|
|
||||||||
Department of Physiology and Biophysics, University of Iowa, Iowa City, Iowa 52242
| |
ABSTRACT |
|---|
|
|
|---|
The large-conductance Ca2+-activated voltage-dependent K+ channel (maxi-K channel) induces a significant repolarizing current that buffers cell excitability. This channel can derive its diversity by alternative splicing of its transcript-producing isoforms that differ in their sensitivity to voltage and intracellular Ca2+. We have identified a novel 132-bp exon of the maxi-K channel from human myometrial cells that encodes 44 amino acids within the first intracellular loop of the channel protein. Distribution analysis reveals that this exon is expressed predominantly in human smooth muscle tissues with the highest abundance in the uterus and aorta and resembles the previously reported distribution of the total maxi-K channel transcript. Single-channel K+ current measurements in fibroblasts transfected with the maxi-K channel containing this novel 132-bp exon demonstrate that the presence of this insert attenuates the sensitivity to voltage and intracellular Ca2+. Alternative splicing to introduce this 132-bp exon into the maxi-K channel may elicit another mode to modulate cell excitability.
potassium channel; calcium activated; splice varient; myometrium
| |
INTRODUCTION |
|---|
|
|
|---|
THE
LARGE-CONDUCTANCE Ca2+-activated voltage-dependent
K+ channel (maxi-K channel) functions to provide a potent
repolarizing current in multiple cell types. The maxi-K channel
possesses various mechanisms to regulate cell excitability. Recently,
the role of auxiliary
-subunits in modulating maxi-K channel
function has been explored (2, 12), and at least one
subunit,
1, which is abundant in smooth muscle tissues,
is known to increase the sensitivity of the channel to voltage and
intracellular Ca2+ (10, 11, 20). A second
mechanism to modulate maxi-K channel behavior is alternative splicing
of the channel transcript to produce various protein isoforms that
differ in their sensitivity to voltage, intracellular Ca2+
levels, and potential susceptibility to posttranslational modification (1, 7, 21). Multiple splice variants of the maxi-K channel are present in humans (4, 21); however, the tissue
distribution of the isoforms and their ability to regulate cell
excitability are currently unknown. Multimeric association of maxi-K
channel isoforms produced by differential splicing with varied
sensitivities to regulators allows for fine tuning of cell excitability
in various tissue types (9, 18). In addition, splicing may
underlie differences in posttranslational modification of maxi-K
channels via phosphorylation by endogenous protein kinases, which, in
turn, alters channel behavior (5, 23).
We have identified a novel 132-bp alternatively spliced exon of the
maxi-K channel. Its transcript is prevalent in human smooth muscle
tissues, similar to that reported for the maxi-K channel. The 132-bp
exon encodes a 44-amino acid segment that is introduced into the first
intracellular loop of the channel. Channels that contain this exon,
when heterologously expressed in mouse Ltk
fibroblasts,
elicit a current similar to the maxi-K channel current but possess a
diminished sensitivity to increasing concentrations of intracellular
Ca2+ and depolarizing voltages. These studies indicate that
the novel exon within the maxi-K channel modulates channel function and may be a regulator of cell excitability.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Tissue collection. Human myometrial tissue from the lower uterine segment was collected from patients undergoing elective or emergency cesarean section under spinal anesthesia at 31-32 and 38-40 wk of gestation either in the presence or absence of spontaneous or induced labor contractions. All patients signed written consent approved by Internal Review Board 199809066. Tissue was placed in Hanks' balanced salt solution or phosphate-buffered saline on ice and used for culturing within 1-3 h after collection.
Cell isolation and culturing. Freshly isolated human myometrial tissue was disaggregated with 1 mg/ml of collagenase (type 1; Worthington Biochemicals) at 37°C with mild agitation for 1 h. Partially digested explants were plated in DMEM/F-12 medium supplemented with 5% fetal bovine serum, 4 ng/ml basic fibroblast growth factor (Sigma), 1 ng/ml epithelial growth factor (Sigma), 50 µg/ml gentamicin (GIBCO BRL), and 5 µg/ml fungizone (GIBCO BRL) and grown in a humidified incubator with 5% CO2 at 37°C for 2 days until smooth muscle cell outgrowth was observed. At that point, the explants were removed, and adherent cells were trypsinized, plated in fresh dishes, and grown for two additional days in the medium described above (fungizone removed) until they reached 70-80% confluency, at which point they were used experimentally.
Total RNA isolation, RT-PCR, and Southern blotting.
Total RNA from cell cultures was isolated by the guanidinium
isothiocyanate method, ethanol precipitated, and resuspended in 10 mM
Tris and 1 mM EDTA, pH 6.5. The concentrations were determined by
spectrophotometry at a wavelength of 260 nm. Total RNA was reverse
transcribed using random primers (ProStar First Strand RT-PCR kit;
Stratagene), and cDNA was PCR amplified using primers flanking human
Slo (hSlo) bp 1-351 of the coding region (forward: 5'
ATGGATGCGCTCATCATC, reverse: 5' ACAACCAGGACTCTGCCAGT). The PCR
products were visualized with ethidium bromide on 1% agarose gels. The
gels were denatured in 1.5 M NaCl/0.5 M NaOH solution, neutralized in 1 M Tris/1.5 M NaCl solution (pH 8.0), and transferred to nitrocellulose
by capillary action. After transfer, the blots were hybridized in
QuickHyb solution (Stratagene) with a radiolabeled cDNA probe (Prime-It
II kit; Stratagene). The probe was designed to recognize bp 1-351
of hSlo. Autoradiography was performed at
90°C overnight. To
prepare for sequencing, the band representing an ~500-bp fragment was
gel purified (QIAEX II Gel Extraction kit; Qiagen), ligated into the
pCRII vector, and transformed into INV
F' cells (TA cloning kit;
Invitrogen). The DNA was then sequenced and analyzed. The accession
number of 132-bp exon is AF349445.
3' RACE PCR. Human myometrial total RNA was reverse transcribed using oligo(dT) primers (ProStar First Strand RT-PCR kit; Stratagene). The subsequent cDNA was PCR amplified with the forward primer 5' GGGAGGAAACCAAGACTC (nt 1-18 of the 132-bp exon) and an oligo(dT) reverse primer (Stratagene). The PCR product obtained was amplified using the forward primer 5' GGGATTCGTATGTTTCACCTG (nt 38-51 of the 132-bp exon) and the same oligo(dT) reverse primer. The resultant DNA was separated on a 1% agarose gel, visualized by ethidium bromide, and transferred to nitrocellulose, and the blot was hybridized with a 5'-end radiolabeled cDNA probe (Klenow Fill-in kit; Stratagene) for bp 38-132 of the 132-bp exon. Bands identified by autoradiography were subsequently gel purified, subcloned, and sequenced.
Chromosomal localization. Genomic DNA from National Institute of General Medical Sciences human/rodent cell hybrid mapping panel no. 1 (BIOSMAP somatic cell hybrid PCRable DNAs, BIOS Labs) was used for PCR amplification of the 132-bp exon, with primers flanking the exon (Southern blotting method) as previously described (3). PCR samples were separated on a 1% agarose gel, and the banding pattern was recorded and analyzed.
Tissue distribution analysis.
A human Multiple Tissue Expression (MTE) array (Clontech) was
hybridized according to the manufacturer's instructions with a
radiolabeled cDNA probe (Prime-It II kit; Stratagene) against the
132-bp exon (1.0 × 106 counts per minute/ml).
Autoradiography was performed at
90°C in the presence of an
intensifying screen for 72 h. Transcript expression levels were
assessed by dot densitometry (LabWorks 3.0; UVP) and normalized
to the dot with the most intense signal.
In vitro expression and electrophysiological characterization.
The 132-bp exon-containing and -lacking forms of the hSlo
-subunit
cDNA were isolated from human myometrial cDNA by PCR with the forward
primer 5' TTGCGGCCGCATGGATGCGCTCATC and the reverse primer
5' GGTCTAGATCAAAGCCGCTCTTCC. The insertless hSlo
sequence found in myometrium corresponded to a previously described
clone (13). The resulting PCR fragments were digested with
NotI and XbaI (sites within primers underlined)
and subcloned into the pTracer-CMV2 plasmid (Invitrogen).
Ltk
mouse fibroblasts grown to 50-80% confluency in
60-mm dishes in DMEM supplemented with 10% horse serum and 0.1%
penicillin and streptomycin or 50 µg/ml of gentamicin were
transfected with 10 µg of construct DNA (Lipofectamine Plus reagent
kit; GIBCO) and incubated one to three additional days. Cells
expressing green fluorescent protein (pTracer-CMV2 plasmid
reporter gene) were used for patch clamping.
fibroblasts were placed in a pH 7.2 bath solution
containing (in mM) 145 KCl, 1 MgCl2, 10 HEPES, and 1 EGTA.
The bath solution was supplemented with the appropriate amount of
CaCl2 to produce free Ca2+ concentrations of
~10
7, 10
6, and 10
5 M, based
on a free intracellular Ca2+ concentration
([Ca2+]) estimation program (17).
Borosilicate glass pipettes of 8-20 M
were filled with a pH 7.2 solution containing (in mM) 145 KCl, 2 CaCl2, 1 MgCl2, and 5 HEPES. High-resistance inside-out patch seals
(3-30 G
) were achieved for single-channel measurements. Constant membrane potentials at 20-mV increments from
60 mV up to as
high as +160 mV were applied to membrane patches in the three different
Ca2+ concentrations for up to 1 min using an AxoPatch 200B
voltage-current amplifier. The elicited currents were recorded using
pCLAMP 6.0 software (Axon Instruments). The open state was defined as
50% of the single-channel current level. The number of open events was
measured using the Fetchan program of pCLAMP 6.0. These data were
analyzed relative to the total number of open levels seen at maximal
stimulation using the pStat program within pCLAMP 6.0 to determine the
open-state probability of a patch at each potential and
Ca2+ concentration. Half-activation potential
(V1/2) values were determined
only from those patches that were raised as nearly as possible to
maximally stimulating potentials. These values ranged between +100 and
+160 mV, since voltages higher than this altered seal integrity. The
currents were fit to normalized Boltzmann curves using Origin 6.0 software, and the potentials at which half-maximal activation was
achieved, based on the Boltzmann curves, were taken as the
V1/2 values. The
V1/2 was not determined for hSlo
containing the 132-bp exon in 10
7 M Ca2+
because the channels could not be opened at +160 mV at this
concentration. Additionally, at high potentials at 10
5 M
Ca2+, many cells containing the hSlo lacking the 132-bp
exon exhibited significant rundown at high potentials, and thus
V1/2 values were determined from those
cells that did not strongly demonstrate this effect.
Statistical analyses. Graphical results are displayed as means ± SE. Statistical significance of differences of means was evaluated by a two-tailed Student's t-test for unpaired observations. Differences were considered significant at P < 0.05.
| |
RESULTS |
|---|
|
|
|---|
To identify the splice variants of the maxi-K channel in human
myometrial cells, first-strand cDNA from primary cell cultures was PCR
amplified using primers that flank the previously described splice site
A (13, 16, 21). The expected 351-bp insertless variant
(Fig. 1A, open arrow)
was evident consistently, as was a second fragment of ~500 bp (Fig.
1A, closed arrow). Southern blot analysis was used to
demonstrate that the 351-bp probe could hybridize to the ~500-bp band
(Fig. 1B, closed arrow), suggesting that the larger band
represents either an alternative transcript of the hSlo mRNA or a
transcript from a homologous gene. To identify this band, the fragment
was purified, subcloned, and sequenced. Sequence analysis indicated
that a portion of this fragment represents a novel 132-bp exon located
between bp 183 and 184 of a previously reported human maxi-K channel
coding region (13). Recovery of the nucleotide sequence
downstream from the insert by 3' RACE PCR confirmed that this insert is
a novel exon within the human maxi-K channel. Chromosomal localization
using a somatic cell hybrid mapping panel proved that the exon is
localized to human chromosome 10 (data not shown), similar to the gene
encoding the human maxi-K channel (21), but the exon was
not detected in either control mouse or hamster genomic DNA by PCR.
|
The amino acids encoded by the 132-bp exon are located in the first
intracellular loop of the maxi-K channel (Fig.
2). Analysis of the deduced amino acid
sequence of the exon revealed an abundance of hydrophilic residues. A
motif search indicated that the exon introduces four potential
consensus sites for posttranslational modification within the first
intracellular loop: two CK2 phosphorylation sites, one myristylation
site, and one amidation site (Fig. 2). The amidation site is a
combination of three amino acids that are within the insert and the
residue immediately 5' of the novel exon.
|
To determine the distribution of the exon among human tissues, a
commercially available MTE array blot of poly(A)+ RNA
derived from multiple human tissues was hybridized with a radiolabeled
probe against the 132-bp exon sequence. Our results are largely
consistent with what is currently known about tissue and organ
distribution of the maxi-K channel. The exon was most abundant in
smooth muscle-containing and lymphoid organs, in skeletal muscle, and
throughout the central nervous system but was absent in the heart (Fig.
3A). The uterus (closed arrow)
and aorta (open arrow) presented the strongest signals by densitometry,
but signals were also prevalent in other smooth muscle-containing
organs that were present on the blot. In addition, this transcript was
very prevalent in liver (A9). Densitometric quantitation of the entire blot was performed to determine the distribution of the 132-bp exon
transcript (Fig. 3B). The 132-bp exon transcript expression demonstrates a similar pattern to that reported for the maxi-K channel,
with a greater abundance of the transcript in smooth muscle-containing
organs. However, significant differences are apparent in the
preferential expression of the 132-bp exon transcript in liver (A9) and
salivary gland (E9), which has not been reported for the maxi-K
channel.
|
To determine the single-channel properties of the exon-containing
isoform of this channel, inside-out patch recordings were performed
from heterologously expressed channels. At +40 mV membrane potential,
an outward current of large amplitude was measured in Ltk
cells transfected with either hSlo or hSlo containing the exon (hSlo+132). Initial observations suggested that when patches containing equal numbers of detectable channels were compared, hSlo+132 currents showed a lower open-state probability than channels lacking the novel
exon (Fig. 4A). The
single-channel conductance was similar in the absence (241 ± 3.0 pS) or presence of the exon (243 ± 3.0 pS, Fig. 4B).
The exon-containing channel demonstrated a much lower open-state
probability at any given Ca2+ concentration. At
10
7 M Ca2+, hSlo+132 channel opening was not
detectable up to voltages of +160 mV, while hSlo lacking the exon could
be measured at potentials greater than +80 mV. At higher
[Ca2+] of 10
6 and 10
5 M, the
exon-containing channel isoform demonstrated a much lower open-state
probability (Fig. 4C). V1/2,
as determined from a Boltzmann curve, was shifted to the right by ~50
mV in 10
6 M Ca2+ (from ~83 to ~137 mV),
indicating a greatly reduced Ca2+ sensitivity in the 132-bp
exon-containing isoform (Fig. 4D). In addition, at
10
5 M Ca2+, the
V1/2 of the channels showed a similar
trend (~59 to ~97 mV); however, significant channel rundown and
seal integrity at this concentration decreased the number of cells that
could be measured, which prevented obtaining statistical significance.
|
| |
DISCUSSION |
|---|
|
|
|---|
The maxi-K channel is believed to provide a potent repolarizing current to attenuate cell excitability and thereby temper smooth muscle contractility and neuronal firing. Regulation of this channel occurs via multiple mechanisms, including posttranslational modification (14) and alternative splicing, to introduce novel exons that can modulate intracellular regulation, and, consequently, channel function. We have isolated a novel splice variant of the maxi-K channel containing a 132-bp exon that encodes for an additional 44 amino acids into the first intracellular domain of the channel. This is the second splice site identified within the NH2-terminal portion of the maxi-K channel (13, 16, 21). Most of the currently known splice sites are confined to the COOH-terminal intracellular "tail" region (21). This novel exon possesses similar characteristics to the COOH-terminal inserts, such as the ability to modulate channel responses to voltage and Ca2+.
The amino acid composition encoded by the 132-bp exon suggests that it
is a functionally active part of the channel protein. The two potential
CK2 consensus sites, which may allow protein phosphorylation
independent of cyclic nucleotides or intracellular Ca2+,
could produce variability in posttranslational modifications in the
first intracellular loop and thus a differential effect on the
channel's function, as it does for other channels (8). The addition of a myristylation site may facilitate membrane targeting and/or membrane assembly of the maxi-K channel protein
(15). It is possible that this channel is alternatively
targeted to, or away from, the plasma membrane to alter cellular
excitability by changing the number of functional channels. The
potential significance of an amidation site in this protein is
difficult to surmise. The effect of amidation on ion channels has been
studied in relation to the ClC-2G Cl
channel, where it
causes a significant increase in the open channel probability
(19). Whether the novel 132-bp exon-containing maxi-K channel could alter biological activity of a K+ channel
protein by posttranslational processing is unknown, but it is an
interesting question to address.
The location of the novel exon within the first intracellular loop
indicates that other regions within the channel protein besides the
COOH-terminal region may be able to alter the maxi-K channel's
sensitivity to intracellular Ca2+ and voltage. Our
single-channel data indicate that the channel containing this exon is
less sensitive to Ca2+ and voltage. Conformational changes
in the maxi-K channel may alter
1 binding
(22); however, experiments to coexpress
- and
-subunits have not yet been performed to assess this point. Our
findings also may result from an interaction of the first intracellular
loop with the COOH-terminal domain (6). The addition of 44 amino acids may allow for interactions between other domains such as
the S4-S5 domains to alter voltage sensing (6). An additional possibility is that intracellular signaling pathways present
in our heterologous expression system affect maxi-K channel activity.
Further studies could address interacting domains important for channel
function, since maxi-K channel isoforms that contain this 132-bp exon
likely form heteromeric channels with isoforms that do not include this
novel exon. This will help explain the differences in the sensitivity
of this channel to voltage and intracellular Ca2+ in
various tissues.
The abundance of the 132-bp exon transcript may indicate the functional significance of this particular isoform in different organs. While transcript levels of the 132-bp exon are prevalent in smooth muscle similar to the entire maxi-K channel, other tissues also contain this isoform. The preferential use of this exon in liver and salivary glands is interesting and may indicate an important function in these tissues. Heterologous expression system studies demonstrate that the novel exon alters the maxi-K channel by conferring a lower sensitivity to changes in voltage and intracellular Ca2+. Therefore, on the basis of electrophysiological data, the function of isoforms containing this novel exon may be to provide a repolarizing current following strong depolarization or intracellular Ca2+ release. The presence of this exon may also modulate the voltage and Ca2+ sensitivity of other isoforms with which it is associated.
It is clear that the 132-bp exon discovered in the human myometrium represents a novel splice variant of the maxi-K channel. Insertion of this exon into the hSlo transcript 3' of nt 183 places 44 additional amino acids in the first intracellular loop of the channel. To date, this is the second splice variant described near the NH2 terminus. Upon stimulation, it generates currents similar to those of the exon-lacking isoform of the maxi-K channel; however, this channel is less sensitive to voltage and intracellular Ca2+. The 132-bp exon-containing isoform is found predominantly in smooth muscle-containing organs and liver, with the highest levels of expression in smooth muscle tissues, similar to the whole channel. The tissue expression pattern may indicate a functional significance of the exon for these organs. Thus it is possible that this splice variant is subject to regulation by local and/or systemic factors.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Nancy A. Benkusky for critical review of the manuscript.
| |
FOOTNOTES |
|---|
This work was supported in part by National Institute of Child Health and Human Development Grant HD-37831 (to S. K. England), National Science Foundation Grant IBN 98-19339 (to S. K. England), and National Institute of Diabetes and Digestive and Kidney Diseases Postdoctoral Training Grant Fellowship DK-07759 (to V. P. Korovkina). Reagents and facilities to conduct a portion of these studies were provided by the Diabetes and Endocrinology Research Center at the University of Iowa (DK-25295).
Address for reprint requests and other correspondence: S. K. England, Dept. of Physiology and Biophysics, 5-660 Bowen Science Bldg., Univ. of Iowa, Iowa City, IA 52242 (E-mail: sarah-england{at}uiowa.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 28 November 2000; accepted in final form 20 February 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Adelman, JP,
Shen KZ,
Kavanaugh MP,
Warren RA,
Wu YN,
Lagrutta A,
Bond CT,
and
North RA.
Calcium-activated potassium channels expressed from complementary DNAs.
Neuron
9:
209-216,
1992[Web of Science][Medline].
2.
Brenner, R,
Jegla TJ,
Wickenden A,
Liu Y,
and
Aldrich RW.
Cloning and functional characterization of novel large conductance calcium-activated potassium channel beta subunits, hKCNMB3 and hKCNMB4.
J Biol Chem
275:
6453-6461,
2000
3.
England, SK,
Uebele VN,
Shear H,
Kodali J,
Bennett PB,
and
Tamkun MM.
Characterization of a voltage-gated K+ channel beta subunit expressed in human heart.
Proc Natl Acad Sci USA
92:
6309-6313,
1995
4.
Ferrer, J,
Wasson J,
Salkoff L,
and
Permutt MA.
Cloning of human pancreatic islet large conductance Ca2+ activated K+ channel (hSlo) cDNAs: evidence for high levels of expression in pancreatic islets and identification of a flanking genetic marker.
Diabetologia
39:
891-898,
1996[Web of Science][Medline].
5.
Hall, SK,
and
Armstrong DL.
Conditional and unconditional inhibition of calcium-activated potassium channels by reversible protein phosphorylation.
J Biol Chem
275:
3749-3754,
2000
6.
Jones, E,
Gray-Keller M,
and
Fettiplace R.
The role of Ca2+ activated K+ channel spliced variants in the tonotopic organization of the turtle cochlea.
J Physiol
518:
653-665,
1999
7.
Lagrutta, A,
Shen KZ,
North RA,
and
Adelman JP.
Functional differences among alternatively spliced variants of Slowpoke, a Drosophila calcium-activated potassium channel.
J Biol Chem
269:
20347-20351,
1994
8.
Lieberman, DN,
and
Mody I.
Casein kinase-II regulates NMDA channel function in hippocampal neurons.
Nat Neurosci
2:
125-132,
1999[Web of Science][Medline].
9.
McCobb, DP,
Fowler NL,
Featherstone T,
Lingle CJ,
Saito M,
Krause JE,
and
Salkoff L.
A human calcium-activated potassium channel gene expressed in vascular smooth muscle.
Am J Physiol Heart Circ Physiol
269:
H767-H777,
1995
10.
McManus, OB,
Helms LMH,
Pallanck L,
Ganetzky B,
Swanson R,
and
Leonard RJ.
Functional role of the
subunit of high conductance calcium-activated potassium channels.
Neuron
14:
645-650,
1995[Web of Science][Medline].
11.
Meera, P,
Wallner M,
Jiang Z,
and
Toro L.
A calcium switch for the functional coupling between hslo and
subunits (KV,Ca
) of maxi K channels.
FEBS Lett
382:
84-88,
1996[Web of Science][Medline].
12.
Meera, P,
Wallner M,
and
Toro L.
A neuronal
subunit (KCNMB4) makes the large conductance, voltage- and Ca2+-activated K+ channel resistant to charybdotoxin and iberiotoxin.
Proc Natl Acad Sci USA
97:
5562-5567,
2000
13.
Pallanck, L,
and
Ganetzky B.
Cloning and characterization of human and mouse homologs of the Drosophila calcium-activated potassium channel gene, slowpoke.
Hum Mol Genet
3:
1239-1243,
1994
14.
Perez, G,
and
Toro L.
Differential modulation of large-conductance KCa channels by PKA in pregnant and nonpregnant myometrium.
Am J Physiol Cell Physiol
266:
C1459-C1463,
1994
15.
Raju, RV,
Kakkar R,
Radhi JM,
and
Sharma RK.
Biological significance of phosphorylation and myristoylation in the regulation of cardiac muscle proteins.
Mol Cell Biochem
176:
135-143,
1997[Web of Science][Medline].
16.
Rosenblatt, KP,
Sun ZP,
Heller S,
and
Hudspeth AJ.
Distribution of Ca2+-activated K+ channel isoforms along the tonotopic gradient of the chicken's cochlea.
Neuron
19:
1061-1075,
1997[Web of Science][Medline].
17.
Schoenmakers TJ, Visser GJ, Flik G, and Theuvenet AP. Chelator: an
improved method for computing metal ion concentrations in physiological
solutions. Biotechniques 12: 870-874, 876-879,
1992.
18.
Shipston, MJ,
Duncan RR,
Clark AG,
Antoni FA,
and
Tian L.
Molecular components of large conductance calcium-activated potassium (BK) channels in mouse pituitary corticotropes.
Mol Endocrinol
13:
1727-1737,
1999.
19.
Stroffekova, K,
Kupert EY,
Malinowska DH,
and
Cuppoletti J.
Identification of the pH sensor and activation by chemical modification of the ClC-2G Cl
channel.
Am J Physiol Cell Physiol
275:
C1113-C1123,
1998
20.
Tanaka, Y,
Meera P,
Song M,
Knaus HG,
and
Toro L.
Molecular constituents of maxi KCa channels in human coronary smooth muscle: predominant
+
subunit complexes.
J Physiol
502:
545-557,
1997
21.
Tseng-Crank, J,
Foster CD,
Krause JD,
Mertz R,
Godinot N,
DiChiara TJ,
and
Reinhart PH.
Cloning, expression, and distribution of functionally distinct Ca2+-activated K+ channel isoforms from human brain.
Neuron
13:
1315-1330,
1994[Web of Science][Medline].
22.
Wallner, M,
Meera P,
and
Toro L.
Determinant for beta-subunit regulation in high-conductance voltage-activated and Ca2+-sensitive K+ channels: an additional transmembrane region at the N terminus.
Proc Natl Acad Sci USA
93:
14922-14927,
1996
23.
Wellman, GC,
Bonev AD,
Nelson MT,
and
Brayden JE.
Gender differences in coronary artery diameter involve estrogen, nitric oxide, and Ca2+-dependent K+ channels.
Circ Res
79:
1024-1030,
1996
This article has been cited by other articles:
![]() |
V. P. Korovkina, S. J. Stamnes, A. M. Brainard, and S. K. England Nardilysin convertase regulates the function of the maxi-K channel isoform mK44 in human myometrium Am J Physiol Cell Physiol, March 1, 2009; 296(3): C433 - C440. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. P. Korovkina, A. M. Brainard, and S. K. England Translocation of an endoproteolytically cleaved maxi-K channel isoform: mechanisms to induce human myometrial cell repolarization J. Physiol., June 1, 2006; 573(2): 329 - 341. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. G. Moczydlowski The maxi K+ channel of human myometrium reveals a split personality J. Physiol., June 1, 2006; 573(2): 286 - 286. [Full Text] [PDF] |
||||
![]() |
B. M. Sanborn, C.-Y. Ku, S. Shlykov, and L. Babich Molecular Signaling Through G-Protein-Coupled Receptors and the Control of Intracellular Calcium in Myometrium Reproductive Sciences, October 1, 2005; 12(7): 479 - 487. [Abstract] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |