reduction in alanines and serines. The high probability of
mitochondrial targeting predicted from the sequence of Slit3 thus
supports our data on localization of endogenous and recombinant Slit3
in mitochondria.
|
NH2-terminal targeting sequence is sufficient for mitochondrial import. To directly test the activity of the predicted NH2-terminal mitochondrial targeting sequence in Slit3, a chimeric construct consisting of amino acid residues 1-140 of Slit3 ligated to GFP was made and transfected into CHO cells (Fig. 5C). GFP was visualized by ultraviolet illumination of fixed cells double labeled with either MitoTracker to identify mitochondria or the KDDD antibody to protein disulfide isomerase (9) to mark the ER. There was significant colocalization of GFP and MitoTracker, clearly showing that this chimeric protein was targeted to mitochondria by the Slit3 NH2-terminal signal (Fig. 5, D-F). Some highly overexpressing cells showed expression of GFP that extended beyond the mitochondria, and in these cells, there was some colocalization with protein disulfide isomerase in the ER (Fig. 5, G-I). This shows that this NH2-terminal region is also sufficient for import into the ER. Because MITO PROTII suggested that Slit1 is the least likely member of the family to be mitochondrial, a Slit1/Slit3 chimeric construct was made by cloning the equivalent NH2-terminal portion of rSlit1 in front of rSlit3 (Fig. 5C). Transfection and localization of the Slit1/Slit3 chimera showed that, unlike the NH2-terminal end of Slit3, this region of Slit1 could direct the Slit3 protein only to the ER (Fig. 5, J-O).
The presence of demonstrable signals for mitochondrial and ER import at the NH2 terminus of Slit3 makes it likely that cells use the same region to generate two distinct pools of Slit3 protein. Moreover, it is likely that cells must choose between these two routes for synthesis and placement of Slit3, because the mitochondrial localization sequence contains the signal peptide. On the basis of localization of Slit3 in cells, we propose that Slit3 is targeted either to mitochondria or is imported into the ER and subsequently trafficked through the Golgi to the plasma membrane for secretion from the cells.Possible function of Slit3 in mitochondria. The function of Slit3 within the mitochondria is not known. Mitochondria function as the energy suppliers to the cells via the production of ATP via oxidative phosphorylation (27). A link between mitochondria and the initiation of apoptosis has become more apparent recently. Within the mitochondrial inner membrane are factors such as cytochrome c, apoptosis-inducing factor, and latent forms of the caspase family of apoptosis-related proteases (27). A role for Slit3 in the promotion of cell death does not seem likely, given the temporal and spatial expression pattern of this gene during development (7, 20). Its increased localization to mitochondria during active cell division would also argue against an apoptotic role. It is possible that the Slit3 protein trafficked to the mitochondria is bound by a mitochondrial target protein, as is the case for tumor necrosis factor (TNF) (13). TNF is another putative secreted ligand, which has been shown to be present in the mitochondria. In this case, there is a TNF-binding protein related to the TNF receptor II, which exists within the mitochondria (13). However, how TNF is trafficked to the mitochondria to bind with this protein is not clear. In the case of Slit3, we assume that it reaches the mitochondria soon after synthesis, which may not require interaction with a receptor for trafficking.
The observation of distinct targeting events for the same protein is not unprecedented. In the case of TNF, trafficking to the mitochondria relies on the presence of a mitochondrial receptor protein (13). More recently, the differential trafficking of varying alternate splice forms of a protein has been reported (2). The porin voltage-dependant anion channel VDAC-1 is a protein of the outer mitochondrial membrane. A variant isoform of this protein, plasmalemmal VDAC-1, contains a hydrophobic leader peptide that facilitates trafficking to the plasma membrane via the Golgi. The length of the Slit3 mRNA (7) and modular nature of the protein may suggest considerable scope for alternate splicing within this gene. Although there was no apparent change in the size of the full-length protein upon differentiation, the removal of a sequence as short as a leader peptide would be undetectable under these conditions. Our analysis of the genomic structure of the three human Slit genes indicates the possibility of generating multiple in-frame alternate transcripts varying by as few as 24 bp (unpublished observations). However, our antibody was recognizing a mitochondrial localization of endogenous and transfected full-length constructs, suggesting that this localization is not restricted to a particular isoform. Our understanding of the role of the fly from Drosophila Slit is that it can act as an extracellular matrix component (22, 23) and also act as a chemorepellent (11). The dogma suggests that Drosophila Slit binds to the transmembrane Robo protein, upregulating that gene and moving Robo-expressing axons away from the source of Slit. However, the slit "loss of function" mutants in the fly show a complete collapse of the midline with some associated neuronal death. This would suggest an additional role in the survival of the midline glial cells. Our MITO PROTII predictions suggest it is possible that some Drosophila Slit protein is also trafficked to the mitochondria. Hence, Slit protein within the mitochondria may assist in maintaining mitochondrial function and cell viability. In summary, this study represents the first characterization of Slit protein cellular distribution outside of neural tissue and provides the first evidence of an alternate fate for a Slit protein. We have characterized the cellular distribution of Slit3 in several cell lines and compared it with that of Slit2. This has revealed that Slit3 can be targeted either for secretion or imported into the mitochondria, where it has potentially novel functions. This distinct localization may not be consistent across tissues or cell lines, and this needs to be investigated further. The distinction in processing and localization between Slit2 and Slit3 suggests differential functions for these proteins. The function of Slit3 in the mitochondria is unknown, but warrants further investigation.| |
ACKNOWLEDGEMENTS |
|---|
We thank Manabu Nakayama, Kazusa DNA Research Institute, Japan, for providing the rat mEGF5 (Slit3) expression clone, Marc Tessier-Levigne for the pSECTAG Slit2 expression construct, and Mike Eccles for the GEC4 cell lines. We also thank Stephen Fuller for providing the protein disulfide isomerase (KDDD) antibody and Rob Parton and Trevor Lithgow for scientific comment.
| |
FOOTNOTES |
|---|
This work was supported by grant funding from the National Health and Medical Research Council (to M. H. Little, T. Yamada, and J. L. Stow).
M. H. Little is a Sylvia and Charles Viertel Senior Research Fellow. M. Piper holds an Australian Postgraduate Award. The Center for Functional and Applied Genomics is a Special Research Center of the Australian Research Council
Address for reprint requests and other correspondence: M. H. Little, Institute for Molecular Bioscience, Ritchie Laboratories, Research Road, Univ. of Queensland, St. Lucia, 4072, Brisbane, Queensland, Australia (E-mail: m.little{at}imb.uq.edu.au).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 19 October 2000; accepted in final form 19 March 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Brose, K,
Bland KS,
Wang KH,
Arnott D,
Henzel W,
Goodman CS,
Tessier-Lavigne M,
and
Kidd T.
Slit proteins bind Robo receptors and have an evolutionarily conserved role in repulsive axon guidance.
Cell
96:
795-806,
1999[Web of Science][Medline].
2.
Buettner, R,
Paputsoglou G,
Scemes E,
Spray DC,
and
Dermietzel R.
Evidence for secretory pathway localization of a voltage-dependant anion channel isoform.
Proc Natl Acad Sci USA
97:
3201-3206,
2000
3.
Chomczynski, P,
and
Sacchi N.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:
156-159,
1987[Web of Science][Medline].
4.
Claros, MG.
Mitoprot, a Macintosh application for studying mitochondrial proteins.
Comput Appl Biosci
11:
441-447,
1995
5.
Claros, MG,
and
Vincens P.
Computational method to predict mitochondrially imported proteins and their targeting sequences.
Eur J Biochem
241:
779-786,
1996[Web of Science][Medline].
6.
Donaldson, JG,
Lippincott SJ,
Bloom GS,
Kreis TE,
and
Klausner RD.
Dissociation of a 110-kD peripheral membrane protein from the Golgi apparatus is an early event in brefeldin A action.
J Cell Biol
111:
2295-2306,
1990
7.
Holmes, GP,
Negus K,
Burridge L,
Raman S,
Algar E,
Yamada T,
and
Little MH.
Distinct but overlapping expression patterns of two vertebrate slit homologs implies functional roles in CNS development and organogenesis.
Mech Dev
79:
57-72,
1998[Web of Science][Medline].
8.
Hu, H.
Chemorepulsion of neuronal migration by Slit2 in the developing mammalian forebrain.
Neuron
23:
703-711,
1999[Web of Science][Medline].
9.
Huovila, AP,
Eder AM,
and
Fuller SD.
Hepatitis B surface antigen assembles in a post-ER, pre-Golgi compartment.
J Cell Biol
118:
1305-1320,
1992
10.
Itoh, A,
Miyabayashi T,
Ohno M,
and
Sakano S.
Cloning and expressions of three mammalian homologues of Drosophila slit suggest possible roles for Slit in the formation and maintenance of the nervous system.
Brain Res Mol Brain Res
20:
175-186,
1998.
11.
Kidd, T,
Bland KS,
and
Goodman CS.
Slit is the midline repellent for the robo receptor in Drosophila.
Cell
96:
785-794,
1999[Web of Science][Medline].
12.
Larsson, SH,
Charlieu JP,
Miyagawa K,
Engelkamp D,
Rassoulzadegan M,
Ross A,
Cuzin F,
van Heyningen V,
and
Hastie ND.
Subnuclear localization of WT1 in splicing or transcription factor domains is regulated by alternative splicing.
Cell
81:
391-401,
1995[Web of Science][Medline].
13.
Ledgerwood, EC,
Prins JB,
Bright NA,
Johnson DR,
Wolfreys K,
Pober JS,
O'Rahilly S,
and
Bradley JR.
Tumor necrosis factor is delivered to mitochondria where a tumor necrosis factor-binding protein is localized.
Lab Invest
78:
1583-1589,
1998[Web of Science][Medline].
14.
Li, HS,
Chen JH,
Wu W,
Fagaly T,
Zhou L,
Yuan W,
Dupuis S,
Jiang ZH,
Nash W,
Gick C,
Ornitz DM,
Wu JY,
and
Rao Y.
Vertebrate slit, a secreted ligand for the transmembrane protein roundabout, is a repellent for olfactory bulb axons.
Cell
96:
807-818,
1999[Web of Science][Medline].
15.
Mizushima, S,
and
Nagata S.
pEF-BOS, a powerful mammalian expression vector.
Nucleic Acids Res
18:
5322,
1990
16.
Nakayama, M,
Nakajima D,
Nagase T,
Nomura N,
Seki N,
and
Ohara O.
Identification of high-molecular-weight proteins with multiple EGF-like motifs by motif-trap screening.
Genomics
51:
27-34,
1998[Web of Science][Medline].
17.
Narula, N,
McMorrow I,
Plopper G,
Doherty J,
Martin KS,
Burke B,
and
Stow J.
Identification of a 200-kD brefeldin-sensitive Golgi membrane.
J Cell Biol
117:
27-38,
1992
18.
Neupert, W.
Protein import into mitochondria.
Annu Rev Biochem
66:
863-917,
1997[Web of Science][Medline].
19.
Nguyen Ba-Charvet, KT,
Brose K,
Marillat V,
Kidd T,
Goodman CS,
Tessier-Lavigne M,
Sotelo C,
and
Chedotal A.
Slit2-mediated chemorepulsion and collapse of developing forebrain axons.
Neuron
22:
463-473,
1999[Web of Science][Medline].
20.
Piper, M,
Georgas K,
Yamada T,
and
Little M.
Expression of the vertebrate Slit gene family and their putative receptors, the Robo genes, in the developing murine kidney.
Mech Dev
94:
213-217,
2000[Web of Science][Medline].
21.
Piper, RC,
Hess LJ,
and
James DE.
Differential sorting of two glucose transporters expressed in insulin-sensitive cells.
Am J Physiol Cell Physiol
260:
C570-C580,
1991
22.
Rothberg, JM,
and
Artavanis-Tsakonas S.
Modularity of the slit protein characterization of a conserved carboxy-terminal sequence in secreted proteins and a motif implicated in extracellular protein interactions.
J Mol Biol
227:
367-370,
1992[Web of Science][Medline].
23.
Rothberg, JM,
Jacobs JR,
Goodman CS,
and
Artavanis-Tsakonas S.
Slit: an extracellular protein necessary for development of midline glia and commissural axon pathways contains both EGF and LRR domains.
Genes Dev
4:
2169-2187,
1990
24.
Shohat, M,
Lotan R,
Magal N,
Shohat T,
Fischel-Ghodsian N,
Rotter JL,
and
Jaber L.
A gene for arthrogryposis multiplex congenita neuropathic type is linked to D5S394 on chromosome 5qter.
Am J Hum Genet
61:
1139-1143,
1997[Web of Science][Medline].
25.
Slot, JW,
Geuze HJ,
Gigengack S,
Lienhard GE,
and
James DE.
Immuno-localization of the insulin regulatable glucose transporter in brown adipose tissue of the rat.
J Cell Biol
113:
123-135,
1991
26.
Tokuyasu, KT.
A technique for ultracryotomy of cell suspensions and tissues.
J Cell Biol
57:
551-565,
1973
27.
Wallace, D.
Mitochondrial disease in mouse and man.
Science
283:
1482-1487,
1999
28.
Wang, KH,
Brose K,
Arnott D,
Kidd T,
Goodman CS,
Henzel W,
and
Tessier-Lavigne M.
Biochemical purification of a mammalian slit protein as a positive regulator of sensory axon elongation and branching.
Cell
96:
771-784,
1999[Web of Science][Medline].
29.
Wu, W,
Wong K,
Chen J,
Jiang Z,
Dupuis S,
Wu JY,
and
Rao Y.
Directional guidance of neuronal migration in the olfactory system by the protein Slit.
Nature
400:
331-336,
1999[Medline].
30.
Yuan, W,
Zhou L,
Chen JH,
Wu JY,
Rao Y,
and
Ornitz DM.
The mouse SLIT family: secreted ligands for ROBO expressed in patterns that suggest a role in morphogenesis and axon guidance.
Dev Biol
21:
290-306,
1999.
This article has been cited by other articles:
![]() |
R. Vuononvirta, N. J. Sebire, B. Messahel, N. Perusinghe, J. S. Reis-Filho, K. Pritchard-Jones, G. M. Vujanic, and C. Jones Expression of Hepatocyte Growth Factor and Its Receptor Met in Wilms' Tumors and Nephrogenic Rests Reflects Their Roles in Kidney Development Clin. Cancer Res., April 15, 2009; 15(8): 2723 - 2730. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |