Am J Physiol Cell Physiol Journal of Applied Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 281: C33-C45, 2001;
0363-6143/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhao, R.
Right arrow Articles by Reithmeier, R. A. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhao, R.
Right arrow Articles by Reithmeier, R. A. F.
Vol. 281, Issue 1, C33-C45, July 2001

Expression and characterization of the anion transporter homologue YNL275w in Saccharomyces cerevisiae

Rongmin Zhao and Reinhart A. F. Reithmeier

Canadian Institutes of Health Research Group in Membrane Biology, Department of Medicine, University of Toronto, Toronto, Ontario, Canada M5S 1A8


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

A search of the yeast Saccharomyces cerevisiae genome has revealed an open reading frame, YNL275w, which encodes a 576-amino acid protein that shows sequence similarity to the family of mammalian Cl-/HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> anion exchangers and Na+/HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> cotransporters. This yeast protein also has a very similar hydropathy profile to the mammalian HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> transporters, indicating a similar membrane topology and structure. A V5 epitope and His6-tagged version of Ynl275wp was expressed in yeast and was localized to the plasma membrane by subcellular fractionation and immunofluorescence labeling. The protein was purified by nickel affinity chromatography and was found not to be N-glycosylated. The protein's mobility on SDS-PAGE gels was not altered by treatment with N-glycanase F, alpha -mannosidase, or by mutation of each of the five consensus N-glycosylation sites. The protein did not bind to concanavalin A by lectin blotting or lectin affinity chromatography. The expressed protein bound specifically to a stilbene disulfonate inhibitor resin (SITS-Affi-Gel), and this binding could be competed by certain anions (HCO<UP><SUB>3</SUB><SUP>−</SUP></UP>, Cl-, NO<UP><SUB>3</SUB><SUP>−</SUP></UP>, and I-) but not by others (SO<UP><SUB>4</SUB><SUP>2−</SUP></UP> and PO<UP><SUB>4</SUB><SUP>3−</SUP></UP>). These results suggest that the yeast gene YNL275w encodes a nonglycosylated anion transport protein, localized to the plasma membrane.

band 3; carbonic anhydrase; genomics; topology


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

BICARBONATE (HCO<UP><SUB>3</SUB><SUP>−</SUP></UP>) transporters exist widely in vertebrate species and include mainly three classes, Cl-/HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> anion exchangers, Na+-dependent Cl-/HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> anion exchangers, and Na+/HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> cotransporters (NBCs). These membrane proteins function to transport HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> across the plasma membrane and in the maintenance of intracellular pH. The erythrocyte anion exchanger 1 (AE1) band 3 is the best-characterized member of the HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> transporter superfamily (39). Band 3 is a glycoprotein that contains a membrane domain responsible for transport function and a cytosolic domain that serves to anchor the cytoskeleton and bind other cytosolic proteins. The N-linked carbohydrate is not essential for the anion transport function (5) but may help the protein to exhibit optimal transport activity (12). The membrane domain of band 3 has the full HCO<UP><SUB>3</SUB><SUP>−</SUP></UP>/Cl- exchanger function (11), and the transport processes can be specifically inhibited by stilbene disulfonate inhibitors (4). The NBCs are electrogenic, Na+-dependent HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> transporters. The corresponding genes or cDNAs for NBCs have been cloned from salamander (43), rat (42), mouse (1), bovine (51), and different human tissues, including NBC1 from kidney (3) and pancreas (1), NBC2 from retina (13), NBC3 from muscles (37), and NBC4 from heart (38). Although NBCs were originally revealed as electrogenic, some isoforms were recently identified from human muscle (NBC3) (37) and rat muscle (7) as electroneutral. The deduced amino acid sequences of NBCs show a high degree of similarity to anion exchangers. Recently, new members of the HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> transporter superfamily, the Na+-driven anion exchanger (NDAE) from Drosophila (44), and Na+-driven Cl-/HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> exchanger (NCBE) from mouse (53), have also been identified.

Homologous sequences of HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> transporters have been identified in a variety of species. The completion of the budding yeast Saccharomyces cerevisiae genome sequence revealed an open reading frame, YNL275w, which showed some sequence identity to band 3 (28). The yeast cell does not seem to require the anion exchanger/carbonic anhydrase system to help the release of metabolic CO2 because CO2 can diffuse directly out of yeast cells. In fact, S. cerevisiae also has an open reading frame (YNL036w) showing high sequence identity to prokaryotic and eukaryotic carbonic anhydrase. However, no significant anhydrase activity was detected for this protein, which was shown to function in oxidative stress resistance (10). YNL275w might have other functions other than a Cl-/HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> exchanger. Band 3 itself can also bind and transport other anions, such as SO<UP><SUB>4</SUB><SUP>2−</SUP></UP>, PO<UP><SUB>4</SUB><SUP>3−</SUP></UP>, and I- (32), and even acts as a lipid flippase (19, 31). The disruption of YNL275w in yeast cells did not show any phenotype under normal growth condition or nonpermissive conditions, such as low (15°C) or high (37°C) temperature. The mRNA level of YNL275w was extremely low and not regulated by certain stress conditions, such as nitrogen starvation (8a). This does not rule out the possibility of an essential function of YNL275w for yeast growth or survival under other conditions.

In this study, we overexpressed and characterized a six-histidine (His6)-tagged Ynl275wp protein in yeast. The His6-tagged Ynl275wp was localized to the plasma membrane and was shown to be a nonglycosylated protein capable of binding a set of anions. The anion-binding properties of Ynl275wp were similar to that of human AE1, and anion binding could be specifically blocked with stilbene disulfonate inhibitors. Future studies of the structure and function of this yeast anion transporter will provide valuable information of relevance to its human homologues.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Materials. Yeast nitrogen base was purchased from Difco. Amino acids used for supplements and tunicamycin were purchased from Sigma. Chemiluminescent developer reagent was purchased from Roche Molecular Biochemicals. ProBond resin for affinity purification of His6-tagged protein and anti-V5 epitope (-GKPIPNPLLGLDST-) (49) antibody were purchased from Invitrogen. n-Dodecyl beta -D-maltoside (DDM) was purchased from Anatrace (Maumee, OH). Rhodamine Red-X goat anti-mouse IgG (H+L) conjugate, monoclonal antibody against yeast Vma2p, 4,4'-dibenzamidostilbene-2,2'-sulfonic acid (DBDS), and 4,4'-diisothiocyanodihydrostilbene-2,2'-disulfonic acid (H2DIDS) were from Molecular Probes. 4,4'-Dinitrostilbene-2,2'-disulfonic acid (DNDS) was from Aldrich. 4-Benzamido-4'-aminostilbene-2,2'-disulfonic acid (BADS) was synthesized according to Kotaki et al. (20). QuickChange site-directed mutagenesis kit was purchased from Stratagene. N-glycanase F, alpha 1-2, 3 mannosidase, horseradish peroxidase goat anti-mouse IgG (H+L) conjugate, and horseradish peroxidase goat anti-rabbit IgG (H+L) conjugate were purchased from New England BioLabs. Fluorescence goat anti-rabbit IgG (H+L) conjugate was purchased from Zymed. Biotinylated concanavalin A was a product of Vector Laboratories. Trypsin was from Worthington Biochemicals. Oligonucleotides were synthesized by ACGT (Toronto, Ontario, Canada). All other chemicals were from commercial sources. Rabbit anti-yeast Pma1p antibody was a gift of Dr. David Perlin (Public Health Institute, New York, NY). Rabbit anti-yeast Vph1p antibody was a gift of Dr. Morris Manolson (Faculty of Dentistry, Univ. of Toronto).

Plasmids and constructions. Multicopy 2µ plasmid pYES/G2-YNL275 (designated as pYES275) containing the YNL275w open reading frame under the control of GAL1 promoter was obtained from Invitrogen (cat. no. YNL275WY). The plasmid contains URA3 selectable marker. Ynl275wp contains an additional 33-amino acid COOH terminus, which includes the paramyxovirus SV5 V5 epitope and His6 tag for detection and purification, respectively. To determine the N-glycosylation status of the expressed Ynl275wp, the five potential N-linked glycosylation sites N-X-S/T were each changed to D-X-S/T by single nucleotide mutation with Stratagene QuickChange site-directed mutagenesis kit according to the supplied instruction manual. The codons of Asn located at 3, 152, 163, 349, and 483 positions were mutated to Asp with the following oligos and their corresponding antisense oligos: N3D: CAGCTGACCACCATGTCGGATGAGAGCACACGAGTTACC, N152D: GCCCCATCTCTATTTTTGATTATACGGTCTACG, N163D: GAAATTATAAAGCCTTTGGATACCAGCTATTTTGGC, N349D: GTTTTACTTTGATCATGACGTATCGTCGCTAATGG, and N483D: CCTAACAGAAGAGATGATACTTCACCTTTAATG, respectively (the mutated Asp codons are underlined). The point mutations in the plasmid were confirmed by DNA sequencing with T7 sequencing kit (Pharmacia Biotech) using the chain-terminating method (46).

Yeast strains and culture conditions. S. cerevisiae strain Invsci (MATa/MATalpha , his3Delta 1, leu2, trp1-289, and ura3-52) was obtained from Invitrogen (cat. no. C810-00). Yeast strain Inv275 was constructed by transforming Invsci with plasmid pYES275. Both Invsci and Inv275 were grown on synthetic minimal medium (SD) supplemented with 24 mg/l histidine, 72 mg/l leucine, 48 mg/l tryptophan, and 2% dextrose. For growing Invsci, 24 mg/l of uracil was additionally supplied. To induce the expression of Ynl275wp, the yeast cells were first grown on medium that contained 2% dextrose to midlog phase [optical density (OD) 600 ~1.0]. The cells were spun down, washed once with distilled water, and then cultured in medium containing 2% galactose for an additional 16 h.

Preparation of crude membrane, plasma membrane, and vacuolar membrane vesicles. Yeast cells were resuspended by adding 1.5 ml/g of fresh weight (FW) solution [250 mM sorbitol, 1 mM MgCl2, 50 mM imidazole, pH 7.5, 1 mM phenylmethylsulfonyl fluoride (PMSF), 5 mM dithiothreitol, and a protease inhibitor cocktail (leupeptin, aprotinin, antipain, pepstatin, and chymostatin at 2 µg/ml per inhibitor)]. The cells were broken in a 2-ml tube in the presence of 1.5-g glass beads/g FW with a Biospeed minibead beater at 4°C for 4 × 100 s. The crude and plasma membranes were prepared from the homogenate as described by Morsomme et al. (27).

To prepare vacuolar membrane vesicles, the cells were collected and spheroplasted as described by Roberts et al. (40). Spheroplasts were homogenated in a Dounce homogenizer. After the cell debris was removed with centrifugation at 3,500 g for 15 min, the membranes were pelleted at 100,000 g for 35 min, resuspended, and applied to one-step 10-30% sucrose gradient centrifugation at 100,000 g for 2 h. The vacuole vesicles at the 10-30% interface were collected, washed, and pelleted at 100,000 g for 35 min and then resuspended in 10 mM imidazole, pH 7.5, and 1 mM MgCl2. Protein quantitation in crude membrane, plasma membrane, and vacuole vesicles was performed according to Bradford (2).

Purification of His-tagged Ynl275wp. To purify the histidine-tagged Ynl275wp, the crude membranes were initially suspended in TN20 solution [20 mM imidazole, pH 7.5, 1 mM MgCl2, 150 mM NaCl, 20% (vol/vol) glycerol, and the protease inhibitor cocktail (described earlier)]. The crude membranes were solubilized with DDM at a ratio of 1 mg of protein:2 mg of DDM for 30 min on ice and then spun for 10 min at 50,000 g to remove the insoluble material. The solubilized proteins were applied to Probond Sepharose, equilibrated with TN20 (1 ml of matrix/20 mg of protein), and incubated for 1 h on a rotary wheel at 4°C. The matrix was then loaded into a column and washed with 10× matrix volume of TN20 supplemented with 0.1% DDM. Bound proteins were then eluted with twice the matrix volume of TN250 (250 mM imidazole, pH 7.5, 1 mM MgCl2, 150 mM NaCl, and 0.1% DDM).

Immunofluorescence microscopy. Immunofluorescence microscopy was essentially performed as described by Pringle et al. (36) with the following slight modifications. After the cell wall was removed with zymolase, the formaldehyde-fixed spheroplasted cells were resuspended in 1 ml of 2% SDS in 1.2 M sorbitol for 5 min to permeabilize the membranes, followed by 2 × 1 ml-gentle washes in 1.2 M sorbitol. Instead of using a multiwell slide, a normal frosted microscope slide (VWR, Canada) was used. The permeabilized cells (10 µl) were added to the polylysine-coated slide and allowed to settle down for 5 min, immediately followed by blocking with PBS containing 1 mg/ml of BSA for 20 min and incubation with primary antibody and secondary antibody in PBS containing 1 mg/ml of BSA. Anti-V5, anti-Vph1p, and anti-Pma1p were used at dilutions 1:200, 1:50, and 1:50, respectively. Secondary antibodies of Rhodamine Red-X goat anti-mouse IgG (H+L) conjugate and fluorescence goat anti-rabbit IgG (H+L) conjugate were used at 1:100 and 1:50, respectively. To keep the moisture of the slide, the slide was put into a petri dish with a piece of water-saturated Whatman paper. After incubation with the primary antibody or the secondary antibody, the slide was washed five times, each wash for 5 min with PBS containing 1 mg/ml of BSA. After the final washing step, the slide was mounted with 90% glycerol, 1 mg/ml p-phenylenediamine, and 0.1× PBS, pH 9.0. The slide was stored at -20°C or observed immediately with an LSM410 invert laser scan microscope (Carl Zeiss, Germany).

SDS-PAGE and immunoblotting. Proteins were separated by SDS-PAGE (21), transferred to a nitrocellulose membrane, and detected by immunoblotting. The primary anti-V5 antibody and the secondary antibody horseradish peroxidase goat anti-mouse IgG (H+L) conjugate were both used at dilution 1:10,000. The blot was developed by chemiluminescence and exposed to X-ray film.

Inhibitor-affinity chromatography. SITS-Affi-Gel was prepared by coupling 4-acetamido-4'-isothiocyanostilbene-2,2'-disulfonic acid (SITS) to Affi-Gel 102 resin in NaHCO3 solution as described by Pimplikar and Reithmeier (33). Purified His6-tagged Ynl275wp (0.1 µg) was diluted into 50 µl of binding solution consisting of 0.1% DDM and 250 mM sodium citrate, pH 7.1, and added to 20 µl of SITS-Affi-Gel equilibrated with binding solution in an Eppendorf tube. After a 15-min incubation in a rotary wheel at 4°C, the Eppendorf tube was spun for 30 s, and 30 µl of supernatant was saved as the unbound fraction. The beads were rapidly washed three times each with 400 µl of binding solution. The protein bound to the beads was released in 100 µl of Laemmli sample buffer at room temperature. Both bound and unbound fractions were subjected to SDS-PAGE and immunoblotting. The relative ratio of binding protein was obtained by scanning and analyzing the signals with the program NIH Image 1.60. To test the inhibitory effect of anions or anion exchanger inhibitors, the anions and anion exchanger inhibitors were included in the binding solution. To test the specificity of SITS-Affi-Gel binding, Affi-Gel 102 without coupling SITS was used as control in binding assay. When the inhibitory effect of HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> was tested, the pH of binding buffer was adjusted to 8.3. To test the pH effect on SITS-Affi-Gel binding, instead of 250 mM sodium citrate, 50 mM each of citrate, 2-(N-morpholino)ethanesulfonic acid, 3-(N-morpholino)propanesulfonic acid, Tris [tris(hydroxymethyl)aminomethane], and 2-(N-cyclohexylamino)ethanesulfonic acid were used as binding buffer, and pH was adjusted with KOH.

Concanavalin A-Sepharose binding. The concanavalin A-Sepharose binding assay was performed with purified His6-tagged Ynl275wp protein in buffer containing 20 mM Tris · HCl, pH 7.4, and 500 mM NaCl with 1% detergent as indicated, essentially as described by Popov et al. (35).

Enzymatic deglycosylation. Purified His6-tagged Ynl275wp or crude membrane proteins, solubilized in 0.1% DDM, were treated with 12,500 U/ml of N-glycanase F or 200 U/ml of alpha 1-2, 3 mannosidase at 37°C for 1 h. The reaction mixtures were added with an equal volume of 2× Laemmli sample buffer and separated by SDS-PAGE.

Tryptic digestion. The Inv275 yeast cells were induced with 2% galactose for 12 h and spheroplasted with the same procedure as used for immunofluorescence but without fixation. The spheroplasts were suspended in 100 mM potassium phosphate, pH 7.5, containing 1.2 M sorbitol. Spheroplasts (100 µl, containing 40 µg total proteins) were digested with trypsin (up to 1.0 mg/ml) at 30°C for 30 min. The reactions were terminated by addition of PMSF at a final concentration of 10 mM and washing once with 600 µl of 100 mM potassium phosphate, pH 7.5, and 1.2 M sorbitol. The spheroplasts were immediately solubilized with 100 µl of Laemmli sample buffer. To digest solubilized proteins, spheroplasts (40 µg total proteins) were solubilized with 0.5% DDM in 1× PBS, and the solubilized proteins were digested with trypsin (up to 2.0 µg/ml) on ice for 15 min. The reactions were terminated by addition of PMSF at a final concentration of 10 mM, followed by the immediate addition of an equal volume of 2× Laemmli sample buffer.

Treatment with tunicamycin. Inv275 yeast cells were grown in 2 ml of SD medium supplemented with 2% glucose until OD 600 reached 1.0. The cells were collected and suspended in 2 ml of SD medium that contained 2% galactose to induce expression of His6-tagged Ynl275wp. After either 0 or 12 h, tunicamycin was added at a final concentration of 10 µg/ml. The cells were harvested at 14 h, spheroplasted, and solubilized in 200 µl of 2× Laemmli sample buffer. The total proteins (10 µl) were resolved on 10% SDS-PAGE gel and immunoblotted with anti-V5 antibody.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

S. cerevisiae YNL275w is a member of the HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> transporter gene superfamily. The HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> transporter superfamily in vertebrates includes anion exchangers and NBCs. These transporters consist of two domains, an NH2-terminal cytosolic domain and a COOH-terminal membrane domain. The membrane domain itself has the full transport function. The yeast open reading frame YNL275w encodes a hydrophobic 576-amino acid protein. The Ynl275wp sequence matched the membrane domain of the human AE1 and human NBC1 when aligned but did not contain a large cytosolic domain (Fig. 1A). The NH2-terminal hydrophilic sequence of Ynl275wp is only 83 amino acids long. The identity between Ynl275wp and HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> transporters is not as high as that between the HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> transporters themselves in vertebrates. The amino acids identity (similarity) of Ynl275wp to AE1 and NBC1 is 26% (47%) and 25% (41%), respectively, using match length of 524 amino acids for AE1 and 577 amino acids for NBC1, whereas the identity between anion exchangers and NBCs is 30-35%. However, the hydropathy profiles of Ynl275wp and AE1 are very similar (Fig. 1B). This indicates that Ynl275wp and HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> transporters in higher organisms likely evolved from a common ancestor and might have a similar structure and physiological function (25). Based on the model of the topology of the known anion exchanger, AE1 (35), and their similar hydropathy profiles, we propose that Ynl275wp spans the membrane 12 times, as shown in Fig. 1C. Ynl275wp has five potential N-linked glycosylation sites located as Asn-3, -152, -163, -349, and -483. None of these sites corresponds to the N-glycosylation site in human AE1, which was located at Asn-642. According to the model, the sites are either located within putative transmembrane (TM) segments, close to the membrane, or in cytosolic loops, suggesting that Ynl275wp may not be N-glycosylated (22, 29, 35).



View larger version (111K):
[in this window]
[in a new window]
 
Fig. 1.   Sequence alignment of Ynl275wp with bicarbonate transporters, hydropathy plots, and the predicted folding model of Ynl275wp. A: sequence alignment of Ynl275wp with human anion exchanger AE1 and human Na+/HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> cotransporter NBC1. For AE1 and NBC1, only those sequences aligned with Ynl275wp are shown. The alignment was performed by CLUSTAL W method from Pôle Bio-Informatique Lyonnais web server (http://pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=npsa_clustalw.html) and adjusted manually, Identical residues; :, strongly similar residues; ·, weakly similar residues. The 12 putative transmembrane domains (TM1-TM12) are indicated by rectangular boxes. , 5 N-glycosylation acceptor sites (N-X-S/T). B: comparison of the hydropathy profiles of Ynl275wp and the membrane domain of human anion exchanger AE1. The profiles were generated by Kyte-Doolittle hydrophilicity method (match allowing gaps) from Protein Hydrophilicity/Hydrophobicity Search and Comparison Server (http://bioinformatics.weizmann.ac.il/hydroph/cmp_hydph.html). The dark line represents the profile of Ynl275wp. The light line represents the profile of AE1. The dark and light bars below the graph represent the gaps in Ynl275wp and human AE1 profiles, respectively. The positions of corresponding amino acids were numbered and shown at the bottom. C: predicted folding model of Ynl275wp. The full-length endogenous Ynl275wp is composed of 576 amino acids and is predicted to span the membrane 12 times. The additional 33 COOH-terminal amino acids indicated with bold letters inside bold circles contain the six-histidine (His6) tag and V5 epitope designed for purification and detection. Both NH2 and COOH termini are cytosolically localized. The 5 N-linked glycosylation acceptor sites are indicated with underlined numbers (3, 152, 163, 349, and 483). Some of the potential tryptic cleavage sites (lysines and arginines) in the second and third extracellular and the fifth intracellular loops are indicated by arrows and labeled with the letter T. The numbers in the parentheses indicate the molecular masses in kilodaltons of the COOH-terminal fragments from the cleavage sites. EC, extracellular side; IC, intracellular side of plasma membrane.

Expression and purification of His6-tagged Ynl275wp. To facilitate the detection and purification of Ynl275wp, we chose the construct pYES275 for protein expression, in which the wild-type YNL275w sequence was fused to an epitope sequence (V5) from V protein of paramyxovirus SV5 and a His6 tag at the COOH terminus. The 33 additional COOH-terminal amino acid sequence, including the V5 epitope and His6 tag, is shown in Fig. 1C. After induction with galactose, the yeast cells harboring pYES275 expressed an immunoreactive protein band at apparent molecular mass 62 kDa on SDS-PAGE gel (Fig. 2, A and B). A small amount of immunoreactive protein was detected at molecular mass ~120 kDa, as shown in Fig. 2B, suggesting the presence of dimers. No immunoreactive protein was detected in untransformed yeast cells. However, under these conditions, the expressed Ynl275wp was not readily visible in crude membrane fractions on SDS-PAGE gel when stained with Coomassie blue. Ynl275wp could be observed by Coomassie blue staining after enrichment by affinity purification with nickel Sepharose column (Fig. 2A). The results suggest that Ynl275wp was not expressed at a high level in transformed yeast cells (~100 µg/l of culture), although the multiple copy 2µ plasmid and the strong GAL1 promoter were used for expression.


View larger version (56K):
[in this window]
[in a new window]
 
Fig. 2.   Purification and detection of His6-tagged Ynl275wp. Crude membranes from galactose-induced Invsci (untransformed wild-type yeast strain) and Inv275 (Invsci transformed with multicopy plasmid pYES275) cells were solubilized with n-dodecyl beta -D-maltoside (DDM) and applied to a nickel resin column. The total crude membrane proteins (T, 40 µg of protein), flowthrough (F, 40 µg of protein), and eluant (E, 2 µg of protein) were resolved by SDS-PAGE, and His6-tagged Ynl275wp was detected by Coomassie blue staining (A) and immunoblotting with anti-V5 antibody (B). MW, prestained molecular mass markers. The solid arrow indicates the monomer of His6-tagged Ynl275wp, and the open arrow indicates the dimer of His6-tagged Ynl275wp.

His6-tagged Ynl275wp cosedimented with the membrane fraction and was hardly detected in the soluble protein fraction (data not shown), implying that Ynl275wp is an integral membrane protein. To determine the subcellular localization of Ynl275wp, the plasma membrane and vacuole membrane vesicles were purified. Figure 3 shows that the enrichment of His6-tagged Ynl275wp followed the pattern of plasma membrane H+-ATPase (Pma1p) but not of the vacuole H+-ATPase subunit Vph1p, indicating that the expressed Ynl275wp was targeted to the plasma membrane.


View larger version (62K):
[in this window]
[in a new window]
 
Fig. 3.   His6-tagged Ynl275wp copurifies with plasma membrane Pma1p. Crude membranes (C), plasma membranes (P), and vacuole vesicle proteins (V; 5 µg protein total) purified from galactose-induced Inv275 cells were solubilized, resolved by SDS-PAGE, and immunoblotted with antibodies against yeast vacuole Vph1p (A), yeast plasma membrane Pma1p (B), and V5 epitope (C).

The plasma membrane localization of Ynl275wp was further confirmed by immunofluorescence. Plasma membrane and vacuole membrane H+-ATPases were detected in both wild-type and transformed yeast cells using specific antibodies. The antibody against V5 epitope only detected immunoreactive protein in transformed cells but not in untransformed Invsci cells (data not shown). In galactose-induced Inv275 cells, Ynl275wp was localized to the plasma membrane (Fig. 4, B and E), where the plasma membrane marker H+-ATPase was well visualized (Fig. 4F), and its location was clearly different from that of the vacuole membrane marker Vph1p (Fig. 4C). However, if the yeast spheroplasts were immunolabeled without permeabilization with SDS, no signal could be detected with anti-V5 antibody (data not shown). This suggests a cytosolic location of the COOH terminus of Ynl275wp in agreement with the folding model in Fig. 1C.


View larger version (105K):
[in this window]
[in a new window]
 
Fig. 4.   Immunolocalization of His6-tagged Ynl275wp in yeast. Inv275 cells were induced with galactose, fixed, spheroplasted, and double stained with anti-V5 antibody and either anti-Vph1p (A-C) or anti-Pma1p (D-F) antibody. Rhodamine-conjugated secondary antibody was used against anti-V5 antibody. FITC-conjugated secondary antibody was used against anti-Pma1p and anti-Vph1p antibodies. A and D are contrast images, B and E are confocal images visualizing rhodamine from anti-V5 antibody-treated cells, C is confocal image visualizing FITC from anti-Vph1p antibody-treated cells, and F is confocal image visualizing FITC from anti-Pma1p antibody-treated cells.

The His6-tagged Ynl275wp was not glycosylated when expressed in yeast. In eukaryotic cells, plasma membrane proteins are synthesized and targeted through the secretory pathway. The modification of translated protein occurs in endoplasmic reticulum and Golgi by N-glycosylation if appropriate glycosylation acceptor sites (N-X-S/T) exist. The carbohydrates in glycoproteins, especially those targeted to plasma membrane, play important roles during biosynthesis and also at the cell surface. To determine whether His6-tagged Ynl275wp was N-glycosylated, crude membrane protein or purified Ynl275wp were treated with N-glycanase F. The results show that none of these treatments altered the mobility of Ynl275wp on SDS-PAGE gel (Fig. 5A). Similar treatment of erythrocyte ghost membrane proteins with N-glycanase F showed a clear mobility shift of band 3, indicating that the carbohydrate attached to band 3 was cleaved (data not shown). To determine whether His6-tagged Ynl275wp contained significant alpha 1-2 or alpha 1-3 high mannose, Ynl275wp was treated with alpha -mannosidase. The treatment did not alter the mobility of Ynl275wp on SDS-PAGE gel, either (Fig. 5A). To rule out the possibility that the sugar was too small for a change in mobility to be observed on normal SDS-PAGE gel, concanavalin A lectin-shift gel, according to Popov et al. (34), was performed, and no change in mobility could be detected (data not shown).


View larger version (47K):
[in this window]
[in a new window]
 
Fig. 5.   Determination of glycosylation status of His6-tagged Ynl275wp. A: crude membrane proteins (5 µg of protein) from galactose-induced Inv275 and purified His6-tagged Ynl275wp (0.2 µg of protein) were treated with 12,500 U/ml N-glycanase F (F) or 200 U/ml alpha -mannosidase (M), resolved by SDS-PAGE (10%), and immunoblotted with anti-V5 antibody. C, control without enzymatic treatment. B: immunodetection of His6-tagged Ynl275wp with mutated N-linked glycosylation sites. Invsci cells were transformed with pYES275 mutant plasmids, each of which had 1 of 5 potential N-linked glycosylation sites mutated. Mutant Ynl275wp was prepared and purified with nickel resin, resolved by SDS-PAGE (10%), and immunoblotted with anti-V5 antibody. Wildtype, wild-type Ynl275wp. N3D, N152D, N163D, N349D, and N483D represent Ynl275wp mutants, which had asparagine substituted by aspartic acid in each of 5 consensus N-glycosylation sites. C: immunodetection of His6-tagged Ynl275wp from yeast cells treated with tunicamycin. Inv275 yeast cells were induced for expression of His6-tagged Ynl275wp for 14 h with or without tunicamycin. The cells were collected, spheroplasted, and the same volume of total proteins was resolved on 10% SDS-PAGE gel and immunoblotted with anti-V5 antibody. C14h, control cells with treatment without tunicamycin; T14h, cells with treatment of tunicamycin for 14 h; T2h, cells with treatment of tunicamycin for 2 h before harvest.

Removal of the potential glycosylation sites by site-directed mutagenesis was also performed. The mutant proteins, each of which had one of the five N-glycosylation sites mutated, showed identical mobility to nonmutated protein on both normal SDS-PAGE (Fig. 5B) and lectin-shift gel (data not shown). Furthermore, application of tunicamycin, which is an inhibitor of UDP-N-acetylglucosamine:dolichyl-phosphate N-acetylglucosamine-1-phosphate transferase and widely used to block glycosylation, did not prevent the synthesis or alter the mobility of His6-tagged Ynl275wp (Fig. 5C).

Additionally, because in S. cerevisiae the glycoproteins are composed extensively of mannose, we used the lectin concanavalin A to examine the glycosylation status of Ynl275wp by concanavalin A blotting and concanavalin A-Sepharose binding. Concanavalin A blotting did not detect any signal of N-linked glycosylation site mutated or nonmutated form of purified Ynl275wp (data not shown). Three different detergent solutions were used for the concanavalin A-Sepharose binding assay. In Triton X-100 and C12E8 solution, concanavalin A did not bind His6-tagged Ynl275wp. In DDM solution, concanavalin A bound a small amount of His6-tagged Ynl275wp (Fig. 6). However, this might be an artifact because DDM contains a maltoside group, which may in micellar form interact weakly with concanavalin A. Together, all of the above results show that His6-tagged Ynl275wp is a nonglycosylated protein when expressed in yeast cells.


View larger version (71K):
[in this window]
[in a new window]
 
Fig. 6.   Concanavalin A-Sepharose-binding assay. Purified Ynl275wp was incubated with concanavalin A-Sepharose for 1 h in a 50-µl buffer (20 mM Tris · HCl, pH 7.4, 500 mM NaCl, 1 mM MgCl2, 1 mM CaCl2, and 1 mM MnCl2). DDM, Triton X-100, or C12E8 (at 1% each) were used to solubilize the protein. The supernatant after centrifugation was saved as the unbound fraction (U). The resin was washed 3 times with the above buffers with 0.1% detergents and then eluted with 100 µl of sample buffer as bound fraction (B). Unbound and bound proteins were applied to SDS-PAGE and immunoblotted with anti-V5 antibody.

Tryptic digestion of His6-tagged Ynl275wp. Proteolytic digestion of intact erythrocytes has been used to directly determine the topology of band 3 (16, 30, 50) since only extracellular sensitive sites can be cleaved. To determine whether His6-tagged Ynl275wp had similar extracellular protease-sensitive sites, galactose-induced Inv275 cells were spheroplasted and digested with trypsin. With an increase of the trypsin concentration to as much as 5 mg/ml, low amounts of a fragment at apparent molecular mass 37 kDa, immunoreactive to anti-V5 antibody, appeared (Fig. 7B). Under the digestion conditions, the intracellular vacuolar ATPase subunit Vma2p, which is very sensitive to small amounts of trypsin (23), was not cleaved by trypsin (Fig. 7C), suggesting that the spheroplasts were kept intact. Higher concentrations of trypsin (>5 mg/ml) destroyed the spheroplasts and were not applicable. This result indicates that a trypsin-sensitive site, ~37 kDa away from the COOH terminus, is located in the extracellular domain of Ynl275wp. A similar-sized fragment can be generated from band 3 by chymotrypsin (50) or trypsin (16) treatment of intact erythrocyte. These sites are located in the third extracellular loop of band 3 (17, 26). Considering that the molecular mass determined by SDS-PAGE is not very precise, the trypsin-sensitive site that produces a 37-kDa COOH-terminal fragment cannot be determined exactly. Potential external trypsin cleavage sites are located in the third extracellular loop of Ynl275wp (Fig. 1C).


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 7.   Tryptic digestion of intact and solubilized yeast spheroplasts. Galactose-induced Inv275 intact spheroplasts (B and C) and 0.5% DDM-solubilized spheroplast proteins (A) were digested with trypsin as described in MATERIALS AND METHODS. Samples were resolved by 15% SDS-PAGE and immunoblotted with anti-V5 antibody (A and B) or anti-Vma2p (C) antibody. M1, M2, and M3 are molecular mass markers and aligned with A, B, and C. M1 and M2 are prestained markers. The bands of M1 ran at molecular masses of 22, 25.8, 35.2, 49.5, 82, and 120 kDa; M2 are 6, 16, 22, 36, 50, 64, and 98 kDa; and M3 are 6.5, 14.3, 20.0, 26.6, 36.5, 42.7, 55.6, and 66.4 kDa. The lowest molecular mass band is underlined and indicated by an open arrow in each lane. Open arrows in A and B indicate protein of intact His6-tagged Ynl275wp; solid arrows indicate the proteolytic fragments at 37 and 14 kDa. Open arrow in C represents Vma2p.

His6-tagged Ynl275wp was more trypsin sensitive after solubilization of the spheroplasts with detergent. When limited tryptic digestion was applied to DDM-solubilized spheroplast proteins in addition to the 37-kDa COOH-terminal fragment, a broad band containing multiple low-molecular-mass bands ~14 kDa also appeared (Fig. 7A). It is likely that the trypsin-sensitive sites ~14 kDa from the COOH terminus are located in an intracellular domain and cannot be reached by trypsin from intact spheroplasts, thus supporting the topology model concerning the fifth intracellular loop close to the COOH terminus as shown in Fig. 1C.

Anion-binding properties of Ynl275wp. The human anion exchanger binds and transports anions such as Cl-, HCO<UP><SUB>3</SUB><SUP>−</SUP></UP>, Br-, I-, SO<UP><SUB>4</SUB><SUP>2−</SUP></UP>, and PO<UP><SUB>4</SUB><SUP>3−</SUP></UP> and also binds stilbene disulfonate inhibitors (32). Pimplikar and Reithmeier (33) developed a stilbene disulfonate affinity resin, SITS-Affi-Gel, in which SITS was covalently coupled to Affi-Gel 102 to bind band 3. The binding of band 3 to SITS-Affi-Gel was reversible at 4°C, and band 3 could be eluted with free stilbene disulfonate such as BADS (33). To better understand the structural and functional properties of Ynl275wp, we also applied SITS-Affi-Gel to His6-tagged Ynl275wp. To rule out potential influence of other proteins on binding, the nickel column-purified His6-tagged Ynl275wp was used. As shown in Fig. 8, when His6-tagged Ynl275wp was incubated with this SITS-Affi-Gel in sodium citrate buffer, the gel could quantitatively bind His6-tagged Ynl275wp. Without SITS coupling, the Affi-Gel itself did not bind any His6-tagged Ynl275wp (control in Fig. 8), showing the specificity of binding to SITS. The specific binding was further confirmed by the fact that the SITS-Affi-Gel binding of His6-tagged Ynl275wp was inhibited by noncovalent inhibitors, DBDS, BADS, and DNDS, or the covalent inhibitor, H2DIDS (Fig. 8). Binding assays in the presence of increasing concentrations of H2DIDS indicated that H2DIDS showed a half-maximal inhibition of the SITS-Affi-Gel binding of His6-tagged Ynl275wp at a concentration of 8.3 µM (Table 1). Noncovalent inhibitors BADS, DBDS, and DNDS showed half-maximal inhibition of SITS-Affi-Gel binding at concentrations of ~200, 400, and >500 µM, respectively (Table 1). These results suggested that Ynl275wp might be another stilbene disulfonate-sensitive member of the HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> transporter superfamily.


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 8.   SITS-Affi-Gel binding assay. Purified Ynl275wp was incubated with a 50-µl binding solution (250 mM sodium citrate, pH 7.1, and 0.1% DDM) in the absence or presence of 500 mM HCO<UP><SUB>3</SUB><SUP>−</SUP></UP>, Cl-, I-, NO<UP><SUB>3</SUB><SUP>−</SUP></UP>, SO<UP><SUB>4</SUB><SUP>2−</SUP></UP>, PO<UP><SUB>4</SUB><SUP>3−</SUP></UP>, 1 mM 4,4'-diisothiocyanodihydrostilbene-2,2'-disulfonic acid (H2DIDS), 4,4'-dinitrostilbene-2,2'-disulfonic acid (DNDS), 4,4'-dibenzamidostilbene-2,2'-sulfonic acid (DBDS), or 0.4 mM 4-benzamido-4'-aminostilbene-2,2'-disulfonic acid (BADS) before addition to SITS-Affi-Gel. When HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> was included, the pH of binding buffer was adjusted to 8.3. After incubation with SITS-Affi-Gel for 15 min at 4°C, the supernatant after centrifugation was saved as unbound fraction. The resin was washed 3 times with binding buffer and then eluted with 100 µl of SDS sample buffer as bound fraction. Unbound and bound proteins were applied to SDS-PAGE and immunoblotted with anti-V5 antibody. For control, Affi-Gel 102 was used instead of SITS-Affi-Gel.


                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Inhibitory constants of SITS-Affi-Gel binding of His6-tagged Ynl275wp

The binding of Ynl275wp to SITS-Affi-Gel was also tested at different pH values. The results indicate that the binding to SITS-Affi-Gel was not significantly affected by pH from pH 3.0 to pH 8.0 (Fig. 9). At pH 8.5, there was still ~70% protein bound to SITS-Affi-Gel. However, at pH >= 9.0, binding was greatly inhibited. Three possibilities can explain the inhibition at alkaline conditions. First, the increased pH may deprotonate the side chains of Lys or Arg (the pKa of side chain of Lys is 11.1 and that of Arg is 12.0), which may play essential roles in binding anionic inhibitors or substrates. Second, OH- might compete the SITS-Affi-Gel binding as a substrate, although its concentration, even at pH 10.0, is far below that found effective for other anions like I- and HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> (see below). Finally, Ynl275wp in such alkaline solutions might be partially denatured and its conformation changed.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 9.   pH effect on SITS-Affi-Gel binding of His6-tagged Ynl275wp. His6-tagged Ynl275wp was incubated with binding solutions that contained 50 mM each of citrate, 2-(N-morpholino)ethanesulfonic acid, 3-(N-morpholino)propanesulfonic acid, Tris, and 2-(N-cyclohexylamino)ethanesulfonic acid adjusted to pH as indicated before applying to SITS-Affi-Gel equilibrated with each binding buffer. The unbound protein in supernatant and protein bound to resin were analyzed by SDS-PAGE and immunoblotting with anti-V5 antibody. The percentage of binding represents the relative signal of bound protein from the total of the bound and unbound signals.

The ability of various anions to compete the binding of Ynl275wp to SITS-Affi-Gel was tested to screen possible Ynl275wp substrates. The experiment was first performed in the presence of anions at a high concentration (500 mM). The result showed that anions HCO<UP><SUB>3</SUB><SUP>−</SUP></UP>, I-, Br-, and NO<UP><SUB>3</SUB><SUP>−</SUP></UP> blocked the binding of Ynl275wp to SITS-Affi-Gel. Cl- partially inhibited the binding, whereas citrate, SO<UP><SUB>4</SUB><SUP>2−</SUP></UP>, and PO<UP><SUB>4</SUB><SUP>3−</SUP></UP> did not inhibit the binding under the conditions used (Fig. 8), indicating that HCO<UP><SUB>3</SUB><SUP>−</SUP></UP>, I-, Br-, NO<UP><SUB>3</SUB><SUP>−</SUP></UP>, and Cl- were all the potential substrates of Ynl275wp. The inhibition of SITS-Affi-Gel binding of Ynl275wp was unlikely due to high ionic strength, since high concentration of phosphate or sulfate did not block the binding, and high ionic strength increased the SITS-Affi-Gel binding affinity of the AE1 (33). As for the inhibition of SITS-Affi-Gel binding by high concentrations of HCO<UP><SUB>3</SUB><SUP>−</SUP></UP>, it was unlikely due to the increased pH (pH 8.3 compared with pH 7.1) in binding buffer. Although at pH 9.0 the binding was greatly inhibited, there was still ~70% protein bound to SITS-Affi-Gel, as shown in Fig. 9 at pH 8.5. The pH increase to 8.3 in the binding buffer should not affect the binding as much as was observed by HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> in Fig. 8 (~80% of protein remained unbound in binding assay).

The transport activity of NBC is Na+ dependent (18, 47). To test whether SITS binding of Ynl275wp was Na+ dependent, potassium iodide was used instead of sodium iodide to do the inhibitory test. The result indicated that potassium iodide and sodium iodide had similar effects on inhibition of SITS binding, suggesting that iodide binding was not cation dependent (Table 1).

Experiments to measure the inhibitory constant (Ki) of anions (50% of inhibition of SITS-Affi-Gel binding by anion) were performed. SITS-binding assay was conducted in the presence of anions at different concentrations. The relative binding ability of Ynl275wp to immobilized SITS was calculated from the bound protein over the total protein by Western blotting. Figure 10 shows a few examples of the binding curves. From the curves, Ki was deduced and the results summarized in Table 1. From Table 1, HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> shows half-maximal inhibition at a concentration of 306 mM. This result was deduced from serials of binding experiments conducted at pH 8.3. Theoretically, the pH of NaHCO3 solution was 8.3, independent of NaHCO3 concentrations at certain ranges, such as from 100 mM to 500 mM. We tested the inhibitory effect of HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> at pH 8.3 in this study, also making sure that most of the dissolved HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> (97% of total) remained as HCO<UP><SUB>3</SUB><SUP>−</SUP></UP>, instead of being converted to CO<UP><SUB>3</SUB><SUP>2−</SUP></UP> or H2CO3. For the halide series F-, Cl-, Br-, and I-, the Ki values decreased with an increase of ion size. This is in accord with the anion binding ability of human anion exchanger (32).


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 10.   Inhibitory effect of anions on Ynl275wp binding to SITS-Affi-Gel. His6-tagged Ynl275wp was incubated with NaCl, NaBr, or NaI at different concentrations before incubation with SITS-Affi-Gel. The unbound protein in supernatant and protein bound to resin were analyzed by SDS-PAGE and immunoblotting. The percentage of binding represents the relative signal of bound protein from the total of the bound and unbound signals. The curves derived from data represent at least 3 independent experiments by sigmoidal fit with Microsoft Origin graphing software.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Ynl275wp is a yeast homologue of anion exchangers and NBCs, both of which have definite physiological functions in vertebrates and belong to the HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> transporter superfamily (39, 41). Ynl275wp homologous sequences can also be found in other species such as Arabidopsis and Caenorhabditis elegans. Although the exact functions of these homologues are unknown, it is clear that the anion exchanger homologues exist widely in higher and lower organisms. With the progress of genome sequencing, more anion exchanger homologous sequences will undoubtedly be identified. In this study, we expressed and characterized a tagged version of the yeast anion exchanger homologue, Ynl275wp. Ynl275wp shows not only sequence similarity but also a very similar hydropathy profile to human anion exchanger AE1 (Fig. 1, A and B), implying the similar structure of Ynl275wp and AE1 (24). His6-tagged Ynl275wp is localized to plasma membrane (Fig. 4). This protein also binds stilbene disulfonate inhibitors, and the binding can be competed by monovalent anions. All these features are the hallmarks of anion transporters, thus strongly suggesting that Ynl275wp is an anion transporter. Additionally, because the SITS-Affi-Gel binding of Ynl275wp was Na+ independent, Ynl275wp might be an anion exchanger rather than an NBC.

Stilbene disulfonate inhibitors have long been known to specifically inhibit the anion transport activity of band 3 (4). Although the exact mechanism of inhibition is still unclear, extensive studies show that the inhibitors covalently or noncovalently bind to band 3 and allosterically change the conformation of band 3 (45). The covalent reaction sites of H2DIDS on band 3 were identified at Lys-539 and Lys-851 (30). Lys-539 is conserved in all anion exchangers and NBCs. Ynl275wp can also bind SITS, DNDS, DBDS, BADS, or H2DIDS. However, it does not have the conserved motif KXXK corresponding to AE1 (located at position from 539 to 541 in AE1) at the end of the fifth TM segment, although there are three lysine residues located around the end of the fifth TM fragment. Additionally, Lys-851 in human AE1 is also not conserved in Ynl275wp (Fig. 1A). Finally, Lys-539 in band 3 was shown to not be essential for anion transport or inhibition when stilbene disulfonate inhibitor DIDS was tested (9). It is possible that H2DIDS may not react covalently with Ynl275wp.

The SITS-Affi-Gel binding of Ynl275wp can be competed by monovalent anions or halides and not by sulfate or phosphate (Table 1). This suggests that Ynl275wp may differ from the erythrocyte anion exchanger band 3. Band 3 transports sulfate, and the transport is coupled with a proton (14). Glu-681 in band 3 has been shown to be essential for the H+-coupled transport (6, 15) and substitution by Asp in mouse AE1-abolished sulfate transport (48). However, as indicated in Fig. 1, A and C, this glutamate residue is not conserved in Ynl275wp, and instead, the amino acid corresponding to AE1 Glu-681 is substituted by asparatic acid at position 347. This suggests that Ynl275wp has no proton-sulfate cotransport capacity. The difference between Ynl275wp and band 3 protein can also be revealed by the fact that Ynl275wp lacks the carbonic anhydrase-binding motif. Band 3 binds carbonic anhydrase II at its COOH terminus with an acidic motif, DADD (52). However, this motif is not conserved in the COOH-terminal tail of Ynl275wp.

Cl- was shown to be a potential substrate of Ynl275wp in this study. However, the yeast cell itself does not take up significant amounts of Cl- under normal growth conditions, and the yeast cytoplasm contains a very low level of Cl- (8). As revealed by the yeast genome sequence, yeast does not have any Cl- channels in the plasma membrane. Three possibilities might explain the reason why Ynl275wp may not transport much Cl- into the yeast cells naturally. First, the YNL275w gene in yeast is only expressed at very low levels under normal growth conditions (8a) and may only be induced under specific conditions. Second, Ynl275wp showed very low affinity for Cl-, as indicated by its high Ki by SITS-Affi-Gel compared with other anions (Table 1). The Ynl275wp might function in transporting other anions rather than Cl-. Finally, we could not rule out the possibility that endogenous YNL275w was not functional at all. In fact, in this study, we only expressed the tagged version of Ynl275wp by the strong GAL1 promoter. The expression of native Ynl275wp and the possible difference between the native and tagged forms of Ynl275wp remain to be explored. Moreover, although His6-tagged Ynl275wp showed properties of an anion transporter in this study, other possible functions should be examined.

Even for the tagged Ynl275wp, despite the 2µ plasmid and GAL1 promoter, we did not obtain a high level of expression, since in the crude membrane fraction, the tagged Ynl275wp was invisible when stained with Coomassie blue. One possibility is that the plasma membrane-associated, His6-tagged Ynl275wp is not a protein required in abundance for yeast optimal growth. Alternatively, the protein may turn over rapidly. For example, if it is a subunit of a protein complex, it may be degraded owing to an assembly limit of other subunits.

The folding model of Ynl275wp was based mainly on the model for anion exchanger AE1 (35) and its hydropathy profile. The folding model of Ynl275wp, as shown in Fig. 1C, was supported in this study by examining its glycosylation status, by immunofluorescence microscopy, and by limited tryptic digestion experiments. N-glycosylation scanning mutagenesis has shown that the efficient N-linked glycosylation site must be at least 12-14 amino acids away from the end of the transmembrane segment (22, 29, 35). None of the five consensus N-glycosylation sites in Ynl275wp was glycosylated as indicated in this study (Figs. 5 and 6). Immunofluorescence microscopy indicated that without permeabilization with detergent, the plasma membrane-localized tagged Ynl275wp was not detectable by anti-V5 antibody, supporting the cytosolic localization of the COOH terminus.

Tryptic digestion of yeast spheroplasts indicated that there is a trypsin-sensitive site ~37 kDa away from the COOH terminus of His6-tagged Ynl275wp (Fig. 7B). Also from Fig. 7B, it is clear that only a small fraction of His6-tagged Ynl275wp was digested. This suggests that the extracellular portions of His6-tagged Ynl275wp are resistant to trypsin. However, we cannot rule out the possibility that the plasma membrane-associated His6-tagged Ynl275wp only represents part of the total expressed protein and that a fraction of overexpressed protein is retained intracellularly and is not accessible to extracellular trypsin. The proteolytic digestion pattern of Ynl275wp is similar to band 3. Under normal ionic strength conditions, band 3 in intact erythrocyte cells is resistant to trypsin (50). Chymotrypsin treatment of intact erythrocyte cells generates a COOH fragment of 38 kDa (50). Western blotting indicated that tryptic digestion of intact erythrocytes under some conditions can produce a COOH-terminal fragment ~35 kDa from band 3 (16). This implies that Ynl275wp and band 3 may have similar conformations, and, in both proteins, there is an extracellular domain, which may be exposed to the surface and is accessible to proteolytic digestion. The extracellular chymotrypsin sites and trypsin sites in band 3 have been localized in the third extracellular loop of band 3 (17, 26). As shown in Fig. 1C, the predicted molecular mass of the COOH-terminal fragment of His6-tagged Ynl275wp from the third extracellular loop is ~42 kDa. Considering that the apparent molecular mass of trypsin-released bands on SDS-PAGE gel is usually slightly smaller for membrane proteins, the extracellular trypsin-sensitive site in Ynl275wp may be located also in the third extracellular loop. However, this requires further confirmation by protein sequencing or mass spectrometry.

This study expressed the yeast Ynl275wp and showed it to be a candidate anion transporter located in the plasma membrane. Further studies need to be done to confirm the folding model and to determine the physiological function of Ynl275wp in yeast cells. The lack of a large cytosolic domain and N-linked oligosaccharide may facilitate structural studies of this membrane protein using crystallographic techniques.


    ACKNOWLEDGEMENTS

We thank Dr. Michael Jennings for helpful discussions and for informing us of his laboratories' studies of YNL275w. We also thank Dr. Morris Manolson for providing rabbit anti-Vph1p antibody and for helpful discussion and comment on this manuscript. We gratefully acknowledge Dr. David Perlin for generously providing rabbit anti-Pma1p antibody.


    FOOTNOTES

This work was supported by Canadian Institutes of Health Research Grant MT15266.

Address for reprint requests and other correspondence: R. A. F. Reithmeier, Canadian Institutes of Health Research Group in Membrane Biology, Dept. of Medicine, Univ. of Toronto, Toronto, Ontario, Canada M5S 1A8 (E-mail: r.reithmeier{at}utoronto.ca).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 25 October 2000; accepted in final form 25 January 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Abuladze, N, Lee I, Newman D, Hwang J, Boorer K, Pushkin A, and Kurtz I. Molecular cloning, chromosomal localization, tissue distribution, and functional expression of the human pancreatic sodium bicarbonate cotransporter. J Biol Chem 273: 17689-17695, 1998[Abstract/Free Full Text].

2.   Bradford, MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248-254, 1976[Web of Science][Medline].

3.   Burnham, CE, Amlal H, Wang Z, Shull GE, and Soleimani M. Cloning and functional expression of a human kidney Na+/HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> cotransporter. J Biol Chem 272: 19111-19114, 1997[Abstract/Free Full Text].

4.   Cabantchik, ZI, and Greger R. Chemical probes for anion transporters of mammalian cell membranes. Am J Physiol Cell Physiol 262: C803-C827, 1992[Abstract/Free Full Text].

5.   Casey, JR, Pirraglia CA, and Reithmeier RA. Enzymatic deglycosylation of human band 3, the anion transport protein of the erythrocyte membrane. Effect on protein structure and transport properties. J Biol Chem 267: 11940-11948, 1992[Abstract/Free Full Text].

6.   Chernova, MN, Jiang L, Crest M, Hand M, Vandorpe DH, Strange K, and Alper SL. Electrogenic sulfate/chloride exchange in Xenopus oocytes mediated by murine AE1 E699Q. J Gen Physiol 109: 345-360, 1997[Abstract/Free Full Text].

7.   Choi, I, Aalkjaer C, Boulpaep EL, and Boron WF. An electroneutral sodium/bicarbonate cotransporter NBCn1 and associated sodium channel. Nature 405: 571-575, 2000[Medline].

8.   Coury, LA, McGeoch JE, Guidotti G, and Brodsky JL. The yeast Saccharomyces cerevisiae does not sequester chloride but can express a functional mammalian chloride channel. FEMS Microbiol Lett 179: 327-332, 1999[Web of Science][Medline].

8a.  EUROFAN project. Munich Information Center for Protein Sequences. http://www.mips.biochem.mpg.de/proj/eurofan/eurofan_1/b2/ynl288w_ynl251c.html/ [2000, Aug. 24]

9.   Garcia, AM, and Lodish HF. Lysine 539 of human band 3 is not essential for ion transport or inhibition by stilbene disulfonates. J Biol Chem 264: 19607-19613, 1989[Abstract/Free Full Text].

10.   Gotz, R, Gnann A, and Zimmermann FK. Deletion of the carbonic anhydrase-like gene NCE103 of the yeast Saccharomyces cerevisiae causes an oxygen-sensitive growth defect. Yeast 15: 855-864, 1999[Web of Science][Medline].

11.   Grinstein, S, Ship S, and Rothstein A. Anion transport in relation to proteolytic dissection of band 3 protein. Biochim Biophys Acta 507: 294-304, 1978[Medline].

12.   Groves, JD, and Tanner MJ. Role of N-glycosylation in the expression of human band 3-mediated anion transport. Mol Membr Biol 11: 31-38, 1994[Web of Science][Medline].

13.   Ishibashi, K, Sasaki S, and Marumo F. Molecular cloning of a new sodium bicarbonate cotransporter cDNA from human retina. Biochem Biophys Res Commun 246: 535-538, 1998[Web of Science][Medline].

14.   Jennings, ML. Proton fluxes associated with erythrocyte membrane anion exchange. J Membr Biol 28: 187-205, 1976[Web of Science][Medline].

15.   Jennings, ML, and Al-Rhaiyel S. Modification of a carboxyl group that appears to cross the permeability barrier in the red blood cell anion transporter. J Gen Physiol 92: 161-178, 1988[Abstract/Free Full Text].

16.   Jennings, ML, Anderson MP, and Monaghan R. Monoclonal antibodies against human erythrocyte band 3 protein. Localization of proteolytic cleavage sites and stilbenedisulfonate-binding lysine residues. J Biol Chem 261: 9002-9010, 1986[Abstract/Free Full Text].

17.   Jennings, ML, and Nicknish JS. Localization of a site of intermolecular cross-linking in human red blood cell band 3 protein. J Biol Chem 260: 5472-5479, 1985[Abstract/Free Full Text].

18.   Jentsch, TJ, Schill BS, Schwartz P, Matthes H, Keller SK, and Wiederholt M. Kidney epithelial cells of monkey origin (BSC-1) express a sodium bicarbonate cotransport. Characterization by 22Na+ flux measurements. J Biol Chem 260: 15554-15560, 1985[Abstract/Free Full Text].

19.   Kleinhorst, A, Oslender A, Haest CW, and Deuticke B. Band 3-mediated flip-flop and phosphatase-catalyzed cleavage of a long-chain alkyl phosphate anion in the human erythrocyte membrane. J Membr Biol 165: 111-124, 1998[Web of Science][Medline].

20.   Kotaki, A, Naoi M, and Yagi K. A diaminostilbene dye as a hydrophobic probe for proteins. Biochim Biophys Acta 229: 547-556, 1971[Medline].

21.   Laemmli, UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680-685, 1970[Medline].

22.   Landolt-Marticorena, C, and Reithmeier RAF Asparagine-linked oligosaccharides are localized to single extracytosolic segments in multi-span membrane glycoproteins. Biochem J 302: 253-260, 1994.

23.   Landolt-Marticorena, C, Williams KM, Correa J, Chen W, and Manolson MF. Evidence that the NH2 terminus of vph1p, an integral subunit of the V0 sector of the yeast V-ATPase, interacts directly with the Vma1p and Vma13p subunits of the V1 sector. J Biol Chem 275: 15449-15457, 2000[Abstract/Free Full Text].

24.   Lolkema, JS, and Slotboom DJ. Estimation of structural similarity of membrane proteins by hydropathy profile alignment. Mol Membr Biol 15: 33-42, 1998[Web of Science][Medline].

25.   Lolkema, JS, and Slotboom DJ. Hydropathy profile alignment: a tool to search for structural homologues of membrane proteins. FEMS Microbiol Rev 22: 305-322, 1998[Web of Science][Medline].

26.   Lux, SE, John KM, Kopito RR, and Lodish HF. Cloning and characterization of band 3, the human erythrocyte anion-exchange protein (AE1). Proc Natl Acad Sci USA 86: 9089-9093, 1989[Abstract/Free Full Text].

27.   Morsomme, P, de Kerchove d'Exaerde A, De Meester S, Thines D, Goffeau A, and Boutry M. Single point mutations in various domains of a plant plasma membrane H+-ATPase expressed in Saccharomyces cerevisiae increase H+-pumping and permit yeast growth at low pH. EMBO J 15: 5513-5526, 1996[Web of Science][Medline].

28.   Nelissen, B, De Wachter R, and Goffeau A. Classification of all putative permeases and other membrane plurispanners of the major facilitator superfamily encoded by the complete genome of Saccharomyces cerevisiae. FEMS Microbiol Rev 21: 113-134, 1997[Web of Science][Medline].

29.   Nilsson, IM, and von Heijne G. Determination of the distance between the oligosaccharyltransferase active site and the endoplasmic reticulum membrane. J Biol Chem 268: 5798-5801, 1993[Abstract/Free Full Text].

30.   Okubo, K, Kang D, Hamasaki N, and Jennings ML. Red blood cell band 3. Lysine 539 and lysine 851 react with the same H2DIDS (4,4'-diisothiocyanodihydrostilbene-2,2'-disulfonic acid) molecule. J Biol Chem 269: 1918-1926, 1994[Abstract/Free Full Text].

31.   Ortwein, R, Oslender-Kohnen A, and Deuticke B. Band 3, the anion exchanger of the erythrocyte membrane, is also a flippase. Biochim Biophys Acta 1191: 317-323, 1994[Medline].

32.   Passow, H. Molecular aspects of band 3 protein-mediated anion transport across the red blood cell membrane. Rev Physiol Biochem Pharmacol 103: 61-203, 1986[Web of Science][Medline].

33.   Pimplikar, SW, and Reithmeier RAF Affinity chromatography of band 3, the anion transport protein of erythrocyte membranes. J Biol Chem 261: 9770-9778, 1986[Abstract/Free Full Text].

34.   Popov, M, Li J, and Reithmeier RAF Resolution of glycoproteins by a lectin gel-shift assay. Anal Biochem 279: 90-95, 2000[Web of Science][Medline].

35.   Popov, M, Li J, and Reithmeier RAF Transmembrane folding of the human erythrocyte anion exchanger (AE1, band 3) determined by scanning and insertional N-glycosylation mutagenesis. Biochem J 339: 269-279, 1999.

36.   Pringle, JR, Adams AE, Drubin DG, and Haarer BK. Immunofluorescence methods for yeast. Methods Enzymol 194: 565-602, 1991[Web of Science][Medline].

37.   Pushkin, A, Abuladze N, Lee I, Newman D, Hwang J, and Kurtz I. Cloning, tissue distribution, genomic organization, and functional characterization of NBC3, a new member of the sodium bicarbonate cotransporter family. J Biol Chem 274: 16569-16575, 1999[Abstract/Free Full Text].

38.   Pushkin, A, Abuladze N, Newman D, Lee I, Xu G, and Kurtz I. Cloning, characterization and chromosomal assignment of NBC4, a new member of the sodium bicarbonate cotransporter family. Biochim Biophys Acta 1493: 215-218, 2000[Medline].

39.   Reithmeier, RAF, Chan SL, and Popov M. Structure of the erythrocyte band 3 anion exchanger. In: Handbook of Biological Physics, edited by Konings WN, and Lolkema JS.. Amsterdam: Elsevier, 1996, p. 281-309.

40.   Roberts, CJ, Raymond CK, Yamashiro CT, and Stevens TH. Methods for studying the yeast vacuole. Methods Enzymol 194: 644-661, 1991[Web of Science][Medline].

41.   Romero, MF, and Boron WF. Electrogenic Na+/HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> cotransporters: cloning and physiology. Annu Rev Physiol 61: 699-723, 1999[Web of Science][Medline].

42.   Romero, MF, Fong P, Berger UV, Hediger MA, and Boron WF. Cloning and functional expression of rNBC, an electrogenic Na+-HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> cotransporter from rat kidney. Am J Physiol Renal Physiol 274: F425-F432, 1998[Abstract/Free Full Text].

43.   Romero, MF, Hediger MA, Boulpaep EL, and Boron WF. Expression cloning and characterization of a renal electrogenic Na+/HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> cotransporter. Nature 387: 409-413, 1997[Medline].

44.   Romero, MF, Henry D, Nelson S, Harte PJ, Dillon AK, and Sciortino CM. Cloning and characterization of a Na+-driven anion exchanger (NDAE1). A new bicarbonate transporter. J Biol Chem 275: 24552-24559, 2000[Abstract/Free Full Text].

45.   Salhany, JM, Cordes KA, and Schopfer LM. Kinetics of conformational changes associated with inhibitor binding to the purified band 3 transporter. Direct observation of allosteric subunit interactions. Biochemistry 32: 7413-7420, 1993[Medline].

46.   Sanger, F, Nicklen S, and Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74: 5463-5467, 1977[Abstract/Free Full Text].

47.   Sciortino, CM, and Romero MF. Cation and voltage dependence of rat kidney electrogenic Na+-HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> cotransporter, rkNBC, expressed in oocytes. Am J Physiol Renal Physiol 277: F611-F623, 1999[Abstract/Free Full Text].

48.   Sekler, I, Lo RS, and Kopito RR. A conserved glutamate is responsible for ion selectivity and pH dependence of the mammalian anion exchangers AE1 and AE2. J Biol Chem 270: 28751-28758, 1995[Abstract/Free Full Text].

49.   Southern, JA, Young DF, Heaney F, Baumgartner WK, and Randall RE. Identification of an epitope on the P and V proteins of simian virus 5 that distinguishes between two isolates with different biological characteristics. J Gen Physiol 72: 1551-1557, 1991.

50.   Steck, TL, Ramos B, and Strapazon E. Proteolytic dissection of band 3, the predominant transmembrane polypeptide of the human erythrocyte membrane. Biochemistry 15: 1153-1161, 1976[Medline].

51.   Sun, XC, Bonanno JA, Jelamskii S, and Xie Q. Expression and localization of Na+-HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> cotransporter in bovine corneal endothelium. Am J Physiol Cell Physiol 279: C1648-C1655, 2000[Abstract/Free Full Text].

52.   Vince, JW, and Reithmeier RAF Identification of the carbonic anhydrase II binding site in the Cl-/HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> anion exchanger AE1. Biochemistry 39: 5527-5533, 2000[Medline].

53.   Wang, CZ, Yano H, Nagashima K, and Seino S. The Na+-driven Cl-/HCO<UP><SUB>3</SUB><SUP>−</SUP></UP> exchanger. Cloning, tissue distribution, and functional characterization. J Biol Chem 275: 35486-35490, 2000[Abstract/Free Full Text].


Am J Physiol Cell Physiol 281(1):C33-C45
0363-6143/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
M. L. Jennings, T. R. Howren, J. Cui, M. Winters, and R. Hannigan
Transport and regulatory characteristics of the yeast bicarbonate transporter homolog Bor1p
Am J Physiol Cell Physiol, July 1, 2007; 293(1): C468 - C476.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Kim, K. Melen, M. Osterberg, and G. von Heijne
A global topology map of the Saccharomyces cerevisiae membrane proteome
PNAS, July 25, 2006; 103(30): 11142 - 11147.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhao, R.
Right arrow Articles by Reithmeier, R. A. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhao, R.
Right arrow Articles by Reithmeier, R. A. F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online