|
|
||||||||
Canadian Institutes of Health Research Group in Membrane Biology, Department of Medicine, University of Toronto, Toronto, Ontario, Canada M5S 1A8
| |
ABSTRACT |
|---|
|
|
|---|
A search of the yeast
Saccharomyces cerevisiae genome has revealed an open reading
frame, YNL275w, which encodes a 576-amino acid protein that shows
sequence similarity to the family of mammalian Cl
/HCO


-mannosidase, or by mutation of each of the five consensus
N-glycosylation sites. The protein did not bind to
concanavalin A by lectin blotting or lectin affinity chromatography.
The expressed protein bound specifically to a stilbene disulfonate
inhibitor resin (SITS-Affi-Gel), and this binding could be competed by
certain anions (HCO
,
NO
) but not by others
(SO

band 3; carbonic anhydrase; genomics; topology
| |
INTRODUCTION |
|---|
|
|
|---|
BICARBONATE
(HCO
/HCO
/HCO




exchanger function
(11), and the transport processes can be specifically
inhibited by stilbene disulfonate inhibitors (4). The NBCs
are electrogenic, Na+-dependent HCO

/HCO
Homologous sequences of HCO
/HCO


(32), and even
acts as a lipid flippase (19, 31). The disruption of
YNL275w in yeast cells did not show any phenotype under normal growth
condition or nonpermissive conditions, such as low (15°C) or high
(37°C) temperature. The mRNA level of YNL275w was extremely low and
not regulated by certain stress conditions, such as nitrogen starvation
(8a). This does not rule out the possibility of an essential function
of YNL275w for yeast growth or survival under other conditions.
In this study, we overexpressed and characterized a six-histidine (His6)-tagged Ynl275wp protein in yeast. The His6-tagged Ynl275wp was localized to the plasma membrane and was shown to be a nonglycosylated protein capable of binding a set of anions. The anion-binding properties of Ynl275wp were similar to that of human AE1, and anion binding could be specifically blocked with stilbene disulfonate inhibitors. Future studies of the structure and function of this yeast anion transporter will provide valuable information of relevance to its human homologues.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Materials.
Yeast nitrogen base was purchased from Difco. Amino acids used for
supplements and tunicamycin were purchased from Sigma. Chemiluminescent
developer reagent was purchased from Roche Molecular Biochemicals.
ProBond resin for affinity purification of His6-tagged protein and
anti-V5 epitope (
GKPIPNPLLGLDST
) (49) antibody were purchased from Invitrogen. n-Dodecyl
-D-maltoside (DDM) was purchased from Anatrace (Maumee,
OH). Rhodamine Red-X goat anti-mouse IgG (H+L) conjugate, monoclonal
antibody against yeast Vma2p, 4,4'-dibenzamidostilbene-2,2'-sulfonic
acid (DBDS), and 4,4'-diisothiocyanodihydrostilbene-2,2'-disulfonic
acid (H2DIDS) were from Molecular Probes.
4,4'-Dinitrostilbene-2,2'-disulfonic acid (DNDS) was from Aldrich.
4-Benzamido-4'-aminostilbene-2,2'-disulfonic acid (BADS) was
synthesized according to Kotaki et al. (20). QuickChange
site-directed mutagenesis kit was purchased from Stratagene. N-glycanase F,
1-2, 3 mannosidase,
horseradish peroxidase goat anti-mouse IgG (H+L) conjugate, and
horseradish peroxidase goat anti-rabbit IgG (H+L) conjugate were
purchased from New England BioLabs. Fluorescence goat anti-rabbit IgG
(H+L) conjugate was purchased from Zymed. Biotinylated concanavalin A
was a product of Vector Laboratories. Trypsin was from Worthington
Biochemicals. Oligonucleotides were synthesized by ACGT
(Toronto, Ontario, Canada). All other chemicals were from commercial
sources. Rabbit anti-yeast Pma1p antibody was a gift of Dr. David
Perlin (Public Health Institute, New York, NY). Rabbit anti-yeast Vph1p
antibody was a gift of Dr. Morris Manolson (Faculty of Dentistry, Univ.
of Toronto).
Plasmids and constructions. Multicopy 2µ plasmid pYES/G2-YNL275 (designated as pYES275) containing the YNL275w open reading frame under the control of GAL1 promoter was obtained from Invitrogen (cat. no. YNL275WY). The plasmid contains URA3 selectable marker. Ynl275wp contains an additional 33-amino acid COOH terminus, which includes the paramyxovirus SV5 V5 epitope and His6 tag for detection and purification, respectively. To determine the N-glycosylation status of the expressed Ynl275wp, the five potential N-linked glycosylation sites N-X-S/T were each changed to D-X-S/T by single nucleotide mutation with Stratagene QuickChange site-directed mutagenesis kit according to the supplied instruction manual. The codons of Asn located at 3, 152, 163, 349, and 483 positions were mutated to Asp with the following oligos and their corresponding antisense oligos: N3D: CAGCTGACCACCATGTCGGATGAGAGCACACGAGTTACC, N152D: GCCCCATCTCTATTTTTGATTATACGGTCTACG, N163D: GAAATTATAAAGCCTTTGGATACCAGCTATTTTGGC, N349D: GTTTTACTTTGATCATGACGTATCGTCGCTAATGG, and N483D: CCTAACAGAAGAGATGATACTTCACCTTTAATG, respectively (the mutated Asp codons are underlined). The point mutations in the plasmid were confirmed by DNA sequencing with T7 sequencing kit (Pharmacia Biotech) using the chain-terminating method (46).
Yeast strains and culture conditions.
S. cerevisiae strain Invsci (MATa/MAT
, his3
1,
leu2, trp1-289, and ura3-52) was obtained
from Invitrogen (cat. no. C810-00). Yeast strain Inv275 was
constructed by transforming Invsci with plasmid pYES275. Both Invsci
and Inv275 were grown on synthetic minimal medium (SD)
supplemented with 24 mg/l histidine, 72 mg/l leucine, 48 mg/l
tryptophan, and 2% dextrose. For growing Invsci, 24 mg/l of uracil was
additionally supplied. To induce the expression of Ynl275wp, the yeast
cells were first grown on medium that contained 2% dextrose to midlog
phase [optical density (OD) 600 ~1.0]. The cells were spun
down, washed once with distilled water, and then cultured in medium
containing 2% galactose for an additional 16 h.
Preparation of crude membrane, plasma membrane, and vacuolar membrane vesicles. Yeast cells were resuspended by adding 1.5 ml/g of fresh weight (FW) solution [250 mM sorbitol, 1 mM MgCl2, 50 mM imidazole, pH 7.5, 1 mM phenylmethylsulfonyl fluoride (PMSF), 5 mM dithiothreitol, and a protease inhibitor cocktail (leupeptin, aprotinin, antipain, pepstatin, and chymostatin at 2 µg/ml per inhibitor)]. The cells were broken in a 2-ml tube in the presence of 1.5-g glass beads/g FW with a Biospeed minibead beater at 4°C for 4 × 100 s. The crude and plasma membranes were prepared from the homogenate as described by Morsomme et al. (27).
To prepare vacuolar membrane vesicles, the cells were collected and spheroplasted as described by Roberts et al. (40). Spheroplasts were homogenated in a Dounce homogenizer. After the cell debris was removed with centrifugation at 3,500 g for 15 min, the membranes were pelleted at 100,000 g for 35 min, resuspended, and applied to one-step 10-30% sucrose gradient centrifugation at 100,000 g for 2 h. The vacuole vesicles at the 10-30% interface were collected, washed, and pelleted at 100,000 g for 35 min and then resuspended in 10 mM imidazole, pH 7.5, and 1 mM MgCl2. Protein quantitation in crude membrane, plasma membrane, and vacuole vesicles was performed according to Bradford (2).Purification of His-tagged Ynl275wp. To purify the histidine-tagged Ynl275wp, the crude membranes were initially suspended in TN20 solution [20 mM imidazole, pH 7.5, 1 mM MgCl2, 150 mM NaCl, 20% (vol/vol) glycerol, and the protease inhibitor cocktail (described earlier)]. The crude membranes were solubilized with DDM at a ratio of 1 mg of protein:2 mg of DDM for 30 min on ice and then spun for 10 min at 50,000 g to remove the insoluble material. The solubilized proteins were applied to Probond Sepharose, equilibrated with TN20 (1 ml of matrix/20 mg of protein), and incubated for 1 h on a rotary wheel at 4°C. The matrix was then loaded into a column and washed with 10× matrix volume of TN20 supplemented with 0.1% DDM. Bound proteins were then eluted with twice the matrix volume of TN250 (250 mM imidazole, pH 7.5, 1 mM MgCl2, 150 mM NaCl, and 0.1% DDM).
Immunofluorescence microscopy.
Immunofluorescence microscopy was essentially performed as described by
Pringle et al. (36) with the following slight
modifications. After the cell wall was removed with zymolase, the
formaldehyde-fixed spheroplasted cells were resuspended in 1 ml of 2%
SDS in 1.2 M sorbitol for 5 min to permeabilize the membranes, followed
by 2 × 1 ml-gentle washes in 1.2 M sorbitol. Instead of using a
multiwell slide, a normal frosted microscope slide (VWR, Canada)
was used. The permeabilized cells (10 µl) were added to the
polylysine-coated slide and allowed to settle down for 5 min,
immediately followed by blocking with PBS containing 1 mg/ml of
BSA for 20 min and incubation with primary antibody and secondary
antibody in PBS containing 1 mg/ml of BSA. Anti-V5, anti-Vph1p, and
anti-Pma1p were used at dilutions 1:200, 1:50, and 1:50, respectively.
Secondary antibodies of Rhodamine Red-X goat anti-mouse IgG (H+L)
conjugate and fluorescence goat anti-rabbit IgG (H+L) conjugate were
used at 1:100 and 1:50, respectively. To keep the moisture of the
slide, the slide was put into a petri dish with a piece of
water-saturated Whatman paper. After incubation with the primary
antibody or the secondary antibody, the slide was washed five times,
each wash for 5 min with PBS containing 1 mg/ml of BSA. After the final washing step, the slide was mounted with 90% glycerol, 1 mg/ml p-phenylenediamine, and 0.1× PBS, pH 9.0. The slide was
stored at
20°C or observed immediately with an LSM410 invert laser
scan microscope (Carl Zeiss, Germany).
SDS-PAGE and immunoblotting. Proteins were separated by SDS-PAGE (21), transferred to a nitrocellulose membrane, and detected by immunoblotting. The primary anti-V5 antibody and the secondary antibody horseradish peroxidase goat anti-mouse IgG (H+L) conjugate were both used at dilution 1:10,000. The blot was developed by chemiluminescence and exposed to X-ray film.
Inhibitor-affinity chromatography.
SITS-Affi-Gel was prepared by coupling
4-acetamido-4'-isothiocyanostilbene-2,2'-disulfonic acid (SITS) to
Affi-Gel 102 resin in NaHCO3 solution as described by
Pimplikar and Reithmeier (33). Purified His6-tagged
Ynl275wp (0.1 µg) was diluted into 50 µl of binding solution
consisting of 0.1% DDM and 250 mM sodium citrate, pH 7.1, and added to
20 µl of SITS-Affi-Gel equilibrated with binding solution in an
Eppendorf tube. After a 15-min incubation in a rotary wheel at 4°C,
the Eppendorf tube was spun for 30 s, and 30 µl of supernatant
was saved as the unbound fraction. The beads were rapidly washed three
times each with 400 µl of binding solution. The protein bound to the
beads was released in 100 µl of Laemmli sample buffer at room
temperature. Both bound and unbound fractions were subjected to
SDS-PAGE and immunoblotting. The relative ratio of binding protein was
obtained by scanning and analyzing the signals with the program NIH
Image 1.60. To test the inhibitory effect of anions or anion exchanger
inhibitors, the anions and anion exchanger inhibitors were included in
the binding solution. To test the specificity of SITS-Affi-Gel binding,
Affi-Gel 102 without coupling SITS was used as control in binding
assay. When the inhibitory effect of HCO
Concanavalin A-Sepharose binding. The concanavalin A-Sepharose binding assay was performed with purified His6-tagged Ynl275wp protein in buffer containing 20 mM Tris · HCl, pH 7.4, and 500 mM NaCl with 1% detergent as indicated, essentially as described by Popov et al. (35).
Enzymatic deglycosylation.
Purified His6-tagged Ynl275wp or crude membrane proteins,
solubilized in 0.1% DDM, were treated with 12,500 U/ml of
N-glycanase F or 200 U/ml of
1-2, 3 mannosidase at
37°C for 1 h. The reaction mixtures were added with an equal
volume of 2× Laemmli sample buffer and separated by SDS-PAGE.
Tryptic digestion. The Inv275 yeast cells were induced with 2% galactose for 12 h and spheroplasted with the same procedure as used for immunofluorescence but without fixation. The spheroplasts were suspended in 100 mM potassium phosphate, pH 7.5, containing 1.2 M sorbitol. Spheroplasts (100 µl, containing 40 µg total proteins) were digested with trypsin (up to 1.0 mg/ml) at 30°C for 30 min. The reactions were terminated by addition of PMSF at a final concentration of 10 mM and washing once with 600 µl of 100 mM potassium phosphate, pH 7.5, and 1.2 M sorbitol. The spheroplasts were immediately solubilized with 100 µl of Laemmli sample buffer. To digest solubilized proteins, spheroplasts (40 µg total proteins) were solubilized with 0.5% DDM in 1× PBS, and the solubilized proteins were digested with trypsin (up to 2.0 µg/ml) on ice for 15 min. The reactions were terminated by addition of PMSF at a final concentration of 10 mM, followed by the immediate addition of an equal volume of 2× Laemmli sample buffer.
Treatment with tunicamycin. Inv275 yeast cells were grown in 2 ml of SD medium supplemented with 2% glucose until OD 600 reached 1.0. The cells were collected and suspended in 2 ml of SD medium that contained 2% galactose to induce expression of His6-tagged Ynl275wp. After either 0 or 12 h, tunicamycin was added at a final concentration of 10 µg/ml. The cells were harvested at 14 h, spheroplasted, and solubilized in 200 µl of 2× Laemmli sample buffer. The total proteins (10 µl) were resolved on 10% SDS-PAGE gel and immunoblotted with anti-V5 antibody.
| |
RESULTS |
|---|
|
|
|---|
S. cerevisiae YNL275w is a member of the HCO




|
Expression and purification of His6-tagged Ynl275wp.
To facilitate the detection and purification of Ynl275wp, we
chose the construct pYES275 for protein expression, in which the
wild-type YNL275w sequence was fused to an epitope sequence (V5) from V
protein of paramyxovirus SV5 and a His6 tag at the COOH terminus. The
33 additional COOH-terminal amino acid sequence, including the V5
epitope and His6 tag, is shown in Fig. 1C. After induction
with galactose, the yeast cells harboring pYES275 expressed an
immunoreactive protein band at apparent molecular mass 62 kDa on SDS-PAGE gel (Fig. 2, A and
B). A small amount of immunoreactive protein was detected at
molecular mass ~120 kDa, as shown in Fig. 2B, suggesting
the presence of dimers. No immunoreactive protein was detected in
untransformed yeast cells. However, under these conditions, the
expressed Ynl275wp was not readily visible in crude membrane fractions
on SDS-PAGE gel when stained with Coomassie blue. Ynl275wp could be
observed by Coomassie blue staining after enrichment by affinity
purification with nickel Sepharose column (Fig. 2A). The
results suggest that Ynl275wp was not expressed at a high level in
transformed yeast cells (~100 µg/l of culture), although the
multiple copy 2µ plasmid and the strong GAL1 promoter were
used for expression.
|
|
|
The His6-tagged Ynl275wp was not glycosylated when expressed in
yeast.
In eukaryotic cells, plasma membrane proteins are synthesized and
targeted through the secretory pathway. The modification of translated
protein occurs in endoplasmic reticulum and Golgi by
N-glycosylation if appropriate glycosylation acceptor sites (N-X-S/T) exist. The carbohydrates in glycoproteins, especially those
targeted to plasma membrane, play important roles during biosynthesis
and also at the cell surface. To determine whether His6-tagged
Ynl275wp was N-glycosylated, crude membrane protein or
purified Ynl275wp were treated with N-glycanase F. The
results show that none of these treatments altered the mobility of
Ynl275wp on SDS-PAGE gel (Fig.
5A). Similar treatment of
erythrocyte ghost membrane proteins with N-glycanase F
showed a clear mobility shift of band 3, indicating that the
carbohydrate attached to band 3 was cleaved (data not shown). To
determine whether His6-tagged Ynl275wp contained significant
1-2 or
1-3 high mannose, Ynl275wp was treated with
-mannosidase. The treatment did not alter the mobility of Ynl275wp
on SDS-PAGE gel, either (Fig. 5A). To rule out the
possibility that the sugar was too small for a change in mobility to be
observed on normal SDS-PAGE gel, concanavalin A lectin-shift gel,
according to Popov et al. (34), was performed, and no
change in mobility could be detected (data not shown).
|
|
Tryptic digestion of His6-tagged Ynl275wp.
Proteolytic digestion of intact erythrocytes has been used to directly
determine the topology of band 3 (16, 30, 50) since only
extracellular sensitive sites can be cleaved. To determine whether
His6-tagged Ynl275wp had similar extracellular protease-sensitive sites, galactose-induced Inv275 cells were spheroplasted and digested with trypsin. With an increase of the trypsin concentration to as much
as 5 mg/ml, low amounts of a fragment at apparent molecular mass 37 kDa, immunoreactive to anti-V5 antibody, appeared (Fig. 7B). Under the digestion
conditions, the intracellular vacuolar ATPase subunit Vma2p, which is
very sensitive to small amounts of trypsin (23), was not
cleaved by trypsin (Fig. 7C), suggesting that the
spheroplasts were kept intact. Higher concentrations of trypsin (>5
mg/ml) destroyed the spheroplasts and were not applicable. This result
indicates that a trypsin-sensitive site, ~37 kDa away from the COOH
terminus, is located in the extracellular domain of Ynl275wp. A
similar-sized fragment can be generated from band 3 by chymotrypsin
(50) or trypsin (16) treatment of intact
erythrocyte. These sites are located in the third extracellular loop of
band 3 (17, 26). Considering that the molecular mass determined by SDS-PAGE is not very precise, the trypsin-sensitive site
that produces a 37-kDa COOH-terminal fragment cannot be determined exactly. Potential external trypsin cleavage sites are located in the
third extracellular loop of Ynl275wp (Fig. 1C).
|
Anion-binding properties of Ynl275wp.
The human anion exchanger binds and transports anions such as
Cl
, HCO
,
I
, SO


|
|
9.0, binding was
greatly inhibited. Three possibilities can explain the inhibition at
alkaline conditions. First, the increased pH may deprotonate the side
chains of Lys or Arg (the pKa of side chain of Lys is 11.1 and
that of Arg is 12.0), which may play essential roles in binding anionic
inhibitors or substrates. Second, OH
might compete the
SITS-Affi-Gel binding as a substrate, although its concentration, even
at pH 10.0, is far below that found effective for other anions like
I
and HCO
|

, Br
, and
NO
partially inhibited the binding, whereas citrate,
SO


, Br
,
NO
were all the potential
substrates of Ynl275wp. The inhibition of SITS-Affi-Gel binding of
Ynl275wp was unlikely due to high ionic strength, since high
concentration of phosphate or sulfate did not block the binding, and
high ionic strength increased the SITS-Affi-Gel binding affinity of the
AE1 (33). As for the inhibition of SITS-Affi-Gel binding
by high concentrations of HCO






, Cl
, Br
, and
I
, the Ki values decreased with an
increase of ion size. This is in accord with the anion binding ability
of human anion exchanger (32).
|
| |
DISCUSSION |
|---|
|
|
|---|
Ynl275wp is a yeast homologue of anion exchangers and NBCs, both
of which have definite physiological functions in vertebrates and
belong to the HCO
Stilbene disulfonate inhibitors have long been known to specifically inhibit the anion transport activity of band 3 (4). Although the exact mechanism of inhibition is still unclear, extensive studies show that the inhibitors covalently or noncovalently bind to band 3 and allosterically change the conformation of band 3 (45). The covalent reaction sites of H2DIDS on band 3 were identified at Lys-539 and Lys-851 (30). Lys-539 is conserved in all anion exchangers and NBCs. Ynl275wp can also bind SITS, DNDS, DBDS, BADS, or H2DIDS. However, it does not have the conserved motif KXXK corresponding to AE1 (located at position from 539 to 541 in AE1) at the end of the fifth TM segment, although there are three lysine residues located around the end of the fifth TM fragment. Additionally, Lys-851 in human AE1 is also not conserved in Ynl275wp (Fig. 1A). Finally, Lys-539 in band 3 was shown to not be essential for anion transport or inhibition when stilbene disulfonate inhibitor DIDS was tested (9). It is possible that H2DIDS may not react covalently with Ynl275wp.
The SITS-Affi-Gel binding of Ynl275wp can be competed by monovalent anions or halides and not by sulfate or phosphate (Table 1). This suggests that Ynl275wp may differ from the erythrocyte anion exchanger band 3. Band 3 transports sulfate, and the transport is coupled with a proton (14). Glu-681 in band 3 has been shown to be essential for the H+-coupled transport (6, 15) and substitution by Asp in mouse AE1-abolished sulfate transport (48). However, as indicated in Fig. 1, A and C, this glutamate residue is not conserved in Ynl275wp, and instead, the amino acid corresponding to AE1 Glu-681 is substituted by asparatic acid at position 347. This suggests that Ynl275wp has no proton-sulfate cotransport capacity. The difference between Ynl275wp and band 3 protein can also be revealed by the fact that Ynl275wp lacks the carbonic anhydrase-binding motif. Band 3 binds carbonic anhydrase II at its COOH terminus with an acidic motif, DADD (52). However, this motif is not conserved in the COOH-terminal tail of Ynl275wp.
Cl
was shown to be a potential substrate of Ynl275wp in
this study. However, the yeast cell itself does not take up significant amounts of Cl
under normal growth conditions, and the
yeast cytoplasm contains a very low level of Cl
(8). As revealed by the yeast genome sequence, yeast does not have any Cl
channels in the plasma membrane. Three
possibilities might explain the reason why Ynl275wp may not transport
much Cl
into the yeast cells naturally. First, the
YNL275w gene in yeast is only expressed at very low levels under normal
growth conditions (8a) and may only be induced under specific
conditions. Second, Ynl275wp showed very low affinity for
Cl
, as indicated by its high Ki by
SITS-Affi-Gel compared with other anions (Table 1). The Ynl275wp might
function in transporting other anions rather than Cl
.
Finally, we could not rule out the possibility that endogenous YNL275w
was not functional at all. In fact, in this study, we only expressed
the tagged version of Ynl275wp by the strong GAL1 promoter.
The expression of native Ynl275wp and the possible difference between
the native and tagged forms of Ynl275wp remain to be explored. Moreover, although His6-tagged Ynl275wp showed properties of an anion
transporter in this study, other possible functions should be examined.
Even for the tagged Ynl275wp, despite the 2µ plasmid and GAL1 promoter, we did not obtain a high level of expression, since in the crude membrane fraction, the tagged Ynl275wp was invisible when stained with Coomassie blue. One possibility is that the plasma membrane-associated, His6-tagged Ynl275wp is not a protein required in abundance for yeast optimal growth. Alternatively, the protein may turn over rapidly. For example, if it is a subunit of a protein complex, it may be degraded owing to an assembly limit of other subunits.
The folding model of Ynl275wp was based mainly on the model for anion exchanger AE1 (35) and its hydropathy profile. The folding model of Ynl275wp, as shown in Fig. 1C, was supported in this study by examining its glycosylation status, by immunofluorescence microscopy, and by limited tryptic digestion experiments. N-glycosylation scanning mutagenesis has shown that the efficient N-linked glycosylation site must be at least 12-14 amino acids away from the end of the transmembrane segment (22, 29, 35). None of the five consensus N-glycosylation sites in Ynl275wp was glycosylated as indicated in this study (Figs. 5 and 6). Immunofluorescence microscopy indicated that without permeabilization with detergent, the plasma membrane-localized tagged Ynl275wp was not detectable by anti-V5 antibody, supporting the cytosolic localization of the COOH terminus.
Tryptic digestion of yeast spheroplasts indicated that there is a trypsin-sensitive site ~37 kDa away from the COOH terminus of His6-tagged Ynl275wp (Fig. 7B). Also from Fig. 7B, it is clear that only a small fraction of His6-tagged Ynl275wp was digested. This suggests that the extracellular portions of His6-tagged Ynl275wp are resistant to trypsin. However, we cannot rule out the possibility that the plasma membrane-associated His6-tagged Ynl275wp only represents part of the total expressed protein and that a fraction of overexpressed protein is retained intracellularly and is not accessible to extracellular trypsin. The proteolytic digestion pattern of Ynl275wp is similar to band 3. Under normal ionic strength conditions, band 3 in intact erythrocyte cells is resistant to trypsin (50). Chymotrypsin treatment of intact erythrocyte cells generates a COOH fragment of 38 kDa (50). Western blotting indicated that tryptic digestion of intact erythrocytes under some conditions can produce a COOH-terminal fragment ~35 kDa from band 3 (16). This implies that Ynl275wp and band 3 may have similar conformations, and, in both proteins, there is an extracellular domain, which may be exposed to the surface and is accessible to proteolytic digestion. The extracellular chymotrypsin sites and trypsin sites in band 3 have been localized in the third extracellular loop of band 3 (17, 26). As shown in Fig. 1C, the predicted molecular mass of the COOH-terminal fragment of His6-tagged Ynl275wp from the third extracellular loop is ~42 kDa. Considering that the apparent molecular mass of trypsin-released bands on SDS-PAGE gel is usually slightly smaller for membrane proteins, the extracellular trypsin-sensitive site in Ynl275wp may be located also in the third extracellular loop. However, this requires further confirmation by protein sequencing or mass spectrometry.
This study expressed the yeast Ynl275wp and showed it to be a candidate anion transporter located in the plasma membrane. Further studies need to be done to confirm the folding model and to determine the physiological function of Ynl275wp in yeast cells. The lack of a large cytosolic domain and N-linked oligosaccharide may facilitate structural studies of this membrane protein using crystallographic techniques.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. Michael Jennings for helpful discussions and for informing us of his laboratories' studies of YNL275w. We also thank Dr. Morris Manolson for providing rabbit anti-Vph1p antibody and for helpful discussion and comment on this manuscript. We gratefully acknowledge Dr. David Perlin for generously providing rabbit anti-Pma1p antibody.
| |
FOOTNOTES |
|---|
This work was supported by Canadian Institutes of Health Research Grant MT15266.
Address for reprint requests and other correspondence: R. A. F. Reithmeier, Canadian Institutes of Health Research Group in Membrane Biology, Dept. of Medicine, Univ. of Toronto, Toronto, Ontario, Canada M5S 1A8 (E-mail: r.reithmeier{at}utoronto.ca).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 25 October 2000; accepted in final form 25 January 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Abuladze, N,
Lee I,
Newman D,
Hwang J,
Boorer K,
Pushkin A,
and
Kurtz I.
Molecular cloning, chromosomal localization, tissue distribution, and functional expression of the human pancreatic sodium bicarbonate cotransporter.
J Biol Chem
273:
17689-17695,
1998
2.
Bradford, MM.
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal Biochem
72:
248-254,
1976[Web of Science][Medline].
3.
Burnham, CE,
Amlal H,
Wang Z,
Shull GE,
and
Soleimani M.
Cloning and functional expression of a human kidney Na+/HCO
4.
Cabantchik, ZI,
and
Greger R.
Chemical probes for anion transporters of mammalian cell membranes.
Am J Physiol Cell Physiol
262:
C803-C827,
1992
5.
Casey, JR,
Pirraglia CA,
and
Reithmeier RA.
Enzymatic deglycosylation of human band 3, the anion transport protein of the erythrocyte membrane. Effect on protein structure and transport properties.
J Biol Chem
267:
11940-11948,
1992
6.
Chernova, MN,
Jiang L,
Crest M,
Hand M,
Vandorpe DH,
Strange K,
and
Alper SL.
Electrogenic sulfate/chloride exchange in Xenopus oocytes mediated by murine AE1 E699Q.
J Gen Physiol
109:
345-360,
1997
7.
Choi, I,
Aalkjaer C,
Boulpaep EL,
and
Boron WF.
An electroneutral sodium/bicarbonate cotransporter NBCn1 and associated sodium channel.
Nature
405:
571-575,
2000[Medline].
8.
Coury, LA,
McGeoch JE,
Guidotti G,
and
Brodsky JL.
The yeast Saccharomyces cerevisiae does not sequester chloride but can express a functional mammalian chloride channel.
FEMS Microbiol Lett
179:
327-332,
1999[Web of Science][Medline].
8a.
EUROFAN project. Munich Information Center for Protein
Sequences.
http://www.mips.biochem.mpg.de/proj/eurofan/eurofan_1/b2/ynl288w_ynl251c.html/
[2000, Aug. 24]
9.
Garcia, AM,
and
Lodish HF.
Lysine 539 of human band 3 is not essential for ion transport or inhibition by stilbene disulfonates.
J Biol Chem
264:
19607-19613,
1989
10.
Gotz, R,
Gnann A,
and
Zimmermann FK.
Deletion of the carbonic anhydrase-like gene NCE103 of the yeast Saccharomyces cerevisiae causes an oxygen-sensitive growth defect.
Yeast
15:
855-864,
1999[Web of Science][Medline].
11.
Grinstein, S,
Ship S,
and
Rothstein A.
Anion transport in relation to proteolytic dissection of band 3 protein.
Biochim Biophys Acta
507:
294-304,
1978[Medline].
12.
Groves, JD,
and
Tanner MJ.
Role of N-glycosylation in the expression of human band 3-mediated anion transport.
Mol Membr Biol
11:
31-38,
1994[Web of Science][Medline].
13.
Ishibashi, K,
Sasaki S,
and
Marumo F.
Molecular cloning of a new sodium bicarbonate cotransporter cDNA from human retina.
Biochem Biophys Res Commun
246:
535-538,
1998[Web of Science][Medline].
14.
Jennings, ML.
Proton fluxes associated with erythrocyte membrane anion exchange.
J Membr Biol
28:
187-205,
1976[Web of Science][Medline].
15.
Jennings, ML,
and
Al-Rhaiyel S.
Modification of a carboxyl group that appears to cross the permeability barrier in the red blood cell anion transporter.
J Gen Physiol
92:
161-178,
1988
16.
Jennings, ML,
Anderson MP,
and
Monaghan R.
Monoclonal antibodies against human erythrocyte band 3 protein. Localization of proteolytic cleavage sites and stilbenedisulfonate-binding lysine residues.
J Biol Chem
261:
9002-9010,
1986
17.
Jennings, ML,
and
Nicknish JS.
Localization of a site of intermolecular cross-linking in human red blood cell band 3 protein.
J Biol Chem
260:
5472-5479,
1985
18.
Jentsch, TJ,
Schill BS,
Schwartz P,
Matthes H,
Keller SK,
and
Wiederholt M.
Kidney epithelial cells of monkey origin (BSC-1) express a sodium bicarbonate cotransport. Characterization by 22Na+ flux measurements.
J Biol Chem
260:
15554-15560,
1985
19.
Kleinhorst, A,
Oslender A,
Haest CW,
and
Deuticke B.
Band 3-mediated flip-flop and phosphatase-catalyzed cleavage of a long-chain alkyl phosphate anion in the human erythrocyte membrane.
J Membr Biol
165:
111-124,
1998[Web of Science][Medline].
20.
Kotaki, A,
Naoi M,
and
Yagi K.
A diaminostilbene dye as a hydrophobic probe for proteins.
Biochim Biophys Acta
229:
547-556,
1971[Medline].
21.
Laemmli, UK.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:
680-685,
1970[Medline].
22.
Landolt-Marticorena, C,
and
Reithmeier RAF
Asparagine-linked oligosaccharides are localized to single extracytosolic segments in multi-span membrane glycoproteins.
Biochem J
302:
253-260,
1994.
23.
Landolt-Marticorena, C,
Williams KM,
Correa J,
Chen W,
and
Manolson MF.
Evidence that the NH2 terminus of vph1p, an integral subunit of the V0 sector of the yeast V-ATPase, interacts directly with the Vma1p and Vma13p subunits of the V1 sector.
J Biol Chem
275:
15449-15457,
2000
24.
Lolkema, JS,
and
Slotboom DJ.
Estimation of structural similarity of membrane proteins by hydropathy profile alignment.
Mol Membr Biol
15:
33-42,
1998[Web of Science][Medline].
25.
Lolkema, JS,
and
Slotboom DJ.
Hydropathy profile alignment: a tool to search for structural homologues of membrane proteins.
FEMS Microbiol Rev
22:
305-322,
1998[Web of Science][Medline].
26.
Lux, SE,
John KM,
Kopito RR,
and
Lodish HF.
Cloning and characterization of band 3, the human erythrocyte anion-exchange protein (AE1).
Proc Natl Acad Sci USA
86:
9089-9093,
1989
27.
Morsomme, P,
de Kerchove d'Exaerde A,
De Meester S,
Thines D,
Goffeau A,
and
Boutry M.
Single point mutations in various domains of a plant plasma membrane H+-ATPase expressed in Saccharomyces cerevisiae increase H+-pumping and permit yeast growth at low pH.
EMBO J
15:
5513-5526,
1996[Web of Science][Medline].
28.
Nelissen, B,
De Wachter R,
and
Goffeau A.
Classification of all putative permeases and other membrane plurispanners of the major facilitator superfamily encoded by the complete genome of Saccharomyces cerevisiae.
FEMS Microbiol Rev
21:
113-134,
1997[Web of Science][Medline].
29.
Nilsson, IM,
and
von Heijne G.
Determination of the distance between the oligosaccharyltransferase active site and the endoplasmic reticulum membrane.
J Biol Chem
268:
5798-5801,
1993
30.
Okubo, K,
Kang D,
Hamasaki N,
and
Jennings ML.
Red blood cell band 3. Lysine 539 and lysine 851 react with the same H2DIDS (4,4'-diisothiocyanodihydrostilbene-2,2'-disulfonic acid) molecule.
J Biol Chem
269:
1918-1926,
1994
31.
Ortwein, R,
Oslender-Kohnen A,
and
Deuticke B.
Band 3, the anion exchanger of the erythrocyte membrane, is also a flippase.
Biochim Biophys Acta
1191:
317-323,
1994[Medline].
32.
Passow, H.
Molecular aspects of band 3 protein-mediated anion transport across the red blood cell membrane.
Rev Physiol Biochem Pharmacol
103:
61-203,
1986[Web of Science][Medline].
33.
Pimplikar, SW,
and
Reithmeier RAF
Affinity chromatography of band 3, the anion transport protein of erythrocyte membranes.
J Biol Chem
261:
9770-9778,
1986
34.
Popov, M,
Li J,
and
Reithmeier RAF
Resolution of glycoproteins by a lectin gel-shift assay.
Anal Biochem
279:
90-95,
2000[Web of Science][Medline].
35.
Popov, M,
Li J,
and
Reithmeier RAF
Transmembrane folding of the human erythrocyte anion exchanger (AE1, band 3) determined by scanning and insertional N-glycosylation mutagenesis.
Biochem J
339:
269-279,
1999.
36.
Pringle, JR,
Adams AE,
Drubin DG,
and
Haarer BK.
Immunofluorescence methods for yeast.
Methods Enzymol
194:
565-602,
1991[Web of Science][Medline].
37.
Pushkin, A,
Abuladze N,
Lee I,
Newman D,
Hwang J,
and
Kurtz I.
Cloning, tissue distribution, genomic organization, and functional characterization of NBC3, a new member of the sodium bicarbonate cotransporter family.
J Biol Chem
274:
16569-16575,
1999
38.
Pushkin, A,
Abuladze N,
Newman D,
Lee I,
Xu G,
and
Kurtz I.
Cloning, characterization and chromosomal assignment of NBC4, a new member of the sodium bicarbonate cotransporter family.
Biochim Biophys Acta
1493:
215-218,
2000[Medline].
39.
Reithmeier, RAF,
Chan SL,
and
Popov M.
Structure of the erythrocyte band 3 anion exchanger.
In: Handbook of Biological Physics, edited by Konings WN,
and Lolkema JS.. Amsterdam: Elsevier, 1996, p. 281-309.
40.
Roberts, CJ,
Raymond CK,
Yamashiro CT,
and
Stevens TH.
Methods for studying the yeast vacuole.
Methods Enzymol
194:
644-661,
1991[Web of Science][Medline].
41.
Romero, MF,
and
Boron WF.
Electrogenic Na+/HCO
42.
Romero, MF,
Fong P,
Berger UV,
Hediger MA,
and
Boron WF.
Cloning and functional expression of rNBC, an electrogenic Na+-HCO
43.
Romero, MF,
Hediger MA,
Boulpaep EL,
and
Boron WF.
Expression cloning and characterization of a renal electrogenic Na+/HCO
44.
Romero, MF,
Henry D,
Nelson S,
Harte PJ,
Dillon AK,
and
Sciortino CM.
Cloning and characterization of a Na+-driven anion exchanger (NDAE1). A new bicarbonate transporter.
J Biol Chem
275:
24552-24559,
2000
45.
Salhany, JM,
Cordes KA,
and
Schopfer LM.
Kinetics of conformational changes associated with inhibitor binding to the purified band 3 transporter. Direct observation of allosteric subunit interactions.
Biochemistry
32:
7413-7420,
1993[Medline].
46.
Sanger, F,
Nicklen S,
and
Coulson AR.
DNA sequencing with chain-terminating inhibitors.
Proc Natl Acad Sci USA
74:
5463-5467,
1977
47.
Sciortino, CM,
and
Romero MF.
Cation and voltage dependence of rat kidney electrogenic Na+-HCO
48.
Sekler, I,
Lo RS,
and
Kopito RR.
A conserved glutamate is responsible for ion selectivity and pH dependence of the mammalian anion exchangers AE1 and AE2.
J Biol Chem
270:
28751-28758,
1995
49.
Southern, JA,
Young DF,
Heaney F,
Baumgartner WK,
and
Randall RE.
Identification of an epitope on the P and V proteins of simian virus 5 that distinguishes between two isolates with different biological characteristics.
J Gen Physiol
72:
1551-1557,
1991.
50.
Steck, TL,
Ramos B,
and
Strapazon E.
Proteolytic dissection of band 3, the predominant transmembrane polypeptide of the human erythrocyte membrane.
Biochemistry
15:
1153-1161,
1976[Medline].
51.
Sun, XC,
Bonanno JA,
Jelamskii S,
and
Xie Q.
Expression and localization of Na+-HCO
52.
Vince, JW,
and
Reithmeier RAF
Identification of the carbonic anhydrase II binding site in the Cl
/HCO
53.
Wang, CZ,
Yano H,
Nagashima K,
and
Seino S.
The Na+-driven Cl
/HCO
This article has been cited by other articles:
![]() |
M. L. Jennings, T. R. Howren, J. Cui, M. Winters, and R. Hannigan Transport and regulatory characteristics of the yeast bicarbonate transporter homolog Bor1p Am J Physiol Cell Physiol, July 1, 2007; 293(1): C468 - C476. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kim, K. Melen, M. Osterberg, and G. von Heijne A global topology map of the Saccharomyces cerevisiae membrane proteome PNAS, July 25, 2006; 103(30): 11142 - 11147. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |