|
|
||||||||
1(I) collagen mRNA in human lung fibroblasts
Pulmonary Center and Department of Biochemistry at Boston University School of Medicine and Boston Veterans Affairs Medical Center, Boston, Massachusetts 02118
| |
ABSTRACT |
|---|
|
|
|---|
We
investigated the role of phosphatidylinositol 3-kinase (PI3K) in the
expression of
1(I) collagen mRNA. We report that the
basal level of
1(I) collagen mRNA was reduced when PI3K
activity was inhibited by either LY-294002 or wortmannin. These PI3K
inhibitors also blocked increases of
1(I) collagen mRNA
levels after the addition of transforming growth factor-
. The effect
of PI3K inhibition was abolished by the removal of the inhibitor or by
the addition of cycloheximide. Inhibition of PI3K activity decreased
the stability of the
1(I) collagen mRNA with no change
in the rate of transcription of the
1(I) collagen gene
as assessed by Northern blotting with actinomycin D-treated fibroblasts
and nuclear run-on assays. Expression of a truncated
1(I) collagen minigene driven by a cytomegalovirus promoter in murine fibroblasts was decreased by LY-294002 treatment. These data indicate that PI3K activation results in increased stabilization of
1(I) collagen mRNA. In vivo, the PI3K
activity in fibroblasts may regulate basal levels of
1(I) collagen mRNA expression.
mRNA stability; LY-294002; wortmannin; actinomycin D
| |
INTRODUCTION |
|---|
|
|
|---|
THE
1(I) collagen mRNA is expressed at low
or undetectable levels by lung fibroblasts that reside in normal
alveolar walls as assessed by in situ hybridization assays
(25). During inflammatory reactions, fibroblasts are
activated by exposure to serum constituents or to specific effector
substances such as insulin-related peptides and transforming growth
factor-
(TGF-
). This activation process may involve upregulation
of specific signal transduction pathways, including the
phosphatidylinositol 3-kinase (PI3K) system. In addition,
1(I) collagen mRNA levels are markedly increased by processes that involve stabilization of the mRNA and increases in gene
transcription (29, 30, 33). In contrast, lung fibroblasts in culture are already activated and usually express readily observable levels of
1(I) collagen mRNA, perhaps by exposure to
artificial cell surfaces and loss of matrix interactions. Active PI3K
can be detected in fibroblasts in culture, even when maintained in a
quiescent state, and can be further activated by exposure to specific
effector substances such as insulin.
PI3Ks are divided into three classes. The class I PI3Ks are
heterodimeric isoforms each consisting of a 110-kDa catalytic subunit
and an adaptor regulator subunit (19). Activated PI3K phosphorylates the D-3 position of the inositol ring of
phosphoinositides. The phospholipid product, phosphatidylinositol
3,4,5-trisphosphate, functions as an upstream regulator of the
- and
-isoforms of protein kinase C (PKC
and PKC
) and the
serine/threonine protein kinase B (PKB/Akt) (1, 21, 23, 32,
35). The participation of active PI3K in metabolic activities
can be assessed using specific inhibitors. The class I PI3Ks are
primarily involved in signal transduction pathways and are reversibly
inhibited by LY-294002. Wortmannin is structurally unrelated to
LY-294002 but covalently binds to the catalytic subunit and
irreversibly inhibits the enzyme. In the present work, we investigated
the regulation of PI3K and its effect on
1(I) collagen
mRNA levels. We found that
1(I) collagen mRNA levels in
human lung fibroblasts are regulated by a mechanism that is sensitive
to PI3K inhibition.
| |
METHODS |
|---|
|
|
|---|
Tissue culture. Human embryonic lung fibroblasts (IMR-90, Institute for Medical Research, Camden, NJ) were grown in Dulbecco's modified Eagle's medium supplemented with 0.37 g sodium bicarbonate/100 ml, 10% (vol/vol) fetal bovine serum (FBS), 100 U penicillin/ml, 10 µg streptomycin/ml, and 0.1 mM nonessential amino acids. After confluence, the serum content of the medium was reduced to 0.4% FBS. Cell numbers were determined by triplicate cell counts with an electronic particle counter (Coulter Counter ZM).
RNA isolation and Northern analysis.
Total cellular RNA was isolated by the single-step method employing
guanidine thiocyanate-phenol-chloroform extraction, as described by
Chomczynski and Sacchi (8). RNA was quantified by
absorbance at 260 nm. Purity was determined by absorbance at 280 and
310 nm. RNA (10 µg) was electrophoresed through a 1% agarose-6% formaldehyde gel and transferred to a nylon membrane. RNA loading was
assessed by ethidium bromide staining of ribosomal bands and by
cohybridization with an oligonucleotide probe containing sequences for
the 18S ribosomal fragment or glyceraldehyde 3-phosphate dehydrogenase. Hybridization was performed using 0.5-1.0 × 106
cpm/lane labeled probe (specific activity 4-10 × 108 cpm/µg). The filter was exposed to X-ray film for
autoradiography at several different times to ensure that the bands
could be quantified by densitometry within the linear range. The
connective tissue growth factor (CTGF) probe is a 586-bp PCR product
generated with the forward primer gtggagtatgtaccgacggcc and the reverse
primer acaggcaggtcagtgagcacgc. The
1(I) collagen probe
came from a rat
1(I) collagen cDNA that specifically
binds human
1(I) collagen mRNA (14).
Nuclear run-on assay. Confluent, quiescent fibroblasts in 150-mm dishes were washed twice with Puck's saline and scraped into a Nonidet P-40 lysis buffer. After two low-speed spins, the pellet was reconstituted in a glycerol buffer. In vitro labeling of nascent RNA and hybridization with cDNA immobilized on nitrocellulose filters were performed according to the methods reported previously (16, 17).
Western blotting. PAGE was performed under reducing conditions using 7.5% polyacrylamide gels as described elsewhere (20). Samples (100 µg) for SDS-PAGE and Western blotting were prepared from the cell layer of quiescent confluent fibroblasts grown in 100-mm tissue culture dishes. The cell layer was disrupted in RIPA buffer (50 mM HEPES, 150 mM NaCl, 1 mM EDTA, 30 mM NaF, 1% Triton X-100, 1 mM Na3VO4, 10 mM NaP2O7, 1 µg/ml antipain, 1 µg/ml leupeptin, 1 µg/ml pepstatin A) and centrifuged (14,000 g for 10 min) at 4°C. Gels were transferred to nitrocellulose filters (Schleicher & Schuell) and blocked with 10% evaporated milk in phosphate-buffered saline with 0.1% Tween for 2 h at room temperature (20). Anti-Akt and anti-phosphoserine-473 Akt (New England Biolabs) were used according to manufacturer's instructions.
Transfection procedures.
A collagen minigene (28) that contains the first five
exons and introns joined to the last six exons and introns was used. The original construct also contained
2.4 kb of the 5'-flanking region and 2 kb of the 3'-flanking sequence beyond the second polyadenylation site. The 5'-flanking region (35 bp upstream from the
functional ATG) was deleted, but the stem-loop structure was preserved.
This clone was ligated into a pcDNA3.1(
) expression vector and
transfected into NIH/3T3 cells at 80-90% confluency using
Lipofectamine-plus reagent. RNA was isolated, and Northern analysis was performed.
Statistics. A Student's test was used for means of unequal size. P < 0.05 was considered significant.
| |
RESULTS |
|---|
|
|
|---|
A dose-response relation for
1(I) collagen mRNA and
LY-294002 for concentrations below and above the EC50 (1.4 µM) was performed to assess the specificity of the interaction.
LY-294002 at 1 µM reduced basal
1(I) collagen mRNA
levels. At 10 µM, LY-294002 caused a dramatic decrease in
1(I) collagen mRNA. At 25 µM, LY-294002 decreased
1(I) collagen mRNA levels by 86 ± 4% (mean ± SE, n = 4) compared with untreated controls (Fig.
1A). The LY-294002 dose-response relation for suppression of
1(I) collagen
mRNA levels was consistent with specific inhibition of PI3K. Similar results were obtained using wortmannin to inhibit PI3K (Fig.
1B). However, the addition of the mitogen-activated protein
(MAP) kinase kinase inhibitor PD-98050 did not affect basal
1(I) collagen mRNA levels (data not shown).
|
TGF-
induces large increases in
1(I) collagen
production by fibroblasts in vitro and likely contributes to
fibrogenesis in vivo (12). We found that LY-294002
inhibited the TGF-
-induced increase in
1(I) collagen
mRNA formation at 24 h (Fig.
2A). The reduction of basal
levels of
1(I) collagen mRNA by LY-294002 was selective.
Inhibition of PI3K did not alter basal or TGF-
-induced levels of
CTGF mRNA (Fig. 2B).
|
After inhibition of PI3K with LY-294002, we performed kinetic studies
to determine the rate of decline of
1(I) collagen mRNA levels. At 2 h after the addition of LY-294002 (25 µM), a
decrease of
1(I) collagen mRNA was evident. After 5 h, the basal
1(I) collagen mRNA level was dramatically
reduced, and after 8 h,
1(I) collagen mRNA was
barely detectable (Fig. 3).
|
To assess recovery after exposure to LY-294002 for 24 h, the
cultures were washed free of the inhibitor. LY-294002 binds reversibly to the ATP-binding pocket of the catalytic subunit of PI3K. At 24 h after removal of LY-294002,
1(I) collagen mRNA levels
increased and, at 48 h,
1(I) collagen mRNA levels
returned to untreated levels (Fig. 4),
verifying the viability of the fibroblasts. During recovery, the
cultures were maintained in low-serum medium to preclude expansion of
the cultures.
|
Cell number was not affected by treatment with LY-294002 (2.39 ± 0.2 × 106 and 2.34 ± 0.1 × 106 cells in untreated and LY-294002-treated cultures, respectively).
The decrease of
1(I) collagen mRNA levels induced by
PI3K inhibition was further characterized by inhibiting protein
synthesis with cycloheximide (CHX; Fig.
5). Northern blot analyses indicate that
CHX alone did not modify
1(I) collagen mRNA levels. The average densitometric results from two experiments indicate that, in
fibroblasts treated with LY-294002, the basal level of
1(I) collagen mRNA was reduced by 80% compared with
1(I) collagen mRNA levels of untreated fibroblasts. In
fibroblasts treated with the combination of LY-294002 and CHX, the
level of
1(I) collagen mRNA was reduced by 48%.
|
The effect of decreased PI3K activity on the rate of transcription was
assessed by nuclear run-on assays (Fig.
6). Nuclei were isolated from untreated
and LY-294002-treated fibroblasts. When the cultures were treated with
LY-294002 for 2 or 6 h, there was no change in the rate of
transcription of the
1(I) collagen gene. In addition,
inhibition of PI3K did not affect transcription of the
-subunit of
the heterotrimeric G protein Gs. No hybridization occurred
in filters containing plasmids without inserts. Similar results were
obtained after a more prolonged exposure (16 h) to LY-294002 (data not
shown).
|
To assess the stability of the
1(I) collagen mRNA,
transcription was blocked with actinomycin D (Fig.
7). Without ongoing transcription,
1(I) collagen mRNA decays with a half-life of 8-12
h (22). To determine the contribution of PI3K activity to
the stability of
1(I) collagen mRNA, fibroblasts were
treated with LY-294002 for 6 h before transcription was blocked
with actinomycin D. In fibroblasts incubated with the combination of
LY-294002 and actinomycin D, the rate of decline in the level of
1(I) collagen mRNA was faster at all time points than in
fibroblasts incubated with only actinomycin D. Similar results were
obtained from three independent experiments. These data suggest that
inhibition of PI3K by LY-294002 reduced the stability of the message.
|
After PI3K activation, Akt is phosphorylated and activated
(1). To verify inhibition of PI3K activity, PAGE was used
to resolve cell lysates, and active Akt was detected by Western
blotting using an anti-phosphoserine-473 Akt antibody. Active Akt was
detected in untreated quiescent fibroblasts. In fibroblasts treated
with 10 or 25 µM LY-294002, the level of active Akt was reduced,
confirming that Akt activation requires PI3K activity. Total Akt did
not vary in any treatment group, as detected with an anti-Akt antibody (Fig. 8).
|
To localize the LY-294002-responsive cis-acting element in
the
1(I) collagen mRNA, we employed a collagen minigene
(28). We deleted the promoter region and most of the
5'-untranslated region (UTR) upstream from the translational start site
and ligated the resultant clone into an expression vector driven by a
cytomegalovirus promoter. The 5'-stem-loop structure containing the
translational start codon was preserved in this truncated minigene.
After transfection of the minigene into NIH/3T3 cells, the high level
of promoter activity generated a transcript that was detectable by
Northern analysis (Fig. 9). Most
importantly, the steady-state level of the minigene transcript
decreased after LY-294002 treatment.
|
| |
DISCUSSION |
|---|
|
|
|---|
We demonstrated that the steady-state level of
1(I)
collagen mRNA was sensitive to inhibition of PI3K by LY-294002. This effect was mediated by a decrease in the stability of the
1(I) collagen mRNA as assessed by treatment with
actinomycin D. Using nuclear run-on assays, we found no associated
change in the rate of transcription of the
1(I) collagen
gene. The decrease in
1(I) collagen mRNA stability was
not the result of toxicity, because cell number did not change after
LY-294002 treatment and
1(I) collagen mRNA levels
completely recovered after removal of the inhibitor. Moreover, the
effect of PI3K inhibition on
1(I) collagen mRNA
stability was selective, because the steady-state level of CTGF mRNA
was not affected.
PI3K likely acts by affecting a specific protein that preferentially
regulates the stability of the
1(I) collagen mRNA.
However, inhibition of protein synthesis by CHX does not mimic the
action of LY-294002. In fact, CHX partially blocked the
LY-294002-mediated decrease in
1(I) collagen mRNA. Taken
together, the results suggest that PI3K may inhibit the activity of a
protein that destabilizes the
1(I) collagen mRNA.
In vivo, the stability of
1(I) collagen mRNA and the
rate of transcription of the
1(I) collagen gene are
decreased in quiescent cells within tissue and activated by disruption
of matrix and exposure to serum or specific effector substances. The
process of isolation and subcultivation of otherwise quiescent hepatic stellate cells results in marked increases in
1(I)
collagen mRNA expression. This increase in steady-state levels of
1(I) collagen mRNA levels results from small increases
in the rate of
1(I) collagen gene transcription that are
amplified by marked prolongation of the mRNA half-life
(15). These data suggest that
1(I) collagen mRNA stabilization is a major feature of fibrogenic reactions, albeit
poorly understood. The phenotypic alterations that accompany the
transition from fibroblasts to myofibroblasts are associated with
increases in
1(I) collagen mRNA stability.
Interestingly, inhibition of PI3K activity prevents the differentiation
of a variety of cell types, including preadipocytes and myocytes
(3, 36). TGF-
released during inflammatory reactions
affects the stability of the
1(I) collagen mRNA
(29). In addition, matrix interactions are likely
important, because other mRNA transcripts such as certain integrin
subunits are stabilized by exposure to collagen but not fibronectin
(38).
Activated fibroblasts derived from patients with scleroderma are
characterized by increases in collagen production that are due, in
large part, to increases in mRNA stability (11). Many mRNAs are regulated by AU-rich sequences located in the 3'-UTR that
promote poly(A) shortening (7, 10). Binding proteins may
protect other cis-acting sequences that serve as cleavage sites for endonuclease attack (4). In regard to
1(I) collagen mRNA, several studies have incompletely
defined regulatory proteins or domains (31, 33).
Overexpression of mutated Ras, but not wild-type Ras, resulted in
decreased stability of the
1(I) collagen transcript, but
the cis-acting elements mediating this change were not
defined (31). A regulatory region in the 3'-region of the
1(I) collagen mRNA transcript was identified in hepatic stellate cells that binds
CP2. This protein also binds and
stabilizes
-globin mRNA (37). The region surrounding
the start codon in the
1(I) collagen transcript can form
a stem-loop structure that incorporates the translational start site.
Stem-loop structures found in other genes such as in the 3'-UTR of the
granulocyte colony-stimulating factor are known to regulate stability
(6). Stefanovic and associates (34)
identified a destabilizing 5'-sequence contained within this stem-loop
structure. Interestingly, this sequence is also found in the
2(I) and
1(III) collagen transcripts. However, other investigators, using a somewhat different experimental approach, examined this region and did not find regulatory activity (5). We found that PI3K inhibition decreased the levels of a transfected collagen minigene containing the 5'-stem-loop structure and the 3'-UTR. It is not yet certain whether one or both of these regions are required to mediate the effect of PI3K inhibition on
1(I) collagen mRNA stability.
PI3K signal transduction elements can interact with the MAP kinase
system that was reported to affect collagen levels in some cellular
systems (2, 13, 18, 27). However, in the human lung
fibroblasts used in our studies, we found that the addition of a
specific MAP kinase kinase inhibitor did not affect basal collagen
accumulation. PI3K signal transduction is mediated in part by
activation of Akt. We demonstrated that Akt activation correlates with
the change in
1(I) collagen mRNA stability. After activation by PI3K, Akt activates or binds to several transduction systems that may ultimately affect collagen mRNA stability, including PKC
, p21-activated kinase, integrin-linked kinase,
telomerase, H2B, 6-phosphofructo-2-kinase, glycogen synthase 3, caspase 3, Rac 1, possibly MEKK3, RSK, and JNK (1, 9).
Alternatively, PI3K may act to mediate collagen stability via other
pathways that include the direct protein kinase activity of PI3K or the D-3-phosphorylated phosphoinositide-dependent kinases such as PKC
,
PKC
, and PKC
(24, 26) acting either directly or indirectly.
We conclude that, in human lung fibroblasts, steady-state levels of
1(I) collagen mRNA are maintained by an
LY-294002-sensitive pathway and, specifically, that PI3K activity
stabilizes
1(I) collagen mRNA. The exact identity of the
putative protein that regulates the stability of
1(I)
collagen mRNA remains uncertain. Possible candidates include a protein
complex recently demonstrated to bind to a stem-loop structure in the
5'-UTR region of the
1(I) collagen mRNA or
CP2, which
binds to the 3'-UTR of the
1(I) collagen mRNA (33,
34). The overall level of PI3K activity may determine basal
steady-state levels of
1(I) collagen mRNA in fibroblasts
in vivo.
| |
ACKNOWLEDGEMENTS |
|---|
This work was supported by National Heart, Lung, and Blood Institute Grant P50HL-56386 and the Department of Veterans Affairs Merit Review Research Program.
| |
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: D. A. Ricupero, The Pulmonary Center, Rm. 304, Boston University School of Medicine, 80 E. Concord St., Boston, MA 02118 (E-mail: ricupero{at}bu.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 5 October 2000; accepted in final form 1 February 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Alessi, DR,
Deak M,
Casamajor A,
Caudwell FB,
Morrice N,
Norman DG,
Gaffney P,
Reese CB,
MacDougall CN,
Harbison D,
Ashworth A,
and
Bownes M.
3-Phosphadylinositide-dependent protein kinase 1 (PDK1) phosphorylates and activates the p70 S6 kinase in vivo and in vitro.
Curr Biol
8:
69-81,
1997.
2.
Amemiya, T,
Sasamura H,
Mifune M,
Kitamura Y,
Hirahashi J,
Hayashi M,
and
Saruta T.
Vascular endothelial growth factor activates MAP kinase and enhances collagen synthesis in human mesangial cells.
Kidney Int
56:
2055-2063,
1999[Web of Science][Medline].
3.
Apostolova, MI,
Ivanova IA,
and
Cherian MG.
Signal transduction pathways and nuclear translocation of zinc and metallothionein during differentiation of myoblasts.
Biochem Cell Biol
78:
27-37,
2000[Web of Science][Medline].
4.
Binder, R,
Howowitz JA,
Basilion JP,
Koeller DM,
Klausner RD,
and
Harford JB.
Evidence that the pathway of transferrin receptor mRNA degradation involves an endonucleolytic cleavage within the 3' UTR and does not involve poly(A) shortening.
EMBO J
13:
1969-1980,
1994[Web of Science][Medline].
5.
Bornstein, P,
McKay DJ,
Devarayalu S,
and
Cook SC.
A highly conserved 5' untranslated, inverted repeat sequence is ineffective on translational control of the
1(I) collagen gene.
Nucleic Acids Res
16:
9721-9736,
1988
6.
Brown, CY,
Lagnado CA,
and
Goodall GJ.
A cytokine mRNA-destabilizing element that is structurally and functionally distinct from A + U rich elements.
Proc Natl Acad Sci USA
93:
13721-13725,
1996
7.
Chen, C-Y,
Cehn T-M,
and
Shyu A-B.
Interplay of two functionally and structurally distinct domains of the c-fos AU-rich elements specifies its mRNA-destabilizing function.
Mol Cell Biol
14:
416-426,
1994
8.
Chomczynski, P,
and
Sacchi N.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:
156-159,
1987[Web of Science][Medline].
9.
Coffer, P,
Jin J,
and
Woodgett JR.
Protein kinase B (c-AKT): a multifunctional mediator of phosphatidylinositol 3-kinase activation.
Biochem J
335:
1-13,
1998.
10.
Day, DA,
and
Tuite MF.
Post-transcriptional gene regulatory mechanisms in eukaryotes: an overview.
J Endocrinol
157:
361-371,
1998[Abstract].
11.
Eckes, B,
Mauch C,
Huppe G,
and
Krieg T.
Differential regulation of transcription and transcript stability of pro-
1(I) collagen and fibronectin in activated fibroblasts derived from patients with systemic scleroderma.
Biochem J
315:
549-554,
1996.
12.
Fine, A,
and
Goldstein RH.
The effect of transforming growth factor-
on cell proliferation and collagen formation by lung fibroblasts.
J Biol Chem
262:
3897-3902,
1987
13.
Gebken, J,
Luders B,
Notbohm H,
Klein HH,
Brinckmann J,
Muller PK,
and
Batge B.
Hypergravity stimulates collagen synthesis in human osteoblast-like cells: evidence for the involvement of p44/42 MAP-kinases (ERK 1/2).
J Biochem (Tokyo)
126:
676-682,
1999
14.
Genovese, C,
Rowe D,
and
Kream B.
Construction of DNA sequences complementary to rat
1 and
2 collagen mRNA and their use in studying the regulation of type I collagen synthesis by 1,25-dihydroxyvitamin D.
Biochemistry
23:
6210-6216,
1984[Medline].
15.
Goldstein, RH.
Control of type I collagen formation in the lung.
Am J Physiol Lung Cell Mol Physiol
261:
L29-L40,
1991
16.
Greenberg, ME,
and
Ziff EB.
Stimulation of 3T3 cells induces transcription of the c-fos proto-oncogene.
Nature
311:
433-438,
1984[Medline].
17.
Groudine, M,
Peretz M,
and
Weintraub H.
Transcriptional regulation of hemoglobin switching in chicken embryos.
Mol Cell Biol
1:
281-288,
1981
18.
Hayashida, T,
Poncele AC,
Hubchak SC,
and
Schnaper HW.
TGF-
1 activates MAP kinase in human mesangial cells: a possible role in collagen expression.
Kidney Int
56:
1710-1729,
1999[Web of Science][Medline].
19.
Kapeller, R,
and
Cantley LC.
Phosphatidylinositol 3-kinase.
Bioassays
16:
565-576,
1994[Web of Science][Medline].
20.
Kim, GY,
Besner GE,
Steffen CL,
McCarthy DW,
Downing MT,
Luquette MH,
Abad MS,
and
Brigstock DR.
Purification of heparin-binding epidermal growth factor-like growth factor from pig uterine luminal flushings and its production by endometrial tissues.
Biol Reprod
52:
561-571,
1995[Abstract].
21.
Kotani, K,
Ogawa W,
Matsumoto M,
Kitamura T,
Sakaue H,
Hino Y,
Miyake K,
Sano W,
Akimoto K,
Ohno S,
and
Kasuga M.
Requirement of atypical protein kinase C-
for insulin stimulation of glucose uptake but not for AKT activation in 3T3-L1 adipocytes.
Mol Cell Biol
18:
6971-6982,
1998
22.
Krupsky, M,
Fine A,
Kuang P-P,
Berk JL,
and
Goldstein RH.
Regulation of type I collagen production by insulin and transforming growth factor-
in human lung fibroblasts.
Connect Tissue Res
203:
1020-1027,
1996.
23.
Le Good, JA,
Ziegler WH,
Parekh DB,
Alessi DR,
Cohen P,
and
Parker PJ.
Protein kinase C isotypes controlled by phosphoinositide 3-kinase through the protein kinase PDK1.
Science
281:
2042-2045,
1998
24.
Liu, Q,
Ning W,
Dantzer R,
Freund GG,
and
Kelley KW.
Activation of protein kinase C-
and phosphatidylinositol 3'-kinase and promotion of macrophage differentiation by insulin-like growth factor-I.
J Immunol
160:
1393-1401,
1998
25.
Lucey, EC,
Ngo HQ,
Agarwal A,
Smith BD,
Snider GL,
and
Goldstein RG.
Differential expression of elastin and
1(I) collagen mRNA in mice with bleomycin-induced fibrosis.
Lab Invest
74:
12-20,
1996[Web of Science][Medline].
26.
Nakanishi, HK,
Brewer A,
and
Exton JH.
Activation of the
-isozyme of protein kinase C by phosphatidylinositol 3,4,5-trisphosphate.
J Biol Chem
268:
13-16,
1993
27.
Neugarten, J,
Medve I,
Lei J,
and
Silbiger SR.
Estradiol suppresses mesangial cell type I collagen synthesis via activation of the MAP kinase cascade.
Am J Physiol Renal Physiol
277:
F875-F881,
1999
28.
Olsen, AS,
Geddis AE,
and
Prockop DJ.
High levels of expression of a minigene version of the human pro-
1(I) collagen gene in stably transfected mouse fibroblasts. Effects of deleting putative regulatory sequences in the first intron.
J Biol Chem
266:
1117-1121,
1991
29.
Penttinen, RP,
Kobayashi S,
and
Bornstein P.
Transforming growth factor
1 increases mRNA for matrix proteins both in the presence and in the absence of changes in mRNA stability.
Proc Natl Acad Sci USA
85:
1105-1108,
1988
30.
Raghow, R,
Lurie S,
Seyer JM,
and
Kang AH.
Profiles of steady-state levels of messenger RNAs coding for type I procollagen, elastin, and fibronectin in hamster lungs undergoing bleomycin-induced interstitial pulmonary fibrosis.
J Clin Invest
76:
1733-1739,
1985.
31.
Slack, JL,
Parker MI,
Robinson VR,
and
Bornstein P.
Regulation of collagen I gene expression by ras.
Mol Cell Biol
12:
4714-4723,
1992
32.
Standaert, ML,
Galloway L,
Karnam P,
Bandyopadhyay G,
Moscat J,
and
Farese R.
Protein kinase C-
as a downstream effector of phsophatidylinositol 3-kinase during stimulation in rat adipocytes. Potential role in glucose transport.
J Biol Chem
272:
30075-30082,
1997
33.
Stefanovic, B,
Hellerbrand C,
Holcik M,
Briendl M,
Liebhaber SA,
and
Brenner DA.
Posttranscriptional regulation of collagen
1(I) mRNA in hepatic stellate cells.
Mol Cell Biol
17:
5201-5209,
1997[Abstract].
34.
Stefanovic, B,
Lindquist J,
and
Brenner DA.
The 5' stem-loop regulates expression of collagen
1(I) mRNA in mouse fibroblasts cultured in a three-dimensional matrix.
Nucleic Acids Res
28:
641-647,
2000
35.
Stokoe, D,
Stephens LR,
Copeland T,
Gaffney PR,
Reese CB,
Painter GF,
Holmes AB,
McCormick F,
and
Hawkins PT.
Dual role of phosphatidylinosintol-3,4,4-triphosphate in the activation of protein kinase B.
Science
277:
567-570,
1997
36.
Usui, I,
Haruta T,
Iwata M,
Takano A,
Uno T,
Kawahara J,
Ueno E,
Sasaoka T,
and
Kobayashi M.
Retinoblastoma protein phosphorylation via PI 3-kinase and mTOR pathway regulates adipocyte differentiation.
Biochem Biophys Res Commun
275:
115-120,
2000[Web of Science][Medline].
37.
Wang, X,
Kiledjian M,
Weiss IM,
and
Liebhaber SA.
Detection and characterization of a 3' untranslated region ribonucleoprotein complex associated with human
-globin mRNA stability.
Mol Cell Biol
15:
1769-1777,
1995[Abstract].
38.
Xu, J,
and
Clark R.
Extracellular matrix alters PDGF regulation of fibroblast integrins.
J Cell Biol
132:
239-249,
1996
This article has been cited by other articles:
![]() |
Y. Zhang, D. Bhatia, H. Xia, V. Castranova, X. Shi, and F. Chen Nucleolin links to arsenic-induced stabilization of GADD45{alpha} mRNA Nucleic Acids Res., January 18, 2006; 34(2): 485 - 495. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. K. Ko and E. P. Kay Regulatory Role of FGF-2 on Type I Collagen Expression during Endothelial Mesenchymal Transformation Invest. Ophthalmol. Vis. Sci., December 1, 2005; 46(12): 4495 - 4503. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Krepinsky, Y. Li, Y. Chang, L. Liu, F. Peng, D. Wu, D. Tang, J. Scholey, and A. J. Ingram Akt Mediates Mechanical Strain-Induced Collagen Production by Mesangial Cells J. Am. Soc. Nephrol., June 1, 2005; 16(6): 1661 - 1672. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhou, J. B. Trudeau, K. J. Schoonover, J. I. Lundin, S. M. Barnes, M. J. Cundall, and S. E. Wenzel Interleukin-13 augments transforming growth factor-{beta}1-induced tissue inhibitor of metalloproteinase-1 expression in primary human airway fibroblasts Am J Physiol Cell Physiol, February 1, 2005; 288(2): C435 - C442. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Taguchi, T. Kondo, M. Watanabe, M. Miyaji, H. Umehara, Y. Kozutsumi, and T. Okazaki Interleukin-2-induced survival of natural killer (NK) cells involving phosphatidylinositol-3 kinase-dependent reduction of ceramide through acid sphingomyelinase, sphingomyelin synthase, and glucosylceramide synthase Blood, November 15, 2004; 104(10): 3285 - 3293. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Asano, H. Ihn, K. Yamane, M. Jinnin, Y. Mimura, and K. Tamaki Phosphatidylinositol 3-Kinase Is Involved in {alpha}2(I) Collagen Gene Expression in Normal and Scleroderma Fibroblasts J. Immunol., June 1, 2004; 172(11): 7123 - 7135. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Tsybouleva, L. Zhang, S. Chen, R. Patel, S. Lutucuta, S. Nemoto, G. DeFreitas, M. Entman, B. A. Carabello, R. Roberts, et al. Aldosterone, Through Novel Signaling Proteins, Is a Fundamental Molecular Bridge Between the Genetic Defect and the Cardiac Phenotype of Hypertrophic Cardiomyopathy Circulation, March 16, 2004; 109(10): 1284 - 1291. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Runyan, H. W. Schnaper, and A.-C. Poncelet The Phosphatidylinositol 3-Kinase/Akt Pathway Enhances Smad3-stimulated Mesangial Cell Collagen I Expression in Response to Transforming Growth Factor-{beta}1 J. Biol. Chem., January 23, 2004; 279(4): 2632 - 2639. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |