Am J Physiol Cell Physiol Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 281: C99-C105, 2001;
0363-6143/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (23)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ricupero, D. A.
Right arrow Articles by Goldstein, R. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ricupero, D. A.
Right arrow Articles by Goldstein, R. H.
Vol. 281, Issue 1, C99-C105, July 2001

Phosphatidylinositol 3-kinase-dependent stabilization of alpha 1(I) collagen mRNA in human lung fibroblasts

Dennis A. Ricupero, Christine F. Poliks, David C. Rishikof, Kelly A. Cuttle, Ping-Ping Kuang, and Ronald H. Goldstein

Pulmonary Center and Department of Biochemistry at Boston University School of Medicine and Boston Veterans Affairs Medical Center, Boston, Massachusetts 02118


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

We investigated the role of phosphatidylinositol 3-kinase (PI3K) in the expression of alpha 1(I) collagen mRNA. We report that the basal level of alpha 1(I) collagen mRNA was reduced when PI3K activity was inhibited by either LY-294002 or wortmannin. These PI3K inhibitors also blocked increases of alpha 1(I) collagen mRNA levels after the addition of transforming growth factor-beta . The effect of PI3K inhibition was abolished by the removal of the inhibitor or by the addition of cycloheximide. Inhibition of PI3K activity decreased the stability of the alpha 1(I) collagen mRNA with no change in the rate of transcription of the alpha 1(I) collagen gene as assessed by Northern blotting with actinomycin D-treated fibroblasts and nuclear run-on assays. Expression of a truncated alpha 1(I) collagen minigene driven by a cytomegalovirus promoter in murine fibroblasts was decreased by LY-294002 treatment. These data indicate that PI3K activation results in increased stabilization of alpha 1(I) collagen mRNA. In vivo, the PI3K activity in fibroblasts may regulate basal levels of alpha 1(I) collagen mRNA expression.

mRNA stability; LY-294002; wortmannin; actinomycin D


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

THE alpha 1(I) collagen mRNA is expressed at low or undetectable levels by lung fibroblasts that reside in normal alveolar walls as assessed by in situ hybridization assays (25). During inflammatory reactions, fibroblasts are activated by exposure to serum constituents or to specific effector substances such as insulin-related peptides and transforming growth factor-beta (TGF-beta ). This activation process may involve upregulation of specific signal transduction pathways, including the phosphatidylinositol 3-kinase (PI3K) system. In addition, alpha 1(I) collagen mRNA levels are markedly increased by processes that involve stabilization of the mRNA and increases in gene transcription (29, 30, 33). In contrast, lung fibroblasts in culture are already activated and usually express readily observable levels of alpha 1(I) collagen mRNA, perhaps by exposure to artificial cell surfaces and loss of matrix interactions. Active PI3K can be detected in fibroblasts in culture, even when maintained in a quiescent state, and can be further activated by exposure to specific effector substances such as insulin.

PI3Ks are divided into three classes. The class I PI3Ks are heterodimeric isoforms each consisting of a 110-kDa catalytic subunit and an adaptor regulator subunit (19). Activated PI3K phosphorylates the D-3 position of the inositol ring of phosphoinositides. The phospholipid product, phosphatidylinositol 3,4,5-trisphosphate, functions as an upstream regulator of the lambda - and zeta -isoforms of protein kinase C (PKClambda and PKCzeta ) and the serine/threonine protein kinase B (PKB/Akt) (1, 21, 23, 32, 35). The participation of active PI3K in metabolic activities can be assessed using specific inhibitors. The class I PI3Ks are primarily involved in signal transduction pathways and are reversibly inhibited by LY-294002. Wortmannin is structurally unrelated to LY-294002 but covalently binds to the catalytic subunit and irreversibly inhibits the enzyme. In the present work, we investigated the regulation of PI3K and its effect on alpha 1(I) collagen mRNA levels. We found that alpha 1(I) collagen mRNA levels in human lung fibroblasts are regulated by a mechanism that is sensitive to PI3K inhibition.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Tissue culture. Human embryonic lung fibroblasts (IMR-90, Institute for Medical Research, Camden, NJ) were grown in Dulbecco's modified Eagle's medium supplemented with 0.37 g sodium bicarbonate/100 ml, 10% (vol/vol) fetal bovine serum (FBS), 100 U penicillin/ml, 10 µg streptomycin/ml, and 0.1 mM nonessential amino acids. After confluence, the serum content of the medium was reduced to 0.4% FBS. Cell numbers were determined by triplicate cell counts with an electronic particle counter (Coulter Counter ZM).

RNA isolation and Northern analysis. Total cellular RNA was isolated by the single-step method employing guanidine thiocyanate-phenol-chloroform extraction, as described by Chomczynski and Sacchi (8). RNA was quantified by absorbance at 260 nm. Purity was determined by absorbance at 280 and 310 nm. RNA (10 µg) was electrophoresed through a 1% agarose-6% formaldehyde gel and transferred to a nylon membrane. RNA loading was assessed by ethidium bromide staining of ribosomal bands and by cohybridization with an oligonucleotide probe containing sequences for the 18S ribosomal fragment or glyceraldehyde 3-phosphate dehydrogenase. Hybridization was performed using 0.5-1.0 × 106 cpm/lane labeled probe (specific activity 4-10 × 108 cpm/µg). The filter was exposed to X-ray film for autoradiography at several different times to ensure that the bands could be quantified by densitometry within the linear range. The connective tissue growth factor (CTGF) probe is a 586-bp PCR product generated with the forward primer gtggagtatgtaccgacggcc and the reverse primer acaggcaggtcagtgagcacgc. The alpha 1(I) collagen probe came from a rat alpha 1(I) collagen cDNA that specifically binds human alpha 1(I) collagen mRNA (14).

Nuclear run-on assay. Confluent, quiescent fibroblasts in 150-mm dishes were washed twice with Puck's saline and scraped into a Nonidet P-40 lysis buffer. After two low-speed spins, the pellet was reconstituted in a glycerol buffer. In vitro labeling of nascent RNA and hybridization with cDNA immobilized on nitrocellulose filters were performed according to the methods reported previously (16, 17).

Western blotting. PAGE was performed under reducing conditions using 7.5% polyacrylamide gels as described elsewhere (20). Samples (100 µg) for SDS-PAGE and Western blotting were prepared from the cell layer of quiescent confluent fibroblasts grown in 100-mm tissue culture dishes. The cell layer was disrupted in RIPA buffer (50 mM HEPES, 150 mM NaCl, 1 mM EDTA, 30 mM NaF, 1% Triton X-100, 1 mM Na3VO4, 10 mM NaP2O7, 1 µg/ml antipain, 1 µg/ml leupeptin, 1 µg/ml pepstatin A) and centrifuged (14,000 g for 10 min) at 4°C. Gels were transferred to nitrocellulose filters (Schleicher & Schuell) and blocked with 10% evaporated milk in phosphate-buffered saline with 0.1% Tween for 2 h at room temperature (20). Anti-Akt and anti-phosphoserine-473 Akt (New England Biolabs) were used according to manufacturer's instructions.

Transfection procedures. A collagen minigene (28) that contains the first five exons and introns joined to the last six exons and introns was used. The original construct also contained -2.4 kb of the 5'-flanking region and 2 kb of the 3'-flanking sequence beyond the second polyadenylation site. The 5'-flanking region (35 bp upstream from the functional ATG) was deleted, but the stem-loop structure was preserved. This clone was ligated into a pcDNA3.1(-) expression vector and transfected into NIH/3T3 cells at 80-90% confluency using Lipofectamine-plus reagent. RNA was isolated, and Northern analysis was performed.

Statistics. A Student's test was used for means of unequal size. P < 0.05 was considered significant.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

A dose-response relation for alpha 1(I) collagen mRNA and LY-294002 for concentrations below and above the EC50 (1.4 µM) was performed to assess the specificity of the interaction. LY-294002 at 1 µM reduced basal alpha 1(I) collagen mRNA levels. At 10 µM, LY-294002 caused a dramatic decrease in alpha 1(I) collagen mRNA. At 25 µM, LY-294002 decreased alpha 1(I) collagen mRNA levels by 86 ± 4% (mean ± SE, n = 4) compared with untreated controls (Fig. 1A). The LY-294002 dose-response relation for suppression of alpha 1(I) collagen mRNA levels was consistent with specific inhibition of PI3K. Similar results were obtained using wortmannin to inhibit PI3K (Fig. 1B). However, the addition of the mitogen-activated protein (MAP) kinase kinase inhibitor PD-98050 did not affect basal alpha 1(I) collagen mRNA levels (data not shown).


View larger version (37K):
[in this window]
[in a new window]
 
Fig. 1.   A: concentration-dependent attenuation of alpha 1(I) collagen mRNA levels. Confluent quiescent fibroblasts were treated for 24 h with various concentrations of LY-294002. Total RNA was isolated, resolved electrophoretically (10 µg), and Northern blotted with probes for alpha 1(I) collagen mRNA and 18S rRNA. Results are representative of 4 independent experiments. B: effect of wortmannin on alpha 1(I) collagen mRNA levels. Confluent quiescent fibroblasts were treated with wortmannin as 1 dose at 25 nM or 2 doses at 12.5 nM each for 24 h. Additional cultures received 25 µM LY-294002. Total RNA was isolated, resolved electrophoretically (10 µg), and Northern blotted with probes for alpha 1(I) collagen mRNA or 18S rRNA.

TGF-beta induces large increases in alpha 1(I) collagen production by fibroblasts in vitro and likely contributes to fibrogenesis in vivo (12). We found that LY-294002 inhibited the TGF-beta -induced increase in alpha 1(I) collagen mRNA formation at 24 h (Fig. 2A). The reduction of basal levels of alpha 1(I) collagen mRNA by LY-294002 was selective. Inhibition of PI3K did not alter basal or TGF-beta -induced levels of CTGF mRNA (Fig. 2B).


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 2.   A: effect of LY-294002 on basal and transforming growth factor-beta (TGF-beta )-induced alpha 1(I) collagen mRNA levels. Confluent quiescent fibroblast cultures were pretreated with 25 µM LY-294002 with or without TGF-beta (1 ng/ml) for 16 h. Total RNA was isolated, resolved electrophoretically (10 µg), and Northern blotted with probes for alpha 1(I) collagen mRNA and 18S rRNA. Results are representative of 2 independent experiments. B: phosphatidylinositol 3-kinase (PI3K) inhibition did not affect expression of connective tissue growth factor (CTGF) mRNA. Confluent quiescent fibroblasts were treated with 25 µM LY-294002 and TGF-beta (1 ng/ml) for 8 h. Total RNA was isolated, resolved electrophoretically (10 µg), and Northern blotted with probes for CTGF mRNA and 18S rRNA. Results are representative of 3 independent experiments.

After inhibition of PI3K with LY-294002, we performed kinetic studies to determine the rate of decline of alpha 1(I) collagen mRNA levels. At 2 h after the addition of LY-294002 (25 µM), a decrease of alpha 1(I) collagen mRNA was evident. After 5 h, the basal alpha 1(I) collagen mRNA level was dramatically reduced, and after 8 h, alpha 1(I) collagen mRNA was barely detectable (Fig. 3).


View larger version (74K):
[in this window]
[in a new window]
 
Fig. 3.   Kinetic studies after PI3K inhibition. Confluent quiescent fibroblasts were treated with 25 µM LY-294002. Total RNA was isolated, resolved electrophoretically (10 µg), and Northern blotted with probes for alpha 1(I) collagen mRNA and 18S rRNA. Results are representative of 3 independent experiments.

To assess recovery after exposure to LY-294002 for 24 h, the cultures were washed free of the inhibitor. LY-294002 binds reversibly to the ATP-binding pocket of the catalytic subunit of PI3K. At 24 h after removal of LY-294002, alpha 1(I) collagen mRNA levels increased and, at 48 h, alpha 1(I) collagen mRNA levels returned to untreated levels (Fig. 4), verifying the viability of the fibroblasts. During recovery, the cultures were maintained in low-serum medium to preclude expansion of the cultures.


View larger version (72K):
[in this window]
[in a new window]
 
Fig. 4.   Recovery of alpha 1(I) collagen mRNA levels after LY-294002 treatment. Confluent quiescent fibroblasts were treated with 25 µM LY-294002 for 16 h, cultures were washed free of the inhibitor, and the medium was replaced with DMEM supplemented with 0.4% FBS for 24 or 48 h. Total RNA was isolated, resolved electrophoretically (10 µg), and Northern blotted with probes for alpha 1(I) collagen mRNA and 18S rRNA. Results are representative of 2 independent experiments.

Cell number was not affected by treatment with LY-294002 (2.39 ± 0.2 × 106 and 2.34 ± 0.1 × 106 cells in untreated and LY-294002-treated cultures, respectively).

The decrease of alpha 1(I) collagen mRNA levels induced by PI3K inhibition was further characterized by inhibiting protein synthesis with cycloheximide (CHX; Fig. 5). Northern blot analyses indicate that CHX alone did not modify alpha 1(I) collagen mRNA levels. The average densitometric results from two experiments indicate that, in fibroblasts treated with LY-294002, the basal level of alpha 1(I) collagen mRNA was reduced by 80% compared with alpha 1(I) collagen mRNA levels of untreated fibroblasts. In fibroblasts treated with the combination of LY-294002 and CHX, the level of alpha 1(I) collagen mRNA was reduced by 48%.


View larger version (76K):
[in this window]
[in a new window]
 
Fig. 5.   Effect of cycloheximide (CHX) on LY-294002-induced decreases of alpha 1(I) collagen mRNA. Confluent quiescent fibroblasts were treated with 25 µM LY-294002 and 5 µM cycloheximide for 16 h. Total RNA was isolated, resolved electrophoretically (10 µg), and Northern blotted with probes for alpha 1(I) collagen mRNA and 18S rRNA. Results are representative of 3 independent experiments.

The effect of decreased PI3K activity on the rate of transcription was assessed by nuclear run-on assays (Fig. 6). Nuclei were isolated from untreated and LY-294002-treated fibroblasts. When the cultures were treated with LY-294002 for 2 or 6 h, there was no change in the rate of transcription of the alpha 1(I) collagen gene. In addition, inhibition of PI3K did not affect transcription of the alpha -subunit of the heterotrimeric G protein Gs. No hybridization occurred in filters containing plasmids without inserts. Similar results were obtained after a more prolonged exposure (16 h) to LY-294002 (data not shown).


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 6.   Rate of transcription of the alpha 1(I) collagen. Confluent quiescent fibroblasts were untreated (control) or treated with 25 µM LY-294002. Nuclei were harvested at 2 and 6 h. Levels of transcription for alpha 1(I) collagen and the G protein subunit alpha s (Gs) genes were determined by nuclear run-on assay.

To assess the stability of the alpha 1(I) collagen mRNA, transcription was blocked with actinomycin D (Fig. 7). Without ongoing transcription, alpha 1(I) collagen mRNA decays with a half-life of 8-12 h (22). To determine the contribution of PI3K activity to the stability of alpha 1(I) collagen mRNA, fibroblasts were treated with LY-294002 for 6 h before transcription was blocked with actinomycin D. In fibroblasts incubated with the combination of LY-294002 and actinomycin D, the rate of decline in the level of alpha 1(I) collagen mRNA was faster at all time points than in fibroblasts incubated with only actinomycin D. Similar results were obtained from three independent experiments. These data suggest that inhibition of PI3K by LY-294002 reduced the stability of the message.


View larger version (66K):
[in this window]
[in a new window]
 
Fig. 7.   Effect of actinomycin D on the steady-state level of alpha 1(I) collagen mRNA. Confluent quiescent fibroblasts were untreated or treated with 25 µM LY-294002 for 6 h. Actinomycin D (5 µM) was then added to the indicated cultures. Total RNA was isolated at the indicated times, resolved electrophoretically (10 µg), and Northern blotted with probes for alpha 1(I) collagen mRNA and 18S rRNA. Results are representative of 3 independent experiments.

After PI3K activation, Akt is phosphorylated and activated (1). To verify inhibition of PI3K activity, PAGE was used to resolve cell lysates, and active Akt was detected by Western blotting using an anti-phosphoserine-473 Akt antibody. Active Akt was detected in untreated quiescent fibroblasts. In fibroblasts treated with 10 or 25 µM LY-294002, the level of active Akt was reduced, confirming that Akt activation requires PI3K activity. Total Akt did not vary in any treatment group, as detected with an anti-Akt antibody (Fig. 8).


View larger version (61K):
[in this window]
[in a new window]
 
Fig. 8.   Phospho-Akt and total Akt levels after treatment with LY-294002. Confluent quiescent fibroblasts were treated with 10 or 25 µM LY-294002 for 16 h. The cell layer was harvested, and 100 µg of total protein were resolved by PAGE. A: blots were probed with an anti-phosphoserine-473 Akt antibody. B: blots were stripped and reprobed with anti-Akt antibody. Results are representative of 2 independent experiments.

To localize the LY-294002-responsive cis-acting element in the alpha 1(I) collagen mRNA, we employed a collagen minigene (28). We deleted the promoter region and most of the 5'-untranslated region (UTR) upstream from the translational start site and ligated the resultant clone into an expression vector driven by a cytomegalovirus promoter. The 5'-stem-loop structure containing the translational start codon was preserved in this truncated minigene. After transfection of the minigene into NIH/3T3 cells, the high level of promoter activity generated a transcript that was detectable by Northern analysis (Fig. 9). Most importantly, the steady-state level of the minigene transcript decreased after LY-294002 treatment.


View larger version (63K):
[in this window]
[in a new window]
 
Fig. 9.   Transfection of alpha 1(I) collagen minigene into NIH/3T3 cells. Subconfluent fibroblasts were transfected with an empty plasmid or a plasmid encoding a truncated minigene. After 24 h, the cultures were left untreated (control) or treated with LY-294002 for an additional 24 h. Total RNA was isolated, resolved electrophoretically (10 µg), and Northern blotted with probes for alpha 1(I) collagen mRNA and 18S rRNA.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

We demonstrated that the steady-state level of alpha 1(I) collagen mRNA was sensitive to inhibition of PI3K by LY-294002. This effect was mediated by a decrease in the stability of the alpha 1(I) collagen mRNA as assessed by treatment with actinomycin D. Using nuclear run-on assays, we found no associated change in the rate of transcription of the alpha 1(I) collagen gene. The decrease in alpha 1(I) collagen mRNA stability was not the result of toxicity, because cell number did not change after LY-294002 treatment and alpha 1(I) collagen mRNA levels completely recovered after removal of the inhibitor. Moreover, the effect of PI3K inhibition on alpha 1(I) collagen mRNA stability was selective, because the steady-state level of CTGF mRNA was not affected.

PI3K likely acts by affecting a specific protein that preferentially regulates the stability of the alpha 1(I) collagen mRNA. However, inhibition of protein synthesis by CHX does not mimic the action of LY-294002. In fact, CHX partially blocked the LY-294002-mediated decrease in alpha 1(I) collagen mRNA. Taken together, the results suggest that PI3K may inhibit the activity of a protein that destabilizes the alpha 1(I) collagen mRNA.

In vivo, the stability of alpha 1(I) collagen mRNA and the rate of transcription of the alpha 1(I) collagen gene are decreased in quiescent cells within tissue and activated by disruption of matrix and exposure to serum or specific effector substances. The process of isolation and subcultivation of otherwise quiescent hepatic stellate cells results in marked increases in alpha 1(I) collagen mRNA expression. This increase in steady-state levels of alpha 1(I) collagen mRNA levels results from small increases in the rate of alpha 1(I) collagen gene transcription that are amplified by marked prolongation of the mRNA half-life (15). These data suggest that alpha 1(I) collagen mRNA stabilization is a major feature of fibrogenic reactions, albeit poorly understood. The phenotypic alterations that accompany the transition from fibroblasts to myofibroblasts are associated with increases in alpha 1(I) collagen mRNA stability. Interestingly, inhibition of PI3K activity prevents the differentiation of a variety of cell types, including preadipocytes and myocytes (3, 36). TGF-beta released during inflammatory reactions affects the stability of the alpha 1(I) collagen mRNA (29). In addition, matrix interactions are likely important, because other mRNA transcripts such as certain integrin subunits are stabilized by exposure to collagen but not fibronectin (38).

Activated fibroblasts derived from patients with scleroderma are characterized by increases in collagen production that are due, in large part, to increases in mRNA stability (11). Many mRNAs are regulated by AU-rich sequences located in the 3'-UTR that promote poly(A) shortening (7, 10). Binding proteins may protect other cis-acting sequences that serve as cleavage sites for endonuclease attack (4). In regard to alpha 1(I) collagen mRNA, several studies have incompletely defined regulatory proteins or domains (31, 33). Overexpression of mutated Ras, but not wild-type Ras, resulted in decreased stability of the alpha 1(I) collagen transcript, but the cis-acting elements mediating this change were not defined (31). A regulatory region in the 3'-region of the alpha 1(I) collagen mRNA transcript was identified in hepatic stellate cells that binds alpha CP2. This protein also binds and stabilizes alpha -globin mRNA (37). The region surrounding the start codon in the alpha 1(I) collagen transcript can form a stem-loop structure that incorporates the translational start site. Stem-loop structures found in other genes such as in the 3'-UTR of the granulocyte colony-stimulating factor are known to regulate stability (6). Stefanovic and associates (34) identified a destabilizing 5'-sequence contained within this stem-loop structure. Interestingly, this sequence is also found in the alpha 2(I) and alpha 1(III) collagen transcripts. However, other investigators, using a somewhat different experimental approach, examined this region and did not find regulatory activity (5). We found that PI3K inhibition decreased the levels of a transfected collagen minigene containing the 5'-stem-loop structure and the 3'-UTR. It is not yet certain whether one or both of these regions are required to mediate the effect of PI3K inhibition on alpha 1(I) collagen mRNA stability.

PI3K signal transduction elements can interact with the MAP kinase system that was reported to affect collagen levels in some cellular systems (2, 13, 18, 27). However, in the human lung fibroblasts used in our studies, we found that the addition of a specific MAP kinase kinase inhibitor did not affect basal collagen accumulation. PI3K signal transduction is mediated in part by activation of Akt. We demonstrated that Akt activation correlates with the change in alpha 1(I) collagen mRNA stability. After activation by PI3K, Akt activates or binds to several transduction systems that may ultimately affect collagen mRNA stability, including PKCepsilon , p21-activated kinase, integrin-linked kinase, telomerase, H2B, 6-phosphofructo-2-kinase, glycogen synthase 3, caspase 3, Rac 1, possibly MEKK3, RSK, and JNK (1, 9). Alternatively, PI3K may act to mediate collagen stability via other pathways that include the direct protein kinase activity of PI3K or the D-3-phosphorylated phosphoinositide-dependent kinases such as PKClambda , PKCepsilon , and PKCzeta (24, 26) acting either directly or indirectly.

We conclude that, in human lung fibroblasts, steady-state levels of alpha 1(I) collagen mRNA are maintained by an LY-294002-sensitive pathway and, specifically, that PI3K activity stabilizes alpha 1(I) collagen mRNA. The exact identity of the putative protein that regulates the stability of alpha 1(I) collagen mRNA remains uncertain. Possible candidates include a protein complex recently demonstrated to bind to a stem-loop structure in the 5'-UTR region of the alpha 1(I) collagen mRNA or alpha CP2, which binds to the 3'-UTR of the alpha 1(I) collagen mRNA (33, 34). The overall level of PI3K activity may determine basal steady-state levels of alpha 1(I) collagen mRNA in fibroblasts in vivo.


    ACKNOWLEDGEMENTS

This work was supported by National Heart, Lung, and Blood Institute Grant P50HL-56386 and the Department of Veterans Affairs Merit Review Research Program.


    FOOTNOTES

Address for reprint requests and other correspondence: D. A. Ricupero, The Pulmonary Center, Rm. 304, Boston University School of Medicine, 80 E. Concord St., Boston, MA 02118 (E-mail: ricupero{at}bu.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 5 October 2000; accepted in final form 1 February 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Alessi, DR, Deak M, Casamajor A, Caudwell FB, Morrice N, Norman DG, Gaffney P, Reese CB, MacDougall CN, Harbison D, Ashworth A, and Bownes M. 3-Phosphadylinositide-dependent protein kinase 1 (PDK1) phosphorylates and activates the p70 S6 kinase in vivo and in vitro. Curr Biol 8: 69-81, 1997.

2.   Amemiya, T, Sasamura H, Mifune M, Kitamura Y, Hirahashi J, Hayashi M, and Saruta T. Vascular endothelial growth factor activates MAP kinase and enhances collagen synthesis in human mesangial cells. Kidney Int 56: 2055-2063, 1999[Web of Science][Medline].

3.   Apostolova, MI, Ivanova IA, and Cherian MG. Signal transduction pathways and nuclear translocation of zinc and metallothionein during differentiation of myoblasts. Biochem Cell Biol 78: 27-37, 2000[Web of Science][Medline].

4.   Binder, R, Howowitz JA, Basilion JP, Koeller DM, Klausner RD, and Harford JB. Evidence that the pathway of transferrin receptor mRNA degradation involves an endonucleolytic cleavage within the 3' UTR and does not involve poly(A) shortening. EMBO J 13: 1969-1980, 1994[Web of Science][Medline].

5.   Bornstein, P, McKay DJ, Devarayalu S, and Cook SC. A highly conserved 5' untranslated, inverted repeat sequence is ineffective on translational control of the alpha 1(I) collagen gene. Nucleic Acids Res 16: 9721-9736, 1988[Abstract/Free Full Text].

6.   Brown, CY, Lagnado CA, and Goodall GJ. A cytokine mRNA-destabilizing element that is structurally and functionally distinct from A + U rich elements. Proc Natl Acad Sci USA 93: 13721-13725, 1996[Abstract/Free Full Text].

7.   Chen, C-Y, Cehn T-M, and Shyu A-B. Interplay of two functionally and structurally distinct domains of the c-fos AU-rich elements specifies its mRNA-destabilizing function. Mol Cell Biol 14: 416-426, 1994[Abstract/Free Full Text].

8.   Chomczynski, P, and Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156-159, 1987[Web of Science][Medline].

9.   Coffer, P, Jin J, and Woodgett JR. Protein kinase B (c-AKT): a multifunctional mediator of phosphatidylinositol 3-kinase activation. Biochem J 335: 1-13, 1998.

10.   Day, DA, and Tuite MF. Post-transcriptional gene regulatory mechanisms in eukaryotes: an overview. J Endocrinol 157: 361-371, 1998[Abstract].

11.   Eckes, B, Mauch C, Huppe G, and Krieg T. Differential regulation of transcription and transcript stability of pro-alpha 1(I) collagen and fibronectin in activated fibroblasts derived from patients with systemic scleroderma. Biochem J 315: 549-554, 1996.

12.   Fine, A, and Goldstein RH. The effect of transforming growth factor-beta on cell proliferation and collagen formation by lung fibroblasts. J Biol Chem 262: 3897-3902, 1987[Abstract/Free Full Text].

13.   Gebken, J, Luders B, Notbohm H, Klein HH, Brinckmann J, Muller PK, and Batge B. Hypergravity stimulates collagen synthesis in human osteoblast-like cells: evidence for the involvement of p44/42 MAP-kinases (ERK 1/2). J Biochem (Tokyo) 126: 676-682, 1999[Abstract/Free Full Text].

14.   Genovese, C, Rowe D, and Kream B. Construction of DNA sequences complementary to rat alpha 1 and alpha 2 collagen mRNA and their use in studying the regulation of type I collagen synthesis by 1,25-dihydroxyvitamin D. Biochemistry 23: 6210-6216, 1984[Medline].

15.   Goldstein, RH. Control of type I collagen formation in the lung. Am J Physiol Lung Cell Mol Physiol 261: L29-L40, 1991[Abstract/Free Full Text].

16.   Greenberg, ME, and Ziff EB. Stimulation of 3T3 cells induces transcription of the c-fos proto-oncogene. Nature 311: 433-438, 1984[Medline].

17.   Groudine, M, Peretz M, and Weintraub H. Transcriptional regulation of hemoglobin switching in chicken embryos. Mol Cell Biol 1: 281-288, 1981[Abstract/Free Full Text].

18.   Hayashida, T, Poncele AC, Hubchak SC, and Schnaper HW. TGF-beta 1 activates MAP kinase in human mesangial cells: a possible role in collagen expression. Kidney Int 56: 1710-1729, 1999[Web of Science][Medline].

19.   Kapeller, R, and Cantley LC. Phosphatidylinositol 3-kinase. Bioassays 16: 565-576, 1994[Web of Science][Medline].

20.   Kim, GY, Besner GE, Steffen CL, McCarthy DW, Downing MT, Luquette MH, Abad MS, and Brigstock DR. Purification of heparin-binding epidermal growth factor-like growth factor from pig uterine luminal flushings and its production by endometrial tissues. Biol Reprod 52: 561-571, 1995[Abstract].

21.   Kotani, K, Ogawa W, Matsumoto M, Kitamura T, Sakaue H, Hino Y, Miyake K, Sano W, Akimoto K, Ohno S, and Kasuga M. Requirement of atypical protein kinase C-lambda for insulin stimulation of glucose uptake but not for AKT activation in 3T3-L1 adipocytes. Mol Cell Biol 18: 6971-6982, 1998[Abstract/Free Full Text].

22.   Krupsky, M, Fine A, Kuang P-P, Berk JL, and Goldstein RH. Regulation of type I collagen production by insulin and transforming growth factor-beta in human lung fibroblasts. Connect Tissue Res 203: 1020-1027, 1996.

23.   Le Good, JA, Ziegler WH, Parekh DB, Alessi DR, Cohen P, and Parker PJ. Protein kinase C isotypes controlled by phosphoinositide 3-kinase through the protein kinase PDK1. Science 281: 2042-2045, 1998[Abstract/Free Full Text].

24.   Liu, Q, Ning W, Dantzer R, Freund GG, and Kelley KW. Activation of protein kinase C-zeta and phosphatidylinositol 3'-kinase and promotion of macrophage differentiation by insulin-like growth factor-I. J Immunol 160: 1393-1401, 1998[Abstract/Free Full Text].

25.   Lucey, EC, Ngo HQ, Agarwal A, Smith BD, Snider GL, and Goldstein RG. Differential expression of elastin and alpha 1(I) collagen mRNA in mice with bleomycin-induced fibrosis. Lab Invest 74: 12-20, 1996[Web of Science][Medline].

26.   Nakanishi, HK, Brewer A, and Exton JH. Activation of the zeta -isozyme of protein kinase C by phosphatidylinositol 3,4,5-trisphosphate. J Biol Chem 268: 13-16, 1993[Abstract/Free Full Text].

27.   Neugarten, J, Medve I, Lei J, and Silbiger SR. Estradiol suppresses mesangial cell type I collagen synthesis via activation of the MAP kinase cascade. Am J Physiol Renal Physiol 277: F875-F881, 1999[Abstract/Free Full Text].

28.   Olsen, AS, Geddis AE, and Prockop DJ. High levels of expression of a minigene version of the human pro-alpha 1(I) collagen gene in stably transfected mouse fibroblasts. Effects of deleting putative regulatory sequences in the first intron. J Biol Chem 266: 1117-1121, 1991[Abstract/Free Full Text].

29.   Penttinen, RP, Kobayashi S, and Bornstein P. Transforming growth factor beta 1 increases mRNA for matrix proteins both in the presence and in the absence of changes in mRNA stability. Proc Natl Acad Sci USA 85: 1105-1108, 1988[Abstract/Free Full Text].

30.   Raghow, R, Lurie S, Seyer JM, and Kang AH. Profiles of steady-state levels of messenger RNAs coding for type I procollagen, elastin, and fibronectin in hamster lungs undergoing bleomycin-induced interstitial pulmonary fibrosis. J Clin Invest 76: 1733-1739, 1985.

31.   Slack, JL, Parker MI, Robinson VR, and Bornstein P. Regulation of collagen I gene expression by ras. Mol Cell Biol 12: 4714-4723, 1992[Abstract/Free Full Text].

32.   Standaert, ML, Galloway L, Karnam P, Bandyopadhyay G, Moscat J, and Farese R. Protein kinase C-zeta as a downstream effector of phsophatidylinositol 3-kinase during stimulation in rat adipocytes. Potential role in glucose transport. J Biol Chem 272: 30075-30082, 1997[Abstract/Free Full Text].

33.   Stefanovic, B, Hellerbrand C, Holcik M, Briendl M, Liebhaber SA, and Brenner DA. Posttranscriptional regulation of collagen alpha 1(I) mRNA in hepatic stellate cells. Mol Cell Biol 17: 5201-5209, 1997[Abstract].

34.   Stefanovic, B, Lindquist J, and Brenner DA. The 5' stem-loop regulates expression of collagen alpha 1(I) mRNA in mouse fibroblasts cultured in a three-dimensional matrix. Nucleic Acids Res 28: 641-647, 2000[Abstract/Free Full Text].

35.   Stokoe, D, Stephens LR, Copeland T, Gaffney PR, Reese CB, Painter GF, Holmes AB, McCormick F, and Hawkins PT. Dual role of phosphatidylinosintol-3,4,4-triphosphate in the activation of protein kinase B. Science 277: 567-570, 1997[Abstract/Free Full Text].

36.   Usui, I, Haruta T, Iwata M, Takano A, Uno T, Kawahara J, Ueno E, Sasaoka T, and Kobayashi M. Retinoblastoma protein phosphorylation via PI 3-kinase and mTOR pathway regulates adipocyte differentiation. Biochem Biophys Res Commun 275: 115-120, 2000[Web of Science][Medline].

37.   Wang, X, Kiledjian M, Weiss IM, and Liebhaber SA. Detection and characterization of a 3' untranslated region ribonucleoprotein complex associated with human alpha -globin mRNA stability. Mol Cell Biol 15: 1769-1777, 1995[Abstract].

38.   Xu, J, and Clark R. Extracellular matrix alters PDGF regulation of fibroblast integrins. J Cell Biol 132: 239-249, 1996[Abstract/Free Full Text].


Am J Physiol Cell Physiol 281(1):C99-C105
0363-6143/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
Y. Zhang, D. Bhatia, H. Xia, V. Castranova, X. Shi, and F. Chen
Nucleolin links to arsenic-induced stabilization of GADD45{alpha} mRNA
Nucleic Acids Res., January 18, 2006; 34(2): 485 - 495.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
M. K. Ko and E. P. Kay
Regulatory Role of FGF-2 on Type I Collagen Expression during Endothelial Mesenchymal Transformation
Invest. Ophthalmol. Vis. Sci., December 1, 2005; 46(12): 4495 - 4503.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
J. C. Krepinsky, Y. Li, Y. Chang, L. Liu, F. Peng, D. Wu, D. Tang, J. Scholey, and A. J. Ingram
Akt Mediates Mechanical Strain-Induced Collagen Production by Mesangial Cells
J. Am. Soc. Nephrol., June 1, 2005; 16(6): 1661 - 1672.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
X. Zhou, J. B. Trudeau, K. J. Schoonover, J. I. Lundin, S. M. Barnes, M. J. Cundall, and S. E. Wenzel
Interleukin-13 augments transforming growth factor-{beta}1-induced tissue inhibitor of metalloproteinase-1 expression in primary human airway fibroblasts
Am J Physiol Cell Physiol, February 1, 2005; 288(2): C435 - C442.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Taguchi, T. Kondo, M. Watanabe, M. Miyaji, H. Umehara, Y. Kozutsumi, and T. Okazaki
Interleukin-2-induced survival of natural killer (NK) cells involving phosphatidylinositol-3 kinase-dependent reduction of ceramide through acid sphingomyelinase, sphingomyelin synthase, and glucosylceramide synthase
Blood, November 15, 2004; 104(10): 3285 - 3293.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Asano, H. Ihn, K. Yamane, M. Jinnin, Y. Mimura, and K. Tamaki
Phosphatidylinositol 3-Kinase Is Involved in {alpha}2(I) Collagen Gene Expression in Normal and Scleroderma Fibroblasts
J. Immunol., June 1, 2004; 172(11): 7123 - 7135.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
N. Tsybouleva, L. Zhang, S. Chen, R. Patel, S. Lutucuta, S. Nemoto, G. DeFreitas, M. Entman, B. A. Carabello, R. Roberts, et al.
Aldosterone, Through Novel Signaling Proteins, Is a Fundamental Molecular Bridge Between the Genetic Defect and the Cardiac Phenotype of Hypertrophic Cardiomyopathy
Circulation, March 16, 2004; 109(10): 1284 - 1291.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. E. Runyan, H. W. Schnaper, and A.-C. Poncelet
The Phosphatidylinositol 3-Kinase/Akt Pathway Enhances Smad3-stimulated Mesangial Cell Collagen I Expression in Response to Transforming Growth Factor-{beta}1
J. Biol. Chem., January 23, 2004; 279(4): 2632 - 2639.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (23)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ricupero, D. A.
Right arrow Articles by Goldstein, R. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ricupero, D. A.
Right arrow Articles by Goldstein, R. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online